BASIC RESEARCH www.jasn.org

Fibrosis and Immune Cell Infiltration Are Separate Events Regulated by Cell-Specific Receptor Notch3 Expression

Sabine Brandt,1,2 Tobias M. Ballhause ,1 Anja Bernhardt,1,2 Annika Becker,1 Delia Salaru,1 Hien Minh Le-Deffge,1 Alexander Fehr,1,2 Yan Fu,2,3 Lars Philipsen ,2,3 Sonja Djudjaj,4 Andreas J. Müller,2,3,5 Rafael Kramann ,6,7 Mahmoud Ibrahim,6 Robert Geffers,8 Chris Siebel,9 Berend Isermann,2,10 Florian H. Heidel,11,12,13 Jonathan A. Lindquist ,1,2 and Peter R. Mertens1,2

Due to the number of contributing authors, the affiliations are listed at the end of this article.

ABSTRACT Background Kidney injuries that result in chronic inflammation initiate crosstalk between stressed resident cells and infiltrating immune cells. In animal models, whole-body receptor Notch3 deficiency protects from leukocyte infiltration and organ fibrosis. However, the relative contribution of Notch3 expression in tissue versus infiltrating immune cells is unknown. Methods Chimeric mice deficient for Notch3 in hematopoietic cells and/or resident tissue cells were generated, and kidney fibrosis and inflammation after unilateral ureteral obstruction (UUO) were analyzed. Adoptive transfer of labeled bone marrow–derived cells validated the results in a murine Leishmania ear infection model. In vitro adhesion assays, integrin activation, and extracellular matrix production were analyzed. Results Fibrosis follows UUO, but inflammatory cell infiltration mostly depends upon Notch3 expression in hematopoietic cells, which coincides with an enhanced proinflammatory milieu (e.g., CCL2 and CCL5 1 upregulation). Notch3 expression on CD45 leukocytes plays a prominent role in efficient cell transmi- gration. Functionally, leukocyte adhesion and integrin activation are abrogated in the absence of receptor Notch3. Chimeric animal models also reveal that tubulointerstitial fibrosis develops, even in the absence of prominent leukocyte infiltrates after ureteral obstruction. Deleting Notch3 receptors on resident cells blunts kidney fibrosis, ablates NF-kB signaling, and lessens matrix deposition. Conclusions Cell-specific receptor Notch3 signaling independently orchestrates leukocyte infiltration and organ fibrosis. Interference with Notch3 signaling may present a novel therapeutic approach in inflamma- tory as well as fibrotic diseases.

JASN 31: ccc–ccc, 2020. doi: https://doi.org/10.1681/ASN.2019121289

Chronic inflammation of solid organs often results in destruction of organ architecture and perpetu- ated fibrosis, with functional deficits and ultimately Received December 13, 2019. Accepted July 12, 2020. organ failure.1,2 The list of injuries causing inflam- Published online ahead of print. Publication date available at mation includes acute and chronic infections, toxic www.jasn.org. agents, autoimmune diseases, and metabolic alter- Correspondence: Dr. Peter R. Mertens, Clinic of Nephrology and 3–6 ations (e.g., hyperglycemia and uremia). Key Hypertension, Diabetes and Endocrinology, Otto-von-Guericke events after primary insults are stress responses of University Magdeburg, Leipziger Strasse 44, 39120 Magdeburg, resident organ cells and leukocyte recruitment. The Germany. Email: [email protected] composition of the infiltrate depends on the timing Copyright © 2020 by the American Society of Nephrology

JASN 31: ccc–ccc, 2020 ISSN : 1046-6673/3111-ccc 1 BASIC RESEARCH www.jasn.org and severity of the immune response, which encompasses de- Significance Statement fense mechanisms, such as complement activation, phagocy- tosis, and antigen presentation.7 Approximately 15% of adults In patients with CKD, receptor Notch3 is strongly upregulated. within the United States (37 million people) have CKD.8 De- Conversely, in experimental kidney disease models, Notch3 de- fi spite the enormity of this problem, therapeutic options are ciency protects from organ damage. To determine whether Notch3 on immune cells or tissue-resident cells participates in the scarce and mostly ineffective. Therefore, an improved under- inflammatory response, animals with bone marrow chimerism were standing of the cellular and molecular mechanisms leading to generated. These animal strains do not exhibit phenotypic differ- inflammation and renal fibrosis is essential to develop strate- ences in the absence of disease. However, after unilateral ureteral gies to combat these processes, because fibrosis-related organ obstruction, distinct alterations in the immune response and organ fi diseases account for almost 50% of all deaths.9–12 Currently, brosis become apparent. Notch3 receptors expressed by immune fi cells are of relevance for transmigration into tissue; the receptors established models of renal brosis propose that kidney injury expressed by resident kidney cells orchestrate organ fibrosis. These leads to immune cell infiltration, fibroblast activation, extra- events seem to be separable and distinct. cellular matrix (ECM) deposition, microvascular rarefaction, and tubular atrophy.9 Inflammation is considered the driving force in fibrotic diseases, with an intimate crosstalk between were housed and bred in the Central Animal Facility of the resident and infiltrating cells; therefore, targeting immune cell Otto-von-Guericke University Magdeburg Medical Faculty. fi infiltration is deemed to be a therapeutic option.13–15 How- The mice were kept under speci c pathogen-free conditions ever, it is not known whether immune cell recruitment is the in individual, ventilated cages (Techniplast, Buguggiate, Italy). culprit of organ fibrosis, or a bystander that modulates repar- All experiments and procedures were conducted in accor- ative processes.1 dance with the German National Guidelines for the Use of In CKD, the Notch receptor family plays a key role in both Experimental Animals (Animal Protection Act) and were ap- inflammatory responses and organ fibrosis.16–19 Animals proved by the state of Sachsen-Anhalt (Aktenzeichen UniMD deficient in receptors Notch1 and -3 demonstrate similar 42502-2-1135 and UniMD 42502-2-1253). All mouse strains fi protective effects on organ fibrosis. Notch3-deficient mice were con rmed by PCR genotyping that was performed as 18 fl exhibit significantly reduced kidney fibrosis (.50%), fewer previously described. Brie y, the mouse tail was lysed with m m myofibroblasts (approximately 50%), and fewer infiltrating 200 l direct PCR tail lysis buffer and 50 g of proteinase immune cells (approximately 30% of total leukocytes) com- K. PCR was performed using primer pairs for WT (forward, pared with wild-type (WT) mice after ureteral obstruc- CCATGAGGATGCTATCTGTGAC; reverse, CACATTGGC tion.18 The inflammatory chemokines CCL2 and CCL5 are ACAAGAATGAGCC) and Notch3 knockout (forward, TCG reduced by .50% in Notch3-deficient mice.18 Similar find- CCTTCTTGACGAGTTCT; reverse, GCGATGCAATTTCCT ings are reported in Notch3-deficient animals undergoing CATTT). The PCR cycler performed 35 cycles at 94°C, 60°C, nephrotoxic serum nephritis and ischemia reperfusion. and 72°C (each for 60 seconds). Products were separated on Thus, genetic ablation of receptor Notch3 protects mice 1% agarose/ethidium bromide gels. from kidney damage.18–20 However, it is not clear whether this protection is mediated Leishmania major Infection by Notch3 deficiency on immune cells or by a lack of Notch3 Leishmania major inoculation was performed as described.23 expression on tissue-resident cells. Here, we use bone marrow Briefly, dsRed-expressing parasites were grown at 26°C, for a (BM) chimeras to clarify cell type–specific roles of receptor maximum of five passages, in M119 medium supplemented Notch3 and discover that Notch3 receptors are not only rele- with 10% heat-inactivated FBS, 0.1 mM adenine, 1 mg/ml biotin, vant for leukocyte transmigration, but are also key molecules 5mg/mlhemin,and2mg/ml biopterin (all from Sigma-Aldrich, 5 for the fibrogenic niche. Unexpectedly, organ fibrosis is not Darmstadt, Germany). For infection, 10 stationary-phase pro- reduced in the absence of prominent leukocyte infiltration and mastigotes were resuspended in 10 ml PBS and injected into the vice versa. ear dermis.

Experimental Kidney Disease METHODS Unilateral ureter obstruction (UUO) was performed with sex- matched, 12- to 16-week-old mice. The right ureters of WT Animals and knockout mice were ligated for 5 and 14 days. Both kid- Studies were performed using Notch3-knockout animals and neys were collected for preparation of cortical RNA, protein their WT littermates in a C57BL/6J (CD45.2) background lysates, immunohistochemistry, and flow cytometry (FACS). (kindly provided by Dr. Anne Joutel, Institut National de la Blood sampling by heart puncture was subjected to complete Santé et de la Recherche Médicale).21,22 The commercially blood cell counting (ADVIA 120; Bayer Diagnostics Munich, available CD45.1 mice are C57BL/6J background. The health Germany) and plasma specimens were stored at 280°C until of the mice corresponded to the Federation of European Lab- further analysis. Contralateral kidneys were harvested for oratory Animal Science Association guidelines. The animals comparative analyses.

2 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

Table 1. List of primary antibodies Primary Antibodies Catalog No. Dilution Company Dye Immunhistochemistry and immunofluorescence Gli1 (IF) AF3455 1:200 R&D Systems Notch3 (IHC) ab23426 1:200 Abcam F4/80 (IHC) MON3099 1:100 Monosan Western blotting Notch3 sc-5539 1:500 Santa Cruz TNC ab108930 1:500 Abcam Tubulin T5168 1:1000 Sigma Phospho–NF-kB–p65 (S536) 3033 1:1000 Cell Signaling Phospho-IkBa (S32) 2859 1:1000 Cell Signaling NF-kB–p65 6956 1:1000 Cell Signaling IkBa 9242 1:1000 Cell Signaling Vinculin sc-59803 1:1000 Santa Cruz CYLD 8462 1:1000 Cell Signaling SMA ab5694 1:1000 Abcam Phospho-STAT3 (S727) 9134 1:1000 Cell Signaling GAPDH sc-20357 1:2000 Santa Cruz Arg1 610709 1:1000 BD Biosciences MELC Vimentin 1:120 515635 Exbio Alexa Fluor 488 Collagen type 4 1:240 1340–30 Southern Biotech Alexa Fluor 488 SMA 1:240 F3777 Sigma FITC Propidium iodide 1:5000 P4864 Sigma Phospho-NF-kB–p65 (S529) 1:20 558421 BD Biosciences Alexa Fluor 488 CD45 1:400 553080 BD Biosciences FITC F4/80 1:20 53–4801 eBioscience Alexa Fluor 488 CD4 1:20 557667 BD Biosciences Alexa Fluor 488 CD3« 1:60 100210 Biolegend Alexa Fluor 488 IF, immunofluorescence; IHC, immunohistochemistry; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; S, serine.

