(12) Patent Application Publication (10) Pub. N0.: US 2014/0348893 A1 KALETTA (43) Pub

Total Page:16

File Type:pdf, Size:1020Kb

(12) Patent Application Publication (10) Pub. N0.: US 2014/0348893 A1 KALETTA (43) Pub US 20140348893A1 (19) United States (12) Patent Application Publication (10) Pub. N0.: US 2014/0348893 A1 KALETTA (43) Pub. Date: NOV. 27, 2014 (54) RNAI FOR THE CONTROL OF INSECTS AND A01N57/16 (2006.01) ARACHNIDS C12P 19/34 (2006.01) (52) US. Cl. (71) Applicant Devgen NV, Ghent-Zwijnaarde (BE) CPC ............ .. C12N15/113 (2013.01); A01N 57/16 _ _ (2013.01); C12P 19/34 (2013.01);A01N25/34 (73) Assignee:Inventor: DEVGENTltllS Jan NV, Ghent-ZWijnaardeNieder-Olm (BE) (201301) CNN 2310/1421 USPC 424/417; 536/245; 435/320.1; 435/252.3; (21) Appl' NO" 14/287’614 514/44 A; 435/913; 424/84; 424/93.2; 43/121 (22) Filed: May 27, 2014 (57) ABSTRACT Related US. Application Data _ _ _ _ _ The present invention describes a neW non-compound based (62) DWISIOn Of apphcanon NO' 11/921,370, ?led 911 Q“ approach for insect and/or arachnid control. The present 1’ 2009’ HOW Pat' NO' 83759306, ?led as apphcanon inventors have identi?ed for the ?rst time novel targets for NO' PCT/ 1132006/ 002360 on May 31’ 2006' RNAi, Which can effectively control insect and/or arachnid (60) Provisional application No. 60/685,765, ?led on May P€St POPUIations- Accordingly, the invention PTOVid?S bOth 31, 2005 nucleotide and amino acid sequences for the novel targets. Also provided are RNA constructs including double stranded Publication Classi?cation RNA regions for mediating RNAi in insects, DNA constructs, expression vectors, host cells and compositions for control (51) Int. Cl. ling insects and/ or arachnids using RNAi. Finally, the inven C12N 15/113 (2006.01) tion also provides for the use of the constructs, vectors, host A01M 1/20 (2006.01) cells and compositions in control of insects and/or arachnids A01N 25/34 (2006.01) populations and suitable kits for use in an RNAi based A01M 1/10 (2006.01) method of controlling insect and/ or arachnid pests. Patent Application Publication Nov. 27, 2014 Sheet 1 0f 13 US 2014/0348893 A1 Effect of 1% dsRNA on cockroach mortality 100— —&— 59033 80_ + 89001 + Bg003 60- + 89004 Mortality(%) —I—— 89005 40— —l— lmidacloprid 20_ —9— Solvent 0 I l I I l I I I I 0 5 10 15 20 25 30 3 4O 4 Days 120 100 : : : . I 80 /1/] it> Mortality(%) 60 0 3 610131720242731343841454852 Days + BgOO1 + 89001 concatemer2 —-l— Hexaflumuron FIG. 2 —6— Solvent Patent Application Publication Nov. 27, 2014 Sheet 2 0f 13 US 2014/0348893 A1 Month1 Month2 23 a? 89032 in LB 89032 in MO FIG. 3 100 90 80 7O 60 Mortality(%) 50 40 3O 20 1O 0 O 3 610131720242731343841 Days + 59001 —+— -ve control (miscellaneous dsRNA) -9- -ve control (solvent) FIG. 4 Patent Application Publication Nov. 27, 2014 Sheet 3 0f 13 US 2014/0348893 A1 SEQ ID NO 1; DNA; Blattella germanica taaggcatggatgttggacaagctcggtggagtgtatgctccaagaccaagcacaggacctcacaagttacgagagagtctgc cccttgtaatatttcttcgtaataggctgaaatatgcattaaccaactgtgaggttaagaaaattgttatgcagcgccttattaaggttg atggaaaagtcagaacagaccccaactatccagctggttttatggatgttgttacaattgaaaaaactggagaatttttccgtctgat ttatgacgtgaaaggacgtttcaccattcacagaataactgctgaagaagccaagtataaactgtgcaaggtaaagagagtgca gactgggcccaagggtattccattcttggtgacccatgatggtagaactcttagatatcctgatcctgtcatcaaagttaatgataca