MICROBIAL METHYLATION AND VOLATILIZATION OF ARSENIC
by
CORINNE RITA LEHR
B. Sc., University of Calgary, 1994
A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
in
THE FACULTY OF GRADUATE STUDIES
(Department of Chemistry)
We accept this thesis as conforming to the required standard
THE UNIVERSITY OF BRITISH COLUMBIA
March 2003
© Corinne Lehr, 2003 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.
Department of C.()e The University of British Columbia Vancouver, Canada Date OJ/W h 1 JOC'J ABSTRACT The basis of the "Toxic Gas Hypothesis" of Sudden Infant Death Syndrome (SIDS) is that the microorganisms present on infants bedding materials volatilize sufficient arsenic, antimony or phosphorus from these materials to be acutely toxic to an infant. The volatilization of arsenic by aerobic microorganisms isolated from new sheepskin bedding materials, as well as from materials used by a healthy infant and by an infant who perished of SIDS was examined. Three arsenic-methylating fungi were isolated from a piece of sheepskin bedding material on which an infant perished of SIDS. These fungi form trimethylarsenic(V) species, precursors to volatile trimethylarsine. Their ribosomal RNA PCR products were used to identify the fungi as Scopulariopsis koningii, Fomitopsis pinicola and Penicillium gladioli. S. koningii, as well as two other sheepskin isolates, Mycobacterium neoaurum and Acinetobacter junii are human pathogens which should also be of concern in connection with SIDS. Few microogransism have been shown to methylate antimony. S. koningii methylated the antimony(III) compounds, potassium antimonyl tartrate and antimony trioxide yielding trimethylantimony. P. gladioli and S. koningii volatilized arsenic as trimethylarsine, but only under conditions such that the production of sufficient trimethylarsine to be acutely toxic to an infant is urilikely. These fungi did not volatilize antimony. ii Very little is known about the demethylation of methylarsenicals. One of the sheepskin isolates, Mycobacterium neoaurum, demethylated methylarsenic compounds to mixtures of As(III) and As(V). There was some evidence that MMA(V) is reductively demethylated to As(III) which is then oxidized to As(V). Iodide decreased the demethylation of MMA(V) by M. neoaurum and increased the methylation of MMA(V) by both P. gladioli and S. koningii. The techniques developed for studying the volatilization of arsenic by the lTiicroorganisrns on sheepskin bedding materials were applied to two other environments - garden waste compost and Meager creek hot springs. Composting of garden waste yielded iodomethane. Aerobic incubation of microbial mats and sediment from Meager creek hot springs yielded trimethylarsine and trimethylstibine. iii TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iv LIST OF TABLES ix LIST OF FIGURES xi LIST OF ABBREVIATIONS xiii ACKNOWLEDGEMENTS xiv Chapter 1 INTRODUCTION 1 1.1 Chemistry of Arsenic 1 1.2 Biological Transformations of Arsenic by Microorganisms 3 1.2.1 Volatilization 3 1.2.2 Mechanism of Arsenic Methylation 4 1.3 Toxicity 7 1.4 Sudden Infant Death Syndrome 9 1.5 Scope of Thesis 12 iv Chapter 2 ANALYTICAL METHODS 14 2.1 Introduction 14 2.2 Materials 16 2.2.1 Reagents 16 2.3 HG-GC-AAS Analysis 17 2.3.1 Introduction 17 2.3.2 Experimental 21 2.3.2.1 Materials 21 2.3.2.2 General HG-GC-AAS Procedure 22 2.3.2.3 Instrumental 23 2.3.2.4 Arsenic Analysis 25 2.3.2.5 As(III)/As(V) Speciation 25 2.3.2.6 Sample Preparation for Antimony Analysis by Solid Phase Extraction....26 2.3.2.7 Antimony Analysis 26 2.3.3 Results and Discussion 27 2.3.3.1 Arsenic Analysis 27 2.3.3.2 As(III)/As(V) Speciation 30 2.3.3.3 Antimony Analysis 30 2.4 Purge and Trap-GC-AAS 33 2.4.1 Experimental 33 2.4.1.1 General Purge and Trap-GC-AAS Procedure 33 2.4.1.2 Purge-and-Trap Flasks 33 2.4.1.3 Preparation of a Trimethylarsine Standard 34 2.4.1.4 Quantification of Trimethylarsine Standard ' 35 2.4.1.5 Quantification of Trhnethylarsine in Sample 35 2.4.2 Results and Discussion 36 2.5 FIA-ICP-MS 37 2.6 GC-ICP-MS 40 2.6.1 Experimental 40 2.6.1.1 Gas Trapping 40 2.6.1.2 GC-ICP-MS General Procedure 40 2.6.1.3 Semi-quantification 44 2.7 Summary 46 Chapter 3 ISOLATION AND IDENTIFICATION OF ARSENIC METHYLATING MICROORGANISMS 47 3.1 Introduction 47 3.2 Experimental 49 3.2.1 Materials 49 3.2.2 Characterization of Sheepskin Bedding Materials 49 3.2.2.1 Analysis of Sheepskin Bedding Materials for Total Arsenic Content 50 3.2.3 Isolation of Aerobic Microorganisms Extant on Sheepskin Bedding Materials 50 3.2.4 Screening of the Isolated Microorganisms for their Ability to Methylate Arsenic 52 3.2.5 Identification of Selected Microorganisms 53 3.2.5.1 Materials Used in the Identification of Microorganisms 53 3.2.5.2 Extraction of Genomic DNA from Selected Isolates 53 3.2.5.3 Polymerase Chain Reaction 54 3.2.5.4 Purification of rDNA PCR Products 55 3.2.5.5 Sequencing Reactions and Isolate Identification 56 3.3 Results and Discussion 58 3.3.1 Arsenic and Antimony Concentration in the Wool and the Skin of Sheepskin Bedding Materials 58 3.3.2 Aerobic Microorganisms Isolated from Sheepskin Bedding Materials 59 3.3.3 Arsenic Methylation by Isolates 65 3.3.4 Identification of Bacteria and Fungi Isolated from Sheepskin Bedding Materials 69 3.3.5 Photographs of Arsenic Methylatmg and Demethylating Microorganisms..72 3.4 Summary 75 vi Chapter 4 METHYLATION AND DEMETHYLATION: INVOLATILE ARSENIC AND ANTIMONY METABOLITES 77 4.1 Introduction 77 4.2 Experimental 79 4.2.1 Time Study of Arsenic Methylation and Demethylation 79 4.2.2 Incubation of S. koningii, F. pinicola and P. gladioli, M. neoaurum with Inorganic and with Methylated Arsenic Species 80 4.2.2.1 Extraction of Inorganic and Methylated Arsenic Species from Biota 81 4.2.3 Incubation of S. koningii, F. pinicola and P. gladioli with Inorganic Antimony Species 82 4.2.4 Incubation of a Mixed Culture of S. koningii, F. pinicola and P. gladioli with As(III) and with MMA(V) 82 4.2.5 Incubation of S. koningii, P. gladioli and M. neoaurum withMMA(V) and Iodide 83 4.3 Results and Discussion 84 4.3.1 Growth Curves of S. koningii and M. neoaurum 84 4.3.2 Time Study of MMA(V) Methylation by S. koningii 88 4.3.3 Arsenic Methylation by S. koningii, P. gladioli and F. pinicola 90 4.3.3.1 F. pinicola 91 4.3.3.2 S. koningii 91 4.3.3.3 P. gladioli 92 4.3.4 Methylation of As(III) and MMA(V) by a Mixed Culture of S. koningii, F. pinicola and P. gladioli 93 4.3.5 Incubation of S. koningii, F. pinicola and P. gladioli with Inorganic Antimony Species 94 4.3.6 Demethylation of Methylarsenic species by M. neoaurum 97 4.3.7 Time Study of MMA(V) Demethylation by M. neoaurum 98 4.3.8 Incubation of M. neoaurum with Inorganic As 102 4.3.9 Incubation of S. koningii, P. gladioli and M. neoaurum with MMA(V) and Iodide 102 4.4 Summary 106 vii Chapter 5 VOLATILIZATION OF ARSENIC 108 5.1 Introduction 108 5.2 Experimental 110 5.2.1 Arsenic and Antimony Volatilization by Fungi Isolated from Sheepskin Bedding Materials 110 5.2.2 Incubation of S. brevicaulis with Sheepskin Bedding Material 112 5.2.2.1 Preparation of Seed Culture of S. brevicaulis 112 5.2.2.2 Preparation of Incubation Flasks 113 5.2.3 Arsenic Volatilization by Composting 114 5.2.3.1 Sampling of Compost Gases 115 5.2.3.2 Analysis of Compost for Arsenic Content 116 5.2.3.3 Compo st Incubation 117 5.2.4 Arsenic Uptake and Volatilization by Biota from Hot Springs of South• western British Columbia 118 5.2.4.1 Meager Creek Hot Springs 118 5.2.4.2 Incubation of Microbial Mats and Sediment 121 5.2.4.3 Aerobic/Anaerobic Incubation of Microbial Mats 123 5.2.5 Clear Creek Hot Spring 125 5.3 Results and Discussion 127 5.3.1 Volatilization of Arsenic by Fungi Isolated from Sheepskin Bedding Materials 127 5.3.2 Volatilization of Arsenic from Sheepskin Bedding Materials by S. brevicaulis 128 5.3.3 Compost 133 5.3.3.1 Analysis of Compost Gases 133 5.3.3.2 Analysis of Compost Incubation Gases 135 5.3.4 Hot Springs of South-western British Columbia 136 5.3.4.1 Volatile Species at Meager Creek Hot Springs 136 5.3.4.2 Microbial Mat and Sediment Incubations 137 5.3.4.3 Aerobic/Anaerobic Incubation of Microbial Mats 139 5.3.5 Clear Creek Hot Spring 141 5.4 Summary 144 Chapter 6 SUMMARY .147 viii LIST OF TABLES Chapter 1 Table 1.1 Some arsenic compounds Chapter 2 Table 2.1 Boiling points of arsenic and antimony hydrides Table 2.2 Operating parameters ICP-MS Table 2.3 Analyte masses (ICP-MS) and dieir relative natural abundance Chapter 3 Table 3.1 Arsenic content (ppb) of sheepskin bedding materials, determined by nitric acid digestion of the materials, HG-GC-AAS analysis of the digests, (SD) Table 3.2 Isolates from New 1 Table 3.3 Isolates from New2 Table 3.4 Isolates from Usedl Table 3.5 Isolates from SIDS 1 Table 3.6 Identification of isolates from sheepskin bedding materials Chapter 4 Table 4.1 Dry biomass of fungi after 28 days of growth with arsenicals (mg) Table 4.2 Percent conversion of starting substrates to methylated products by S. koningii Table 4.3 Percent conversion of starting substrates to methylated products by P. gladioli Table 4.3 Percent conversion of methylarsenic species to inorganic arsenic by M. neoaurum ix Chapter 5 Table 5.1 Incubation conditions for arsenic or antimony volatilization by arsenic methylating fungi Ill Table 5.2 Minimal salts/glucose medium 112 Table 5.3 S. brevicaulis incubation on sheepskin conditions 113 Table 5.4 Compost incubation conditions 118 Table 5.5 Microbial mats and sediment incubation conditions 122 Table 5.6 Microbial mats aerobic/anaerobic incubation conditions 124 Table 5.7 Yield of trimethylarsine and trimethylstibine from incubations of sediment and microbial mats from Meager Creek hot springs 138 Table 5.8 Total concentrations of metal(loid)s in Clear Creek water and biota obtained by FIA-ICP-MS analysis directly (water) or of digests (biota) 142 LIST OF FIGURES Chapter 1 Figure 1.1 Challenger mechanism for the methylation of arsenic 5 Figure 1.2 S-adenosylmethioiiiiie; the methyl group in bold is donated during the methylation of arsenic 6 Chapter 2 Figure 2.1 Hydride generation-gas chromatography-atomic absorption spectrometry instrumentation 24 Figure 2.2 HG-GC-AAS of standard arsenic species (As(III), MMA(V), DMAA, TMAO), 25 ng each arsenic species; 4 M acetic acid as HG buffer 28 Figure 2.3 HG-GC-AAS calibration curve of As(V); 1 M HC1 as HG buffer 29 Figure 2.4 HG-GC-AAS of standard antimony species (potassium antimonyl tartrate, MesSbCk), 50 ng as Sb each species 31 Figure 2.5 HG-GC-AAS calibration curve of Me3SbCl2 32 Figure 2.6 Purge-and-trap head 34 Figure 2.7 Gas chromatography-inductively coupled plasma-mass spectrometry instrumentation 43 Chapter 3 Figure 3.1 HG-GC-AAS analysis of 0.50 mL aliquot of isolate #337 after incubation with As(III) for 28 days 66 Figure 3.2 HG-GC-AAS analysis of 0.25 mL aliquot of isolate #337 after incubation with MMA(V) for 28 days 67 Figure 3.3 HG-GC-AAS analysis of 0.15 mL aliquot of isolate #364 after incubation with MMA(V) for 28 days 68 Figure 3.4 15 Day old culture of P. gladioli A) colonies on potato dextrose agar B) microscopic smear 60X magnification 72 Figure 3.5 15 Day old culture of S. koningiii A) colonies on Sabouraud agar B) microscopic smear 60X magnification 73 Figure 3.6 15 Day old culture of F. pinicola A) colonies on Sabouraud agar B) microscopic smear 60X magnification 74 xi Chapter 4 Figure 4.1 Growth curve of S. koningii in submerged culture with 500 ppb (as As) of MMA(V) 86 Figure 4.2 Growth curve of M. neoaurum in submerged culture with 500 ppb (as As) of MMA(V) 87 Figure 4.3 Methylation of MMA(V) to TMAs(V) by S. koningii as a function of time889 Figure 4.4 HG-GC-AAS analysis of 1.00 mL aliquot of media after incubation of S. koningii with potassium antimonyl tartrate for 28 days 96 Figure 4.5 Demethylation of MMA(V) to inorganic arsenic (As(III) + As(V)) by M. neoaurum as a function of time 100 Figure 4.6 Demethylation of MMA(V) to As(III) by M. neoaurum as a function of time 101 Figure 4.7 HG-GC-AAS analysis of aliquots of media after incubation of P. gladioli for 28 days A) 1.00 mL aliquot, incubation with 500 ppb as As of MMA(V) B) 0.10 mL aliquot, incubation with 500 ppb as As of MMA(V) and 1.65 ppm as I of Nal 105 Chapter 5 Figure 5.1 Meager Creek hot springs 120 Figure 5.2 Incubation day 20 of: Flask B) S. brevicaulis Flask D2) S. brevicaulis and Usedl sheepskin Flask C2) Usedl sheepskin 131 Figure 5.3 GC-ICP-MS chromatogram (m/z =75) of headspace gas after 20 days incubation of S. brevicaulis with Usedl sheepskin bedding material 132 Figure 5.4 GC-ICP-MS chromatogram (m/z = 127) of gas collected over 7 days from a new windrow of garden-waste compost 10 cm below the surface of the compost.. 134 xii ABBREVIATIONS A AS atomic absorption spectroscopy As(III) arsenous acid As(V) arsenic acid d. H2O deionised water DMA dimethylarsine DMAA dimethylarsinic acid DMAs dimethylarsenic species DMAs(V) dimethylarsenic(V) species DMAs(III) dirnethylarsenic(III) species DMSb dimethylantimony species EDTA ethylenedimrinetetraacetic acid FIA flow injection analysis GC gas chromatography HG hydride generation ICP inductively coupled plasma MMA monomethylarsine MMA(III) monomethylarsonous acid MMA(V) monomethylarsonic acid MS mass spectrometry m/z mass-to-charge ratio Newl sample 1 of unused sheepskin bedding material New2 sample 2 of unused sheepskin bedding material ppb parts per billion PTFE polytetrafluoroethylene rpm revolutions per minute SD standard deviation RSD relative standard deviation SIDS Sudden Infant Death Syndrome SIDS1 sample 1 of sheepskin bedding material used by an infant who perished of SIDS TMA trimethylarsine TMAO trimethylarsine oxide TMAs(V) trimethylarsenic(V) species TMSbO trimethylstibine oxide TMSb(V) trimethylantimony(V) species Usedl Sample 1 of sheepskin bedding material used by a healthy infant UBC University of British Columbia w/v weight/volume xiii ACKNOWLEDGEMENTS No man is an island, entire of itself; every man is a piece of the continent. John Donne First, I would like to thank my supervisor Bill Cullen for his guidance, patience and support. I am also grateful to my supervisory cornmittee. I would like to thank Elena Polishchuk for helping me discover the excitement of microbiology and for her expertise. I am grateful to Marie-Chantal Delisle, Catherine Franz, Tina Liao, Una Radoja and Candice Martins for their assistance in carrying out the microbiology work. I am grateful to Bert Mueller for his expertise in mnning and repairing the ICP-MS. I am indebted to the past and present members of Bill's Toxic Team for their collaborations, helpful discussions and friendship. In particular, I would like to thank Vivian Lai, Bianca Kuipers, Paul Andrewes, Lixia Wang, Kirsten Falk, Dietmar Glindemann, Andrew Mo si, Chris Simpson, Sophia Grmichinho, Sarah Maillefer, Changqing Wang, Hongsui Sun, Corinne Haug, Cathy Sun, Ulrik N0rum and Vicenta Devesa. Thanks to Joerg Feldmann for his help with the gas experiments and for my first mountaineering trip. Most all I would like to thank my family, Mom, Dad and Eric, for their love and support. CHAPTER 1 INTRODUCTION Albertus Magnus is credited with the discovery of metallic arsenic in 1250 A.D., but the first clear report of the preparation of metallic arsenic was by the Swiss physician and alchemist, Paracelsus (1493-1541). He heated orpiment with organic matter and eggshells. By the 18th century, arsenic was classified as a semi-metal. Arsenic is a primary element in 206 minerals.1 The arsenic content of the earth's i crust is, on average, 2 ppm2 Weathering, volcanic and biological activity mobilize arsenic from the minerals. Anthropogenic activities such as lTiiiiing and the manufacture of wood preservatives also contribute to the mobilization of arsenic. 1.1 CHEMISTRY OF ARSENIC Arsenic is a Group 15 element and is a metalloid with the properties of both metals and non-metals. The common oxidation states of arsenic are -3, 0, +3 and +5. A large number of inorganic and organic compounds of arsenic are known. The arsenic compounds of interest in this thesis are listed in Table 1.1; they are primarily inorganic and methylated species. 1 Table 1.1 Some arsenic compounds Name pK.3 Abbreviation Formula Arsenous acid 9.3 As(III) As(OH)3 Arsenic acid 2.3 As(V) AsO(OH)3 Monomethylarsonous acid unknown MMA(III) CH3As(OH)2 Monomethylarsonic acid 3.6 MMA(V) CH3AsO(OH)2 Dimethylarsinic acid 6.2 DMAA (CH3)2AsO(OH) Arsine AsH3 Monomethylarsine MMA CH3AsH2 Dimethylarsine DMA (CH3)2AsH Trimethylarsine TMA (CH3)3As 2 1.2 BIOLOGICAL TRANSFORMATIONS OF ARSENIC BY MICROORGANISMS4 Microorganisms carry out a diversity of transformations of arsenic species. Oxidation of arsenite to arsenate, reduction of arsenate to arsenite and to arsine, and conversion of arsenite to arsine are all known. Many microorganisms methylate arsenic compounds notably to trimethylarsenic species. A few microorganisms cleave arsenic- carbon bonds. 