Primary Cell Cultures mouse-specific Notch3 receptor blocking antibody (provided BM cells were obtained from the femurs of mice as previously by Genentech) 1 hour before stimulation with Shh. To isolate described.24 Cells were counted before BM transplantation or ECM, cells were detached with EGTA (Sigma-Aldrich) in homing assays, aliquoted in 13106 or 50,000 cells, respec- calcium-free PBS (Thermo Fisher), with shaking at 4°C for tively, and stored on ice. Polarization into BM-derived mac- 1 hour. The procedure was repeated four times until all cells rophages (BMDMs) was propagated in DMEM (Thermo were removed. The tubular cell–derived ECM scaffold was Fisher, Dreieich, Germany) medium supplemented with washed with PBS and collected by scraping with a rubber po- 10% FBS (Thermo Fisher), 50 U/ml penicillin (Thermo liceman in PBS for subsequent Western blot analysis. Fisher), 50 mg/ml streptomycin (Thermo Fisher), and 10 ng/ml macrophage colony-stimulating factor (M-CSF; PeproTech) over- BM Transplantation 2 2 night. The next day, nonadherent cells (13108 cells/plate) were Female (8–10 weeks old) C57BL/6N (n56) and Notch3 / transferred into a new petri dish and maintained for 6 days in cell (n56) mice were used as BM donors for age- and sex- 2 2 culture medium with M-CSF (10 ng/ml) and the following re- matched C57BL/6J (n512) and Notch3 / (n512) recipient spective cytokines: IL-13 (20 ng/ml) and IL-4 (30 ng/ml) (Pepro- mice. Recipients were irradiated with a total dose of 8 Gy divided Tech) for the anti-inflammatory response; or IL-6 (20 ng/ml) into two doses (4 Gy each) at an interval of 3 hours. BM cells (PeproTech) for the proinflammatoryresponse.Halfoftheme- were isolated from the femur and tibia of donor mice as de- dium was exchanged daily. Tubular cells were prepared as pre- scribed.24 At 4 hours after irradiation, BM cells were injected viously described.24 via tail vein. All mice received the antibiotic neomycin sulfate (2 mg/ml) (Merck, Darmstadt, Germany) via drinking water for Preparation of Tubular Cell–Derived ECM Scaffold 2 weeks. BM reconstitution was confirmed after 4 weeks. Serum-starved tubular cells were treated without or with re- combinant Sonic hedgehog (Shh) protein (50 ng/ml; Merck Homing Experiments Millipore, Darmstadt, Germany) for 3 days. To establish the Successful BM cell homing was visualized by fluorescence cy- Notch3 dependency of Shh-induced ECM scaffold, we added a tometry of BM cells. LSK (lineage-negative stem cell antigen

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 3 BASIC RESEARCH www.jasn.org

ABhuman tissue human glom Woronicka human Hodgin diabetes F panel lupus nephritis diabetes glom mouse glom (n=12) (n=46) (n=22) (n=10)

fold-change Notch1 Notch3 Notch2 Notch4 ImmGen database

thymus Notch3 Notch1 Notch2 Notch4 Notch3 Notch4 Notch1 Notch2 Notch3 Notch1 Notch2 Notch4 Notch3 Notch1 Notch4 Notch2 healthy glomeruli diabetes tubulo- interstitium healthy healthy mouse T-cells human lupus diabetes nephritis spleen

human B-cells

dendritic cells nephroseq database lymph node peritoneal macrophages least most human expressed expressed alveolar macrophages

control C bone marrow

low high

D lupus nephritis vSMC/P Unk TAL–2 TAL–1 PT–5 PT–4 PT–3 human tissue PT–2 PT–1 IgA nephritis POD PC–3 PC–2 PC–1 MC INT IMM IC–B IC–A2 Average Expression ICA1 control EPC 2 EC–4 1 EC–3 0 EC–2 –1 EC–1 DL Percent Expressed DCT 0 CNT 5 ATL–3 UUO 10 ATL–2 15 ATL–1 20 mouse tissue NOTCH4 NOTCH3 NOTCH2 NOTCH1 Features

E

Notch3/ Notch3/ phase contrast Notch3/Gli1/DAPI Notch3 Gli1 Notch3 Gli1 Gli1/DAPI Gli1/DAPI

Figure 1. Notch3 receptor expression is upregulated in diseased tissue. Members of the Notch receptor protein family are differ- entially expressed in (A) healthy glomeruli and the tubulointerstitium. Colors indicate z-scores normalized to depict relative values within rows. The Nephroseq database (www.nephroseq.org) was used for analysis and visualization. (B) Within diseased human and mouse kidney tissue, an upregulation of all members of the Notch family could be observed. Among the four members of the family,

4 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

1 positive kit positive) cells were isolated by sorting from BM Fix/Perm buffer set (BioLegend, Koblenz, Germany). Non- cells (FACSAria III; BD) and staining with Vybrant DiD specific binding was minimized with 5% mouse serum. Sur- (Thermo Fisher) according to the manufacturer’s instruc- face markers included the following: CD11b clone M1/70 tions. Cells (53104) were injected into irradiated mice, and APC/Cy7, CD3 clone 145-2C11 APC, CD45 clone 30-F11 16 hours later these mice were euthanized and BM cells and PE,F4/80cloneBM8PacificBlue,Gr1(Ly6G/Ly6C)clone axillary lymph nodes were analyzed for DiD-positive cell RB6-8C5 PerCP/Cy5.5, CD45.1 clone A20 PerCP, CD45.2 numbers by fluorescence cytometry. clone 104 APC, Ly6G clone 1A8 BV421, Ly6C clone HK1.4 PE-Cy7, MHC-II clone M5/114.15.2 BV510, CD29 Adoptive Transfer of Immune Cells and Quantification clone HMbeta1 PECy7, CD18 clone M18/2 FITC, and IL6R of Tissue Infiltration clone D7715A7 PECy7 (all from BioLegend). Flow cytome- 2 2 BM cells were isolated using CD45.1 WTand CD45.2 Notch3 / try was performed with a FACS Canto II or Fortessa (BD mice as donors (see above for isolation procedure) without Immunocytometry Systems). Data collection and analyses erythrocyte lysis. Staining of cells was performed by incu- were achieved using FlowJo software. Spectral spillover bation for 10 minutes at 37°C in 5 mMcarboxyfluorescein was corrected by creating a compensation matrix generated succinimidyl ester (CFSE; Thermo Fisher). After two washes in with the help of single antibody stainings and fluorescence PBS supplemented with 10% FCS, 2.53 107 CD45.1 minus one control samples. 2 2 WT cells were mixed with 2.53107 CD45.2 Notch3 / cells in 300 ml PBS and injected into the tail vein in WTrecipient Integrin Signaling mice. For assessment of cell infiltration, kidney tissue was Monitoring of activated b1-integrins was performed as de- mechanically crushed and digested in buffer I (RPMI; scribed.25 Briefly, BMDMs were stimulated in 25 mM HEPES Thermo Fisher), 0.1% BSA (Sigma-Aldrich), 1 mg/ml col- buffer (pH 7.4), supplemented with 150 mM sodium chloride lagenase D (Sigma-Aldrich), and 100 mg/ml DNase I (NaCl) and magnesium chloride. As positive control for activated (Sigma-Aldrich) for 30 minutes. After repeated mechanical b1-integrin, cells were incubated in buffer solution containing tissue disintegration, the entire well contents were passed 5 mM manganese(II) chloride. Stimulation was performed with through 70- and 40-mm cell strainers. Erythrocytes were IL-6 (15 ng/ml; Peprotech) alone or together with anti–IL-6 lysed and cells were analyzed by flow cytometry. Ears were blocking antibody (R&D) for the indicated time points. After separated into dorsal and ventral sheets using jagged forceps, stimulation, cells were incubated with 9EG7 antibody (CD29 digested in RPMI 1640 medium containing collagenase clone 9EG7, antibody detecting active b1-integrin; BD Biosci- (1 mg/ml) and DNase (50 ng/ml) (both from Sigma-Aldrich) ences, Heidelberg, Germany) and, after washing with modified for 45 minutes at 37°C, and then passed through a 70-mm cell FACSbuffer(25mMHEPES,pH7.4,150mMNaCl,5%FCS, strainer. 0.1% sodium azide), rat IgG-specific, FITC-conjugated, goat anti- rat antibody (BD Biosciences) was added. Washes with buffer Flow Cytometry solution removed unbound antibodies. Single-cell suspensions of tissue samples (kidney and ear) and isolated BMDMs were labeled using antibodies di- NF-kB Signaling rected against surface receptors/proteins. Fixation and cell Cells were stimulated with 1 mg/cm2 of recombinant membrane permeabilization was performed with the FOXP3 tenascin-C (TNC; Merck) for the indicated time points

Notch3 transcripts were the most strongly regulated in different diseases. (C) Histochemical validation of expression and signaling of Notch3 in diseased human/mouse kidney tissue compared with healthy control tissue. Kidney sections were immunohistochemically stained with specific antibody against the intracellular domain of receptor Notch3. Scale bar, 50 mm. (D) Dot plot of NOTCH1–4 expression in human kidneys using data from Lake et al.28 Dot size indicates the percentage of cells with respective gene expression. The color scale indicates average normalized gene expression. (E) Pericyte marker Gli1 and Notch3 colocalize in vessels and tubu- lointerstitial cells. Cells positive for Gli1 (green) and Notch3 (red) are seen in vessels and are dispersed in the injured kidneys after UUO in the tubulointerstitium. Scale bars, 100 mm. (Note that the image is rotated 90° clockwise to fit the layout.) (F) Heat-map analysis of Notch receptor family members in immune (cell) compartments, with data obtained from the ImmGen database (www.immgen.org) (blue, low expression; red, high expression). ATL-1/-2/-3, thin ascending limb; CNT, connecting tubule; DCT, distal convoluted tubule; DL, descending limb; EC-1, endothelial cells—glomerular capillaries; EC-2, endothelial cells—AVR; EC-3, endothelial cells—AEA and DVR; EC-4, endothelial cells (unassigned); EPC, epithelial cells (unassigned); glom, glomerular; IC-A2, collecting duct—intercalated cells type A (medulla); IC-A1, collecting duct—intercalated cells type A (cortex); IC-B, collecting duct—intercalated cells type B; IMM, immune cells—macrophages; INT, interstitium; MC, mesangial cells; PC-1, collecting duct—principal cells (cortex); PC-2, collecting duct—principal cells (stressed); PC-3, collecting duct—principal cells (medulla); POD, podocytes; PT-1, proximal tubule epithelial cells (S1); PT-2, proximal tubule epithelial cells (S2); PT-3, proximal tubule epithelial cells (stress/inflammation); PT-4, proximal tubule epi- thelial cells (fibrinogen1; S3); PT-5, proximal tubule epithelial cells (S3); TAL-1/-2, thick ascending limb; Unk, unknown—novel PT CFH1 subpopulation (S2); vSMC/P, vascular smooth muscle cells and pericytes.

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 5 BASIC RESEARCH www.jasn.org

UUO day 5: downregulated in Notch3 knockout versus wild type ABUUO day 5 Notch3 knockout 19 % Inflammation mediated by chemokine and cytokine signaling pathway versus wild type 11 % Nicotinic acetylcholine receptor signaling pathway (P00044) 6 7 % Interleukin signaling pathway (P00036) GO-pathway analysis 5 228 125 7 % lntegrin signalling pathway (P00034) 4 7 % PDGF signaling pathway (P00047) 3 4 % Alzheimer disease-presenilin pathway (P00004) 4 % Alzheimer disease-amyloid secretase pathway (P00003) 2 4 % Parkinson disease (P00049) -log10 p-value 1 p-value-threshold 4 % Asparagine and aspartate biosynthesis (P02730) 0 4 % Cytoskeletal regulation by Rho GTPase (P00016) -6 -4 -2 0 2 4 6 4 % Notch signaling pathway (P00045) 4 % Cadherin signaling pathway(P00012) log2 fold-change 4 % CCKR signaling map (P06959) 4 % Wnt signaling pathway (P00057) down-regulated 4 % Synaptic vesicle trafficking (P05734) up-regulated 4 % 5-Hydroxytryptamine degradation (P04372) unregulated 4 % Toll receptor signaling pathway (P00054) log2 fold 4 % TGF-beta signaling pathway (P00052) change-threshold

Notch3 wt Notch3 -/- CD F -/- NGAL/Lcn2 wt 10 fibrosis-related irradiation (2x 4Gy)

Notch3 genes 8 * Notch3 collagen 1a1 6 collagen 1a2 collagen 3 4 tenascin-C Notch-3 bone marrow i.v. injection α-SMA wt 2 TGF-β Notch3 transcript number (log2 fold-change) beta catenin Notch3 -/- 0 Notch3 wt Notch3 -/- low high Notch3 wt>wt Notch3 ko>wt Notch3 wt>ko Notch3 ko>ko chimeric knockout wild type chimeric wild type transplant transplant knockout transplant transplant

E tenascin-C collagen 1/3 G UUO

wt Notch3 Notch-3 Notch-1 Notch-2 Notch-4

Notch3 -/- wt>wt ko>wt ko>ko wt>ko

low high

Figure 2. Notch3-knockout animals are protected from UUO-induced disease. (A) Volcano plot of all genes is depicted. The most significantly upregulated genes are shown in red, whereas green represents the significantly downregulated genes. Blue dots are genes that are differentially expressed below the cutoff values of log-fold change and log10 P value. (B) Upregulated genes (fold change $1.0 and P.0.05) are classified according to their involvement in different pathways via Panther database. Numbers show the percentage of genes involved in the respective pathways. (C) Quantitative mRNA analysis of the tubular injury marker neu- trophil gelatinase–associated lipocalin (NGAL/Lcn2) in kidney tissue of WT and Notch3 receptor–knockout animals revealed that tubularcellsareprotectedfromUUO-inducedtissuedamageintheabsence of Notch3 receptor. (D) Heat-map analysis of selected fibrosis-relevant genes after UUO in WT and Notch3-knockout animals (red, upregulated; green, downregulated). (E) Histo- chemical validation of enhanced TNC and collagen 1/3expressioninWTUUOkidneytissuecomparedwithNotch3-knockout tissue. (F) Scheme of the four chimeric animal models generated and used in the study. BM transplantation was carried out with 8-week-old mice by intravenous (i.v.) injection of 13106 BM-derived cells 4 hours after irradiation. The images of individual cells refer to hematopoietic (BM-derived) cells; the rest of the mouse body represents nonhematopoietic tissue. The presence of WT Notch3 receptor is indicated by gray, the Notch3 knockout by white. To investigate the contribution of Notch3 expression on BM-derived cells and tissue-resident cells, UUO was performed 4 weeks after transplantation. Kidneys were analyzed on days 5 and 14 after disease induction. (G) Hierarchic clustering and heat-map analysis of Notch1–4 expression in UUO kidneys. GO, Gene Ontology. andsubsequentlywashedwithice-coldPBS.Celllysiswas with cOmplete Mini Protease Inhibitor Cocktail Phospho- performed with radioimmunoprecipitation assay lysis Stop (Roche). Lysates were cleared by centrifugation at buffer (50 mM Tris base, 150 mM NaCl, 1 mM EDTA, 1% 14,000 3 g. Protein concentrations were determined using nonidet P-40, 0.25% sodium deoxycholate) supplemented Lowry assay.