gttcaacttgacatcgctacttccaagattatggatagcatcaaatttgataatggtaatctctgtatgattactggaggccgtaacttg ggtcgtgttggaactgtagttaatcgagaacgtcatcctggttcctttgacattgtgcatgttaaagattcacaaggacacacatttgc taccagattgaa SEQ ID NO 2; PRT; Blattella germanica Lys Ala Trp Met Leu Asp Lys Leu Gly Gly Val Tyr Ala Pro Arg Pro Ser Thr Gly Pro His Lys Leu Arg Glu Ser Leu Pro Leu Val lle Phe Leu Arg Asn Arg Leu Lys Tyr Ala Leu Thr Asn Cys Glu Val Lys Lys lle Val Met Gln Arg Leu lle Lys Val Asp Gly Lys Val Arg Thr Asp Pro Asn Tyr Pro Ala Gly Phe Met Asp Val Val Thr lle Glu Lys Thr Gly Glu Phe Phe Arg Leu lle Tyr Asp Val Lys Gly Arg Phe Thr lle His Arg lle Thr Ala Glu Glu Ala Lys Tyr Lys Leu Cys Lys Val Lys Arg Val Gln Thr Gly Pro Lys Gly lle Pro Phe Leu Val Thr His Asp Gly Arg Thr Leu Arg Tyr Pro Asp Pro Val lle Lys Val Asn Asp Thr Val Gln Leu Asp lle Ala Thr Ser Lys lle Met Asp Ser lle Lys Phe Asp Asn Gly Asn Leu Cys Met lle Thr Gly Gly Arg Asn Leu Gly Arg Val Gly Thr Val Val Asn Arg Glu Arg His Pro Gly Ser Phe Asp lle Val His Val Lys Asp Ser Gln Gly His Thr Phe Ala Thr Arg Leu Asn SEQ ID NO 3; DNA; Blattella germanica; degenerate primer; w is a or t; r is a or g; m is a or c; y is c ort catttgaagc gtttwrmygc ycc SEQ ID NO 4; DNA; Blattella germanica; speci?c primer gtgcccttgc caatgatgaa cacgttg SEQ 10 NO 5; DNA; speci?c T7 primer cgctaatacg actcactata ggggagtgta tgctccaaga ccaag SEQ ID NO 6; DNA; Blattella germanica; speci?c primer caatctggta gcaaatgtgt gtcc SEQ ID NO 7; DNA; Blattella germanica; speci?c primer ggagtgtatg ctccaagacc aag SEQ ID NO 8; DNA; synthetic T7 primer cgctaatacg actcactata ggcaatctgg tagcaaatgt gtgtcc SEQ ID NO 9; RNA; Blattella germanica; u can be t (for DNA complement) ggaguguaug cuccaagacc aagcacagga ccucacaagu uacgagagag ucugccccuu FIG. 5 Patent Application Publication Nov. 27, 2014 Sheet 7 0f 13 US 2014/0348893 A1 SEQ ID NO 31; DNA; Blattella gemianica; ggcttgatcccaatgaaataaacgaaatlgcaaataccaattccagacaaaatattcgtaaactgattaaagatggtcttatcatc aagaagcccgtagctgtacactcaagggcccgtgttcgcaagaacaccgaagcaagaagaaaaggacgtcactgcggttttg gcaaaaggaagggtacggcaaatgcccgtatgccacagaaggtcttgtggattaatcgcatgcgtgttctgagaaggcttctca agaagtacagggaagcaaagaagatcgacagacatctataccaccagctglacatgaaggccaagggtaacgtgttcaaga acaagcgtglcctgatggagtlcatccacaagaagaaggctgagaaggccaggacaaagatgcttaacgac SEQ ID NO 32; PRT; BIatleIIa germanica; Leu Asp Pro Asn Glu IIe Asn Glu IIe Ala Asn ThrAsn Ser Arg Gln Asn Ile Arg Lys Leu Ile Lys Asp Gly Leu He He Lys Lys Pro Val Ala Val His Ser Arg Ala Arg Val Arg Lys Asn Thr Glu Ala Arg Arg Lys Gly Arg His Cys Gly Phe Gly Lys Arg Lys Gly Thr Ala Asn Ala Arg Met Pro Gln Lys Val Leu Trp Ile Asn Arg Mat Arg Val Leu Arg Arg Leu Leu Lys Lys Tyr Arg Glu Ala Lys Lys Ile Asp Arg His Leu Tyr His Gln Leu Tyr Met Lys Ala Lys Gly Asn Val Phe Lys Asn Lys Arg Val Leu Met Glu Phe IIe His Lys Lys Lys Ala Glu Lys Ala Arg Thr Lys Met Leu Asn Asp SEQ ID NO 33; DNA; Blatlella germanica; degenerative primer forward; r is a org; b is c org ort tgcgatgcgg caaraaraag gtbtgg SEQ ID NO 34; DNA; Blattella germanica; degenerative primer reverse; y is c or I; r is a or g gtcggcgagc ytcrgcytg SEQ ID NO 35; DNA; speci?c T7 primer fonlvard cgctaalacg actcactata ggggcttgat cccaatgaaa taaacg SEQ ID NO 36; DNA; Blattella germanica; speci?c primer reverse gtcgttaagc atctltgtcc tggc SEQ ID NO 37; DNA; Blattella germanica; speci?c primer forward ggcttgatcc caatgaaata aacg SEQ ID NO 38; DNA; speci?c T7 primer reverse