1.2.1 Volatilization The biological volatilization of arsenic was first convincingly documented by Gosio in 1893.5 He showed that pure cultures of Aspergillus glaucum and of Mucor mucedo, grown on potato pulp containing arsenic trioxide, volatilized some of the arsenic. Gosio also isolated a fungus, now known as Scopulariopsis brevicaulis, from a mouldy carrot slice, and showed that it was much more active in arsenic volatilization than the other two fungi. Gosio's work was the culmination of studies throughout the latter half of the nineteenth century which sought to determine the cause of cases of chronic arsenical poisoning occurring in rooms where arsenic based pigments such as Scheele's green, CuHAsCh, had been used.6 In 1933, Challenger identified the gas produced by S. brevicaulis as trimethylarsine.7 A range of fungi are now to known to methylate arsenic yielding volatile trimethylarsine.4 Although Challenger claimed, in 1945, "the weight of the evidence would indicate that bacteria are unable to produce volatile methyl derivatives of arsenic"8, examples of arsenic volatilization by aerobic and anaerobic bacteria are now known.4 Fungal volatilization of inorganic arsenic yields only trimethylarsine. The bacteria, - 3 Pseudomonas sp. and Alcaligenes sp., isolated from soil yield, however, only arsine from inorganic arsenic when incubated anaerobically.9 In another experiment, a Pseudomonas sp. acclimated with sodium arsenate for 6 months converted arsenate to all three methylarsines.10 Several factors can influence the volatilization of arsenic. Not all substrates are converted to volatile arsines. Bird et al found that the PenicUlium species, P. chrysogenum and P. notatum, converted sodium methylarsonate and sodium dimethylarsinate to trimethylarsine, but the fungi did not methylate arsenous acid.11 Elements typically toxic to microorganisms, such as vanadium, nickel and tin, inhibit the formation of trimethylarsine from methylarsonate by PenicUlium sp.12 as do carbohydrate and sugar acids. 1.2.2 Mechanism of Arsenic Methylation Challenger proposed a mechanism for the methylation of arsenic by fungi. This mechanism, which has come to be known as the Challenger mechanism, consists of alternating oxidative methylation and reduction steps. The mechanism is illustrated in Figure 1.1. Oxidative addition of a methyl group to As(III) via the reaction of methyl iodide with alkaline As(III), the Meyer reaction, is well-known.13 Each of the steps of the Challenger mechanism can be replicated through alternating oxidative methylation by trimethylsulfonium hexafluoro phosphate (Me3S+PF6_) and reduction by sulphur dioxide.414 4 o 2e" As . HO OH / v OH HO OH CH3^ O 2e" As AS / . ""CH3 / \;""CH3 X HO 0H HO OH CH3< O 2e" As A / V""CH3 / \'""CH3 HO CH3 HO \H3 CH3< O 2e As. As v ""CH3 / \""CH3 3 3 HC CH H3C CH3 Figure 1.1 Challenger Mechanism for the Methylation of Arsenic 5 Challenger et al found that incubation of S. brevicaulis or A. niger with 14 14 [ CH3]methionine yielded ( CH3)3As, implying that 5-adenosyhnethioirine is the methyl donor in the fungal methylation of arsenic.15 This is further supported by the inhibition of arsenic methylation by ethionine.16 Ethionine is an antagonist to methionine.17 The structure of S-adenosyknethione is illustrated in Figure 1.2. The methyl group donor for the methylation of arsenic by bacteria, and in particular, anaerobic bacteria, is less certain. Although S-adenosylmetMonine may be the source of the methyl group for some bacteria, the methyl group could also originate from 4 18 methylcobalamin. ' The two-electron reductants in the Challenger mechanism are very likely thiols. Glutathione is probably a reductant, and dithiol derivatives such as 6,8-dithiooctanoic acid (lipoic acid) may be involved.4'18 NH2 C02 OH Figure 1.2 S-adenosylmethionine; the methyl group in bold is donated during the methylation of arsenic 6 1.3 TOXICITY Arsenic is commonly known as a poison. The toxicity of arsenic, however, depends on the speciation, and even acutely toxic arsenic compounds have been used for medicinal purposes. Arsenic was considered a cure-all in the 19th century.19 It has been used to treat diseases such as syphilis and organoarsenicals are still used today in the treatment of African trypanosomiasis.20 In 2001, the FDA approved the use of arsenic trioxide in the treatment of certain cases of acute promyelocytic leukemia.21 Interestingly, a small number of the residents of Styria, Austria during the 17th to 19th centuries consumed arsenic trioxide (typically 300-400 mg every 2-3 days) in the belief that it was beneficial to health and well-being.22 The acute toxicity of inorganic arsenic compounds is well known. Arsenite binds to -OH and -SH groups, and particularly to adjacent -SH groups, inactivating enzymes. Arsenate competes with phosphate. For example, arsenate disrupts oxidative phosphorylation by fonning an unstable arsenate ester of ADP, which is hydrolysed non- 2.3 enzymatically. The International Agency for Research on Cancer considers arsenic and inorganic arsenic compounds as human carcinogens.24 Although the biological methylation of arsenic is considered a detoxification mechanism, recent work suggests that the trivalent methylated arsenic metabolites have highly adverse effects on cells. Mass et al found that MMA(III) and DMA(III) induce DNA damage in human peripheral lymphocytes and that MMA(III) and DMA(III) were 77 and 386 times more potent, respectively, in causing DNA damage than As(III) on the basis of the single cell gel assay.25 Vega et al found that trivalent arsenicals (at concentrations between 0.001 and 0.01 uM) promote cell proliferation of human 7 epidermal keratinocytes, and that the relative acute toxicities of arsenicals to these cells were in the order of: As(III) > MMA(III) > dimethylAs(III) glutathione > dimethylAs(V) > MMA (V) > As(V) 26 Trimethylarsine is the compound of primary interest in this thesis. Although arsine is an acute hemolytic toxin to mammals (threshold limit value = 50 ppb in air)27, the toxicity of the methylated species, trimethylarsine, is likely much less. Trimethylarsine is of low acute oral toxicity to mice (LD50 = 7.87 g kg"1) and hemolysis * 28 is not observed. It is also of low embryotoxicity to mice (no embryotoxic effects at trimethylarsine concentrations of 4.7 mM in culture medium).29 The acute and chronic inhalation toxicities of trimethylarsine to humans, and in particular to infants, however, are unknown. 8 1.4 SUDDEN INFANT DEATH SYNDROME Sudden Infant Death Syndrome (SIDS) was defined in 1969 as "the sudden death of any infant or young child which is unexpected by history, and in which a thorough post-mortem examination fails to demonstrate an adequate cause of death".30 SIDS is the leading cause of death of infants between the ages of one month and one year in developed countries, with a rate, in Canada, of 0.45 deaths per 1000 live births.31 SIDS has been associated with a number of factors. These include infant sex, age, birth order and ethnicity, young maternal age, exposure to tobacco smoke, season of the year, bed sharing, prior mattress use by another infant and the prone sleeping position.32'38 The prone sleeping position is strongly correlated with rates of SIDS and vigorous campaigns to promote placing infants in the supine position to sleep, "Back to Sleep" campaigns, have resulted in strong decreases in the rates of SIDS.39"41 The cause of SIDS, however, remains unkiiown. Read et al postulated, in 1982, that SIDS results from subclinical damage and 42 vulnerability in sleep in combination with secondary triggers. In 1994, Filiano and Kinney proposed the triple-risk model of SIDS.43 This model proposes that some infants have defects in brainstem neurotransmitter receptors in regions responsible for autonomic cardiopulmonary control or have an altered trajectory in the development of autonomic control.44"46 When these infants enter a critical developmental period for homeostatic responses and are exposed to an external stressor during sleep, they succumb to SIDS.47'48 9 Other theories propose that SIDS is due to bacterial toxins ' , the laryngial chemoreflex51, asphyxia caused by rebreathing of expired gases52, positional airway obstruction53 or vertebral artery compression resulting in brainstem ischemia54. The biological formation of volatile arsines, stibines or phosphines and their subsequent inhalation by sleeping infants has been suggested as a possible cause of SIDS. In a report to the media (BBC, June 1989) and in a letter to the Lancet55, Richardson claimed that the fungus isolated by Gosio, S. brevicaulis, infected all of the tested mattresses on which an infant had perished of SIDS, and that S. brevicaulis generated toxic arsine, stibine and/or phosphine from the mattress' filling and cover. In response to these claims, the British Department of Health appointed a committee chaired by Professor Turner. This committee attempted to replicate Richardson's results and they reported, in 1991, that there was no evidence to support the "toxic gas hypothesis".56 In 1994, Richardson published further experimental results.57 He attributed the primary cause of SIDS to the anticholinesterase action of arsines, stibines or phosphines produced by S. brevicaulis from polyvinyl chloride mattress materials. The experimental results relied on the observation of color changes in silver nitrate and mercuric chloride papers following exposure to the volatile metabolites claimed to be the trihydride gases. It should be noted that arsine, stibine and phosphine are not expected to be products of aerobic microbial metabolism Two documentaries were produced by Central television in 1994 (The Cook Report, Nov. 17 and Dec. 1) that promoted the "toxic gas hypothesis". The first, on November 17 presented Richardson's experimental results and reported that infants who had died of SIDS had elevated serum and liver antimony levels as compared to infants 10 who had died of other causes. The second, on December 1, reported that the concentration of antimony in infants' hair correlated with the concentration of antimony in their mattresses. These results were later refuted.58,59 In response to public concern generated by the Cook report, the British Department of Health appointed an expert committee, chaired by Lady Limerick, to examine the available evidence regarding the validity of the "toxic gas hypothesis". This committee found that S. brevicaulis is found infrequently in SIDS mattresses and that S. brevicaulis does not volatilize antimony, phosphorus or arsenic from PVC mattress materials under typical infant sleeping conditions. They also found that there was no relationship between the use of antimony or phosphorus based fire retardants in infants' bedding materials and the rate of SIDS. The committee concluded that the "toxic gas hypothesis" should not be considered in connection with SIDS.59 The range of toxic gases, irucroorganisms and substrates considered by the Limerick committee, however, was narrow. They focused on one microorganism, S. brevicaulis, and on one substrate, antimony. Although S. Brevicaulis does methylate both arsenic and antimony forming volatile trimethylarsine and trimethylstibine60'61, respectively, it is not commonly found on bedding material whether used by healthy infants or by infants who perished of SIDS62. A wide variety of irucroorganisms are present on infants' bedding materials63 and some of these may be able to volatilize arsenic or antimony. 11 1.5 SCOPE OF THESIS In this work, the volatilization of arsenic by the aerobic microorganisms extant on sheepskin bedding material is examined. Sheepskin is a commonly used bedding material that appears to be associated with a number of incidences of SIDS.64 The wool may contain ppm levels of arsenic if the sheep have grazed on materials containing these elements.65 Furthermore, the physical nature of the sheepskin makes it hard to clean, providing fertile ground for the growth of microorganisms. The methylation and volatilization of antimony by these microorganisms is also exarnined. The aim of the work described in Chapter 2 is to adapt existing analytical methods for the analysis of arsenic and antimony to the species of interest in this thesis. These methods include hydride generation-gas chromatography-atomic absorption spectrometry (HG-GC-AAS), purge and trap-GC-AAS, flow injection analysis - inductively coupled plasma - mass spectrometry (FIA-ICP-MS) and GC-ICP-MS. The microorganisms isolated from samples of sheepskin bedding materials are described in Chapter 3. The isolates are screened for their ability to methylate arsenic and to form precursors to volatile trimethylarsine. The isolates are identified by amplification and sequencing of their rDNA. The methylation of arsenic by the sheepskin isolates is described in Chapter 4. The isolates are incubated with a variety of arsenic substrates. Their ability to methylate antimony is also exarnined. 12 The volatilization of arsenic by those sheepskin isolates that methylate arsenic is reported in Chapter 5. The formation of volatile organometal(loid) compounds in two other environments - garden waste compost and hot springs near Vancouver, is also described. 13 CHAPTER 2 ANALYTICAL METHODS 2.1 INTRODUCTION The analytes of interest, in this thesis, are primarily inorganic and methylated compounds of arsenic and antimony. Arsenic trioxide is colourless, tasteless and odourless, an ideal poison, and forensic medicine initially drove the development of methods for the analysis of arsenic.66 The Marsh test, discovered in 1836, enabled the reliable determination of trace amounts of arsenic.67 In this test, inorganic arsenic is reduced to arsine by zinc and hydrochloric acid. Heating of the arsine results in deposition of a metallic mirror on an adjacent cold surface. This reduction reaction is the basis of the modern hydride generation (HG) procedure. Photometric methods for the analysis of arsenic, such as the molybdenum blue technique, were later developed.68 These methods for the analysis of total arsenic content have largely been superseded by HG coupled to element specific detection such as 69 V0 71 atomic absorption spectrometry (AAS) ' , atomic fluorescence spectrometry (AFS) , inductively coupled plasma (ICP)-optical emission spectrometry72 and ICP- mass spectrometry (MS)73. Direct analysis of aqueous solutions for arsenic and other metal(loid) concentrations is now routinely accomplished by graphite furnace (GF)- AAS74, ICP-optical emission spectrometry75 and ICP-MS76'77. Early methods for the speciation of inorganic arsenic were primarily based on the 78 79 selective complexation of arsenate or arsenite followed by photometric analysis ' Coupling of HG to GC, with AAS detection, by Braman and Forebak in 1973, enabled 14 the separation of inorganic and methylated arsenic species.80 Modern HPLC methods are able to separate a wide variety of arsenic species including inorganic, methyl and 81 82 arsenosugar species. ' Methods for the speciation of inorganic antimony, and particularly for the analysis of methylantimony species, are much less developed than those for arsenic. Antimony concentrations in environmental matrices are typically much lower than arsenic 83 concentrations, so even though antimony is a potential human carcinogen , there has been little need to develop speciation methodology. Furthermore, few well-characterized antimony compounds are available as standards for method development. HG with AAS, AES, AFS, ICP-AES, ICP-MS or GC-MS detection are the primary methods for the analysis of inorganic and methylantimony species.84, 85 HPLC methods for antimony speciation have recently been developed, but little work has been done in applying these methods to more complex biological matrices.86 Early methods for the analysis of volatile arsenic compounds relied on their reactions, for example with mercuric chloride (Biginelli's solution), to afford identifiable solids.8 Most modern methods for the identification and quantification of arsines, stibines and other volatile organometal(loid) compounds use GC separation coupled to MS, ICP-MS or AAS detection.87"93 GC-ICP-MS gives multi-element detection and low detection limits, but GC-AAS is more robust. The analytes are often focused in a low- temperature trap prior to GC analysis to improve the separation and detection limits. 15 2.2 MATERIALS 2.2.1 Reagents Na2HAs04 7H20 was purchased from Sigma, As20"3 from Fisher Scientific, CH3AsO(OH)2 from Pfalz and Bauer and (CH3)2AsO(OH) from Aldrich. CH3AsI2, 94 96 (CH3)3AsO and (CH3)3SbO were synthesized according to literature methods. " These arsenicals and antimonals were used to prepare 1000 ppm stock solutions of arsenate [As(V)J, arsenite [As(III)], monomethylarsonic acid [MMA(V)], dimethylarsinic acid [DMAA], monomethylarsonous acid [MMA(III)], trimethylarsine oxide [TMAO] and trimethylstibine oxide [TMSbO]. A mixed standard, for FIA-ICP-MS and GC-ICP-MS analyses, containing 1.00 ppm each of Ge, As, Se, Cd, Sn, Sb, Te, Hg and Pb in 1% HN03 (from concentrated, doubly distilled in quartz, Seastar) was prepared from individual element ICP standard solutions (10.000 g L"1, Alfa AESAR). Distilled deionised water (d. H20) was used to prepare all solutions. All other chemicals used were of at least reagent grade, were obtained from commercial sources and were diluted in d. H20 to the appropriate concentration. Glassware was soaked overnight in 1 M nitric acid and then rinsed with d. H20. 