6 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

Table 2. Scheme of BM transplantation 0.2% Triton X-100, and blocked with 1% BSA (Sigma) in PBS. Multiepitope ligand cartography (MELC) analysis was per- formed as previously described.24 The an- tibodies used are listed in Table 1. The appropriate working dilutions, incuba- tion times, and positions within the MELC experiment were validated system- atically using conditions suitable to MELC, as described,26 with subsequent data analysis.27

Gene Array Cytokine Quantification RNA extraction from kidney tissue lysates and gene array anal- In tissue lysates of mechanically homogenized kidneys, cyto- ysis have been described.24 The extraction protocol was as kine levels of MIP1a, MIG, KC, IL-10, TNFa,CCL5,and follows: RNA was prepared using a Qiagen (Valencia, CA) CCL2 were determined using a flow cytometry–based bead RNAeasy Kit. RNA was quantified using a NanoDrop-1000 assay (BD Biosciences) using FACS Canto II. spectrophotometer, and quality was monitored with the Agi- lent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Immunohistochemistry The labeling protocol was as follows: cyanine 3–labeled com- Methacarn-fixed, paraffin-embedded tissue sections were plementary RNA (cRNA) was prepared from 0.5 mg RNA us- used for immunohistochemistry (avidin-biotin complex ing the One-Color Low RNA Input Linear Amplification PLUS method). Unmasking of antigens was optimized as follows: kit (Agilent Technologies), according to the manufacturer’s for F4/80 staining, sections were incubated with protease 1 instructions, followed by RNAeasy column purification (Ventana, Basel, Switzerland) for 10 minutes at 20°C. En- (Qiagen). Dye incorporation and cRNA yield were checked dogenous peroxidase activity was inhibited by 3% hydrogen using the NanoDrop ND-1000 Spectrophotometer. The hy- peroxide. After washing, the sections were incubated with bridization protocol was as follows: cyanine 3–labeled cRNA blocking solution (20% FCS in 13 Tween 20–PBS) for (1.5 mg; sp act, .10.0 pmol cyanine 3/mgcRNA)wasfrag- 1 hour at room temperature and incubated overnight at mented at 60°C for 30 minutes in a reaction volume of 4°C with the primary antibody diluted in 1% FCS plus 13 250 ml containing 13 Agilent fragmentation buffer and Tween 20–PBS. The biotinylated secondary antibody was 23 Agilent blocking agent, following the manufacturer’sin- incubated for 30 minutes at room temperature, and sections structions. On completion of the fragmentation reaction, were washed three times in 13 Tween 20–PBS. Avidin-biotin- 250 ml of 23 Agilent hybridization buffer was added to peroxidase complex (Elite Kit; Vector Laboratories) was used for the fragmentation mixture and hybridized using the Agilent staining, followed by counterstaining with hematoxylin. 4344k Mouse v2 (design identifier, 026655) for 17 hours at 65°C in a rotating Agilent hybridization oven. After hybrid- Periodic Acid–Schiff Staining ization, the microarrays were washed for 1 minute at room Sections were deparaffinized and rehydrated. For staining, the temperature with GE Wash buffer 1 (Agilent Technologies) sections were incubated with periodic acid solution and Schiff and for 1 minute with 37°C GE Wash buffer 2 (Agilent Tech- reagent (both from Sigma-Aldrich), followed by an extensive nologies), and then dried immediately by brief centrifuga- washing step. The counterstain was carried out with hematox- tion. For data processing, the scanned images were analyzed ylin solution. with Feature Extraction Software 10.5 (Agilent Technolo- gies) using default parameters to obtain background- Sirius Red Staining subtracted and spatially detrended processed signal Deparaffinized sections were incubated with 0.1% Sirius Red intensities. in saturated picric acid (Dr. K. Hollborn & Söhne GmbH & Co KG, Leipzig, Germany) and were destained with 0.01 N hydro- Proliferation Assay chloric acid. The dehydrogenation and subsequent embed- BMDMs (13104 cells per well) were seeded in six-well ding were similar to the description above. plates. The medium used was complete DMEM with M-CSF (10 ng/ml; PeproTech) for nonpolarized macro- Automated Multidimensional Fluorescence Microscopy phages, M-CSF and IL-6 for proinflammatory macrophages, Snap-frozen tissue embedded into O.C.T. (Sakura Finetek) or M-CSF together with IL-4 and IL-13 for anti- was used to perform cryo-sections (10 mm thickness) that inflammatory macrophages. Half of the medium was ex- were placed on silan-coated slides. Tissue samples were fixed changed daily. The cell number was quantified manually with 2% paraformaldehyde (Santa Cruz), permeabilized with by counting in Neubauer chambers.

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 7 BASIC RESEARCH www.jasn.org

A CD45+ leukocytes CD11b+/ GR1+ neutrophils CD11b+ myeloid cells chimeras: *** 15 *** 4 *** 15 *** Notch3 wt>wt *** *** *** *** ** ko>ko ) *** ) *** Notch3 3 3 3 *** 10 10 Notch3 ko>wt 2 Notch3 wt>ko

Cells [%] 5 5 1 Cells # (×10 Cells # (×10

0 0 0 contralateral UUO contralateral UUO contralateral UUO

CD3+ T-cells CD11b+/ GR1-/ F4/80+ macrophages CD11binterm./ GR1+ monocytes *** ** 15 *** 4 *** 3 ** * *** ) ) ) * * * 3 3 3 * 3 * * 10 2 2 5 1 1 Cells # (×10 Cells # (×10 Cells # (×10

0 0 0 contralateral UUO contralateral UUO contralateral UUO

B 30 Notch3 wt>wt Notch3 ko>ko Notch3 ko>wt Notch3 wt>ko chimeras: Notch3 wt>wt 20 Notch3 ko>ko 10 Notch3 ko>wt wt>ko (in % positive) F4/80-staining Notch3 0 contralateral ** 30 *** *** *** 20 ***

10 (in % positive) F4/80-staining UUo day 5 0 ** 30 *** *** *** *** 20

10 UUo day 14 (in % positive) F4/80-staining 0 C D wt>wt ko>ko ko>wt wt>ko * chimeras: Notch3 Notch3 Notch3 Notch3 10 CCL2 *** *** wt>wt * Notch3 8 Notch3 ko>ko ko>wt 6 Notch3 Notch3 wt>ko 4

2

0 protein concentration [ng/ml]

10 CCL5 *** *** * 8 * 6

4

2 CD45 F4/80 CD3 CD4

protein concentration [ng/ml] 0 contralateral UUO

Figure 3. Immune cell infiltration is dependent on Notch3 expression on BM-derived cells. (A) Effect of Notch3 expression on immune cell infiltration after the induction of UUO. Healthy (contralateral) and diseased kidneys of the four types of chimeric mice were har- vested after UUO. Kidney tissue was digested with collagenase and the resulting single-cell suspension was stained and characterized by flow cytometry (gating strategy shown in Supplemental Figure 6). All data collection and analyses were performed using FlowJo software (Ashland, OR). Controls were used for gating analyses to distinguish immunopositive from unstained cell populations (n512 in 1 each group). Cell numbers were calculated from the CD45 leukocyte population. (B) Immunostaining of infiltrating monocytes/ macrophages was performed using the F4/80 antibody. Quantification was performed by assessing the positively stained cortical area.

8 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

Lysate Preparation and Western Blot Analysis (www.immgen.org) was used for analysis and visualization of Kidney tissue was mechanical homogenized in RIPA buffer Notch receptor family expression among immune cell (50 mM Tris hydrochloride, 150 mM nonidet P-40, 1 mM compartments. sodium deoxycholate, 1 mM EDTA, and 1 mM sodium ortho- Unique molecular identifier count data from Lake et al.28 was vanadate) containing complete protease inhibitor cocktail downloaded from Gene Expression Omnibus (GSE121862). (Roche) at 4°C for 15 minutes. Protein was quantified using Counts were normalized and visualized using Seurat version the Bio-Rad protein assay. Heat-denatured protein samples 3.0.1.29 were separated using 10% SDS-PAGE and blotted onto nitro- cellulose membranes. The membranes were blocked with 5% Statistical Analyses dry milk in TBS/Tween 20, and then incubated with primary All results were confirmed in three independent experiments, antibodies diluted in TBS/Tween 20 overnight at 4°C. The if not otherwise stated. Data management and statistical anal- applied antibodies are listed in Table 1. As secondary anti- ysis was performed using GraphPad Prism software version bodies, horseradish peroxidase–conjugated goat anti-rabbit 7.03 (GraphPad Software, San Diego, CA). Results were cal- IgG (Biozol) or goat anti-mouse IgG (Biozol, Germany) serum culated and presented as mean6SD. For multiple compari- was added for 30 minutes. Pierce ECL substrate (Thermo Sci- sons, statistical difference was calculated by one-way ANOVA. entific) was used for detection. Post hoc analysis was performed with the Tukey test when ANOVA showed significant differences. P,0.05 was consid- Adhesion Assay ered statistically significant. For adhesion to culture plates, BMDMs were polarized with M-CSF over 7 days and then detached by addition of trypsin/ EDTA. Suspended cells were serum starved for 1 hour in ad- hesion assay medium (10 mM HEPES, pH 7.4, 137 mM NaCl, RESULTS 1 mM magnesium chloride, 1 mM calcium chloride, 2.7 mM potassium chloride, 4.5 g/L glucose, 3% BSA [wt/vol]). There- Notch Receptors Are Differentially Expressed in after, 2.53105 cells per well were plated out on cell culture Kidney Disease plates (12-well; Greiner Bio-One) in the same medium sup- Database and single-cell RNA sequence analyses reveal differ- plemented with 8% FCS, and 5 mM manganese sulfate, if ential Notch receptor expression in healthy and injured kid- indicated. Seeded cells were washed and fixed with 4% para- neys. Both Notch1 and -3 are highly expressed in diseased formaldehyde (wt/vol) in PBS, and stained with Alexa Fluor kidneys, but in different cell types (Figure 1, A–C). Immuno- 546 phalloidin and 49,6-diamidino-2-phenylindole (DAPI). histochemistry reveals a strongly activated Notch3 signaling Positive nuclear staining of DAPI represented adherent cells. pathway in diseased human (lupus nephritis, IgA nephritis) The whole well was imaged using a 2.53 objective and cell and mouse (UUO) kidneys, predominantly in tubular as well numbers were counted. Human umbilical vein endothelial as tubulointerstitial cells.18,19 Costaining using the pericyte cells (HUVECs) were grown as described.27 HUVECs were marker Gli1 together with Notch3 confirms coexpression in activated with 1 mM PMA for 12 hours before adding freshly pericytes, which is similarly determined by single-cell RNA isolated BM cells. Notch3 WT cells were labeled with CFSE sequencing (Figure 1, D and E). Furthermore, a distinct ex- (0.5 mM). Notch3-knockout cells were stained with 0.1 mM pression profile of the Notch receptors in immune cells exists, CellTracker Deep Red (Thermo Fisher). After two washes in even in the absence of disease (Figure 1F). PBS supplemented with 10% FCS, WT cells were mixed with To gain insight into the mechanism(s) by which Notch3 2 2 Notch3 / cells at a 1:1 ratio and incubated for 1 or 2 hours. deficiency alters the pattern of kidney damage, we performed Adhesion of cells BM-derived cells to HUVECs was analyzed gene expression analysis of UUO kidneys. We observe 1463 after detachment from the surface by flow cytometry. differentially expressed genes in Notch3 knockouts compared with WTanimals, with 353 genes altered by a log2 fold change Databases greater than one (228 down-, 125 upregulated). Gene Ontology The Nephroseq database (www.nephroseq.org) was used for and pathway analyses were carried out to determine molecular analysis and visualization of the expression of the Notch re- processes and biologic pathways associated with dif- ceptor protein family in kidney tissue. The ImmGen database ferentially expressed genes. Pathway analyses reveal reduced