cgctaatacg actcactata gggtcgttaa gcalctltgt cctggc SEQ ID NO 39; RNA; Blattella germanica; u can be t (for DNA complement) ggcuugaucc caaugaaaua aacgaaauug caaauaccaa uuccagacaa aauauucgua aacugauuaa agauggucuu aucaucaaga agcccguagc uguacacuca agggcccgug FIG. 5CONT’D Patent Application Publication Nov. 27, 2014 Sheet 13 0f 13 US 2014/0348893 A1 SEQ ID NO 66; DNA; synthetic BgOO1 fragment cttgggtcgtgttggaactgtagttaatcgagaacgtcatcctggttcct SEQ ID NO 67; DNA; synthetic BgOO1 concatemer 1 tatgctccaagaccaagcacaggacctcacaagttacgagagagtctgcctatgctccaagaccaagcacaggacctcacaa gttacgagagagtctgcctatgctccaagaccaagcacaggacctcacaagttacgagagagtctgcctatgctccaagacca agcacaggacctcacaagttacgagagagtctgcctatgctccaagaccaagcacaggacctcacaagttacgagagagtct gcc SEQ ID NO 68; DNA; synthetic BgOO1 concatemer 2 cttgggtcgtgttggaactgtagttaatcgagaacgtcatcctggttcctcttgggtcgtgttggaactgtagttaatcgagaacgtcat cctggttcctcttgggtcgtgttggaactgtagttaatcgagaacgtcatcctggttcctcttgggtcgtgttggaactgtagttaatcga gaacgtcatcctggttcctcttgggtcgtgttggaactgtagttaatcgagaacgtcatcctggttcct SEQ ID NO 69; DNA; synthetic BgOO1 fragment gctgaaatatgcattaaccaactgtgaggttaagaaaattgttatgcagcgccttattaaggttgatggaaaagtcagaacagacc ccaactatccagct SEQ ID NO 70; DNA; synthetic BgOO1 concatemer 3 gctgaaatatgcattaaccaactgtgaggttaagaaaattgttatgcagcgccttattaaggttgatggaaaagtcagaacagacc ccaactatccagctgctgaaatatgcattaaccaactgtgaggttaagaaaattgttatgcagcgccttattaaggttgatggaaaa gtcagaacagaccccaactatccagctgctgaaatatgcattaaccaactgtgaggttaagaaaattgttatgcagcgccttatta aggttgatggaaaagtcagaacagaccccaactatccagct FIG. 5CONT'D US 2014/0348893 A1 Nov. 27, 2014 RNAI FOR THE CONTROL OF INSECTS AND less toxic insecticides, there is an increased probability that ARACHNIDS the insect may become resistant over time. Insecticides act by binding to a certain insect protein, such as RELATED APPLICATION INFORMATION an acethylcholine receptor for example, and cause death of [0001] This is a divisional application ofU.S. patent appli the pest species by either deactivating or over-activating the cation Ser. No. 11/921,370 ?led on Oct. 1, 2009, which is a protein. Insecticides have been developed to be safe at certain 371 of International Application No. PCT/IB2006/002360, concentration, but can and do impact on human health when ?led May 31, 2006, which claims bene?t to US. Provisional incorporated at higher dosages or over long periods. In con Application No. 60/685,765, ?led May 31, 2005, the contents trary to agrochemicals, household insecticides are applied in of which are incorporated herein by reference herein. places where food is stored or prepared and food contamina tion and contact to humans cannot be avoided. STATEMENT REGARDING ELECTRONIC [0008] One alternative to chemical pesticides is to utilise SUBMISSION OF A SEQUENCE LISTING biological agents. Over the last few years, downregulation of genes (also referred to as “gene silencing”) in multicellular [0002] A Sequence Listing in ASCII text format, submitted organisms by means of RNA interference or “RNAi” has under 37 CPR. §1.821, entitled 803 84-US-REG-ORG-P-1_
Recommended publications
  • Effects of House and Landscape Characteristics on the Abundance and Diversity of Perimeter Pests Principal Investigators: Arthur G