16 2.3 HG-GC-AAS ANALYSIS 2.3.1 Introduction The Marsh test, first utilized the generation of volatile arsine in the analysis of arsenic.67 In 1969, Holak coupled hydride generation of arsine with atomic absorption spectrometry (AAS) , and the introduction of arsenic into the spectrophotometer as volatile arsine increased the sensitivity of the analysis of inorganic arsenic by 100 times over ordinary flame AAS.98 HG-AAS has the additional advantage of increased selectivity. This technique has since been applied to the analysis of many other elements including antimony, selenium, tellurium, geraiamum, tin, lead and bismuth, in a wide • 99-101 range of matrices. When the HG method was first developed, a metal, such as zinc, in hydrochloric acid, was used to reduce the arsenic to arsine. This illustrated by equation 2.1. This method has the disadvantages of a very slow reaction time (up to 30 minutes) and possible contamination from the metal. + 2+ 4 Zn + 8 H + As(OH)3 -> 4 Zn + AsH3 + 3 H20 + H2 Equation 2.1 Acid-metal reduction of arsenic to arsine 17 Later HG methods employed the reduction of the analyte to its corresponding hydride by borohydride.99'102'103 For arsenic or antimony, analyte in the +5 oxidation state is first reduced to the +3 oxidation state (equation 2.2). The analyte is then further reduced to the corresponding hydride (equation 2.3). The borane produced by these reactions reacts immediately with water yielding boric acid and hydrogen (equation 2.4). These reactions are illustrated below for arsenic.104'105 + RnAs(0)(OH)3.„ + H + BH4" -> R„As(OH)3.„ + BH3 + H20 (2.2) + RnAs(OH)3.n + (3-n) H + (3-n) BH4" — RnAsH3.„ + (3-n)BH3 + (3-n) H20 (2.3) BH3 + 3 H20 -> B(OH)3 + 3 H2 (2.4) where n = 0-3, R = methyl or alkyl group Equations 2.2-2.4 Reduction of an arsenic species to the corresponding arsine Arsine, stibine and their methyl-substituted homologues vary greatly in their boiling points.106 These boiling points are listed in Table 2.1. Braman and Foreback developed a procedure that takes advantage of these boiling point differences to speciate inorganic and methylarsenic in natural waters.80 The generated arsenic hydrides are condensed into a cold trap and are then separated through fractional volatilization by slow wanning of the trap. Separation of the trapped hydrides through a gas chromatography column preceded by rapid warming of the cold trap, rather than by fractional volatilization, reduces peak broadening. Cold trapping has the added advantage that the generated hydrides are concentrated which improves the detection limits. 18 Table 2.1 Boiling points of arsenic and antimony hydrides Arsenic Compound Boiling Point (°C) Antimony Compound Boiling Point (°C) Arsine -63 Stibine -17 Methylarsine 2.0 Methylstibine 41 Dimethylarsine 36 Dimethylstibine 61 Trimethylarsine 52 Trimethylstibine 81 Although some information on the original compound is lost by hydride derivatization of analytes, HG-GC-AAS offers a direct method of determining the presence of inorganic and methyl arsenic and antimony species in samples. Methods for the speciation of antimony are not as well developed as those for the speciation of arsenic.84 A method for the HG-GC-AAS analysis of methylantimony species was first published by Andreae et al in 1981107 and this analytical technique is still undergoing refinement.108,109 Care must be taken in choosing the reaction conditions so as to avoid demethylation of methylantimony species. Dodd et al found, for example, that Me3SbCl2 and Me3Sb(OH)2 can yield inorganic, mono- and dimethylarsine as well as trimethylarsine upon reaction with NaBH4.110 The procedure described by Andrewes et al60 was followed for the methylantimony analyses performed in this thesis. Fungi such as S. brevicaulis methylate antimony, but the amount of trimethylantimony(V) species formed is very small relative to the amount of starting inorganic antimony.60,61 HG-GC-AAS analysis of a large sample volume (1 to 10 mL) 19 allows detection of the trhiiethylantirnony(V) products, but results in a large stibine peak which is not resolved from the small trimethylstibine peak. Furthermore, the generation of large amounts of stibine produces a metal mirror on the cuvette and causes metal oxide smoke to form resulting in an increased detection limit. If the hydride generation reaction is carried out at pH 6, trimethylantimony(V) species are reduced to trimethystibine, but inorganic antimony(V) species are not reduced to stibine. This eliminates the problem described above. Inorganic antimony(III) species are, however, reduced at pH 6 to stibine so it is then necessary to remove the inorganic antimony(III) species from the sample prior to analysis. Anion exchange columns strongly retain antimony(III) while trimethylantimony(V) species elute.111,112 Andrewes et al found that an inexpensive basic alumina column prepared in-house successfully removed antimony(III) species while allowing trimethylarsenic(V) species to elute when irririimal salts/glucose medium containing potassium antirnonyl tartrate (10 mg Sb L'1) and trimethylantimony dichloride (1 mg SbL"1) was passed through the column.60 In the work described in this thesis, the media and the extracts, from all experiments involving the incubation of fungi with antimony compounds, were passed through basic alumina columns prior to their analysis. A variety of methods have been developed for the speciation of As(III) and As(V).81'113 In 1977, Braman et al reported that the reduction of As(III) and As(V) to arsine by sodium borohydride is pH dependent and related to the pKa values of the arsenic species, and that the selective reduction of As(III) followed by AES analysis of the generated arsine enabled speciation of inorganic arsenic in water.114 Although this method has been used extensively for the speciation of inorganic arsenic in water and in 20 biota, the reaction conditions must be chosen very carefully to ensure that As(III) is reduced to arsine while none of the As(V) is reduced.115 Anion-exchange chromatography offers another method of separating As(III) and 3 As(V). At pH values below 9, As(III) is present as a neutral species (pKai = 9.3) and elutes un-retained from anion-exchange columns. At most pH values As(V) is present as 3 an anion (pKai = 2.3, pKa2 = 6.8, pKA3 = 11.6) and is retained by anion-exchange columns. Disposable silica-based strong anion-exchange cartridges are a simple and inexpensive way of separating As(III) and As(V).116 As(V) is completely retained and remains on the cartridge. All of the As(III) elutes unretained. The eluted As(III) can then be analysed by HG-GC-AAS. The As(V) concentration is calculated as the difference between the total inorganic arsenic concentration and the As(III) concentration. 3+ 2+ 2+ 1 Several cations and anions such as Fe , Ni , Cu , MnOV and S2O82" interfere with the reduction of arsenic species to their hydrides.117'118 In this thesis, the method of standard additions was employed in all semi-quantitative analyses for both arsenic and antimony to compensate for these possible interferences. 2.3.2 Experimental 2.3.2.1 Materials The stock solutions of arsenicals and antimonals (Section 2.2.1) were diluted in d. H20 to a concentration of 1 ppm as arsenic or antimony for standards for the analytical procedure. NaBH4 was purchased from Alfa Aesar and 2% (w/v) solutions of NaBH4 in d. H2O were prepared daily. 21 2.3.2.2 General HG-GC-AAS Procedure Semi-continuous flow HG-GC-AAS based on the method and apparatus developed by Cullen et al was used for arsenic and antimony speciation in aqueous samples.119 In the first step, the hydrides are generated and condensed into a trap cooled in liquid nitrogen. In the second step, the trap is heated and the hydrides are purged with helium into the GC where they are separated. AAS is used for detection. The instrumental details are described in the Section 2.3.2.3 and are illustrated in Figure 2.1. Initially, the 6-port valve is turned to the trap position and the second U-shaped trap is cooled in liquid nitrogen. The liquid/gas separator is allowed to drain and the drain tubing is then closed. The peristaltic pump is started and an appropriate volume of sample is pumped into the system. The sample mixes with the buffer, then with the sodium borohydride solution and finally with the helium-purge gas. After the mixture moves through the reaction coil, the generated hydrides and hehum purge gas are separated from the hquid reaction waste in the gas/liquid separator. The gases then go through a U-shaped trap cooled in dry ice/acetone to remove any moisture and finally pass into the second U-shaped trap, which is cooled in Hquid nitrogen where the hydrides are. condensed. The peristaltic pump is stopped, after thoroughly rinsing the sample uptake with d. H2O and after allowing sufficient time for all of the evolved hydrides to condense in the trap, and the 6-port valve is turned to the inject position. The hquid nitrogen Dewar is removed from the second U-shaped trap and is replaced by a beaker of hot water (~ 90 °C) to rapidly purge the hydrides into the GC. At the same time, the temperature program on the GC and the Shimadzu EZChrom software for recording the data are started. The arsines or stibines, after eluting from the GC 22 column, are swept into the quartz tube cuvette where they are atomized by the hydrogen/air flame and detected by the AAS. More specific details on the HG procedure, on the GC temperature program and on the AAS parameters are given for arsenic in Section 2.3.2.4 and for antimony in Section 2.3.2.7. 2.3.2.3 Instrumental119 The instrumental set-up is outlined in the block diagram in Figure 2.1. A Gilson Minipuls 2 four-channel peristaltic pump delivered the sample, buffer and sodium borohydride solutions. Tygon tubing was used in the peristaltic pump. The solutions were mixed and hydride generation took place in a PTFE reaction coil (1.8 m, 0.25 cm i.d.). The gas/liquid separator was constructed from silanized ((CH3)2SiCi2) glass. The water and cold traps were made from 30 cm PTFE tubing (0.25 and 0.40 cm i.d. respectively). All other tubing and swageloks were fabricated from PTFE (0.25 cm i.d.). PTFE was used for the interior of the 6-way valve interface between the cold trap and the GC. Arsine loss occurred with the use of a stainless steel valve. A Hewlett Packard 5830A gas chromatography was used to separate the generated arsines and stibines. Supelcoport SP-2100 (Supelco, 10% on Chromosorb, 45/60 mesh) was hand-packed into PTFE tubing (3.3 m, 0.25 cm i.d.) for the column. This chromatographic packing material is robust and stable in air. The separated arsines and stibines were detected by using a Varian AA-1275 AAS. The AAS was fitted with a quartz T-tube cuvette. 23 Figure 2.1 Hydride generation-gas chromatography-atomic absorption spectrometry instrumentation 24 2.3.2.4 Arsenic Analysis120"122 In the work described in this thesis, 1 M HC1 was used to adjust the pH for analyses of total inorganic arsenic and 4 M acetic acid was used as to adjust the pH for the speciation of methylated arsenic. A borohydride concentration of 2.0% was used for this work. A temperature ramp program was used for the GC to separate the generated arsines. The initial temperature was 50 °C and the temperature was increased at 15 °C min"1 to a final temperature of 120 °C. The arsines were detected by AAS at an absorbance wavelength of 193.7 nm The lamp current was 10 mA and the monochromator slit width was 1 nm 2.3.2.5 As(III)/As(V) Speciation The samples were passed through strong anion-exchange cartridges (Supelclean LC-SAX SPE tubes, 3 mL, Supelco) to retain the As(V). A new cartridge was used for each sample. The cartridges were conditioned by washing 2 mL of methanol and then 2 mL of d. H2O through the cartridge. The solvents were eluted at 2 mL min"1 using positive pressure (syringe piston). The sample (2.50 mL) was passed through the conditioned cartridge at 2 mL min"1. The column was eluted with 2.50 mL of d. H2O at 2 mL min"1, which was collected with the sample. The combined eluates were weighed in order to calculate the dilution factor. The concentration of As(III) in the eluted sample was determined by HG- GC-AAS as described in Section 2.3.2.4. Duplicate mixtures of 5.0 ug of As(III) and 5.0 ug of As(V) in 2.50 mL Sabouraud broth were washed through cartridges to verify cartridge performance. 25 2.3.2.6 Sample Preparation for Antimony Analysis by Solid Phase Extraction A column was prepared for each sample. A 10 mL syringe barrel was plugged with a small amount of glass wool. Basic alumina (5 g, 80-200 mesh, Brockman activity I, Fisher Scientific) was added to the syringe barrel. Ammonium carbonate buffer (10 mL, 50 mM in H20, adjusted to pH 12.0 with potassium hydroxide) was passed through the column. The sample (fungal medium or extract) was then passed through the column. The first 2 mL of sample was not collected and was used to rinse the column.60 The buffer and the sample were eluted under gravity, and the column was not rinsed after the sample had eluted. The eluted sample was then analysed as described in Section 2.3.2.7. 2.3.2.7 Antimony Analysis Citric acid (50 mM, pH 6.0) was employed to adjust the pH for the HG reaction, and the antimony species were reduced with a solution of 2.0% NaBH4. Dmethylantimony compounds are not available commercially and are difficult to synthesize. Consequently, the trimethylantimony species calibration curve was used for the estimation of the amount of dimethylantimony species in the analytes. A temperature ramp program was used for the GC in order to separate the generated stibines. The initial temperature was 50 °C and the temperature was increased at 30 °C min"1 to a final temperature of 150 °C. The stibines were detected by AAS at an absorbance wavelength of 217.6 nm The lamp current was 10 mA and the monochromator slit width was 0.2 nm 26 2.3.3 Results and Discussion 2.3.3.1 Arsenic Analysis A chromatogram from the HG-GC-AAS analysis of a mixture of 25 ng each of As(III), MMA(V), DMAA and TMAO is shown in Figure 2.2. Arsine, monomethylarsine (MMA) and dimethylarsine (DMA) are baseline separated by the Supelcoport SP-2100 column. DMA and trimethylarsine (TMA) are almost baseline separated. A calibration curve of the HG-GC-AAS analysis of aliquots of a 1000 ppb As(V) standard is shown in Figure 2.3. The slopes of the calibration curves of TMAO and of DMAA with 4 M acetic acid as the HG buffer and of inorganic arsenic with 1 M HC1 as the buffer were similar. The sensitivity of HG-GC-AAS analysis of As(V) with 4 M acetic acid is approximately 80% less than with 1 M HC1. The absolute detection limit for DMAA and TMAO with 4 M acetic acid as the HG buffer and for inorganic arsenic with 1 M HC1 as the HG buffer was estimated at 1 ng As. The maximum sample volume is 10 mL and the concentration detection limit is then 0.1 ppb. 27 0.12 Figure 2.2 HG-GC-AAS of standard arsenic species (As(III), MMA(V), DMAA, TMAO), 25 ng each arsenic species; 4 M acetic acid as HG buffer 28 4.0E+6 y = 74385x + 311240 R2 = 0.9978 3.0E+6 + o u -S 2.0E+6 o 1.0E+6 O.OE+0 10 20 30 40 Amount of As (ng) Figure 2.3 HG-GC-AAS calibration curve of As(V); 1 M HC1 as HG buffer 29 2.3.3.2 As(III)/As(V) Speciation When mixtures of 5.0 ug of As(III) and 5.0 ug of As(V) in 2.50 mL Sabouraud broth were passed through strong anion-exchange cartridges (Supelclean LC-SAX SPE tubes, 3 mL, Supelco) and the eluate and rinsings were collected and diluted to 5.00 mL, 1.06 (SD = 0.02) ppm of inorganic arsenic was detected. This indicates that As(III) elutes from these cartridges, whereas As(V) is strongly retained. Y. M. Sun (unpublished) found that when 1.00 mL of a 10.0 ppm As(V) solution (in water) was passed through this type of cartridge, no inorganic arsenic could be detected in the eluate. When 1.00 mL of a 10.0 ppm As(III) solution was passed through this type of cartridge and the eluate and rinsings were collected and diluted to 10.00 mL, 1.08 ppm of inorganic arsenic was detected. These results indicate that the Supelclean LC-SAX strong anion- exchange cartridge can be used to remove the As(V) from a mixture of As(III) and As(V) 2.3.3.3 Antimony Analysis A chromatogram from the HG-GC-AAS analysis of a mixture of 50 ng (as Sb) each of potassium antimonyl tartrate and trimethylantimony oxide (TMSbO) is shown in Figure 2.4. Stibine and trimethylstibine (TMSb) were baseline separated. A calibration curve of the HG-GC-AAS analysis of aliquots of a 1000 ppb Me3SbCl2 standard is shown in Figure 2.5. The absolute detection limit for TMSbOwas estimated at 2 ng Sb. The maximum sample volume is 10 mL and the concentration detection limit is then 0.2 ppb. The slope of the Sb(III) and TMSb(V) calibration curves were very similar and so it is reasonable to use the TMSb(V) calibration curve to estimate the concentrations of DMSb. 30 0.12 -4 o.oo —I 1 1 1 1 1 1 1 r 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 Time (min) Figure 2.4 HG-GC-AAS of standard antimony species (potassium antimonyl tartrate, TMSbO), 50 ng as Sb each species 31 2.0E+6 T Amount of Sb (ng) Figure 2.5 HG-GC-AAS calibration curve of Me3SbCl2 32 2.4 PURGE AND TRAP-GC-AAS 2.4.1 Experimental 2.4.1.1 General Purge and Trap-GC-AAS Procedure The biota for gas analysis experiments was grown in closed purge-and-trap flasks (Section 2.4.1.2). After the incubations were complete, a filter (0.2 jam Supor Acrodisc® 25; Gelman Sciences) was attached to the outlet tubing of the purge-and-trap head to prevent microbial contamination of the laboratory during purging. This filter was connected to the cold trap of HG-GC-AAS apparatus (Section 2.3.2.3) via PTFE tubing (5 cm). The inlet tubing of the purge-and-trap head was connected to the helium purge of the HG-GC-AAS apparatus and helium was purged at 215 mL min"1 through the flask (three times the volume of the headspace). GC-AAS analysis of the trapped volatile arsenic compounds was carried out by the method described for the analysis of the trapped arsines in the HG-GC-AAS procedure (Section 2.3.5). 