Diagrams show data obtained by computer-based morphometric analysis on days 5 and 14 after induction of UUO in obstructed and contralateral kidneys. Values indicate the relative area of tissue that stained positive. Data represent mean6SD (n512 in each group). Scale bar, 50 mm. (C) Representative pictures of automated multidimensional fluorescence microscopy (MELC) imaging of diseased kidneys of chimeric mice. Immune cells were stained using CD45 (red), CD3 (green), CD4 (dark blue), and F4/80 (cyan). Mean fluo- rescence intensities were calculated as described in the Methods section. n53. Scale bar, 50 mm. (D) Ligated or contralateral kidneys of chimeric mice were homogenized, and levels of CCL2 and CCL5 were determined after ureteral ligation using flow cytometry–based bead assays (n56 animals per group). *P,0.05; **P,0.005; ***P,0.001.

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 9 BASIC RESEARCH www.jasn.org

A L. major CFSE-stained BMD cells parasites adoptive transfer sacrifice

tissue analysis: bone marrow, ear 1 2 5 day post adoptive transfer WT (CD45.1) n=6 n=6 n=6 Notch3-/- (CD45.2)

BCEar: monocytes Ear: neutrophils

CD45.2 +ve CD45.2 +ve

CD45.2APC CD45.1 +ve CD45.2APC

MHCIIAmCyan CD45.1 +ve Ly6G Pacific Blue

CFSE CD45.1 PE-Cy5 CFSE CD45.1 PE-Cy5 - - 150 150 wild type (CD45.1)

Ly6G ** *** * MHCII *** * -/- + Notch3 (CD45.2) + 100 100 CD11b CD11b + + 50 50 % of CFSE

0 % of CFSE 0 day 1 day 2 day 5 day 1 day 2 day 5 post adoptive transfer

D 150 wild type (CD45.1) + + Bone marrow: CD11b CSFE CD45.1 & CD45.2 subsets Notch3-/- (CD45.2) *** + 100 CD45.2 +ve

% CFSE 50 SSC-A SSC-A SSC-A CD45.1 +ve CD45.2 (APC) 0 FSC-A CD11b (APC-Cy7) CFSE CD45.1 (PE-Cy5) day 1 day 2 day 5 post adoptive transfer

EFBone marrow: monocytes Bone marrow: neutrophils

CD45.2 +ve CD45.2 +ve

monocytes CD45.2APC CD45.1 +ve neutrophils CD45.2APC MHCIIAmCyan CD45.1 +ve Ly6G Pacific Blue CFSE CD45.1 PE-Cy5 CFSE CD45.1 PE-Cy5 - - 150 150 wild type (CD45.1) Notch3-/- (CD45.2) Ly6G MHCII

+ *** *** *** *** *** + 100 100 CD11b CD11b + + 50 50

0 0 % of CFSE day 1 day 2 day 5 % of CFSE day 1 day 2 day 5 post adoptive transfer

Figure 4. Notch3 receptor expression on immune cells is required for effective recruitment to site of Leishmania infection. (A) Ex- perimental setup of adoptive BM cell transfer. CFSE-stained BM of WT (CD45.1) and Notch3-knockout (CD45.2) mice were adoptively transferred to recipients after 3 weeks of infection with dsRed-expressing L. major parasites in the ear dermis. Infected ear tissues were analyzed on days 1, 2, and 5 after application by flow cytometry. For further tracking of the immune cells, the immune cell composition of the BM was analyzed as well. (B and C) Representative flow cytometry plots of infected ear tissues to identify CSFE- stained WT and Notch3-knockout monocytes and neutrophils. Diagrams show the cell population frequencies quantified by flow

10 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH inflammatory signaling pathways in knockout animals after Given the blunted immune cell infiltration, it is hypothe- UUO (Figure 2). Several of the regulated molecules play key sized that the crosstalk between the damaged kidney cells and roles in fibrotic and inflammatory processes. To facilitate in- circulating immune cells is disturbed. Among the numerous terpretation of the data, a subset of fibrosis-associated genes, chemokines quantified (Methods), CCL2 and CCL5 are reg- which are known to be upregulated in WTanimals after UUO, ulated in a Notch3-dependent manner (Figure 3D), suggesting were selected.30 Immunohistochemistry of TNC and collagens an inability of injured tissue to perform chemokine synthesis. . 1 and 3 in diseased kidneys of WT and Notch3-knockout mice The absence of infiltrating immune cells in Notch3ko wt . confirm these findings (Figure 2, C–E). and Notch3ko ko animal strains is possibly linked with insuf- ficient mobilization of cells from the BM or dysfunctional cell Immune Cell Infiltration into the Tissue Requires Intact transmigration into tissue. Because the absolute number of Notch3 Signaling circulating leukocytes does not differ in the chimeric animal To specifically address the role of receptor Notch3 on immune strains (Supplemental Figure 3D), it is hypothesized that versus tissue cells, BM chimeras were generated (Figure 2, F Notch3-deficient immune cells are unable to extravasate and G, Table 2). Extensive analyses confirm full reconstitution from the blood circulation. To test this hypothesis, we per- and complete BM chimerism in the animal strains formed an adoptive transfer of WT and Notch3-deficient cells (Supplemental Figures 1–3, Supplemental Table 1). Five days using a well-defined infection model.23 CSFE-labeled BM cells after UUO induction, the immune cell infiltrate was analyzed. (WT, CD45.1; Notch3 knockout, CD45.2) were transferred in 1 The percentage of infiltrating CD45 cells in injured kidneys is equal numbers into L. major–infected WT animals. Labeled reduced by approximately 70% in Notch3-deficient BM trans- WT immune cells are efficiently recruited to the site of infec- . planted into WT recipients (Notch3ko wt)comparedwith tion, whereas the number of Notch3-deficient cells is markedly . knockout animals receiving WT BM cells (Notch3wt ko)(Fig- reduced (20%–40% reduction on days 1 and 2, and 80% on 1 ure 3). Among the CD45 cells infiltrating the kidney, we day 5 after adoptive transfer) (Figure 4, A and B). Parallel 1 observe a 50% reduction of CD3 T cells, macrophages, and analysis of the BM on days 1, 2, and 5 confirm that the monocytes, and a 70% reduction of neutrophils. These differ- Notch3-deficient cells are able to home to the BM after adop- . . ences are similarly seen in Notch3ko ko and Notch3ko wt tive transfer. For monocytes and neutrophils, a Notch3- . strains, which contrast to the results seen in Notch3wt ko and dependent infiltration into the ear is observed (Figure 4, B . Notch3wt wt animal strains. and C). In the BM, the reverse effect is seen, because more Next, monocytes/macrophages were immunostained to as- Notch3 knockout cells are counted (Figure 4, D–F). The results sess their spatial distribution. After UUO, a strong, predom- from the ear infection model, together with UUO, suggest that inantly tubulointerstitial cell infiltrate is seen in WT recruitment of immune cells into diseased organs is dependent . . (Notch3wt wt) and WT BM chimeras (Notch3wt ko) on Notch3 receptor expression by immune cells. These results . (Figure 3B), which is blunted by 70% in Notch3ko ko animals suggest that a retention of immune cells within the BM occurs and reduced by 50% in mice receiving Notch3-deficient BM and, at the same time, the adhesion and/or transmigration of . . (Notch3ko wt). Notably, in Notch3wt ko animals, a similar circulating cells into the tissue is blunted. number of inflammatory cells as in WT animals are recruited, suggesting that receptor Notch3 expression by resident cells is Notch3 Deficiency Impairs Integrin Signaling not a prerequisite for cell recruitment. Adhesion assays demonstrate an inability of Notch3-deficient The composition and spatial organization of cells within immune cells to adhere to HUVECs (Figure 5, A and B). To the inflamed kidney was visualized by MELC (Figure 3C). Af- analyze the Notch3-dependent adhesion in more detail, po- . . ter UUO, Notch3wt wt and Notch3wt ko mice exhibit strong larized BMDMs were seeded onto cell culture plates. Both WT 1 1 infiltrates of CD45 leukocytes, which are primarily F4/80 and Notch3-knockout cells display a comparable level of basal 1 macrophages, with a smaller fraction of CD3 T cells. In con- adhesion to plastic. Because adhesion is mediated by integrin . . 1 trast, Notch3ko ko and Notch3ko wt animal strains have mark- activation, we incubated cells with manganese ions (Mn2 )to 1 edly less infiltrating immune cells (approximately 50%). From induce an open “active” integrin conformation.31 After Mn2 these results, we conclude that Notch3 expression on circulat- exposure, WT cells exhibit enhanced adhesion, whereas ing immune cells is critical for successful cell transmigration Notch3-knockout cells do not (Figure 5, C–H). The adhesion into the damaged kidney tissue. of IL-6–polarized, Notch3-knockout macrophages is similarly

cytometry. Mean values are indicated by red line. (D) Flow cytometry analysis of the immune cell composition within the BM revealed an equal contribution of WT and Notch3-knockout adoptively transferred cells at days 1 and 2 after transfer. At day 5, more Notch3- knockout cells were harvested from the BM, whereas there were fewer WT cells. (E and F) Representative flow cytometry plots of the BM to identify CSFE-stained WT and Notch3-knockout monocytes and neutrophils. Diagrams showing the cell populations fre- quencies measured by flow cytometry. Mean values are indicated by the line. FSC-A, forward scatter area; SSC-A, side scatter area. *P,0.05; **P,0.005; ***P,0.001.

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 11 BASIC RESEARCH www.jasn.org

A BMD cells: wild type (red) FACs Notch-3-/- (CSFE)

activated HUVECs

wild type

-/- ) ) B Notch-3 3 *** neutrophils 3 monocytes

) 6 *** 6 6 3 ** ** ** ** cells cells + 4 4 - 4 Ly6G Ly6G + + cells adherent

+ 2 2 2 to HUVECs (×10 CD11b 0 0 CD11b 0 CD11b

1h 2h adherent to HUVECs (×10 1h 2h 1h 2h

co-culture adherent to HUVECs (×10 HUVECs for G C adhesion buffer 2+ +/- Mn adhesion assay outside-in wild type integrin activation MΦ 2+ Notch3R 0 Mn MΦ Mn2+ culture counting α β α β plate adherent cells w/o 030 counts Mn2+

synergism D adhesion to culture plate activated β1 integrin 30 *** wild type -/- 2 no Notch3 Notch3-/- integrin activation 20 wild type Mn2+ Mn2+

-/- 10 w/o counts 2+ non-polarized Mn adherent cells/ mm Notch3 0 activated β1 integrin w/o Mn2+ Mn2+ E 40 *** *** wild type 2 Notch3-/- H wild type 30 2‘ IL-6 30‘ IL-6 anti-IL-6 wild type 2’ IL-6 20 wild type wild type -/- Notch-3 -/- w/o -/-

counts Notch-3 Mn2+ IL-6-polarized 10 adherent cells/ mm

Notch3 β 0 activated 1 integrin wild type w/o Mn2+ Mn2+ Notch-3-/- F 30 ** wild type Notch3R

2 -/- Notch3 IL-6 β β 20 IL-6R α α wild type

synergism -/- 10

IL-4/-13-polarized inside-out integrin activation adherent cells/ mm

Notch3 0 w/o Mn2+ Mn2+

Figure 5. b1-Integrin activation and adhesion of BM-derived (BMD) cells is reduced in the absence of Notch3 expression. (A) Ex- perimental setup of adhesion assay. A mixture of CellTracker Deep Red–stained WT cells and CFSE-stained Notch3-knockout cells were cocultured with PMA-activated HUVECs for 1 or 2 hours. The type and number of bound cells were analyzed by FACS. (B) Di- 1 agrams show the numbers of adherent CD11b cells as well as neutrophils and monocytes. (C) Experimental setup of adhesion assay.