    Project Final Report presented to: The Pest Management Foundation Board of Trustees Project Title: Effects of house and landscape characteristics on the abundance and diversity of perimeter pests Principal Investigators: Arthur G. Appel and Xing Ping Hu, Department of Entomology and Plant Pathology, Auburn University Date: June 17, 2019 Executive Summary: The overall goal of this project was to expand and refine our statistical model that estimates Smokybrown cockroach abundance from house and landscape characteristics to include additional species of cockroaches, several species of ants as well as subterranean termites. The model will correlate pest abundance and diversity with house and landscape characteristics. These results could ultimately be used to better treat and prevent perimeter pest infestations. Since the beginning of the period of performance (August 1, 2017), we have hired two new Master’s students, Patrick Thompson and Gökhan Benk, to assist with the project. Both students will obtain degrees in entomology with a specialization in urban entomology with anticipated graduation dates of summer-fall 2019. We have developed and tested several traps designs for rapidly collecting sweet and protein feeding ants, purchased and modified traps for use during a year of trapping, and have identified species of ants, cockroaches, and termites found around homes in Auburn Alabama. House and landscape characteristics have been measured at 62 single-family homes or independent duplexes. These homes range in age from 7 to 61 years and include the most common different types of siding (brick, metal, stone, vinyl, wood), different numbers/types of yard objects (none to >15, including outbuildings, retaining walls, large ornamental rocks, old trees, compost piles, etc.), and different colors.
    [Show full text]
  • C Cockroach Biology and Management
    E-359 5/12 Cockroach Biology and Management Wizzie Brown, Michael Merchant, and Roger E. Gold* ockroaches are among the most common American, oriental, and smokybrown cockroaches insect pests in homes, schools, and busi- live mostly outdoors but may move indoors in C nesses. They like to eat many of the same search of food or water. Cockroaches also infest foods we do and are especially troublesome wher- homes when brought in with groceries or boxes, ever food is prepared or served. They also may and, once established, can readily move within transfer disease-causing organisms. structures such as from apartment to apartment. Fortunately, cockroaches can be controlled American cockroaches, also known as water- with a little knowledge about their biology and bugs or palmetto bugs, are more common in com- behavior, attention to sanitation, and effective use mercial buildings and are one of the most common of commercially available insecticides. cockroaches in sewer systems. The largest cock- roach in Texas, it can grow 1½ to 2 inches long. Identifying cockroaches Both the adult male and the female can fly. Adults are reddish brown (Fig. 1a), with tan to Cockroaches have flattened bodies and heads light-yellow bands outlining the pronotum. Young that, when viewed from above, are concealed by a nymphs are grayish brown, but after the first few plate-like structure called a pronotum. They move molts, they become more reddish brown (Fig. 1b). surprisingly fast with their elongated, spiny legs. Their long, thin antennae help them find food and feel their way in the dark (which is when they are a b most active).