2.4.1.2 Purge-and-Trap Flasks Erlenmeyer flasks (1 L) were fitted with male ground-glass joints (Pyrex no. 4980, stopper no. 9). Purge-and-trap heads were made for these flasks allowing the headspace of the flasks to be purged directly into a cold trap. These heads are illustrated in Figure 2.6 and consist of a female ground-glass joint (40/38) that was fitted with a 3- cm long, 0.5-cm outer diameter glass tube outlet and a 15-cm long, 0.5-cm outer diameter 33 glass tube inlet (sufficiently long to be below the surface of the medium). The head was sealed to the flask with Teflon tape. PTFE tubing (5 cm) was connected to both the inlet and the outlet tubes. inlet outlet Figure 2.6 Purge-and-trap head 2.4.1.3 Preparation of a Trimethylarsine Standard Hydride reduction of TMAO was used to prepare trimethylarsine standards. TMAO (0.500 mL, 1000 ppm) and HN03 (32.0 uL, 0.250 M) were mixed in a 150 mL glass serum bottle. The bottle was closed with a butyl-rubber septum and crimp sealed. NaBHLj (0.10 mL, 0.3% w/w in H20) was added via syringe. The contents of the bottle were mixed for 5 minutes. The standard was made fresh daily. 34 2.4.1.4 Quantification of Trimethylarsine Standard89 At the end of the analysis, in a fumehood, the septum was removed from the trimethylarsine standard bottle and the trimethylarsine was allowed to vent for one hour. The contents of the bottle were diluted appropriately and the concentration of TMAO remaining in the solution was determined by HG-GC-AAS. The amount of TMA generated in the headspace of the bottle was calculated by difference and the concentration of trimethylarsine in the headspace of the bottle was calculated from the volume of the headspace. 2.4.1.5 Quantification of Trimethylarsine in Sample The amount of trimethylarsine in the headspace of the sample flasks was determined semi-quantitatively by using an external calibration curve. After the analysis of a sample flask was complete, a PTFE T-piece fitted with a rubber sleeve stopper was inserted between the helium purge and the inlet of the sample flask. Aliquots (10-100 uL) of the trimethylarsine standard were injected through the septum via a gas-tight syringe. The headspace of the sample flask was purged with helium into the cold trap in the same manner as for the sample, and the trapped standard was analyzed by GC-AAS (Section 2.3.2.3). This method accounts for trapping efficiency. Triplicate aliquots of 50 uL of the trimethylarsine standard were injected directly into the GC via the T-piece as well as into the flask inlet to determine the efficiency of the purge-and-trap procedure. The efficiency was estimated as the ratio of the AAS signals recorded from the two T-piece positions. 35 2.4.2 Results and Discussion The yield of trimethylarsine from TMAO by NaBKU reduction in a closed bottle was 92 (SD = 1)%, and the concentration of TMA in the headspace of the bottle was 3.08 (SD = 0.03) mg L"1. The only arsenic compound observed in the headspace of the bottle was trimethylarsine. The calibration curve was linear below 200 ng of TMA. The absolute detection limit was estimated at 5 ng TMA. By comparison of the AAS signal given by 155 ng of TMA injected immediately before the GC and injected into the inlet of a sample flask, it is estimated that 60 (SD = 3)% of the trimethylarsine in the sample flask is trapped. A slower purge rate could yield a greater amount of trapping, but this would greatly increase the analysis time. Injection of the trimethylarsine standard into the flask inlet will account for the amount of trapping. The RSD of the AAS signal given by triplicate aliquots of 155 ng of TMA injected into the inlet of a sample flask was 8%. 36 2.5 FIA-ICP-MS A VG Plasma Quad 2 Turbo Plus ICP-MS (VG Elemental) was used for the FIA- ICP-MS analyses. This instrument has a de Galan V-groove nebulizer, a Scott spray chamber (water cooled, 4-6 °C), a standard ICP torch and a quadrupole MS. The operating parameters are given in Table 2.2. The m/z values monitored for each analyte element are given in Table 2.3. The presence of chloride in the analyte can result in the formation of Ar35Cl+. This species is also of m/z = 75 and interferes with the measurement of arsenic. The interference was corrected by measuring at m/z = 77 where the signal is due to both 77Se+ and Ar37Cl+, and by measuring at m/z = 82 where the signal is due only to 82Se+. Rhodium (m/z = 103) was added to the samples (final concentration 5 ppb) as an internal standard in order to correct for detector drift and for plasma instability. 37 2.2 Operating parameters ICP-MS Parameter Value Forward radio-frequency power 1350 W Reflected Power <10W Coolant (outer) gas flow rate 13.8 L min"1 Auxiliary gas (intermediate) flow rate 0.65 L min"1 Nebulizer gas flow rate 1.00 L min"1 Expansion chamber pressure 2 mbar Intermediate chamber pressure <1 x 10"4 mbar Analyzer chamber pressure 2 x 10"6 mbar Analysis mode Single sample acquisition, peak jump 38 2.3 Analyte masses (ICP-MS) and their relative natural abundance Element m/z Relative Abundance Germanium 70 20.5 Arsenic 75 100 Selenium 82 9.2 Cadmium 113 12.2 Tin 119 8.6 Antimony 121 57.3 123 42.7 TeUerium 126 19.0 Iodine 127 100 Mercury 200 23.1 202 29.8 Lead 208 52.4 Bismuth 209 100 39 2.6 GC-ICP-MS 2.6.1 Experimental 2.6.1.1 Gas Trapping124 125 The analyte gases (from purge-and-trap flasks or glass chambers) were purged with helium (compressed gas cylinder) at 100 mL min"1 into glass U-tube traps (6 mm o.d. x 22 cm length) cooled in dry ice/acetone (-78 °C).126 The volume of helium purged through the containers was three times the volume of the headspace. The traps were filled with chromatographic column packing material (Supelco, 10% Supelcoport SP- 2100 on Chromosorb, 45-60 mesh) and were plugged with glass wool. Although volatile organometal(loid) compounds can be trapped on some materials at room temperature, low-temperature trapping increases the trapping efficiency and reduces decomposition of these compounds. The traps were also wrapped with heating wire to enable them to be warmed rapidly during the analysis procedure. After purging was complete, the ends of the traps were closed with septa and the traps were stored in a freezer at -80 °C until the analysis of the tube contents by using GC-ICP-MS. 2.6.1.2 GC-ICP-MS General Procedure The GC-ICP-MS method is based on the procedure developed by Feldmann.127 The same instrumentation and operating parameters as for the FIA-ICP-MS procedure (Section 2.5) were used for this procedure. The analysis mode was switched to time resolved analysis. 40 The GC-ICP-MS apparatus is illustrated in Figure 2.7. The cryofocusing trap was constructed in the same manner as the sample traps (Section 2.6.1.1). The traps and transfer line were connected via PTFE tubing and Swagelok fittings. The transfer line, also PTFE tubing (0.7 mm i.d., 100 cm), was wrapped with heating tape and heated at 100 °C. The elbow that connects the spray chamber with the torch of the ICP-MS was replaced with a glass T piece to allow the gases from the cryofocusing trap to mix with nebulized rhodhium solution (internal standard, 5 ppb in 1% HNO3) prior to entering the ICP-MS torch. In the first step of the analysis, a sample trap (in a Dewar filled with dry ice/acetone) is connected to the helium and to the cryofocusing trap. The cryofocusing trap is cooled in liquid nitrogen. The three-way valve is turned to the vent position to prevent pressure changes during cryofocusing from extmguishing the plasma. The heating wire of the sample trap is connected to a variac, the dry ice/acetone Dewar is removed and the sample trap is heated at a temperature ramp of 40 °C lnin"1 for two minutes. In the second step of the analysis, the three-way valve is turned to the inject position, the liquid nitrogen Dewar is removed and the heating wire of the cryofocusing trap is connected to a variac. The analysis method is started on the computer and the cryofocusing trap is heated at 40 °C min"1 until the analysis is complete. The volatile compounds were identified by comparison of their retention times with those of standards. Standard volatile compounds were produced by batch hydride reduction of the appropriate species such as TMAO or TMSbO. A reaction flask was inserted between the helium purge and an unused sample trap. The generated standards 41 were analysed in the same manner as the samples. Those compounds for which standards could not be generated were identified on the basis of their boiling point estimated by extrapolation from the retention time. 42 O U > •T-l o Figure 2.7 Gas chromatography-inductively coupled plasma-mass spectrometry instrumentation 43 2.6.1.3 Semi-quantification Gaseous standards for most common, volatile organometal(loid) compounds are not available. Feldmann developed a semi-quantitative method of analysis based on nebulization of aqueous standards.128 This approach uses a single point calibration with an internal standard (rhodium). A procedure based on Feldmann's work was used for semi-quantitative determination of the amount of volatile organometal(loid) compounds present in the samples. The relative sensitivity factor (RSF) compares the sensitivity of a given element (E) with that of an internal standard (Rh). It is calculated by using equation 2.3. bl RSFE = (IE - IE ) mRhP P (lRh-lRhbl) mE where: IE, lEbl, iRh, lRhbl = intensity of E, Rh from standard solution, blank rriEP, mRhP = mass transfer rate of E, Rh to the plasma Equation 2.3 The RSF was detennined by nebulizing, into the plasma, a standard solution containing the analyte elements and rhodium (Section 2.2.1) and a blank solution containing 1% (w/w) HNO3. The measured intensities were averaged over a period of 10 minutes after allowing a 5-minute period for rinsing. 44 The mass transfer rate of an analyte element or rhodium to the plasma was calculated by using equation 2.4. P mE = ([E]STDU)-([E]DD) where: U = uptake rate, D = drain rate [E]D = concentration of the element in the drain solution Equation 2.4 The drain solution was collected into a container during the 10-minute analysis period. [E]D was determined by FIA-ICP-MS. D was calculated by weighing the collection container before and after the 10-minute analysis period. Siiriilarly, U was calculated by weighing the standard solution container before and after the 15-minute rinse and analysis period. During the analysis of the gases, the rhodium internal standard was nebulized into the plasma continuously. The peak areas (AG) of the gaseous compounds were integrated by using the Microcal Origin program The rhodium intensity was averaged over the analyte peak width (IRIO. The amount of metal(loid) gas (mo) was then calculated by using equation 2.5. Equation 2.5 is obtained by integration of equation 2.3 over the peak width. P mo = (AGmRh Wb)/(iRh RSFE) where: Wb = width of analyte peak at base Equation 2.5 45 2.7 SUMMARY HG-GC-AAS methods were refined for the analysis of aqueous inorganic and methyl arsenic and antimony species. These species were adequately separated and the detection limits for DMAA, TMAO and inorganic arsenic were estimated at 0.1 ppb. The detection limit for TMSbO was estimated at 0.2 ppb. As(V) was completely removed from a mixture of As(III) and As(V) with no loss of As(III) by eluting samples through a strong anion-exchange cartridge. This allowed the determination of As(III) and As(V) by difference from the total inorganic arsenic. Total elemental concentrations in aqueous solution were obtained by FIA-ICP-MS. Volatile organometal(loid) compounds were analyzed by using GC-ICP-MS. The amounts of these compounds were deteirnined semi-quantitatively by using a single point calibration with a rhodium internal standard, and with nebulization of aqueous standards. Volatile arsenic compounds were analyzed by using purge and trap-GC-AAS. A method was developed for the semi-quantification of TMA by using an external calibration curve of a standard generated through hydride reduction. The detection limit was 5 ng of TMA and the RSD of the AAS signal given by triplicate aliquots of 155 ng of TMA was 8%. 46 CHAPTER 3 ISOLATION AND IDENTIFICATION OF ARSENIC METHYLATING MICROORGANISMS 3.1 INTRODUCTION A variety of bacteria such as Staphylococcus aureus, Clostridium perfringens and streptococci have been investigated in association with SIDS.129"131 This work considered primarily the in vivo formation of toxins by pathogenic bacteria that infect infants49'132 55 57 The "toxic gas hypothesis" put forward by Richardson ' proposes that the formation of toxic and volatile arsines, stibines or phosphines from infants' bedding materials by S. brevicaulis (Section 1.4) may be a primary cause of SIDS. The majority of studies of this "toxic gas hypothesis" have considered the role of S. brevicaulis in SIDS. S. brevicaulis, however, is not commonly found on bedding materials.63 Warnock and Campell isolated several Bacillus species from PVC mattress covers, but they did not examine the interaction of these species with arsenic or antimony.62 Jenkins et al incubated the inner polyurethane foam from infants' mattresses (SIDS and non-SIDS cases) under anaerobic conditions with porcine faeces inoculum and with monoseptic cultures of common enteric bacteria such as Salmonella gallinarum and Escherichia coli. They found no volatilization of antimony, arsenic or phosphorus.133 47 A wide variety of aerobic microorganisms are present on infants' bedding materials63 and some of these organisms may be able to volatilize arsenic or antimony from the bedding materials. In the present work, the microorganisms extant on infants' sheepskin bedding material (SIDS and non-SIDS cases) were isolated. Sheepskin is a commonly used bedding material that appears to be associated with a number of incidences of SIDS in New Zealand.64 The fleece may contain significant amounts of arsenic and antimony if the sheep have grazed where the soil contains these elements.134 Furthermore, the physical nature of the sheepskin makes it hard to clean, providing fertile ground for the growth of microorganisms. The isolates from the sheepskin bedding material were screened for their ability to methylate As(III) and MMA(V) and to form TMAs(V) species, precursors to volatile trimethylarsine. Those isolates that methylate arsenic were identified through amplification of their rDNA by the polymerase chain reaction (PCR) followed by 135 sequencing of their rDNA. 48 3.2 EXPERIMENTAL All operations involving the handling of live microorganisms were carried out in a biosafety hood, both to prevent contamination of the microorganism cultures and for the safety of the operator. S. brevicaulis is an opportunistic pathogen and some of the sheepskin isolates could also be pathogenic. 3.2.1 Materials Nutrient agar, tryptic soy agar, potato dextrose agar, Sabouraud agar, nutrient broth and tryptic soy broth were purchased from Difco. Potato dextrose broth was purchased from Sigma and Sabouraud broth was purchased from BBL. Broth, agar plates and agar slants were prepared by using standard methods and as recommended by the manufacturers. The media and other materials were autoclaved, as necessary, for 20 min at 121 °C and 1.38 bar. Liquid medium cultures were maintained on a rotary shaker (4.45 cm displacement, 135 rpm). D. H2O was used to prepare all solutions. Glassware for the arsenic experiments was soaked, overnight in 1 M nitric acid and then rinsed with d. H20. 