12 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

1 . not enhanced after addition of Mn2 ,linkingabsenceofthe fibrosis-related genes in Notch3ko wt animals compared with . Notch3 receptor with a defect in IL-6 signaling. The adhesion Notch3wt ko mice (Figure 7A). capacities of IL-4/IL-13–polarized WT and Notch3-knockout TNC is a component of the fibrogenic niche.32 TNC ex- 1 . . macrophages after addition of Mn2 do not differ. Because we pression in Notch3ko wt animals is comparable to Notch3wt wt . do not see differences in the expression levels of b1- and b2- animals, whereas for Notch3wt ko chimera, TNC expression is . integrins and IL-6 receptor in resting macrophages similar to Notch3ko ko knockouts (Figure 7, B and C). To test (Supplemental Figure 4), we hypothesize that receptor Notch3 the hypothesis that Notch3 regulates TNC expression, pri- is involved in IL-6–dependent integrin activation. This is sup- mary tubular cells were incubated with an activator of the ported by findings with an antibody (9EG7) specificforthe Wnt signal pathway, Shh, for 3 days, subjected to decellulari- active conformation of b1-integrin. BMDMs were stimulated zation, and then analyzed for the presence of TNC within the with IL-6 and activation of b1-integrin was monitored. ECM. Shh induces TNC expression.32 Indeed, less TNC was WT cells have a more activated b1-integrin in response to detected in Notch3 knockout compared with WT tubular cells. 1 IL-6 or Mn2 compared with Notch3-knockout macrophages. The application of a Notch3 blocking antibody to the medium IL-6 blocking antibody prevents activation of b1-integrin, in WT cells decreased TNC levels similarly to Notch3 knock- which serves as a control (Figure 5H). outs, confirming a Notch3 dependency of TNC expression Phenotypic analyses show that both WT and Notch3- (Figure 7D). Extracellular TNC stimulates SMA expression deficient cells display no differences in polarization efficiency in WT tubular cells; however, there was lower expression in and proliferation (Supplemental Figure 4, E–H). Notch3-knockout cells, indicating a TNC-Notch3-SMA axis. Similar results were detected with kidney tissue lysates from Notch3 Deficiency in Kidney Tissue Protects from chimeric animals. When Notch3 expression was deleted in UUO-Induced Fibrosis resident kidney cells, there was also less SMA expression after Extensive dilation of collecting ducts, proximal tubules, and UUO (Figure 7, E and F). TNC and SMA are both known distal tubules was present, and tubular cell damage and apo- target genes of NF-kB. From the literature, a close link be- . . ptosis ensue in Notch3wt wt and Notch3ko wt animals; how- tween Notch3 and NF-kB signaling is described.33 To deter- . . ever, to a lesser extent in Notch3ko ko and Notch3wt ko animals mine the spatial activation of NF-kB (pp65), MELC analyses (Figure 6A). The loss of tubular cells is diminished when were performed in the chimeric animal strains (NF-kB pp65 Notch3 expression is ablated in kidney-resident cells shown as yellow in Figure 8A). The abundance of nuclear p65 . . (Figure 6B). Higher numbers of neutrophil gelatinase– is high in tubular cells from Notch3ko wt and Notch3wt wt . . associated lipocalin transcript are detected with tubular cell strains, and low in Notch3wt ko and Notch3ko ko animals. expression of Notch3, supporting a Notch3-dependent dam- Western blotting confirmed these results (Figure 8B). To ex- age pattern (Figure 6C). Tubulointerstitial fibrosis with accu- plore the idea that master regulators of NF-kB signaling are mulation of collagens 1 and 3 was visualized by Sirius Red dysregulated in the chosen model, isolated tubular cells were staining (Figure 6D, Supplemental Figure 5). A 50% decrease analyzed for the lysine 63 deubiquitinase CYLD (Figure 8C). . . in fibrosis was observed in Notch3ko ko and Notch3wt ko mice. CYLD is constitutively upregulated in the Notch3-knockout MELC analyses revealed that tubulointerstitial cells express compared with WT cells. Therefore, we propose a model based more smooth muscle actin (SMA) in animals with resident on this study and published data in which integrin activation . . cells expressing Notch3 (Notch3wt wt and Notch3ko wt ani- and the subsequent activation of NF-kB signaling depends mals) (Figure 6E). Transcript numbers of fibrosis-related upon Notch3 receptor expression, which is summarized in a genes, such as collagens 1 and 3, fibronectin-1, TNC,and scheme shown in Figure 8D. . TGF-b in Notch3wt ko mice at days 14 after UUO compared Taken together, the results indicate cell-specific functions . with Notch3ko wt animals are lower (Figure 7A). Furthermore, of Notch3 receptor. In circulating immune cells, Notch3- . . organ fibrosis in Notch3wt ko mice is similar to Notch3ko ko dependent integrin activation mediates transmigration and animals, suggesting that tubular Notch3 expression is a driv- tissue infiltration. In tissue-resident cells, Notch3-dependent ing factor that mitigates the profibrogenic response. This is signaling enhances matrix synthesis and cell phenotypes that further supported by the higher transcript numbers of propagate organ fibrosis (Figure 8E).

1 Primary macrophages (Mf) were incubated in adhesion buffer. Integrins were activated using Mn2 ions. Macrophages were added to the culture plate and incubated for 30 minutes. Adherent cells were analyzed after DAPI staining. Representative images and quan- titative analysis of (D) adherent nonpolarized cells, (E) IL-6–polarized cells, and (F) IL-4/IL-13–polarized cells. (G) Outside-in activation of 1 b1-integrin was analyzed in the presence (filled line) or absence (dotted line) of Mn2 in nonpolarized WT (shown in blue) and Notch3- knockout (shown in red) macrophages by FACS using 9EG7 antibody. The gray-filled histograms represent fluorescence in the absence of the primary antibody. (H) For inside-out activation of b1-integrin, nonpolarized macrophages were stimulated with 15 ng/ml IL-6 for the indicated time points and stained for activated b1-integrin using 9EG7 antibody. Specificity was tested using IL-6 blocking antibody (dotted blue line). Experiments were repeated three times each. Notch3R, Notch3 receptor; w/o, without. Scale bar, 100 mm. *P,0.05; **P,0.005; ***P,0.001.

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 13 BASIC RESEARCH www.jasn.org

wt>wt ko>ko ko>wt wt>ko A Notch3 Notch3 Notch3 Notch3 PAS staining 4 3 2 1

mean tubular 0 damage index contralateral 4 ** 3 ****** ** 2 1

mean tubular 0 damage index UUO day 5 4 ** 3 *** *** ** 2 1

mean tubular 0 damage index t ko wt ko t>w

UUO day 14 w ko> ko> wt>

B Notch3Notch3Notch3Notch3

C *** *** NGAL/Lcn2 15 *** *** *** 10 * *** *** 8 * 10 *** 6 4 5 2 circumference transcript number (log2 fold-change) 0 0 wt ko wt ko pt dt cd pt dt cd pt dt cd pt dt cd > > > wt ko ko> wt cells/basement membrane Notch3wt>wt Notch3ko>ko Notch3ko>wt Notch3wt>ko Notch3 Notch3 Notch3 Notch3 D UUO day 5 (Sirius Red staining) Sirius Red staining 15 *** * ** chimeras: wt>wt ko>wt * Notch3 Notch3 10 Notch3wt>wt Notch3ko>ko 5 Notch3ko>wt Notch3wt>ko Collagen I/II ratio 0 Notch3ko>ko Notch3wt>ko

E UUO day 5 Col IV SMA Vimentin Notch3wt>wt Notch3ko>wt

Notch3ko>ko Notch3wt>ko

Figure 6. Mice with genetic ablation of Notch3 in tissue-resident cells are protected from tubular epithelial cell damage. (A) In healthy kidneys from the four chimeric animal models, Periodic acid–Schiff (PAS) staining of cortical kidney tissue specimens revealed no apparent dysontogenesis or renal phenotype. Staining of obstructed kidneys at days 5 and 14 of the respective chimeric animals was performed and representative images were taken. The PAS staining showed an increase in tubular damage in WT chimeras and

14 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

DISCUSSION microvascular pathologies in diabetes.42 Our results indicate that immune cells lacking Notch3 receptor have an adherence In the pathogenesis of organ fibrosis, tissue injury with sub- defect, which renders these cells incapable of transmigration sequent immune cell infiltration, phenotypic alterations to- into the tissue. Integrin conformational changes are disturbed ward myofibroblasts, and excess ECM deposition are thought in the absence of Notch3 signaling. Our findings are supported to be intimately linked.34 In the kidney, the origin of myofi- by studies describing the role of Notch receptors and their broblasts has been deciphered by cell lineage tracking35; how- ligands in leukocyte adhesion to the endothelium.43–45 We ever, a causal link between immune cell infiltration and the observe Notch3-dependent activation of b1-integrin and fibrotic response has yet to be demonstrated. Some reports monocyte adhesion to endothelial cells, whereas integrin ex- show that infiltrating hematopoietic cells are a source of col- pression per se is not altered with Notch3 deletion. From these lagen type 1 synthesis in the kidney.36 Cell lineage tracing results, we conclude that Notch3 receptor is part of the arma- studies confirm that myofibroblasts originate from proliferat- mentarium of inflammatory cells to perform site-directed ing tissue-resident fibroblasts and infiltrating BM-derived transmigration via integrin signaling. cells.35,37 Our findings with chimeric animal strains suggest Diminished kidney fibrosis in chimeric animals that have a that,inthefibrotic response, Notch3 receptor signaling par- deletion of Notch3 in resident kidney cells with abundant in- ticipates in both immune and resident kidney cells.18,19,38 We filtrates of immune cells is intriguing and may pinpoint to hypothesized that Notch3 receptor signaling is required for other immune cell functions, such as resolution of the in- immune cell recruitment, and that the subsequent organ fi- flammatory response. These may include phagocytosis of cell brosis is incited by a prevailing inflammatory tissue milieu. debris and confinement of inflammation through anti- The experimental approach using BM chimeras with animals inflammatory cytokines, with subsequent tissue regeneration.46,47 expressing Notch3 either in tissue or in BM-derived immune A verdict on the respective roles that the still-infiltrating cells play cells allowed us to discriminate the relative contribution of is, however, not possible with our results.24,48,49 Furthermore, the Notch3 receptor in each population. Extensive control exper- absolute number of infiltrating immune cells does not necessarily iments exclude a participation of Notch3 receptor in BM re- allow us to form conclusions about their relative effects on tissue constitution, a prerequisite for meaningful results. The model fibrosis.36,50 of UUO is well defined and not immune-mediated, with a ECM deposition is downregulated in Notch3-knockout clear starting point of tubular damage.39 After UUO, mice.18 We identify tissue-resident cells as the drivers of fibro- Notch3-deficient tubular cells are protected from immediate sis. We propose that Notch3 receptor signaling is central in the damage and remain adherent to the basement membrane, formation of the fibrotic niche. This depends on a cellular despite a proinflammatory tissue milieu (Supplemental microenvironment composed of a specialized ECM network, Figure 7). Intriguingly, in the absence of Notch3 receptor in secreted factors, and specialized cell types.32,51,52 One critical resident kidney cells, organ fibrosis is blunted, although there component of the fibrotic niche is TNC.53 Our findings show . is marked immune cell infiltrate. Conversely, the Notch3ko wt that the production of TNC-containing ECM depends on chimeras suggest that Notch3 receptor signaling is a prereq- Notch3 expression in resident kidney cells. A crosstalk of uisite for most immune cells to transmigrate into the kidney Shh/Wnt-induced ECM synthesis and Notch3 signaling ex- tissue. Thus, dichotomous functions become apparent for ists.32,54 We envision that the activation of Notch3 signaling Notch3 receptor: one on immune cells, and the other on by ECM resembles that of the membrane-anchored ligands tissue-resident cells. Delta and Jagged, which upregulate TNC expression. Recently, In macrophages, Notch signals control cell maturation.40 it has been shown that tubular epithelial cell damage triggers Macrophages are known to propagate atherogenesis.41 Fur- the expression and secretion of fibrotic cues (e.g., Shh, Wnt thermore, inhibition of Notch3 signaling markedly alleviates ligands, TGF-b).32 Thesemaystimulatemyofibroblasts to