    [Show full text]
  • THE ECOLOGY and MANAGEMENT of the ORIENTAL COCKROACH Blatta Orientalis
    THE ECOLOGY AND MANAGEMENT OF THE ORIENTAL COCKROACH Blatta orientalis l. (ORTHOPTERA: BLATTIDAE) IN THE URBAN ENVIRONMENT by Ellen Mary Thoms Dissertation submitted, to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of DOCTOR OF PH I LOSO PHY in Entomology APPROVED: W.H Robinson, Chairman J.B. Ballard R.M. Andrews J. L. Eaton D. E. Mullins May, 1986 Blacksburg, Virginia THE ECOLOGY AND MANAGEMENT OF THE ORIENTAL COCKROACH Blatta orientalis L. (ORTHOPTERA: BLATTIDAE) IN THE URBAN ENVIRONMENT by Ellen Mary Thoms Committee Chairman: William H Robinson Entomology (ABSTRACT) The oriental cockroach, Blatta orientalis L., was found to be an important seasonal household pest. Of 151 residents interviewed in two Roanoke apartment complexes in Virginia, 90% had seen oriental cockroaches, 60% considered one oriental cockroach indoors to be a problem, and 77% had taken steps to control these cockroaches. Monitoring oriental cockroach populations indicated when and where treatment would be necessary to reduce cockroach infestations. The adult cockroach population peaked in late June and July, and declined through August and September while the number of nymphs increased. Eighty percent of all cockroaches trapped at Roanoke apartment buildings were caught at porches, the primary cockroach harborage sites. In a mark-recapture study at four apartment buildings, 50% of the resighted oriental cockroaches remained at one porch, 36% moved alc:>ng one side of a building, 13% moved between the front and back of a building, and 2% moved between two buildings. Only 1-5% of the oriental cockroaches marked outdoors were ever captured indoors.
    [Show full text]
  • Cockroach Control Protocol
    Cockroach Control Protocol Understanding Cockroach Habits and Life Cycle • Cockroaches undergo gradual metamorphosis, passing EGG through three life stages – egg, nymph and adult. ADULT • Nymphs are similar in appearance to adults, but smaller. • As the nymph matures, it sheds its exoskeleton to grow. Freshly molted cockroaches are white, assuming their typical coloration within a few hours as their LIFE CYCLE OF cuticle hardens. THE GERMAN COCKROACH* NYMPH • Each nymphal stage* is larger than the previous one NYMPH and the adult emerges after the last nymphal stage. • The life cycle from egg to adult is dependent upon environmental conditions and the specific cockroach species. Each cockroach species has a unique number of immature stages. • In general, cockroaches need four things to successfully live in an environment: water, food, shelter and warmth. NYMPH Different cockroaches have slightly different requirements, which will be helpful in knowing where to inspect and focus control efforts. *German cockroaches have several nymphal stages (6-7 molts) before becoming adults. Number of molts varies by species. Common Species Inspection • American cockroach, Periplaneta Americana • Locate all harborage sites. Focus on areas where the following conditions exist: high humidity/free water, • Brownbanded cockroach, Supella longipalpa darkness and limited air movement. Look under sinks, refrigerators, dishwashers and stoves, around toilets, near • Smokybrown cockroach, Periplaneta fuliginosa trash containers and inside cabinets and storage areas. See common harborage sites on page 5. • German cockroach, Blattella germanica • Check behind objects attached to walls such as pictures, • Oriental cockroach, Blatta orientalis paintings, smoke detectors and posters. See identifying characteristics on page 3. • Do not restrict inspection to just well-known areas such as kitchens and bathrooms.
    [Show full text]
  • Cockroach IPM in Schools Janet Hurley, ACE Extension Program Specialist III What Are Cockroaches?