3.2.2 Characterization of Sheepskin Bedding Materials Four pieces of sheepskin bedding material were obtained from T. J. Sprott (Auckland, New Zealand). Two were new (Newl, New2), one had been used by a healthy infant (Usedl) and one had been used by an infant who perished of SIDS (SIDS1). The sheepskin bedding materials consist of approximately 2-mm-thick skin and 4-cm-long wool. 49 3.2.2.1 Analysis of Sheepskin Bedding Materials for Total Arsenic Content The wool and the skin of triplicate 16-cm2 samples of each sheepskin bedding material were separated by using a scalpel. The skin and the wool were then digested in acid in preparation for arsenic analysis by using HG-GC-AAS.136 The samples were placed in test tubes (outer diameter 16- x 140-mm) and 2 mL of concentrated nitric acid (doubly distilled in quartz, Seastar) was added to each test tube. The test tubes were transferred to a heating block, gradually heated to 150 °C over a period of five hours and were then cooled to room temperature. Hydrogen peroxide (2 mL, 30% (w/v) in water, reagent grade, Fisher) and a further 1 mL of concentrated nitric acid were added to each test tube. The test tubes were heated again to 150 °C and were maintained at this temperature until the samples had evaporated to dryness. The samples were re-dissolved in 10.00 mL of H2O. Three test tubes containing no sample were prepared in the same manner as the sample digests as blanks. The arsenic concentrations in the digests were determined by using HG-GC-AAS, as described in Section 2.3. 3.2.3 Isolation of Aerobic Microorganisms Extant on Sheepskin Bedding Materials Discs (1-cm-diameter) were cut from the sheepskin bedding materials (Newl, New2, Usedl, SIDS1) by using a sterile hole-punch and were moistened with 5 mL of sterile d. H2O. A disc of each sheepskin was placed on separate plates of nutrient, tryptic soy, Sabouraud and potato dextrose agars to facilitate the growth of bacteria and fungi. This was performed in duplicate. The plates were incubated at 21 °C and were examined daily for the growth of colonies. These colonies were further plated until plates containing distinct single organism cultures were obtained. The cultures were 50 characterized and differentiated by macroscopic and microscopic examination and, for bacterial cultures, by Gram staining (Sigma kit). Seed cultures were prepared by inoculating a 2-mm-diameter loop of the single organism culture into 50 mL of the appropriate hquid medium (nutrient, tryptic soy, Sabouraud or potato dextrose broth) in a 125-mL Erlenmeyer flask. The flasks were closed with disposable foam plugs (Jaece) and were maintained on the rotary shaker at 21 °C. The seed cultures were sub-cultured monthly by transferring 5 mL of the seed culture into a flask containing 45 mL of the appropriate media. Monthly, the cultures were also observed microscopically and plated onto appropriate solid media to ensure that they remained axenic. Samples of each culture were stored as part of the Biological Services Laboratory's culture collection (Department of Chemistry, University of British Columbia). Three agar slants were prepared for each fungal culture. The slants were inoculated by streaking the slant with a 2 mm-diameter loop of the hquid culture and the fungi were grown on the slants for two weeks at 21 °C. Mineral oil was sterilized by heating in an oven at 180 °C for 4 h. The slants were covered with sterile mineral oil and were stored at 21 °C. Three cryo-preservation vials (1.8 mL, Nunc) containing 0.5 mL of 20% glycerol and 0.5 mL of the appropriate double-strength hquid medium (individually autoclave sterilized) were prepared for each bacterial culture. The tubes were inoculated and incubated at 21 °C for four hours. They were then cooled slowly in a bio-freezing vessel (Bicell) to -80 °C in a freezer and were stored in the freezer. 51 3.2.4 Screening of the Isolated Microorganisms for their Ability to Methylate Arsenic Two 125-mL'Erlenmeyer flasks were prepared for each of the isolates. Forty-five mL of the appropriate broth was added to each flask. As(III) was added to one set of flasks and MMA(V) was added to the second set of flasks, such that the final concentration of the arsenic in the media was 560 ppb. The flasks were capped with foam plugs and were autoclaved. After cooling to room temperature, 5 mL of the seed culture was added aseptically. Two blank flasks containing only broth and arsenic were also prepared, in the same manner, for each of the four broths, nutrient, potato dextrose, Sabouraud and tryptic soy, with each of the arsenic species, As(III) and MMA(V). The flasks were incubated on the rotary shaker at 21 °C for 28 days. An aliquot (5 mL) from each flask was then transferred to a 15 mL centrifuge tube (Falcon polypropylene) and was frozen (-20 °C) until analysis. The aliquots were qualitatively analyzed by HG-GC-AAS, as described in Section 2.3, for the presence of methylated arsenic products. 52 3.2.5 Identification of Selected Microorganisms Two of the fungal isolates which methylate arsenic, culture collection numbers 332 and 335, were identified by amplification and sequencing of their 26S rDNA. The third fungal isolate which methylates arsenic, culture collection number 337, was identified by Microbe Inotech Laboratories Inc. (St. Louis, MO). Several of the bacterial isolates were also identified, by amplification and sequencing of their 16S rDNA. M.Delisle, S. Ip and C. Franz of the Biological Services Laboratory (Department of Chemistry, University of British Columbia) carried out the genomic DNA extractions and the amplification and sequencing reactions. 3.2.5.1 Materials Used in the Identification of Microorganisms Primers for the polymerase chain reaction and for the rDNA sequencing reactions were prepared by the Nucleic Acid and Protein Sequencing laboratory (University of British Columbia). Teirriinator mix (Big Dye) was purchased from Applied Biosystems. Taq (Thermus aquaticus) DNA polymerase, dATP, dCTP, dGTP, dTTP and agarose gel (1%) were purchased from Gibco BRL. 3.2.5.2 Extraction of Genomic DNA from Selected Isolates137 Seed culture (100 mL) was transferred to a 250 mL polyethylene bottle and centrifuged (Sorvall, RC-5B rotor) at 8 000 rpm for 10 min. The supernatant was discarded and the fungal pellet was re-suspended in 30 mL of buffer (pH 8.5, 200 mM Tris-HCI, 250 mM sodium chloride, 25 mM EDTA, 0.5% sodium dodecyl sulphate). The 53 cell suspension was transferred to a 50 mL centrifuge tube (Falcon, polypropylene), was homogenized for 2 min (Omni PCR tissue homogeniser) and was cooled on ice for 2 min. The fracturing and cooling steps were repeated four times. Chloroform (7 mL) and 7 mL of the lysed cell culture were added to a 50 mL centrifuge tube. These were mixed for 5 s (vortex mixer) and centrifuged for 10 min at 10 000 rpm (Sorvall, RC-5B rotor). The aqueous phase was transferred to another 50 mL centrifuge tube and 2-propanol was added to this phase (0.54 mL per mL of aqueous phase) precipitating out the genomic DNA. The genomic DNA was collected by centrifuging the mixture for 3 inin at 10 000 rpm After discarding the supernatant, the pellet was mixed for 5 s (vortex mixer) with 500 pL of 70% ethanol. This mixture was centrifuged for 5 mill at 13 000 rpm (IEC Micromax, 851 rotor), the supernatant was discarded and the pellet was dried under vacuum (Savant SpeedVac concentrator). The dried pellet was re-suspended in 50 pL of sterile d. H2O and was dissolved by heating at 55 °C for 1 h. The genomic DNA solution was stored in a freezer at -20 °C. 3.2.5.3 Polymerase Chain Reaction138 The genomic DNAs extracted from the selected isolates were amplified by using the polymerase chain reaction. The polymerase chain reaction mixture contained the following components: 2.0 pL genomic DNA solution (Section 3.2.5.2), primers, 5.0 pL buffer (pH 8.5, 200 mM Tris-HCl, 500 mM potassium chloride), 0.20 pL Taq DNA polymerase (5 U/pl), 0.40 pL deoxynucleoside triphosphate mixture (25 pM each of 54 dATP, dCTP, dGTP, dTTP), d. H20 (such that the total volume of the reaction mixture was 48.5 \xL). The fungal 26S rDNA was amplified by using primers NL-1 (5' GCATATCAATAAGCGGAGGAAAAG 3', 0.40 \ih, 102 ixM) and NL-4 (5' GGTCCGTGTTTCAAGACGG 3', 0.45 uL, 79.5 LXM).139 The bacterial 16S rDNA was amplified by using primers 27f (5' AGAGTTTGATC(CA)TGGCTCAG 3', 0.25 uL, 40 ixM) and 1525r (5' AAGGAGGTG(TA)TCCA(GA)CC 3', 0.35 ixL, 40 LXM). 140 A variety of bacterial primers, including 27f and 1525r, were tested for the PCR amplification of the rDNA of the isolate numbered 364 in the culture collection. The rDNA of this isolate was not amplified by using any of these primers. The rDNA of this bacterium was, however, amplified by using primers NL-1 (0.25 |iL, 102 \xM) and NL-4 (0.30 uL, 79.5 fiM). The polymerase chain reaction mixture was cooled to 0 °C and transferred to a thermocycler (MJ Research MiniCycler). The genomic DNA was denatured at 94 °C for 3 min and then 1.5 |iL of 50 mM magnesium chloride was added. Amplification was performed for 30 cycles with denaturation at 94 °C for 45 s, annealing at 55 °C for 40 s, and elongation at 72 °C for 90 s. The elongation time of the final cycle was 10 min. 3.2.5.4 Purification of rDNA PCR Products The rDNA PCR products were purified by using gel electrophoresis. The gel was prepared by dissolving 0.26 g of agarose gel in 30 mL of buffer (pH 8.5, 2 M Tris-acetic 1 acid, 0.1 M NaEDTA2 H20). Efhidium bromide (30 ixL, 0.5 g L" ), a fluorescent dye that binds to DNA, was also added to the gel solution to enable visualization of the rDNA bands after the electrophoresis was complete. The gel was prepared by the standard 55 method and the PCR products were loaded onto the prepared gel. Gibco BRL lOx Blue Juice was used as a gel-loading buffer, as outlined in the manufacturer's protocol, and the gel electrophoresis was carried out at 85 V for 40 min. The gel was then examined under UV light and the brightest bands were cut from the gel. The amplified rDNAs of these bands were each separated from the gel by using a gel extraction kit (QIAGEN QIAquick, standard protocol). To prepare for the sequencing reactions, the concentration of the rDNA in the solutions resulting from the gel extraction was estimated by using spectrophotometry. The absorbance of the solutions, after appropriate dilution, was measured at wavelengths of 260 nm and of 280 nm This procedure was first developed by Warburg and Cristian to detennine protein purity in the presence of nucleic acids141 and can be applied to the determination of DNA concentration in the presence of protein contamination. The concentration of the rDNA in the diluted solution can then be calculated, based on the differing absorbencies of proteins and DNA at 260 and 280 nm, by using equation 3.1. 1 [DNA] (mg L" ) = (A260nm X 62.9) - (A280nm x 36.0) Equation 3.1 3.2.5.5 Sequencing Reactions and Isolate Identification The amplified rDNA was sequenced by using the Sanger dideoxy procedure.142 The sequencing reaction mixtures contained the following components: terminator mix (4.0 pL), primer (0.6 pL), purified rDNA PCR product (20 pg rDNA) and sterile d. H20 (11.2 pL). Primer 27f (Section 3.2.5.3) (40 pM) was used for the sequencing reactions for the bacteria and primer NL-1 (102 pM) was used for the sequencing reactions for the 56 fungi and for the isolate numbered 364 in the culture collection. Amplification was performed for 25 cycles, following an initial denaturation at 96 °C for 1 min, with denaturation at 96 °C for 30 s, annealing at 50 °C for 15 s, and elongation at 60 °C for 4 min. The sequencing reaction products were separated from any remaining starting materials by passing the final reaction mixture through a CENTRI-SEP Column (Princeton Separations, standard protocol). The sequencing reaction products were then dried under vacuum (Savant SpeedVac concentrator). Sequence deteraiination was performed by the Nucleic Acid and Protein Sequencing laboratory (University of British Columbia), the generated DNA sequences were aligned using the National Center for Biotechnology Information website [http: //w w w. ncbi. nlm nih. go v/Blast] and the sequences were submitted to the Basic Local Alignment Search Tool for a similarity match. 57 3.3 RESULTS AND DISCUSSION 3.3.1 Arsenic and Antimony Concentration in the Wool and the Skin of Sheepskin Bedding Materials The bedding materials contain an average of 170 ± 10 mg of wool and 80 ± 8 mg of skin per cm2. The concentration of arsenic in the wool and in the skin of the sheepskin bedding materials, as determined by HG-GC-AAS analysis of the acid digests, is given in Table 3.1. The skin and the wool of the sheepskin bedding materials contain 90 to 380 ppb of arsenic. The arsenic concentration in sheep wool reflects the arsenic concentration in the environment where the sheep graze.143 Kolacz et al134 found that the arsenic concentration in the wool of sheep grazing in areas low in arsenic was 29 ppb; Raab found that the arsenic concentration in the wool of sheep grazing on seaweed was 5.2 ppm65 Little is known about the form of the arsenic in the sheepskin or wool and, hence, its bioavailabUity to lxiicroorganisms. Table 3.1 Arsenic contenta'b (ppb) of sheepskin bedding materials, deteraiined by nitric acid digestion of the materials, HG-GC-AAS analysis of the digests, (SD) Skin Wool Newl 190(10) 140 (50) New2 180(10) 370 (60) Usedl 380 (40) 90 (50) SIDS1 360(20) 360 (80) "detection limit = 20 ppb As baverage of triplicate digests 58 3.3.2 Aerobic Microorganisms Isolated from Sheepskin Bedding Materials In all, thirty-three isolates were obtained by plating on agar the four pieces of sheepskin bedding material. These isolates appeared to be distinct species by comparison of their macroscopic and microscopic appearances, and the isolates are described in Tables 3.2 to 3.5. The microscopic appearances of the fungi are complex, and so, are not included in the description of the isolates. The numbers of isolates from Newl and from New2 were much lower than the number of isolates from either Usedl or from SIDS1. This indicates that these pieces of bedding material have not been contaminated and confirms their validity as unused controls. The number of bacterial isolates was larger than the number of fungal isolates for both the Usedl and for the SIDS1 sheepskins. SIDS1, however, yielded a greater proportion of fungi than did Usedl. A much larger study.would be necessary to detenriine if this is significant. 59 Table 3.2 I solates from New 1 Appearance Culture Number Organism Isolation Macroscopic Microscopic (Section 3.2.3) Type Agar transparent, shiny, 343 fungus nutrient colourless, frost pattern Gram positive potato circular, pink, 344 rods bacterium dextrose transparent yellow, shiny, smooth, 347 fungus tryptic soy flat Gram positive circular, beige, glossy 348 tryptic soy rods bacterium 60 Table 3.3 Isolates from New2 Appearance Culture Number Organism Isolation Macroscopic Microscopic (Section 3.2.3) Type Agar Gram positive white, slightly darker 349 nutrient rods bacterium centre, shiny, round transparent, shiny; Gram positive 350 Sabouraud small, doughnut rods bacterium shaped beige, raised, Gram positive 351 tryptic soy irregularly- shaped rods bacterium colonies yellow, shiny, smooth, 352 fungus tryptic soy flat, regular edges Gram negative white, very small, 353 tryptic soy rods bacterium round 61 Table 3.4 Isolates from Used 1 Appearance Culture Number Organism Isolation Macroscopic Microscopic (Section 3.2.3) Type Agar Gram negative white, flat, flower- 354 nutrient rods bacterium pattern, irregular edge white, transparent, Gram negative 355 nutrient very flat, irregular coccoid bacterium edge black, very thick, potato 356 fungus large, shiny in middle, dextrose fuzzy on edges white with a few red Gram negative potato 357 spots, flat, irregular rods bacterium dextrose edges Gram negative potato pale pink, smooth, 358 coccoid bacterium dextrose flat, rhizoid potato pale pink, transparent, 362 fungus • dextrose shiny, smooth, flat 364 uncertain Sabouraud yellow, smooth, raised rods Gram positive yellow, shiny, raised, 365 Sabouraud rods bacterium concentric rings Gram negative pale yellow, shiny, coccoid, some 366 Sabouraud bacterium concentric rings with flagella Gram positive 367 tryptic soy bright yellow, raised rods bacterium white, shiny, regular 368 fungus tryptic soy edge Gram positive white, darker centre, 369 tryptic soy rods bacterium raised 62 Table 3.5 Isolates from SIDS 1 Appearance Culture Number Organism Isolation Macroscopic Microscopic (Section 3.2.3) Type Agar transparent, many 325 fungus nutrient small round colonies forming frost pattern Gram negative transparent, cloudy, 326 nutrient coccoid bacterium very thin Gram negative beige, smooth, flat coccoid 327 nutrient bacterium shiny, regular edge chains Gram negative white, shiny, smooth, 328 nutrient coccoid bacterium regular edge potato 329 fungus transparent, shiny, flat dextrose Gram negative potato transparent, shiny, 330 rods bacterium dextrose round Gram negative potato transparent, shiny, 331 rods bacterium dextrose irregular colonies potato white, dull, irregular 332 fungus dextrose edge Gram negative potato beige, shiny, raised, 334 coccoid bacterium dextrose irregularly shaped white, shiny, small, 335 fungus Sabouraud flat transparent, flat, Gram positive 336 Sabouraud small, round fonning rods bacterium frost pattern white, transparent, 337 fungus Sabouraud shiny, flat, rhizoid 63 Table 3.5 (continued) Isolates from SIDS1 Appearance Culture Number Organism Isolation Macroscopic Microscopic (Section 3.2.3) Type Agar Gram negative white, smooth, regular 338 tryptic soy rods bacterium edges Gram positive white, shiny, raised, 339 tryptic soy rods bacterium regular edges Gram negative beige, powdery 340 tryptic soy coceo id bacterium surface, irregular edge Gram positive white/beige, shiny, 341 tryptic soy rods bacterium raised Gram positive cloudy, transparent, 342 tryptic soy rods bacterium covers plate 64 5 3.3.3 Arsenic Methylation by Isolates After incubation of each isolate with As(III) and with MMA(V) for 28 days, the sample aliquot taken at the end of the experiment was analysed directly by using HG-GC- AAS (Section 2.3). Any methylarsenic species present in the aliquots were identified by comparison of their retention times with those of the standards (see Figure 2.2). Three of the fungi that were isolated from SIDS1 produced trimethylarsenic(V) species. None of the isolates from the new sheepskin bedding materials (Newl, New2) or from the bedding material used by a healthy infant (Usedl) methylated arsenic. No change in the speciation of the arsenic in the blank flasks was observed. The isolate numbered 337 in the culture collection methylated As(III) yielding trimethylarsenic(V) species and a small amount of dimethylarsenic species. This is seen in the chromatogram in Figure 3.1. This isolate also methylated MMA(V) yielding trimethylarsenic(V) species, as shown by the chromatogram in Figure 3.2. The isolates numbered 332 and 335 in the culture collection methylated MMA(V) yielding trimethylarsenic(V) species and a small amount of dimethylarsenic species. As(III) was not methylated by either of these isolates. One of the isolates from Usedl, culture collection number 364, demethylated MMA(V) yielding inorganic arsenic. This is shown by the chromatogram in Figure 3.3. Little is known about the demethylation of methylarsenic species by microorganisms. This isolate did not methylate arsenic. 