knockout transplants, and less tubular damage in knockout chimeras and WT transplants. Quantification of the results obtained with the tubular histology score, which assesses loss of brush border, tubular dilation, and apoptosis/necrosis of tubular cells. n512. Scale bar, 50 mm. (B) Analysis of the tubular epithelial attachment to the basement membrane of collecting ducts (cd), proximal tubules (pt), and distal tubules (dt). Tubular cell damage and apoptosis ensues, the loss of tubular cells over the whole nephron was diminished when Notch3 expression is ablated within resident tissue cells. (C) Quantitative mRNA analysis of the tubular injury marker neutrophil . gelatinase–associated lipocalin (NGAL/Lcn2) in kidney tissue of WT and Notch3-knockout transplanted mice (Notch3ko wt) revealed . that tubular structure was protected in chimeric Notch3wt ko mice. (D) Sirius Red staining for collagen deposits showed an increase of . . collagen deposition in Notch3wt wt and Notch3ko wt mice. Representative Sirius Red stainings of obstructed kidneys obtained on day 5 of obstruction are shown. The polarization filter allows us to distinguish collagens 1 (red color) and 3 (green color). Quantification of collagens 1 and 3 and ratio calculation was performed using ImageProPlus software. Scale bar, 50 mm. (E) Representative pictures of automated multidimensional fluorescence microscopy (MELC) imaging of diseased kidneys of chimeric mice. Fibrosis-related proteins were stained using SMA (magenta), collagen 4 (Col IV; white), and vimentin (orange). n53. Scale bar, 50 mm. *P,0.05; **P,0.005; ***P,0.001.

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 15 BASIC RESEARCH www.jasn.org

A B tenascin-C Notch3wt>wt Notch3ko>ko Notch3ko>wt Notch3wt>ko wt>wt ko>ko ko>wt wt>ko UUO day 5

Notch3 Notch3 Notch3 Notch3 fibrosis-related genes collagen 1a1 collagen 1a2 UUO day 5 UUO day collagen 3 tenascin-C fibronectin TGF- -catenin Notch3 low high

C wt/wt ko/ko ko/wt wt/ko wt/wt ko/ko ko/wt wt/ko D extracellular matrix Notch3Notch3Notch3Notch3 Notch3 Notch3 Notch3 Notch3 Mr shh ++ ++ 123456789101112 Mr (kDa) Notch3 tubular cells WTKO WT KO WT KO WT KO (kDa) 250 tenascin-C > tenascin-C > 250

GAPDH > 36 Notch3 (ICD) > 100

Tubulin > 60 contralateral UUO

* 15 wild type *** *** ** -/- 15 * *** Notch3 10 chimeras: *** 10 Notch3wt>wt *** Notch3ko>ko 5 5 Notch3ko>wt

wt>ko intensity) (relative Notch3 tenascin-C/tubulin 0 (relative intensity) (relative 0 tenascin-C/GAPDH contralateral UUO receptor Notch3 blocking antibody

E primary tubular cells F wild type Notch3-/- Mr wt>wt ko>ko ko>wt wt>ko wt>wt ko>ko ko>wt wt>ko tenascin-C -1d3d-1d3d(kDa) Mr SMA > 60 Notch3Notch3Notch3Notch3Notch3Notch3Notch3Notch3(kDa) SMA > vinculin > 120 60 vinculin > *** 120 *** contralateral UUO * wild type 6 * *** Notch3-/- 50 *** *** 4 chimeras: 40 wt>wt *** Notch3 30 Notch3ko>ko 2 20 Notch3ko>wt SMA/vinculin 10 Notch3wt>ko SMA/vinculin (relative intensity) (relative

0 intensity) (relative 0

Figure 7. TNC expression in fibrotic kidneys is dependent on Notch3 expression on tissue-resident cells. (A) Heat-map analysis of . . . Notch3 receptor transcripts and selected fibrosis-relevant genes after UUO in Notch3wt wt, Notch3ko ko, Notch3ko wt,and . Notch3wt ko animals (red, upregulated; blue, downregulated). (B) Representative micrographs showing the expression and localization of TNC in kidney tissue after UUO. Scale bar, 50 mm. (C) Western blot analyses of renal expression of TNC protein in contralateral and obstructed kidneys after UUO. (D) Primary tubular cells (Notch3 WT and knockout [KO]) were cultured in a 6-cm dishes and incubated with or without Shh to induce TNC expression. Inhibition of Notch3 signaling was achieved by means of a blocking antibody before stimulation with Shh. After 3 days, cultures were decellularized by addition of EGTA-containing solution, and the remaining ECM scaffold was included in the Western blot analysis for TNC quantification. Cell lysates were tested for Notch3 receptor expression. (E) Western blot analysis of whole-cell lysates from TNC-stimulated primary tubular cells (Notch3 WT and knockout) revealed a time- dependent, TNC-induced expression of SMA in WT cells, which is abolished in Notch3-knockout cells. (F) Western blot analyses demonstrating renal expression of SMA protein in contralateral and obstructed kidneys after UUO. Experiments were each repeated three times. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. ICD, intracellular domain. *P,0.05; **P,0.005; ***P,0.001.

16 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

A B C wt>wt ko>ko ko>wt wt>ko wt>wt ko>ko ko>wt wt>ko UUO day 5 Mr primary tubular cells Notch3Notch3Notch3Notch3Notch3Notch3Notch3Notch3(kDa) -/- pp65 > wild type Notch3 65 Mr short exposure tenascin-C -1d3d-1d3d(kDa) wt>wt p65 > 65 CYLD > 100 long exposure

Notch3 120 p65 > 65 vinculin >

plKB> 70

lKB> 70 ko>ko

vinculin > 120 Notch3 contralateral UUO D outside-in integrin activation extracellular matrix ko>wt (e.g. tenascin-C, collagen) Shh IL-6

Notch3

IL-6R Notch3R PTCH1 Notch3R inside-out synergism integrin activation wt>ko NICD

P P P P Notch3 STAT3 ERK1/2 Akt JNK

auto-fluorescence F4/80 P P p65 p65 p50 SMA p65 NF-kB NICD e.g.SMA, Collagen-IV tenascin-C collagen

E myofibroblast & capillary tubular cell immune cell’s fibroblast extracellular matrix

wild type Notch-3 knockout health disease

inflammatory millieu: high low low high (CCL5, CCL2, MCP1) fibrosis: high low high low (collagen, smooth muscle actin)

NF-KB (p65) activation: high low high low

Figure 8. NF-kB (p65) activation in diseased kidneys is dependent on Notch3 expression on tissue-resident cells. (A) Representative images obtained by automated multidimensional fluorescence microscopy (MELC) visualize the spatial distribution of NF-kB–positive cells in diseased kidneys from the four different chimeric animal strains (NF-kB p65 is stained in yellow). F4/80 in green identifies immune cells. Collagen type IV (white) and SMA (blue) allow for discrimination of tissue structures, tubular cells exhibit a red auto- fluorescence signal. n53. Scale bars, 50 mm. (B) Western blot analyses were performed with kidney tissue lysates. Antibodies specific for NF-kB (p65), phospho (Ser536)–NF-kB (p65) (with long exposure to visualize the signals in the contralateral kidneys), total IkBa,and phospho (Ser32)–IkBa were applied. (C) Western blot analysis of whole-cell lysates from TNC-stimulated primary tubular cells (WT or Notch3 knockout) revealed an upregulation of the NF-kB inhibitor CYLD in Notch3-knockout cells. Experiments were repeated three times. (D) Schematic illustrating the crosstalk of receptor Notch3 in combination with Shh and integrin signaling leading to the ac- cumulation of ECM. All data obtained within this study are highlighted in blue. Known interactions from the literature are indicated as black lines with white boxes. (E) Cartoon that depicts key findings of the study.

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 17 BASIC RESEARCH www.jasn.org produce and secrete TNC and other ECM components, with J. Lindquist was supported by DFG grant LI-1031/4-1. F. Heidel was supported TNC acting as a ligand for integrins. Our findings corroborate in part by a DFG grant HE-6233/4-1 and by the Thüringian Ministry for a permissive effect of Notch3 expression on b1-integrin acti- Research, Thüringian state program ProExzellenz (RegenerAging, FSU-I- 03/14). S. Djudjaj was funded by the Excellence Initiative of the German vation. Besides TNC, a strong upregulation of collagens type 1 federal and state governments grant ERS, OPSF470. A. Müller received fund- and 3 and SMA is present when resident kidney cells express ing from the European Union’s H2020 European Research Council research Notch3 receptor. Thus, a prominent role is executed by and innovation program (StG ImmProDynamics, grant number 714233) and Notch3 signaling in the fibrotic response, similarly to SMA.55 the DFG grant MU3744/4-1. P. Mertens reports receiving federal state Sax- Mechanistically, NF-kB is part of the aforementioned sig- ony-Anhalt and the European Structural and Investment Funds (ESF, 2014–2020), under project number ZS/2016/08/80645, during the conduct naling pathways. Recent studies report that the activation of of the study. the NF-kB pathway in kidney disease is abrogated in the ab- sence of receptor Notch3.19,56 As one example, Notch3 recep- k 57,58 tor and p65/NF- B orchestrate T cell function. It has been ACKNOWLEDGMENTS shown that nuclear translocation of p65/NF-kB in tissue- resident cells is reduced when Notch3 receptor is absent. We are grateful to Mrs. Huß, Königsmark, and Schuppe for excellent technical Taken together, immune cell infiltration and tissue fibrosis assistance, and to Dr. S. Kliche (Institute of Molecular and Clinical Immu- are distinct and separable events that are largely regulated via nology, Otto-von-Guericke University Magdeburg) for helpful discussion. Notch3 receptor: (1) Notch3 expression on immune cells Dr. Sabine Brandt, Dr. Tobias Ballhause, Dr. Anja Bernhardt, Dr. Annika Becker, Dr. Delia L. Salaru, Dr. Hien Le-Deffge, Dr. Alexander Fehr, Dr. YanFu, propagates cell adhesion function and transmigration, Dr. Lars Philipsen, Dr. Sonja Djudjaj, Dr. Andreas Müller, Dr. Rafael Kramann, whereas (2) Notch3 expression on resident kidney cells par- Dr. Mahmoud Ibrahim, Dr. Robert Geffers, Dr. Berend Isermann, Dr. Florian ticipates in the induction of organ fibrosis. Our data indicate Heidel, and Dr. Jonathan A. Lindquist performed experiments and analyzed that, besides immune cells, different kidney-resident cells ex- data; Dr. Chris Siebel provided essential reagents; Dr. Sabine Brandt, press Notch3 receptor, e.g., tubular and tububointerstitial Dr. Jonathan A. Lindquist, and Dr. Peter R. Mertens wrote the manuscript; and Dr. Peter R. Mertens conceived the study and supervised the work. cells, pericytes, and mesangial cells. It will be of interest to fi Dr. Rafael Kramann reports receiving grants from Chugai Pharma/Roche, decipher disease-speci c expression patterns and cell- outside the submitted work. specific roles of receptor signaling in future studies.59 Notably, specific Notch3 blocking antibodies have been developed and 60 entered into clinical trials. Given that Notch3-knockout an- SUPPLEMENTAL MATERIAL imals are not limited in their life span,21,22 our study results encourage further research with focus on cell-specific Notch3 This article contains the following supplemental material online at http:// blocking compounds. jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2019121289/-/ DCSupplemental. Limitations of this Study Supplemental Figure 1. Complete blood counts with immune cell compo- fi sition as well as kidney function in Notch3 knockout and wild type mice. Our ndings on Notch3-dependent effects have been obtained Supplemental Figure 2. Flow cytometry on bone marrow chimerism from in a single experimental model that primarily relies on tubular transplanted mice. cell damage with a subsequent inflammatory response. A gen- Supplemental Figure 3. Confirmation of successful homing, reconstitution, eralization on other modes of kidney damage is not possible as well as chimerism in bone marrow transplanted mice. fi and further results are needed to specify how Notch3 receptor Supplemental Figure 4. Analysis of polarization ef ciency, cell proliferation, IL-6 receptor and integrin expression of wild type and Notch3 knockout bone alters immune cell properties in disease. marrow-derived macrophages. Supplemental Figure 5. Sirius Red staining performed with obstructed kid- neys on days 14. fi DISCLOSURES Supplemental Figure 6. Flow cytometric analysis of kidney in ltrating immune cells. Supplemental Figure 7. Gene array analysis on IL-6 transcript numbers. C. Siebel has a patent “Anti-jagged antibodies and methods of use” (WO Supplemental Table 1. Whole blood counts of wild type, Notch3 knockout 2014/028446) issued, and a patent “Methods of treating cancer using notch and chimeric animals. antagonists” (US20120328608) issued. All remaining authors have nothing to disclose.