    Cockroach IPM in schools Janet Hurley, ACE Extension Program Specialist III What are cockroaches? • Insects in the Order Blattodea • gradual metamorphosis • flattened bodies • long antennae • shield-like pronotum covers head • spiny legs • Over 3500 species worldwide • 5 to 8 commensal pest species Medical Importance of Cockroaches • Vectors of disease pathogens • Food poisoning • Wound infection • Respiratory infection • Dysentery • Allergens • a leading asthma trigger among inner city youth Health issues • Carriers of disease pathogens • Mycobacteria, Staphylococcus, Enterobacter, Klebsiella, Citrobacter, Providencia, Pseudomonas, Acinetobacter, Flavobacter • Key focus of health inspectors looking for potential contaminants and filth in food handling areas Cockroaches • No school is immune • Shipments are • Visitors Everywhere • Students Cockroach allergies • 37% of inner-city children allergic to cockroaches (National Cooperative Inner-City Asthma Study) • Increased incidence of asthma, missed school, hospitalization • perennial allergic rhinitis Not all cockroaches are created equal Four major species of cockroaches • German cockroach • American cockroach • Oriental cockroach • Smoky brown cockroach • Others • Turkestan cockroach • brown-banded cockroach • woods cockroach German cockroach, Blatella germanica German cockroach life cycle German cockroach • ½ to 5/8” long (13-16 mm) • High reproductive rate • 30-40 eggs/ootheca • 2 months from egg to adult • Do not fly • Found indoors in warm, moist areas in kitchens and bathrooms German
    [Show full text]
  • Chapter 1: Global Spread of the German Cockroach
    ORIGIN AND SPREAD OF THE GERMAN COCKROACH, BLATTELLA GERMANICA TANG QIAN (B.Sc. (Hons), Wuhan University, China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2015 Declaration Declaration I hereby declare that this thesis is my original work and it has been written by me in its entirety. I have duly acknowledged all the sources of information which have been used in the thesis. This thesis has also not been submitted for any degree in any university previously. Tang Qian 31 Dec 2015 i Acknowledgement Acknowledgement My Ph.D. was supported by the NUS Research Scholarship from the Singapore Ministry of Education. The research project was funded by the Lee Hiok Kwee Endowed Fund of the Department of Biological Sciences, the National University of Singapore to Associate Professor Theodore Evans. I would like to thank the Singapore Ministry of Education and the National University of Singapore for providing me such opportunity to enter the academic world. This thesis could not be finished without the effort of my supervisors: Associate Professor Theodore Evans and Assistant Professor Frank Rheindt. Associate Prof. Evans initiated this ambitious research project with confidence and insights. Assistant Prof. Rheindt supported this project with professional advice and knowledge in the field of population genetics. This project requires much effort to collect samples. Associate Prof. Evans and Assistant Prof. Rheindt always offered me their advice and time. There are many people involved in my Ph.D. project, so I would like to cite their contribution by chapter: For chapter one, I would like to thank those who spent days in museums retrieving German cockroach specimens for my review.
    [Show full text]
  • Cockroaches and Their Management1 P
    ENY-214 Cockroaches and Their Management1 P. G. Koehler, B. E. Bayer, and D. Branscome2 or dying plants and animals. However, they are considered pests when they interact with people, invading lawns and gardens or entering homes and other structures. More importantly, they can affect human health by spreading diseases, such as Salmonella, and ruin materials such as books, clothes and food. Cockroaches secrete an oily liquid that has an offensive and sickening odor. This odor may also be imparted to dishes that are apparently clean, food and clothes. Excrement in the form of pellets or an inklike liquid also contributes to this nauseating odor. Additionally, cockroaches produce allergens, which include their feces, shed skins, and body parts such as antennae and legs. In susceptible individuals, contact with these allergens can result in mild to severe rashes, other allergic reactions, and in extreme cases death from asthma attacks. Cockroach Species This fact sheet is excerpted from SP486: Pests in and around the Southern Home, which is available from the UF/IFAS Extension The cockroaches most commonly found in and around Bookstore. http://ifasbooks.ifas.ufl.edu/p-1222-pests-in-and-around- Florida homes are the Florida woods roach (Figure 1), the-southern-home.aspx American (Figure 2), smokybrown (Figure 3), brown (Figure 4), Australian (Figure 5), German (Figure 6) and Cockroaches have various common names including water Asian (Figure 7). The smallest cockroaches—the German, bugs, croton bugs and palmetto bugs. There are at least Asian and brownbanded (Figure 8)—are close to the same 69 different cockroach species found in the United States.