65 Figure 3.1 HG-GC-AAS analysis of 0.50 mL aliquot of isolate #337 after incubation with As(III) for 28 days 66 0.12 Time (min) Figure 3.2 HG-GC-AAS analysis of 0.25 mL aliquot of isolate #337 after incubation with MMA(V) for 28 days 67 0.09 Time (min) Figure 3.3 HG-GC-AAS analysis of 0.15 mL aliquot of isolate #364 after incubation with MMA(V) for 28 days 68 3.3.4 Identification of Bacteria and Fungi Isolated from Sheepskin Bedding Materials The identities of the bacterial and fungal isolates from the sheepskin bedding materials, as determined by amplification and sequencing of their rDNA, is listed in Table 3.6. The majority of the isolates, from each of the four pieces of sheepskin bedding material, are common Bacillus species. Chin and Watts144 found that Bacillus species are predominant in dry sheep fleece. Warnock et al62 found, in their investigation of polyvinyl chloride mattress covers on which infants perished of SIDS, that bacteria, and in particular Bacillus species, are the prevalent organisms. The isolate numbered 337 in the culture collection, which methylated both As(III) and MMA(V) to form triixiethylarsenic species, was identified as Scopulariopsis koningii. S. koningii is of the same genus as S. brevicaulis, a fungus that was shown by Gosio5, in 1893, to be active in arsenic volatilization and that is now well-known for its ability to methylate arsenic4'8. S. brevicaulis has recently received considerable attention in 57 connection with SIDS and the "toxic gas hypothesis". The isolate numbered 335 in the culture collection, which methylated MMA(V) to form trimethylarsenic species, was identified as Fomitopsis pinicola. The isolate numbered 332 in the culture collection, which similarly methylated MMA(V), was identified as PenicUlium gladioli. Several other PenicUlium species methylate arsenic to trimethylarsenic species including P. chrysogenum and P. notatum.145 The methylation of arsenic species by S. koningii, P. gladioli or F. pinicola, however, has not been previously reported. 69 The isolate numbered 364 in the culture collection, which demethylated MMA(V) to yield inorganic arsenic species, was identified as Mycobacterium neoaurum. Very little is known about the demethylation of methylarsenic species by microorganisms and the demethylation of methylarsenic species by Mycobacterium neoaurum has not been previously reported. It should be noted that several of the identified sheepskin bedding material isolates are pathogenic. Scopulariopsis koningii is keratinolytically active and causes skin and nail lesions.146 Mycobacterium neoaurum bacteraemia has been reported.147'148 Acinetobacter junii, culture collection number 357, causes life-threatening infection in pre-term newborn infants.149'150 The pathogenicity of some of the microorganisms present on infants' bedding materials could also play a role in SIDS. 70 Table 3.6 Identification of isolates from sheepskin bedding materials Sequencing Results Culture Collection Sheepskin Name Number of Percentage Number Source Base Pairs Match (Section 3.2.3) 344 Newl Bacillus subtilus 521 97 348 Newl Bacillus licheniformis 598 98 349 New2 Bacillus oleronius 543 96 350 New2 Bacillus subtilus 611 97 351 New2 Bacillus licheniformis 623 97 357 Usedl Acinetobacter junii 410 95 364 Usedl Mycobacterium neoaurum 508 97 365 Usedl Bacillus licheniformis 623 97 367 Usedl Bacillus subtilus 668 97 369 Usedl Bacillus pumilus 534 81 332 SIDS1 Penicillium gladioli 570 98 335 SIDS1 Fomitopsis pinicola 557 91 336 SIDS1 Bacillus subtilus 686 97 337 SIDS1 Scopulariopsis koningii 314 100 339 SIDS1 Bacillus licheniformis 434 97 341 SIDS1 Bacillus pumilus 753 97 71 3.3.5 Photographs of Arsenic Methylating Microorganisms 73 B 59 Figure 3.6 15 Day old culture of F. pinicola A) colonies on Sabouraud agar B) microscopic smear 60X magnification 7-4 3.4 SUMMARY Acid digestion of samples of the sheepskin bedding materials followed by HG- GC-AAS analysis of the digests showed that the skin and the wool of the sheepskin bedding materials contain 90 to 380 ppb of arsenic. Thirty-eight aerobic microorganism isolates were obtained from the four pieces of sheepskin bedding materials. Fewer microorganisms were isolated from the unused sheepskin bedding materials (NEW1, NEW2) than from the other bedding materials. The bedding material used by an infant who perished of SIDS (SIDS1) yielded a greater variety of isolates than the bedding material used by a healthy infant (USED1). Incubation of each of these isolates in liquid media with 500 ppb as arsenic of As(III) or MMA(V) showed that three of the fungal isolates from SIDS1 methylate arsenic. One isolate methylated both As(III) and MMA(V) yielding trimethylarsenic species. Two isolates methylated only MMA(V). One bacterial isolate from USED1 demethylated MMA(V) yielding inorganic arsenic species. Identification of selected isolates by amplification and sequencing of their rDNA showed that the majority of the identified isolates were common Bacillus species. The fungal isolate which methylated both As(III) and MMA(V) was identified as Scopulariopsis koningii. The other two fungal isolates that methylate arsenic were identified as PenicUlium gladioli and as Fomitopsis pinicola. The bacterial isolate which demethylated MMA(V) was identified as Mycobacterium neoaurum. Arsenic methylation or the demethylation of methyl arsenic by these species of microorganisms has not previously been reported. 75 Arsenic methylating microorganisms are present in the SIDS1 sheepskin bedding material. This indicates that there is the potential for the formation of volatile trimethylarsine. The following chapter explores the methylation of arsenic by Scopulariopsis koningii, Penicillium gladioli and Fomitopsis pinicola, and the demethylation of methylarsenic species by Mycobacterium neoaurum. The biological volatilization of arsenic is examined in Chapter 6. 76 CHAPTER 4 METHYLATION AND DEMETHYLATION: INVOLATILE ARSENIC AND ANTIMONY METABOLITES 4.1 INTRODUCTION The development of the hydride generation method for the speciation of inorganic and methylated arsenic by Braman and Forebak in 197380 opened up the study of these species in the environment. In particular, HG analysis enabled studies of the formation of involatile methylated arsenic compounds by microorganisms to be carried out. Although a wide variety of microorganisms have been shown to methylate arsenic145'151"153, arsenic methylation by microorganisms is certainly not universal, and much work remains in order to elucidate the conditions that affect methylation and the formation of trimethylarsenic(V) species, precursors to volatile trimethylarsine. Much less is known about the methylation of antimony by microorganisms. Barnard, a student of Challenger, found some evidence that Penicillium notatum produced a volatile antimony compound upon incubation with phenylstibonic acid and with potassium antimonate.18 This work has not been able to be confirmed by using modern analytical methods. More recent experiments, in which soil enrichment cultures were incubated with potassium antimonyl tartrate or potassium hexahydroxyantimonate, yielded trimethylstibine.154'155 S. brevicaulis was the first microorganism clearly shown to methylate antimony in pure culture.60'61 Other microorganisms now known to methylate antimony include Cryptococcus humicolus, Clostridium spp., Phaeolus schweinitzii,Methanobacteriumformicicum, andDesulfovibrio vulgaris91'156'15* 77 Few accounts of arsenic dealkylation by microorganisms have been published. Challenger found that PenicUlium notatum is able to cleave an arsenic-carbon bond of ClCH2CH2AsO(OH)2 converting the compound to trimethylarsine. Demethylation of mono- and dimethylarsenic compounds in soils and by isolates from soils such as Alcaligenes and Pseudomonas has been reported.9'159"161 Wine yeast demethylate dimetbylarsinate to methylarsonate.162 Cullen et al found that homogenates of C. humicola incubated with S'-adenosylmetWonine and NADPH demethylated [14C]dimethylarsinate to [14C]methylarsonate.163 Quinn et al isolated a bacterium from activated sludge which dealkylated arsonacetate and used arsonoacetate as the sole carbon and energy source.164 The mechanism(s) of demethylation are not known. In the present work, the formation of involatile methylated arsenic compounds, and in particular the formation of trimethylarsenic(V) species, precursors to volatile trimethylarsine, by fungal isolates from the SIDS 1 sheepskin bedding material (described in Chapter 3), namely Scopulariopsis koningii, PenicUlium gladioli and Fomitopsis pinicola, is investigated. The range of arsenic compounds that are methylated and the amount methylation as a function of time is determined for each fungal isolate. The ability of these fungal isolates to methylate antimony is also assessed. The demethylation of arsenic compounds by Mycobacterium neoaurum is examined. 78 4.2 EXPERIMENTAL Distilled deionised water (d. H2O) was used to prepare all solutions. Glassware for the arsenic and antimony experiments was soaked overnight in 1 M nitric acid and then rinsed with d. H2O. Arsenic and antimony stock solutions (1000 ppm as element) were prepared from the appropriate compounds as described in Section 2.2.1. These solutions were sterilised by filtering through 0.22 lim syringe filters (Pall Acrodisc) before adding to the sterile media. All operations involving the handling of live microorganisms were carried out in a biosafety hood. 4.2.1 Time Study of Arsenic Methylation and Demethylation The amount of TMAs(V) produced from MMA(V) by S. koningii (isolate # 337), and the amounts of As(III) and As(V) produced from MMA(V) by M. neoaurum (isolate # 364) were measured as a function of time. Six 125-mL Erlenmeyer flasks were prepared for each microorganism Forty-five mL of the appropriate broth was added to each flask, the flasks were capped with foam plugs and were autoclaved. After cooling to room temperature, 5 mL of the seed culture was added aseptically. Sterile MMA(V) (1000 ppm) was then added asepticalfy such that the final concentration of MMA(V) in the media was 500 ppb as arsenic. The flasks were incubated at 21 °C on the rotary shaker. At 0, 5, 10, 20, 30 and 45 days, one flask of M. neoaurum was removed from the shaker and stored in a freezer at -20 °C. At 0, 3, 7, 14, 30 and 45 days, one flask of S. koningii was removed from the shaker and stored in a freezer at -20 °C. 79 S. koningii was separated from the media by gravity filtering the flask contents through filter paper (Whatman, No. 41, 11.0 cm diameter). M. neoaurum was separated from the media by centrifugation at 5000 rpm for 20 minutes (Sorvall RC-5B). The biota were freeze-dried and then weighed. The masses of the dry biota (MMA(V) and blanks) were plotted against the ages of the cultures. The media was weighed. For M. neoaurum, the media were analysed directly by HG-GC-AAS for the concentration of inorganic arsenic (As(III) and As(V)) products. Aliquots of the media were also passed through a strong anion-exchange column to remove As(V) (Section 2.3.2.5) and these aliquots were then analysed by HG-GC-AAS for the concentrations of As(III). The amounts of As(V) were detenxiined by the difference between the inorganic arsenic and the As(III) concentrations. For S. brevicaulis, the media were analysed directly by HG-GC-AAS (Section 2.3) for the concentration of TMAs(V) products. 4.2.2 Incubation of 5. koningii, F. pinicola and P. gladioli, M. neoaurum with Inorganic and with Methylated Arsenic Species Each of the three fungal isolates which was found to methylate arsenic to form trimethylarsenic species, namely P. gladioli, F. pinicola and S. koningii, and the bacterium that demethylates MMA(V), M. neoaurum, were incubated with each of As(III), As(V), MMA(III) and MMA(V). M. neoaurum was also incubated with DMAA and TMAO. Three flasks were prepared for each isolate and each arsenical as described in Section 4.2.1. After autoclaving, the appropriate arsenicals were added asepticalfy to the flasks (1000 ppm stock solution) such that the final concentration of arsenic in the media was 500 ppb. 80 Two killed cell controls were prepared for each isolate and each arsenic species in the same way as for the samples, except that the seed cultures were added to the flasks prior to autoclaving. Three blank flasks were also prepared for each microorganism, in the same way as for the samples, except that no arsenic was added to the flasks. All cultures were incubated on the rotary shaker for 28 days. At the end of the experiment, the fungi were separated from the media by filtration and M. neoaurum was separated from the media by centrifugation, as described in Section 4.2.1. The media were weighed. The biota were freeze-dried and then weighed. The inorganic and methylated arsenic species were extracted from the freeze-dried biota (Section 4.2.2.1). The media were frozen for later analysis by HG-GC-AAS. For the three fungi, the media and extracts were analysed directly by HG-GC- AAS (Section 2.3) for the concentrations of methylarsenic products. For M. neoaurum, the media and extracts were analysed directly by HG-GC-AAS for the concentrations of inorganic arsenic (As(III) and As(V)) products. Aliquots of the media and extracts were also passed through a strong anion-exchange column to remove As(V) (Section 2.3.2.5) and these aliquots were then analysed by HG-GC-AAS for the concentrations of As(III). 4.2.2.1 Extraction of Inorganic and Methylated Arsenic Species from Biota165 166 A 1:1 mixture of methanol/ d. H2O (10 mL) was added to the entire freeze-dried pellet of biota in a 50 mL centrifuge tube (Falcon). The mixture was homogenized (Omni PCR tissue homogenizer) for 1 minute at high-speed and was then centrifuged at 5000 rpm for 20 minutes (Sorvall RC-5B). The supernatant was removed and collected. These steps were repeated two more times. The collected extracts were combined in 81 another 50 mL centrifuge tube and dried under vacuum at room temperature (Savant SpeedVac concentrator). D. H20 (10 mL) was added to the dried extract and the tube was sonicated for 10 minutes to re-dissolve the dried extracts. 