REFERENCES

FUNDING 1. Rockey DC, Bell PD, Hill JA: Fibrosis—a common pathway to organ injury and failure. NEnglJMed372: 1138–1149, 2015 This work was funded by the Deutsche Forschungsgemeinschaft (DFG, 2. Kramann R, Schneider RK, DiRocco DP, Machado F, Fleig S, Bondzie German Research Foundation) under project identifier 97850925 - SFB 854 PA, et al.: Perivascular Gli11 progenitors are key contributors to injury- (to P. Mertens [project A1], B. Isermann [project B26N], F. Heidel [project induced organ fibrosis. Cell Stem Cell 16: 51–66, 2015 A20], and A. Müller [Z01, B31N]); project identifier GRK 2408 (to B. Iser- 3. Li L, Kang H, Zhang Q, D’Agati VD, Al-Awqati Q, Lin F: FoxO3 activation mann [project 7] and to P. Mertens [project 8]); CRC854 (to L. Philipsen in hypoxic tubules prevents chronic kidney disease. JClinInvest129: [project Z01]); and grants ME-1365/7-2 and ME-1365/9-2 (to P. Mertens). 2374–2389, 2019

18 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

4. Petejova N, Martinek A, Zadrazil J, Teplan V: Acute toxic kidney injury. automated multidimensional fluorescence microscopy. Nat Biotechnol Ren Fail 41: 576–594, 2019 24: 1270–1278, 2006 5. Liu J, Kumar S, Dolzhenko E, Alvarado GF, Guo J, Lu C, et al.: Molecular 27. Edelmann B, Gupta N, Schnoeder TM, Oelschlegel AM, Shahzad K, characterization of the transition from acute to chronic kidney injury Goldschmidt J, et al.: JAK2-V617F promotes venous thrombosis following ischemia/reperfusion. JCI Insight 2: e94716, 2017 through b1/b2 integrin activation. JClinInvest128: 4359–4371, 2018 6. Breitkopf DM, Jankowski V, Ohl K, Hermann J, Hermert D, Tenbrock K, 28. Lake BB, Chen S, Hoshi M, Plongthongkum N, Salamon D, Knoten A, et al.: The YB-1:Notch-3 axis modulates immune cell responses and et al.: A single-nucleus RNA-sequencing pipeline to decipher the mo- organ damage in systemic lupus erythematosus. Kidney Int 97: lecular anatomy and pathophysiology of human kidneys. Nat Commun 289–303, 2020 10: 2832, 2019 7. Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, et al.: Inflammatory 29. Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM responses and inflammation-associated diseases in organs. Onco- 3rd, et al.: Comprehensive integration of single-cell data. Cell 177: target 9: 7204–7218, 2017 1888–1902.e21, 2019 8. Centers for Disease Control and Prevention: Chronic kidney disease in 30. Arvaniti E, Moulos P, Vakrakou A, Chatziantoniou C, Chadjichristos C, the United States, 2019, Atlanta, GA, US Department of Health and Kavvadas P, et al.: Whole-transcriptome analysis of UUO mouse model Human Services, Centers for Disease Control and Prevention, 2019 of renal fibrosis reveals new molecular players in kidney diseases. Sci 9. Liu Y: Cellular and molecular mechanisms of renal fibrosis. Nat Rev Rep 6: 26235, 2016 Nephrol 7: 684–696, 2011 31. Mould AP, Akiyama SK, Humphries MJ: Regulation of integrin alpha 5 10. Djudjaj S, Boor P: Cellular and molecular mechanisms of kidney fibrosis. beta 1-fibronectin interactions by divalent cations. Evidence for distinct Mol Aspects Med 65: 16–36, 2019 classes of binding sites for Mn21,Mg21, and Ca21. J Biol Chem 270: 11. Kramann R, Fleig SV, Schneider RK, Fabian SL, DiRocco DP, Maarouf O, 26270–26277, 1995 et al.: Pharmacological GLI2 inhibition prevents myofibroblast cell- 32. Fu H, Tian Y, Zhou L, Zhou D, Tan RJ, Stolz DB, et al.: Tenascin-C is a cycle progression and reduces kidney fibrosis. JClinInvest125: major component of the fibrogenic niche in kidney fibrosis. JAmSoc 2935–2951, 2015 Nephrol 28: 785–801, 2017 12. Bielesz B, Sirin Y, Si H, Niranjan T, Gruenwald A, Ahn S, et al.: Epithelial 33. Song N, Thaiss F, Guo L: NFkB and kidney injury. Front Immunol 10: Notch signaling regulates interstitial fibrosis development in the kid- 815, 2019 neys of mice and humans. J Clin Invest 120: 4040–4054, 2010 34. Humphreys BD: Mechanisms of renal fibrosis. Annu Rev Physiol 80: 13. Nathan C, Ding A: Nonresolving inflammation. Cell 140: 871–882, 2010 309–326, 2018 14. Schroder K, Tschopp J: The inflammasomes. Cell 140: 821–832, 2010 35. LeBleu VS, Taduri G, O’Connell J, Teng Y, Cooke VG, Woda C, et al.: 15. Lech M, Anders HJ: Macrophages and fibrosis: How resident and in- Origin and function of myofibroblasts in kidney fibrosis. Nat Med 19: filtrating mononuclear phagocytes orchestrate all phases of tissue in- 1047–1053, 2013 jury and repair. Biochim Biophys Acta 1832: 989–997, 2013 36. Buchtler S, Grill A, Hofmarksrichter S, Stöckert P, Schiechl-Brachner G, 16. Sirin Y, Susztak K: Notch in the kidney: Development and disease. Rodriguez Gomez M, et al.: Cellular origin and functional relevance of J Pathol 226: 394–403, 2012 collagen I production in the kidney. J Am Soc Nephrol 29: 1859–1873, 17. Sweetwyne MT, Tao J, Susztak K: Kick it up a notch: Notch signaling and 2018 kidney fibrosis. Kidney Int Suppl (2011) 4: 91–96, 2014 37. Kramann R, DiRocco DP, Humphreys BD: Understanding the origin, 18. Djudjaj S, Chatziantoniou C, Raffetseder U, Guerrot D, Dussaule JC, activation and regulation of matrix-producing myofibroblasts for Boor P, et al.: Notch-3 receptor activation drives inflammation and fi- treatment of fibrotic disease. J Pathol 231: 273–289, 2013 brosis following tubulointerstitial kidney injury. J Pathol 228: 286–299, 38. Huang S, Park J, Qiu C, Chung KW, Li SY, Sirin Y, et al.: Jagged1/ 2012 Notch2 controls kidney fibrosis via Tfam-mediated metabolic re- 19. El Machhour F, Keuylian Z, Kavvadas P, Dussaule JC, Chatziantoniou C: programming. PLoS Biol 16: e2005233, 2018 Activation of Notch3 in glomeruli promotes the development of rapidly 39. Martínez-Klimova E, Aparicio-Trejo OE, Tapia E, Pedraza-Chaverri J: progressive renal disease. JAmSocNephrol26: 1561–1575, 2015 Unilateral ureteral obstruction as a model to investigate fibrosis- 20. Kavvadas P, Keuylian Z, Prakoura N, Placier S, Dorison A, Chadjichristos attenuating treatments. Biomolecules 9: 141, 2019 CE, et al.: Notch3 orchestrates epithelial and inflammatory responses 40. Krishnasamy K, Limbourg A, Kapanadze T, Gamrekelashvili J, Beger C, to promote acute kidney injury. Kidney Int 94: 126–138, 2018 Häger C, et al.: Blood vessel control of macrophage maturation pro- 21. Boulos N, Helle F, Dussaule JC, Placier S, Milliez P, Djudjaj S, et al.: motes arteriogenesis in ischemia. Nat Commun 8: 952, 2017 Notch3 is essential for regulation of the renal vascular tone. Hyper- 41. Ewert L, Fischer A, Brandt S, Scurt FG, Philipsen L, Müller AJ, et al.: Cold tension 57: 1176–1182, 2011 shock Y-box binding protein-1 acetylation status in monocytes is as- 22. Krebs LT, Xue Y, Norton CR, Sundberg JP, Beatus P, Lendahl U, et al.: sociated with systemic in flammation and vascular damage. Athero- Characterization of Notch3-deficient mice: Normal embryonic devel- sclerosis 278: 156–165, 2018 opment and absence of genetic interactions with a Notch1 mutation. 42. Wimmer RA, Leopoldi A, Aichinger M, Wick N, Hantusch B, Novatchkova Genesis 37: 139–143, 2003 M, et al.: Human blood vessel organoids as a model of diabetic vascul- 23. Olekhnovitch R, Ryffel B, Müller AJ, Bousso P: Collective nitric oxide opathy. Nature 565: 505–510, 2019 production provides tissue-wide immunity during Leishmania infection. 43. Colombo M, Mirandola L, Platonova N, Apicella L, Basile A, Figueroa JClinInvest124: 1711–1722, 2014 AJ, et al.: Notch-directed microenvironment reprogramming in mye- 24. Bernhardt A, Fehr A, Brandt S, Jerchel S, Ballhause TM, Philipsen L, loma: A single path to multiple outcomes. Leukemia 27: 1009–1018, et al.: Inflammatory cell infiltration and resolution of kidney in- 2013 flammation is orchestrated by the cold-shock protein Y-box binding 44. Briot A, Bouloumié A, Iruela-Arispe ML: Notch, lipids, and endothelial protein-1. Kidney Int 92: 1157–1177, 2017 cells. Curr Opin Lipidol 27: 513–520, 2016 25. Clahsen T, Schaper F: Interleukin-6 acts in the fashion of a classical 45. Murata A, Okuyama K, Sakano S, Kajiki M, Hirata T, Yagita H, et al.: A chemokine on monocytic cells by inducing integrin activation, cell Notch ligand, Delta-like 1 functions as an adhesion molecule for mast adhesion, actin polymerization, chemotaxis, and transmigration. cells. JImmunol185: 3905–3912, 2010 J Leukoc Biol 84: 1521–1529, 2008 46. Sheikh Z, Brooks PJ, Barzilay O, Fine N, Glogauer M: Macrophages, 26. Schubert W, Bonnekoh B, Pommer AJ, Philipsen L, Böckelmann R, foreign body giant cells and their response to implantable biomaterials. Malykh Y, et al.: Analyzing proteome topology and function by Materials (Basel) 8: 5671–5701, 2015

JASN 31: ccc–ccc, 2020 Cell-Specific Activities of Notch3 19 BASIC RESEARCH www.jasn.org