    [Show full text]
  • (Blattella Asahinai Mizukubo) in the Urban Environment
    Evaluations of Integrated Pest Management control techniques of the Asian cockroach (Blattella asahinai Mizukubo) in the Urban Environment by Edward Todd Snoddy A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy in Entomology Auburn, Alabama May 6, 2012 Keywords: Invasive species, peridomestic pest, mulch preference Copyright 2012 by Edward Todd Snoddy Approved by Arthur G. Appel, Chair, Professor of Entomology Xing Ping Hu, Professor of Entomology Jack W. Feminella, Professor of Biological Sciences Jeffrey L. Sibley, Barbara and Charles Bohman Professor of Horticulture Abstract The objective of this research was to evaluate components of an Integrated Pest Management (IPM) program for the Asian cockroach, Blattella asahinai Mizukubo. IPM programs are more effective in control of cockroaches than insecticides alone. IPM programs are usually the most environmentally friendly because they drastically reduce the amount of pesticide residue. The toxicity of seven consumer gel and paste insecticide baits was evaluated against Asian cockroaches in continuous exposure tests with and without competitive food. Bait toxicity and consumption varied with the gel and paste bait and with and without a competitive food source. Advion® was the most toxic insecticidal bait, however, and the LT50 value decreased in the presence of competitive food. The toxicity of nine consumer granular insecticide baits was evaluated against Asian cockroaches in continuous exposure tests with and without competitive food. Toxicity and consumption varied among the granular baits and with the presence of competitive food. Most baits had greater LT50 values when the cockroaches were presented competitive food.
    [Show full text]
  • Susceptibility of Different Life Stages of Blattella Germanica (Blattodea: Blattellidae) and Periplaneta Fuliginosa (Blattodea: Blattidae) to Entomopathogenic Fungi
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CONICET Digital Int.J.Curr.Microbiol.App.Sci (2014) 3(12): 614-621 ISSN: 2319-7706 Volume 3 Number 12 (2014) pp. 614-621 http://www.ijcmas.com Original Research Article Susceptibility of different life stages of Blattella germanica (Blattodea: Blattellidae) and Periplaneta fuliginosa (Blattodea: Blattidae) to entomopathogenic fungi Gutierrez Alejandra C.1,3*, García Juan José1,3, Alzogaray Raúl A.2, Urrutia Maria I.4 and López Lastra Claudia C.1 1Centro de Estudios Parasitológicos y de Vectores (CONICET Consejo Nacional de Investigaciones Científicas UNLP Universidad Nacional de La Plata), Avenida 120 s/n e/61 y 62, CP 1900, La Plata, Buenos Aires, Argentina 2Centro de Investigaciones de Plagas e Insecticidas (CIPEIN-UNIDEF/CONICET), Juan Bautista de La Salle 4397, B1603ALO Buenos Aires, Argentina. Universidad Nacional de San Martín, Instituto de Investigación e Ingeniería Ambiental, San Martín, Buenos Aires, Argentina. 3Comisión de Investigaciónes Científicas Calle 526 entre 10 y 11 CP: 1900 La Plata - Buenos Aires Argentina 4CeSPI Centro Superior para el Procesamiento de la Información- UNLP, Universidad Nacional de La Plata *Corresponding author A B S T R A C T The susceptibility of nymphs and adults of the German cockroach, Blattella germanica Linnaeus (Blattodea: Blattellidae) and the smokybrown cockroach, Periplaneta fuliginosa Serville (Blattodea: Blattidae) to Argentinian isolates of the entomopathogenic fungi Metarhizium anisopliae (Metschn.) Sorokin (CEP 085) and Beauveria bassiana (Bals.-Criv.) Vuill. (CEP K e y w o r d s 077) was evaluated. Fungi were tested by using two different methods: bait and direct contact.
    [Show full text]
  • And Periplaneta Fuliginosa (Blattodea: Blattidae) to Entomopathogenic Fungi
    Int.J.Curr.Microbiol.App.Sci (2014) 3(12): 614-621 ISSN: 2319-7706 Volume 3 Number 12 (2014) pp. 614-621 http://www.ijcmas.com Original Research Article Susceptibility of different life stages of Blattella germanica (Blattodea: Blattellidae) and Periplaneta fuliginosa (Blattodea: Blattidae) to entomopathogenic fungi Gutierrez Alejandra C.1,3*, García Juan José1,3, Alzogaray Raúl A.2, Urrutia Maria I.4 and López Lastra Claudia C.1 1Centro de Estudios Parasitológicos y de Vectores (CONICET Consejo Nacional de Investigaciones Científicas UNLP Universidad Nacional de La Plata), Avenida 120 s/n e/61 y 62, CP 1900, La Plata, Buenos Aires, Argentina 2Centro de Investigaciones de Plagas e Insecticidas (CIPEIN-UNIDEF/CONICET), Juan Bautista de La Salle 4397, B1603ALO Buenos Aires, Argentina. Universidad Nacional de San Martín, Instituto de Investigación e Ingeniería Ambiental, San Martín, Buenos Aires, Argentina. 3Comisión de Investigaciónes Científicas Calle 526 entre 10 y 11 CP: 1900 La Plata - Buenos Aires Argentina 4CeSPI Centro Superior para el Procesamiento de la Información- UNLP, Universidad Nacional de La Plata *Corresponding author A B S T R A C T The susceptibility of nymphs and adults of the German cockroach, Blattella germanica Linnaeus (Blattodea: Blattellidae) and the smokybrown cockroach, Periplaneta fuliginosa Serville (Blattodea: Blattidae) to Argentinian isolates of the entomopathogenic fungi Metarhizium anisopliae (Metschn.) Sorokin (CEP 085) and Beauveria bassiana (Bals.-Criv.) Vuill. (CEP K e y w o r d s 077) was evaluated. Fungi were tested by using two different methods: bait and direct contact. Mortality was monitored daily for twenty days to obtain LT50. M.