4.2.3 Incubation of S. koningii, F. pinicola and P. gladioli with Inorganic Antimony Species The three fungal isolates which methylate arsenic, namely P. gladioli, F. pinicola and S. koningii, were incubated with potassium antimonyl tartrate (20.0 ppm as Sb). S. koningii was also incubated with KSb(OH)6 (500 ppb as Sb), SbCh (500 ppb as Sb) and Sb203 (saturated solution). The flasks (triplicate) and appropriate killed cell controls (duplicate) were prepared as described in Section 4.2.1. The SD2O3 (25 mg) was added prior to autoclaving. The cultures were incubated on the rotary shaker for 28 days. At the end of the experiment, the fungi were separated from the media by filtration as described in Section 4.2.1. The media were weighed, and the biota were freeze-dried and then weighed. The methylated antimony species were extracted from the freeze-dried biota (Section 4.2.2.1). Aliquots of the media and extracts were passed through an alumina column to remove inorganic antimony (Section 2.3.2.6) and these aliquots were then analysed by HG-GC- AAS for the concentrations of methylantimony species (Section 2.3). 4.2.4 Incubation of a Mixed Culture of 5. koningii, F. pinicola and P. gladioli with As(III) and with MMA(V) A mixture of S. koningii, F. pinicola and P. gladioli was incubated with As(III) and with MMA(V) (500 ppb as As). The flasks (triplicate) were prepared as described in Section 4.2.2 and were inoculated with 1.7 mL of each seed culture. After 28 days, the 82 fungal mixtures were separated from the media by filtration (Section 4.2.1). The media were weighed and the biota were freeze-dried and then weighed. The methylated arsenic species were extracted from the freeze-dried biota (Section 4.2.2.1). The media were frozen for later analysis by HG-GC-AAS. The media and extracts were analysed directly by HG-GC-AAS (Section 2.3) for the concentrations of methylarsenic products. 4.2.5 Incubation of 5. koningii, P. gladioli and M. neoaurum with MMA(V) and Iodide S. koningii, P. gladioli and M. neoaurum were each incubated with MMA(V) (500 ppb as As) and iodide (1.65 ppm). The flasks (triplicate) were prepared as described in Section 4.2.2. Sodium iodide was added to the flasks prior to autoclaving. After 28 days, the fungi were separated from the media by filtration and M. neoaurum was separated from the media by centrifugation, as described in Section 4.2.1. The media were analysed directly by HG-GC-AAS (Section 2.3) for the concentrations of methylarsenic products. 83 4.3 RESULTS AND DISCUSSION 4.3.1 Growth Curves of 5. koningii and M. neoaurum In order to determine whether there is any relationship between arsenic methylation or demethylation, and growth of the microorganisms, the growth curves of submerged batch cultures of the filamentous fungus, S. koningii and of the bacterium, M. neoaurum, were obtained. Dry weights of the fungal cells were plotted against the ages of the cultures. Microorganisms growing in batch culture typically exhibit four phases of cell growth.167 Initially, there is a short lag phase. Next, there is the growth phase. For filamentous fungi in submerged cultures, the total cell mass is typically proportional to the cube of time.168'169 As nutrients and oxygen are depleted at the centres of the fungal colonies, deceleration of growth and then linear growth may follow cubic growth. For bacteria, the total cell mass typically increases exponentially with time during the growth phase. When one or more nutrients have been depleted from the medium limiting the growth or when toxic products build up, the stationary phase begins. The total cell mass has reached a maximum and remains constant. In the death phase, following the stationary phase, the total cell mass decreases due to cell lysis. The growth curve of S. koningii in Sabouraud broth with 500 ppb (as As) of MMA(V) is depicted in Figure 4.1. The lag phase is not seen on the growth curve and is very short as is typical for transfer of fungi into the same type of media. The growth of S. 84 koningii in this medium is rapid and the stationary phase is reached after 3 days of growth. A very long stationary phase (27 days) is followed by the death phase. The growth curve of M. neoaurum in Sabouraud broth with 500 ppb (as As) of MMA(V) is depicted in Figure 4.2. Again, the lag phase is very short. Although growth of this species of Mycobacterium is typically rapid170, the stationary phase was not reached until after 10 days of growth. Other types of media may be more appropriate for this bacterium The stationary phase lasted 10 days and was followed by the death phase. 85 Figure 4.1 Growth curve of S. koningii in submerged culture with 500 ppb (as As) of MMA(V) 86 0.25 T 0 i 1 1 1 1 i 0 10 20 30 40 50 Time (days) Figure 4.2 Growth curve of M. neoaurum in submerged culture with 500 ppb (as As) of MMA(V) 87 4.3.2 Time Study of MMA(V) Methylation by S. koningii The yield of TMAs(V) from MMA(V) by S. koningii was measured against time. This was determined by HG-GC-AAS analysis (Section 2.3) of aliquots of the media from the incubation of S. koningii with MMA(V) and is plotted in Figure 4.3. The methylation of MMA(V) occurs during the stationary phase of the growth of S. koningii. No methylation occurred during the growth phase and the amount of TMAs(V) decreased during the death phase. This indicates that the methylation of MMA(V) by S. koningii is a secondary metabolic process not related to growth. 88 25 T Time (days) Figure 4.3 Methylation of MMA(V) to TMAs(V) by S. koningii as a function of time 89 4.3.3 Arsenic Methylation by 5. koningii, P. gladioli and F. pinicola S. koningii, P. gladioli and F. pinicola were incubated with each of the arsenicals As(III), As(V), MMA(IIII) and MMA(V). The amount of dry biomass obtained for each of the three fungi, after 28 days of growth with the various arsenic species, is listed in Table 4.1. At the 500 ppb concentration level of arsenic, As(III), As(V) and MMA(V) reduced slightly the cell growth of S. koningii. None of the arsenic species reduced the cell growth of P. gladioli. Only arsenate decreased the cell growth of F. pinicola. Table 4.1 Dry biomass of fungi after 28 Days of growth with arsenicals (mg) Substrate F. pinicola* S. koningif P. gladioli3 Blank 307 (4) 384 (5) 260 (10) As(III) 330 (10) 336(9) 270 (10) As(V) 230 (10) 317 (5) 245 (3) MMA(III) 340 (10) 370 (5) 275 (8) MMA(V) 290 (10) 329 (6) 250 (5) (SD) of 3 replicates The percent conversion of the starting arsenic substrates to methylated products in the media and in the biota, after 28 days of growth of the fungi, was determined by HG- GC-AAS (Section 2.3) of the media and of the biota extracts. These results are discussed below for each fungus. No methylation of the arsenic species occurred in any of the killed-cell control flasks. This indicates that the fungi mediate the arsenic methylation. 90 4.3.3.1 F. pinicola F. pinicola methylates only MMA(V), and methylated arsenic products were detected only in the media. The amount of methylated products was small; 0.8% (SD = 0.2) of the MMA(V) was converted to dimethylarsenic species (DMAs) and 2.1% (SD = 0.8) of the MMA(V) was converted to TMAs(V). It is possible that other arsenic substrates are methylated, but the amount of product is below the detection limit. 4.3.3.2 5. koningii S. koningii methylated all four substrates. The amounts of methylated products formed from each substrate are given in Table 4.2. The amounts of trimethylarsenic products formed from the oxidized species, As(V) and MMA(V), were much greater than the amounts formed from the reduced species, As(III) and MMA(III). If arsenic methylation by S. koningii, occurs via the Challenger mechansism (Section 1.3.2), as it does for S. brevicaulis, then the oxidized species As(V) and MMA(V) are reduced to As(III) and MMA(III), respectively, prior to methylation. The differing amounts of methylation are likely due to differences in the uptake of the arsenicals into the fungus. DMAs were also produced from As(III) and MMA(III), but in much smaller amounts than the TMAs(V). The amounts of methylated arsenic products were much lower in the biota than in the media, indicating that the methylated products are primarily excreted from the organism Methylation of arsenic may be a way for the fungus to increase the excretion of toxic arsenic species. 91 Table 4.2 Percent conversion of starting substrates to methylated products by S. koningii SUBSTRATE MEDIA3 BIOTA EXTRACTS3 As(III) DMAs 0.5 (0.2) TMAs(V)2.2 (0.5) TMAs(V) 8.7 (0.5) As(V) TMAs(V) 20 (1) TMAs(V)2.8 (0.4) MMA(III) DMAs 1.2 (0.2) not detectedb TMAs(V)7.0 (0.9) MMA(V) TMAs(V) 17 (2) TMAs(V)3.4 (0.4) " (SD) of 3 replicates b detection limit = 5 ppb as As 4.3.3.3 P. gladioli P. gladioli methylated only MMA(V) and MMA(III). The selective methylation of arsenic has been noted for a number of other fungi such as Aspergillus niger, Aspergillus fischeri and Gliocladium roseum.152 Bird et aln found that P. chrysogenum and P. notatum methylate sodium methylarsonate, but do not methylate arsenious acid, and suggested that this may be related to the greater ease of reduction of MMA(V) and of methyl group addition to MMA(III). The amounts of methylarsenic products are listed in Table 4.3. When MMA(V) was the substrate, both dimethyl- and trimethylarsenic products formed and the amount of methylated products in the media was similar to the amount of methyl products in the biota. When MMA(III) was the substrate, only trimethylarsenic products formed and these were detected only in the media. In contrast to S. koningii, the amount of 92 trimethylarsenic products formed from MMA(III) was much larger than the amount formed from MMA(V). This may be due to differences in uptake of the two arsenicals or due to slow reduction of MMA(V) to MMA(III). Table 4.3 Percent conversion of starting substrates to methylated products by P. gladioli SUBSTRATE MEDIA3 BIOTA EXTRACTS3 MMA(III) TMAs(V)38 (2) no products detected MMA(V) DMAs 0.8 (0.4) DMAs 1.2 (0.2) TMAs(V)7.0 (0.9) TMAs(V)8 (1) a (SD) of 3 replicates b detection limit = 5 ppb as As 4.3.4 Methylation of As(III) and MMA(V) by a Mixed Culture of 5. koningii, F. pinicola and P. gladioli Diverse fungi are present on infants' mattresses. Their interaction could increase the yield of methylarsenic species. A mixture of the three fungi that methylate arsenic, namely, S. koningii, F. pinicola and P. gladioli, were incubated with As(III) and with MMA(V). If S. koningii follows the stepwise oxidative methylation and reduction steps of the Challenger mechanism as does S. brevicaulis^, in a mixed culture some of the methylarsenic products from the methylation of inorganic arsenic by S. koningii would be expected to be further methylated by P. gladioli or by F. pinicola to trimethylarsenic species. The dry biomass, after 28 days of growth with As(III) (500 ppb as As), was 320 (SD = 90) mg, and after growth with MMA(V) (500 ppb as As) was 310 (SD = 40) mg. These values are very close to the average of the biomasses of the individual fungi after 93 incubation with the given arsenical. The three fungal species compete for the available nutrients and hence, their growth is limited. The amount of TMAs(V) produced by the mixture of fungi was slightly higher than the amount produced by S. koningii alone. HG-GC-AAS analysis of the media and of the biota extracts showed that 12 (SD = 2)% of the As(III) substrate was converted to TMAs(V) in the medium and 0.46 (SD = 0.02)% was converted to TMAs(V) in the biota. The mixed cultures which were incubated with MMA(V) converted 23 (SD = 4)% of the starting arsenical to TMAs(V) in the medium and 0.46 (SD = 0.05)% to TMAs(V) in the biota. Very small amounts of DMAs were detected in some samples. Almost all of the methylated products were excreted from the fungi. 4.3.5 Incubation of 5. koningii, F. pinicola and P. gladioli with Inorganic Antimony Species Only a few species of microorganisms have been shown to methylate antimony (Section 4.1). Each of the three fungi that methylated arsenic was incubated with potassium antimonyl tartrate (20.0 ppm as Sb) to determine whether these fungi can also methylate antimony. The masses of the dry biota, after 28 days of incubation of F. pinicola and P. gladioli with potassium antimonyl tartrate, were 291 (SD = 2) mg and 242 (SD = 7) mg, respectively. This indicates that potassium antimonyl tartrate had no effect on the cell growth (Section 4.3.3) of F. pinicola or P. gladioli at a concentration of 20.0 ppm (as Sb). Potassium antimonyl tartrate was, however, detrimental to the cell growth of S. koningii with a dry mass yield of 250 (SD = 20) mg. 94 S. koningii methylated potassium antimonyl tartrate converting 1.2 (SD = 0.1)% of the starting material to TMSb(V) and 0.1 (SD = 0.1)% to DMSb, in the medium A chromatogram from the HG-GC-AAS analysis of the medium after 28 days of incubation is shown in Figure 4.4. S. koningii has not previously been shown to methylate antimony. S. brevicaulis, which is of the same genus as S. koningii, was the first microorganism clearly shown to methylate antimony.60,61 F. pinicola and P. gladioli did not methylate antimony. S. koningii was also incubated with KSb(OH)6 and SbCi3 at a concentration of 500 ppb (as Sb), and with a saturated solution of Sb203. KSb(OH)6 and Sb203 had no effect on the cell growth of S. koningii with dry mass yields of 350 (SD = 40) mg and 340 (SD = 10) mg, respectively. SbCb was very detrimental to the cell growth of S. koningii yielding a dry mass of 160 (SD = 60) mg after 28 days of growth. Only Sb203 was methylated; 0.19 (SD = 0.03)% of the starting material was converted to TMSb(V) and 0.022 (SD = 0.002)% was converted to DMSb, in the media. S. koningii methylated only Sb(III) species. No methylation occurred in the killed cell controls and hence, the methylation is mediated by the fungus. Andrewes et al60 found that S. brevicaulis methylated only Sb(III) species, and attributed the lack of Sb(V) methylation to the inabihty of the fungus to take up Sb(V) due to the differing structures of Sb(V) and As(V) in solution171. Similarly to S. brevicaulis, the methylation of antimony is much less than the methylation of arsenic. S. koningii is, however, able to methylate 20 times more antimony than S. brevicaulis over a 28 day period. 95 Figure 4.4 HG-GC-AAS analysis of 1.00 mL aliquot of media after incubation of S. koningii with potassium antimonyl tartrate for 28 days 96 4.3.6 Demethylation of Methylarsenic species by M. neoaurum Although the methylation of arsenic is well understood, only a few microorganisms have been shown to be capable of the reverse process, demethylation of methylarsenic species (Section 4.1). During the screening of the isolates from the sheepskin bedding materials for their ability to methylate arsenic, it was found that the bacterium, Mycobacterium neoaurum, converted MMA(V) to inorganic arsenic. M. neoaurum was incubated with MMA(III), MMA(V), DMAA and TMAO to further examine its ability to demethylate methylarsenic species. The percent conversions of the starting methylarsenic substrates to inorganic arsenic products in the media and in the biota, after 28 days of growth of the bacterium, were determined by HG- GC-AAS of the media and of the biota extracts (Section 2.3) and are listed in Table 4.4. No demethylation of the arsenic species occurred in any of the killed-cell control flasks. This indicates that the demethylation is mediated by the bacterium DMAA and TMAO were not demethylated by M. neoaurum. Uptake of methylated arsenicals into cells is primarily via passive diffusion.172 Cullen et al found, by model studies of liposomes, that the permeability of DMAA was much greater than that of MMA(V) through a liposomal bilayer.173 The lack of demethylation of DMAA and TMAO is likely a consequence of the demethylation process rather than of the uptake of the arsenicals. M. neoaurum yielded a mixture of As(III) and As(V) from both MMA(III) and from MMA(V). The mechanism of demethylation is not known, but it is likely that demethylation of methylarsenic follows the reverse of the Challenger mechanism That 97 is, that MMA(III) is oxidised to MMA(V) which is then reductively demethylated to As(III). Although As(III) is slowly oxidised to As(V) in oxygenated solutions, M. neoaurum may also be capable of oxidising As(III). The amounts of inorganic arsenic products were much lower in the biota than in the media, indicating that the demethylated products are primarily excreted from the organism M. neoaurum converted a greater proportion of MMA(III) to inorganic arsenic than MMA(V). Again, if demethylation is the reverse of the Challenger mechanism, M. neoaurum would first oxidize MMA(III) to MMA(V). The differences in demethylation, between these two methylarsenicals, would then be due to differences in uptake of the arsenicals into the bacterium Table 4.4 Percent conversion of methylarsenic species to inorganic arsenic by M. neoaurum SUBSTRATE MEDIA3 BIOTA EXTRACTS3 MMA(V) As (III) 8 (3) As (III) 0.9 (0.3) As(V) 17 (3) As(V) 0.55 (0.04) MMA(III) As (III) 31 (3) As (III) 1.2(0.4) As(V) 9 (3) As(V) 1.3(0.4) (SD) of 3 replicates 4.3.7 Time Study of MMA(V) Demethylation by M. neoaurum The yield of inorganic arsenic and As(III) from MMA(V) by M. neoaurum was measured against time. This was determined by HG-GC-AAS analysis (Section 2.3) of aliquots of the media from the incubation of M. neoaurum with MMA(V) for 0, 5, 10, 20, 30 and 45 days. The percent conversion of MMA(V) to inorganic arsenic versus time is 98 plotted in Figure 4.5 and the percent conversion of MMA(V) to As(III) versus time is plotted in Figure 4.6. During the initial lag phase, there is little demethylation. During the growth phase the yield of inorganic arsenic increases rapidly. Demethylation continues during the stationary and death phases, but at a much slower rate. In contrast to arsenic methylation by S. koningii, demethylation of MMA(V) by M. neoaurum is a primary metabolic process associated with growth of the bacterium The yield of As(III), however, increases rapidly during the growth stage, reaches a maximum just after the stationary phase and then declines rapidly. The As(V) concentration, calculated by the difference between the inorganic arsenic concentration and the As(III) concentration, increases rapidly after the stationary phase. This suggests that MMA(V) is reductively demethylated to As(III), and that the rate of oxidation of As(III) to As(V) is independent of the growth of the bacterium. 