47. Borthwick LA, Wynn TA, Fisher AJ: Cytokine mediated tissue fibrosis. 55. Noseda M, Fu Y, Niessen K, Wong F, Chang L, McLean G, et al.: Smooth Biochim Biophys Acta 1832: 1049–1060, 2013 muscle alpha-actin is a direct target of Notch/CSL. Circ Res 98: 48. Castaño AP, Lin SL, Surowy T, Nowlin BT, Turlapati SA, Patel T, et al.: 1468–1470, 2006 Serum amyloid P inhibits fibrosis through Fc gamma R-dependent 56. Sakai N, Wada T, Furuichi K, Iwata Y, Yoshimoto K, Kitagawa K, et al.: monocyte-macrophage regulation in vivo. Sci Transl Med 1: 5ra13, 2009 p38 MAPK phosphorylation and NF-kappa B activation in human 49. Huen SC, Cantley LG: Macrophage-mediated injury and repair after crescentic glomerulonephritis. Nephrol Dial Transplant 17: 998–1004, ischemic kidney injury. Pediatr Nephrol 30: 199–209, 2015 2002 50. Lever JM, Hull TD, Boddu R, Pepin ME, Black LM, Adedoyin OO, et al.: 57. Barbarulo A, Grazioli P, Campese AF, Bellavia D, Di Mario G, Pelullo M, Resident macrophages reprogram toward a developmental state after et al.: Notch3 and canonical NF-kappaB signaling pathways co- acute kidney injury. JCI Insight 4: e125503, 2019 operatively regulate Foxp3 transcription. J Immunol 186: 6199–6206, 51. von Holst A: Tenascin C in stem cell niches: Redundant, permissive or 2011 instructive? Cells Tissues Organs 188: 170–177, 2008 58. Kumar V, Palermo R, Talora C, Campese AF, Checquolo S, Bellavia D, 52. Wong GS, Rustgi AK: Matricellular proteins: Priming the tumour mi- et al.: Notch and NF-kB signaling pathways regulate miR-223/FBXW7 croenvironment for cancer development and metastasis. Br J Cancer axis in T-cell acute lymphoblastic leukemia. Leukemia 28: 2324–2335, 108: 755–761, 2013 2014 53. Midwood KS, Chiquet M, Tucker RP, Orend G: Tenascin-C at a glance. 59. Park J, Shrestha R, Qiu C, Kondo A, Huang S, Werth M, et al.: Single-cell J Cell Sci 129: 4321–4327, 2016 transcriptomics of the mouse kidney reveals potential cellular targets of 54. Sivasankaran B, Degen M, Ghaffari A, Hegi ME, Hamou MF, Ionescu kidney disease. Science 360: 758–763, 2018 MC, et al.: Tenascin-C is a novel RBPJkappa-induced target gene for 60. Olsauskas-Kuprys R, Zlobin A, Osipo C: Gamma secretase inhibitors of Notch signaling in gliomas. Cancer Res 69: 458–465, 2009 Notch signaling. Onco Targets Ther 6: 943–955, 2013

AFFILIATIONS

1Clinic of Nephrology and Hypertension, Diabetes and Endocrinology, Otto-von-Guericke University Magdeburg, Magdeburg, Germany 2Health Campus Immunology, Infectiology and Inflammation (GCI3), Otto-von-Guericke University, Magdeburg, Germany 3Institute of Molecular and Clinical Immunology, Otto-von-Guericke University Magdeburg, Magdeburg, Germany 4Institute of Pathology, Rheinisch-Westfälische Technische Hochschule Aachen University, Aachen, Germany 5Intravital Microscopy of Infection and Immunity Research Group, Helmholtz Centre for Infection Research, Braunschweig, Germany 6Department of Nephrology and Clinical Immunology, Rheinisch-Westfälische Technische Hochschule Aachen University, Aachen, Germany 7Department of Internal Medicine, Nephrology and Transplantation, Erasmus Medical Center, Rotterdam, The Netherlands 8Genome Analytics Research Group, Helmholtz Centre for Infection Research, Braunschweig, Germany 9Department of Discovery Oncology, Genentech, Inc., South San Francisco, California 10Institute of Clinical Chemistry and Pathobiochemistry, Otto-von-Guericke University Magdeburg, Magdeburg, Germany 11Department of Hematology and Oncology, Otto-von-Guericke University Magdeburg, Magdeburg, Germany 12Department of Internal Medicine II, Hematology and Oncology, Friedrich Schiller University Medical Center, Jena, Germany 13Leibniz Institute on Aging, Fritz Lipmann Institute, Jena, Germany

20 JASN JASN 31: ccc–ccc,2020 Supplementary material

Supplementary Figure 1: Complete blood counts with immune cell composition as well as kidney function in Notch3 knockout and wild type mice.

Supplementary Figure 2: Flow cytometry on bone marrow chimerism from transplanted mice.

Supplementary Figure 3: Confirmation of successful homing, reconstitution, as well as chimerism in bone marrow transplanted mice.

Supplementary Figure 4: Analysis of polarization efficiency, cell proliferation, IL-6 receptor and integrin expression of wild type and Notch3 knockout bone marrow- derived macrophages.

Supplementary Figure 5: Sirius Red staining performed with obstructed kidneys on days 14.

Supplementary Figure 6: Flow cytometric analysis of kidney infiltrating immune cells.

Supplementary Figure 7: Gene array analysis on IL-6 transcript numbers.

Supplementary Table 1: Whole blood counts of wild type, Notch3 knockout and chimeric animals.

Supplementary Figure 1. Complete blood counts with immune cell composition as well as kidney function in Notch3 knockout and wild type mice. No differences between wild type and Notch3 knockout animals were seen in (A) complete blood counts of circulating leukocytes, (B) cellular composition of the bone marrow, (C) kidney morphology (PAS staining, scale bars equal 50 µm) and (D) kidney function (blood urea nitrogen (BUN), serum creatinine).

Supplementary Figure 2: Flow cytometry on bone marrow chimerism from transplanted mice. (A) CD45.1/CD45.2 chimeras were generated by lethally irradiating the recipient mice and transplanting bone marrow cells from the donor mice as indicated. (B) Kaplan-Meier survival curves revealed no difference in lethality of the mice due to the transplantation procedure. (C-E) Flow cytometric analysis of CD45.1 and CD45.2 expression of isolated cells from spleen (C), bone marrow (D), and blood (E) reveal a level of chimerism that exceeds 80%.

Supplementary Figure 3: Confirmation of successful homing, reconstitution, as well as chimerism in bone marrow transplanted mice. (A) BM transplantation was carried out with 8 weeks old mice by i.v. injection of 1x106 bone marrow-derived cells 4 hours after irradiation. To investigate the contribution of Notch3 expression on bone marrow-derived cells and tissue resident cells UUO was performed 4 weeks following transplantation. Kidneys were analyzed on days 5 and 14 following disease induction. (B) The percent survival of the chimeric animals is shown for each of the four strains. A 10% mortality rate is seen in all strains, likely due to complications within the transplantation procedure. (C) Weight analysis of the mice reveals no difference, irrespective of the transplantation procedure. (D) To determine complete depletion of bone marrow cells by irradiation the number of circulating leukocytes 72 hours post intervention was analyzed and Pappenheim staining of the irradiated bone marrow was performed without bone marrow transfer. 72 hours post irradiation the number of circulating leukocytes was less than 0.1x109/L without bone marrow transfer. Following injection of 1x106 bone marrow cells the pool of circulating leukocytes reached values within “normal” range 6 weeks later. The receptor Notch3 knockout in bone marrow cells did not affect erythropoiesis. Pappenheim staining of bone marrow isolated cells was used to exclude phenotypic differences between the groups. (E) Successful homing of the transferred wild type and Notch3 knockout cells to the bone marrow and lymph nodes was seen within 16 hours post transplantation. We analyzed the repopulation of the bone marrow and the lymph nodes by injected bone marrow-derived DID labeled cells into irradiated wild type mice and receptor Notch3-/- mice. The cells were detected 16 hours after transplantation in the organ systems bone marrow and lymph nodes by flow cytometry. As a significant difference, p <0.05 was considered. (n=4). (F) Chimerism was confirmed by PCR of isolated bone marrow cells and isolated cells of the tail tip (representing the genotype of the non-transplanted cells of the recipients) using the primers described for genotyping. Sensitivity of the PCR was determined by sequential dilution of stock solutions. (G) In the chimera an analysis of transcripts for Notch1, Notch2 and Notch4 was performed by means of gene array (Agilent 4x44k mouse v2 design ID:026655). (H) Following UUO no differences in the transcript numbers for Notch1 and Notch2 were observed. However, the Notch4 receptor seemed to be differently regulated in knockout recipients compare to wild type. (I) Kidney function of bone- marrow chimeric mice was assessed by quantifying blood urea nitrogen (BUN) and serum creatinine levels. Animals that received folic acid had strongly impaired renal function and served as positive control.

Supplementary Figure 4: Analysis of polarization efficiency, cell proliferation, IL-6 receptor and integrin expression of wild type and Notch3 knockout bone marrow-derived macrophages. Bone marrow from wild type or Notch3 knockout mice was isolated and cultured in media supplemented with 10ng/ml M-CSF alone or together with IL-6 or IL-4 and IL-13. (A) Bone marrow-derived macrophages were stimulated with IL-6 for 2 or 30 min in the presence or absence of the IL-6 blocking antibody. Cellular lysates were prepared and analyzed for the tyrosine- phosphorylated (p)STAT3. Notch3 knockout macrophages were less responsive to IL-6 compared to wild type macrophages. (B) IL-6-receptor expression on wild type and Notch3 knockout bone marrow-derived macrophages was analyzed by flow cytometry. IL-6-receptor expression differed between non-polarized (M0), IL-6- polarized (M1), and IL4/IL13-polarized (M2) cells, but no difference in IL6-receptor expression was found between wild type and knockout cells for any given population. (C) Expression of β1-integrin (CD29) and (D) β2-integrin (CD18) was analyzed. The histogram shows the mean fluorescence intensity (MFI) of the CD29 and CD18 expression in wild type and Notch3 knockout bone marrow-derived macrophages. (E) Phenotypical analysis of macrophages from wild-type and knockout cultures before and after polarization using F4/80 and CD11b revealed that almost all cells are macrophages. (F) Bone marrow cells were cultured for 14 days and cell numbers quantified on days 2, 5, 11, and 14. (n=3). (G) Cell cycle analysis was performed using propidium iodide staining of fixed cells at day 9. The proportion of cells in G1, S, and G2/M is indicated in the inset Table (n=3). (H) Analysis of arginase 1 (Arg1) expression by Western blot confirms successful IL-4/IL-13-polarization for both wild type and Notch3 knockout macrophages (n=3).

Supplementary Figure 5: Sirius Red staining performed with obstructed kidneys on days 14. Sirius red staining for collagen deposits showed an increase of collagen deposition in Notch3wt>wt or Notch3ko>wt mice. Representative Sirius red stainings of obstructed kidneys on day 14 from chimeric mice are shown. A polarization filter allowed to distinguish collagen 1 (red) and 3 (green). Scale bar equals 50 μm.

Supplementary Figure 6: Flow cytometric analysis of kidney infiltrating immune cells. (A) Gating strategy for flow cytometric analysis of infiltrating immune cells. Renal lymphocytes were defined by doublet exclusion of live cells (using the forward and side scatter properties) followed by gating for CD45+ leukocytes. The different subsets were gated out of the CD45+ population using the markers CD45+/CD11b+ for myeloid cells; CD45+/CD11b+/GR1-/F4/80+ for macrophages; CD45+/CD11bint/GR1+ for monocytes; CD45+/CD11b+/GR1+ for neutrophils; and CD45+/CD3+ for T cells. (B) CD11c cells were described as CD11b+ and Ly6G-. The number of CD11c+ cells within kidney appeared to be independent of Notch3 expression.

Supplementary Figure 7: Gene array analysis on IL-6 transcript numbers. Gene transcript analysis of healthy contralateral wild type and Notch3 knockout kidneys was compared to obstructed kidneys following UUO. IL-6 transcripts were more abundant following UUO, but there was no significant difference between wild type and Notch3 knockout genetic background.

Supplementary Table 1: Whole blood analysis of wild type, Notch3 knockout, and chimeric mice. All analyzed blood samples were within normal limits for mice. without intervention [± SD] 6 weeks following bone transfer, chimeric mice [± SD] parameter normal range wild type Notch3 wt>wt ko>ko ko>wt wt>ko Notch3 Notch3 Notch3 Notch3 [unit] knockout leukocyte 1.8 – 10.7 3.00 ± 1.02 3.24 ± 1.17 5.32 ± 1.63 5.36 ± 1.99 5.68 ± 1.94 6.39 ± 2.56 [10e9/L] erythrocyte 6.36 – 9.42 9.14 ± 1.14 9.07 ± 0.90 8.16 ± 1.31 8.30 ± 0.95 8.33 ± 1.05 9.12 ± 0.95 [10e12/L] hemoglobin 5 – 8 8.27 ± 0.89 8.22 ± 1.01 6.84 ± 1.27 7.00 ± 1.05 6.94 ± 0.91 6.83 ± 1.19 [mmol/L) thrombocytes 592 – 2972 673 ± 237 719 ± 136 1036 ± 451 954 ± 197 953 ± 296 985 ± 367 [10e9/L]