    [Show full text]
  • Controlling Cockroaches Without Synthetic Organic Insecticides
    L-1373 CONTROLLING COCKROACHES WITHOUT SYNTHETIC ORGANIC INSECTICIDES G. L. Piper, R. R. Fleet, G. W. Frankie and R. E. Frisbie* Cockroaches rank high on the homeowner's list Cockroach Species of in ect problem. The mo t widespread grievance Before starting control procedures, the home­ against the roach is its mere presence in the home, owner should determine which cockroach species a well as the implication of uncleanliness which are present. accompanies a roach infestation. Roaches contami­ The most common is the large American cock.­ nate food with excrement and salivary secretions roach (Figure I). It is reddish-brown ·to brm\'n in and lea e an unpleasant odor. They are capable color, has a tan or light yellow band around the of carrying disease organisms, but the role roaches shield behind the head, and is 1'l'2 inches long play in transmitting these organisms to man is when mature. Outdoors it is found under the bark unknown. of trees, in leaf litter, rubbish piles, sewage systems, Many homeo\vners do not want to use synthetic and in barns or other out-buildings. Inside the organic in ecticides to control cockroaches. Because home, this roach commonly is found around th of thi, eyeral method of controlling cockroaches furnace and associated heating ducts. Egg cases are that do not invoh'e synthetic insecticides have been deposi ted in sheltercd areas on or near the floor, devised. usually close to a food source, and are concealed wi th debris. Cockroach Description and Biology The smokybrown is the other common large Cockroache generally have a flattened, oval roach (Figure 2).
    [Show full text]
  • Smokybrown Cockroach
    Smokybrown Cockroach Drugstore Beetle Periplaneta fuliginosa American Cockroach Stegobium paniceum Periplaneta americana (Adult) (Adult) 3.2cm (Adult) 3-4mm 3.8-5.5cm Inspired by Fleming College’s insect ID Inspired by Fleming College’s insect ID Inspired by Fleming College’s insect ID cards. Created by Meaghan Perry and cards. Created by Meaghan Perry and Mary cards. Created by Meaghan Perry and Mary Mary Baughman, Ransom Center, Austin, Baughman, Ransom Center, Austin, Texas. Baughman, Ransom Center, Austin, Texas. Texas. Sam American Cockroach Arthur Smokybrown Color: Adults are Reddish Brown with light Cockroach yellowish markings on the pronotum. They are Dillon the Drugstore Beetle good flyers. They are found in sewers, basements Color: Adults are uniform reddish mahogany and around pipes. American cockroaches eat brown. They are very good flyers. They are found Color: Brown, with the head tucked underneath starch in book bindings, manuscripts, glue, paper in sewers, loose mulch, and attics. They lose the pronotum. Among brown collection pest with starch sizing, and dead or wounded insects. moisture through the cuticle and require liquid beetles, only Stegobium has grooves Fermenting foods attract them. While feeding and every 2-3 days. They eat organic matter, and longitudinally on the wing cases (elytra). The resting they deposit Attar, a brown liquid deposit attar, a brown liquid containing antennae end in 3 segmented clubs. Female can containing pheromones that attract other pheromones that attract other cockroaches. The lay up to 75 eggs at once. Adults do not feed but cockroaches. Egg cases (ootheca) are 9 mm. eggs are laid in a dark brown egg case (ootheca) can chew holes.
    [Show full text]