99 40 T 0 i 1 1 1 1 i 0 10 20 30 40 50 Time (days) Figure 4.5 Demethylation of MMA(V) to inorganic arsenic (As(III) + As(V)) by M. neoaurum as a function of time 100 30 T 0 10 20 30 40 50 Time (days) Figure 4.6 Demethylation of MMA(V) to As(III) by M. neoaurum as a function of time 101 4.3.8 Incubation of M. neoaurum with Inorganic As M. neoaurum was incubated with As(III) and with As(V) to determine whether this bacterium oxidizes or reduces inorganic arsenic. There were no changes in the arsenic speciation of the As(V) killed cell controls. After 28 days of incubation with 500 ppb of As(III), 23 (SD = 3)% of the inorganic arsenic in the media of the killed cell control was As(V). Only inorganic arsenic species were present in the media. As(III) is oxidised to As(V) in oxygenated media. When live M. neoaurum was similarly incubated with As(III), 36 (SD = 7)% of the inorganic arsenic in the media was As(V). Again, only inorganic arsenic species were present in the media. The difference in oxidation of As(III), between the live and killed cell controls, is too small to determine whether M. neoaurum oxidizes arsenic. When live M. neoaurum was incubated with As(V), only 44 (SD = 6)% of the inorganic arsenic in the media remained as As(V) after 28 days of incubation. M. neoaurum reduces As(V) to As(III). In contrast to the incubation of M. neoaurum with As(III), when M. neoaurum is incubated with MMA(V), almost all of the As(III) product in the media is eventually oxidised to As(V). It may be that the continual yield of As(III) from the methylated arsenicals drives the bacterium to oxidise the As(III) to As(V). 4.3.9 Incubation of 5. koningii, P. gladioli and M. neoaurum with MMA(V) and Iodide FIA-ICP-MS analysis (Section 2.5) of aqueous solutions of monomethylarsonous oxide showed that the solubility of this compound varies with the preparation and that 102 operations such as filter-sterilization changed the concentration of the compound in solution. This may be due to polymerization and precipitation in solution. These problems were not encountered with diiodomethylarsine. Hence, MMA(III) stock solutions were prepared from monomethylarsonous iodide. S. koningii, P. gladioli and M. neoaurum were incubated with MMA(V) (500 ppb as As) and iodide (1.69 ppm, same concentration of iodide as from MMA(III) during incubations with MMA(III) in Section 4.2.2) to determine whether the increased iodide concentration has any effect on arsenic methylation or demethylation. When P. gladioli was incubated with MMA(V) (500 ppb) and iodide (1.69) ppm, 62 (SD = 4)% of the MMA(V) was converted to TMAs(V) in the media after 28 days of incubation. This yield is 9-times higher than the yield obtained with MMA(V) alone. The chromatograms from the HG-GC-AAS analysis of the media from the incubation of P. gladioli with MMA(V) and with or without iodide are compared in Figure 4.7. S. koningii was also incubated with MMA(V) and iodide and 36 (SD = 6)% of the MMA(V) was converted to TMAs(V). This is double the yield over that obtained with MMA(V) alone. In contrast to the increased methylation observed for the incubation of these fungi with MMA(V) and iodide, iodide decreased the amount of demethylation of MMA(V) by M. neoaurum. The conversion of MMA(V) to inorganic arsenic over 28 days decreased almost two-fold to 13 (SD = 2)%. The increase in MMA(V) methylation when S. knoningii and P. gladioli are incubated with MMA(V) and iodide, is likely due to the reduction of MMA(V) to MMA(III) and the reduction of DMAs(V) to DMAs(III) by iodide. If methylation of 103 MMA(V) proceeds in these fungi via the Challenger mechanism, as it does for other fungi (Section 1.3.2), then reduction steps alternate with oxidative methylation steps. The decrease in MMA(V) demethylation by M. neoaurum when iodide is added indicates that MMA(V) is reductively demethylated to As(III). Reduction of MMA(V) to MMA(III) by iodide would binder the demethylation. The speciation of arsenic in water and soil is receiving increasing attention due to concerns about human health. Ingestion of arsenic through drinking water is associated with significantly higher risk of major cancers, in particular skin and stomache cancers, and increased risk of vascular disease.24 The toxicity of arsenic depends on the speciation (Section 1.3). Iodide present in water and soil could certainly affect the biological transformation of arsenic and consequently, the arsenic speciation. 104 Li 1 1 —r 1 1 1 r 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 Time (min) Figure 4.7 HG-GC-AAS analysis of aliquots of media after incubation of P. gladioli for 28 days A) 1.00 mL aliquot, incubation with 500 ppb as As of MMA(V) B) 0.10 mL aliquot, incubation with 500 ppb as As of MMA(V) and 1.65 ppm as I of Nal 105 4.4 SUMMARY The methylation of arsenic to TMAs(V) by three fungi, S. koningii, P. gladioli and F. pinicola, isolated from a mattress on which an infant perished of SIDS, was investigated. F. pinicola methylated only MMA(V) and merely 2.9% of the MMA(V) (500 ppb as As starting concentration) was converted to methylated products, DMAs and TMAs(V). P. gladioli exhibited selective methylation: MMA(V) and MMA(III) were methylated. As(V) and As(III) were not. The highest yield was from MMA(III) where 38% of the MMA(III) was converted to TMAs(V) after 28 days of incubation. S. koningii methylated a greater amount of As(V) and MMA(V) than As(III) and MMA(III). The highest yield was from As(V) where 23% of the As(V) was converted to TMAs(V). In general, for these fungi, the amounts of methylated arsenic products in the media are far greater than the amounts in the biota. Because the fungi on the bedding materials could interact increasing the methylation of arsenic, a mixture of the three fungi was incubated with As(III) and with MMA(V). The yields of TMAs(V) from the mixture of fungi were slightly greater than the amounts of TMAs(V) generated when a similar amount of mono septic fungal culture was incubated with As(III) or with MMA(V). S. koningii also methylated inorganic antimony(III) compounds, converting 1.2 % of potassium antimonyl tartrate and 0.19% of Sb203 to TMSb(V) in the medium Few microorganisms are known to methylate antimony. The demethylation of methylarsenic species by M. neoaurum was also investigated. The concentration of As(III) increased rapidly during the growth phase and 106 then decreased rapidly during the plateau and death phases. The concentration of As(V) increased slowly during the growth phase and then increased rapidly during the plateau and death phases. These results indicate that MMA(V) is reductively demethylated to As(III) which is then oxidized to As(V). After 28 days of incubation, 26% of MMA(V) and 43% of MMA(III) were demethylated to a mixture of As(III) and As(V). M. neoaurum reduced As(V) to As(III). The effects of iodide on arsenic methylation and demethylation were also examined. Iodide increased the methylation of MMA(V) by S. koningii and by P. gladioli and decreased the demethylation of MMA(V) by M. neoaurum. This is likely due to the reduction of methylated As(V) species to methylated As(III) species by iodide. P. gladioli and S. koningii convert a significant amount of inorganic or monomethylarsenic species to TMAs(V). This shows that these fungi have the potential to volatilize arsenic, which may be significant in relationship to the "Toxic Gas Hypothesis" for SIDS. The volatilization of arsenic by these fungi is further investigated in the following chapter. F. pinicola, P. gladioli, S. koningii and M. neoaurum are commonly found in soil and water. Their ability to methylate and demethylate arsenic is certainly important in the environmental cycle of arsenic. 107 CHAPTER 5 VOLATILIZATION OF ARSENIC 5.1 INTRODUCTION The toxic gas hypothesis of SIDS is anchored primarily on the possibility of the volatilization of arsenic, antimony or phosphorus from infants' bedding materials by S. brevicaulis.55'57 As described in Chapters 3 and 4, three fungi isolated from the SIDS1 mattress, namely Scopulariopsis koningii, Penicillium gladioli and Fomitopsis pinicola, methylate arsenic forming trimethylarsenic(V) species. This is indicative of their potential for formation of volatile trimethylarsine. Scopulariopsis koningii also methylates inorganic antimony forrning trimethylantimony(V) species (Section 4.3.5) and may be able to volatilize antimony. In the present work, the formation of volatile arsenic compounds by Scopulariopsis koningii, Penicillium gladioli and Fomitopsis pinicola and the formation of volatile antimony compounds by Scopulariopsis koningii is investigated. The volatilization of arsenic and antimony from sheepskin bedding materials by Scopulariopsis brevicaulis is studied as well. The present work also examines the biological volatilization of arsenic and antimony in two other large-scale environments - in a garden-waste compost heap and in hot springs. A number of studies have investigated the formation, in compost, of volatile inorganic compounds174'175 such as ammonia, carbon dioxide and nitrous oxide and the formation of volatile organic compounds176"178 such as terpenes, ethanol and methane. Metals and metalloids including chromium, arsenic, mercury and lead may be present in 108 compost, depending on the feedstock.1/y' 1SU Volatile organometalloid compounds are found in landfill and in sewage gases.90' 181 Compost is similarly highly biologically active and volatile organometalloid compounds could also be generated by compost. Hot springs are also be a source of volatile organometalloid compounds.182 Hot springs are rich in dissolved minerals; arsenic concentrations in geothermal fluids, for example, are typically between 1 and 10 ppm183 Thermophillic bacteria and fungi are usually present in the springs and thick microbial mats are often seen. These rnicroorganisms could interact with the dissolved minerals present in the thermal waters yielding volatile organometalloid compounds. 109 5.2 EXPERIMENTAL D. H2O was used to prepare all solutions. All glassware was soaked overnight in 1 M nitric acid and then rinsed with d. H2O. 5.2.1 Arsenic and Antimony Volatilization by Fungi Isolated from Sheepskin Bedding Materials Medium (360 mL) of the appropriate type (Sabouraud or potato dextrose broth) was added to purge-and-trap flasks (Section 2.4.1.2). The flasks were then closed with cotton plugs and were autoclaved. After cooling the flasks to room temperature, the arsenic or antimony species (as concentrated stock solutions, Section 2.2.1) and 40 mL of the appropriate seed culture (Section 3.2.3) were added to the flasks. The arsenic and antimony substrates used in this experiment and their concentrations are described in Table 5.1. The flasks were closed with purge-and-trap heads (Section 2.4.1.2), and the inlet and the outlet tubing on the heads were closed with hose clamps. The flasks were incubated in the dark, to minimize decomposition of volatile arsenic or antimony compounds, at 21 °C for 28 days. After the incubation was complete, the headspace gases of the flasks were analysed for the presence of volatile arsenic or antimony compounds by using purge and trap-GC-AAS (Section 2.4). 110 Table 5.1 Incubation conditions for arsenic or antimony volatilization by arsenic methylating fungi Flask Fungus Substrate Concentration as As or Sb (ppm) la,b F. pinicola MMA(V) 5.0 2a,b F. pinicola MMA(V) 50 3a,b P. gladioli MMA(V) 5.0 4a,b P. gladioli MMA(V) 50 5a,b S. koningii MMA(V) 5.0 6a,b S. koningii MMA(V) 50 7a,b S. koningii MMA(V) 100 8a,b S. koningii As(III) 30 9a,b S. koningii As(III) 100 10a,b S. koningii potassium 100 antimonyl tartrate 111 5.2.2 Incubation of S. brevicaulis with Sheepskin Bedding Material 5.2.2.1 Preparation of Seed Culture of S. brevicaulis S. brevicaulis was obtained as a slant from the American Type Culture Collection (ATCC 7903). Seed cultures were prepared by inoculating a 2-mm-diameter loop from this slant into 50 mL of a minimal salts/glucose medium152 (see Table 5.2) in a 125-mL Erlenmeyer flask. Table 5.2 Minimal salts/glucose medium Ingredients Concentration (g L"1) (NH4)2S04 2.0 KH2P04 0.10 MgS047 H20 0.050 FeS047 H20 0.0018 tWamine'HCl 0.010 glucose 10 succinic acid 5.9 NaOH as required to adjust pH to 5.0±0.1 at 25 °C 112 5.2.2.2 Preparation of Incubation Flasks Minimal salts/glucose medium (Table 5.2, 100 mL) was added to each of six purge-and-trap flasks (Section 2.4.1.2). The contents of the flasks are described in Table h5.3. A 3cm x 3 cm piece of Usedl sheepskin (1.5 ± 0.1 g wool, 0.72 ±0.07 g skin) for each flask was cut into 2 mm x 2mm pieces, and was added to the medium of the designated flasks. The flasks were then closed with cotton plugs and were autoclaved. Two flasks were also prepared containing only a 5 cmx 5cm piece of sheepskin and 10 mL of d. H20. These two flasks were not autoclaved. After cooling the flasks to room temperature, 10 mL of S. brevicaulis seed culture was added to certain flasks as indicated in Table 5.3. For all of the flasks, the cotton plugs were replaced with autoclaved purge-and-trap heads, and the inlet and the outlet tubing on the heads were closed with hose clamps. The flasks were incubated at 21 °C for 20 days under normal daylight/darkness cycle. Table 5.3 S. brevicaulis incubation on sheepskin conditions Flask S. brevicaulisl Sheepskin? A No No B Yes No Cl,2 No Yes Dl,2 Yes Yes 113 After incubation was complete, the headspace gases of each flask were trapped in a U-tube cooled in a dry ice/acetone bath (Section 2.6.1.1). The contents of the tubes were analysed for the presence of volatile arsenic and antimony compounds by using GC- ICP-MS (Section 2.6). 5.2.3 Arsenic Volatilization by Composting The City of Vancouver started a garden-waste-composting program in 1989. Grass trimmings, leaves and other plant waste are brought to the Vancouver landfill where the material is sorted to remove foreign matter. The waste is ground such that the maximum length of the material is 7 cm The plant material is then mixed with water and piled into windrows. The windrows are turned at regular intervals to ensure that the optimum temperature, moisture and oxygen levels are maintained throughout the piles. After three months in windrows, the compost is stored in curing piles for a further nine months. The final compost is sold, primarily for use as landscaping mulch, or, after blending with other materials, for use as topsoil. 114 5.2.3.1 Sampling of Compost Gases A new windrow, piled six hours previous to the start of the experiment, was chosen because this composting process is most active during the first two weeks after the windrow is created (George Twarog, personal cornmunication). The temperature of this windrow was 48 °C. A gas collector, consisting of an inverted acrylic dish 20 cm in diameter and 10 cm in height with a 4-mm i.d. PTFE outlet, was placed 10 cm below the surface of the pile. After one week, the outlet of the gas collector was connected to a 1-L evacuated glass chamber with a 4-mm i.d. outlet fitted with a PTFE stopcock. The glass chamber was covered with black tape to miniiriize decomposition of the gases by light and to minimize the danger of implosion. The gas in the collector was sucked into this chamber.184' 185 The temperature in the compost pile had increased, after one week, to 61 °C. The gas in the glass chamber was purged, in the laboratory, into a U-tube cooled in a dry ice/acetone bath (Section 2.6.1.1). The contents of the tubes were analysed for the presence of volatile arsenic, antimony, bismuth, tellurium, tin, lead, mercury, cadmium and iodine compounds by using GC-ICP-MS (Section 2.6). 115 5.2.3.2 Analysis of Compost for Arsenic Content Compost (1 kg) was collected from 10 cm below the surface of the pile at the start of the experiment. A sample (99.97 g) of the compost was freeze-dried (dry weight 32.17 g) and portions of this dried compost were digested in acid186 prior to analysis for arsenic content. The digestion was carried out in duplicate with duplicate blanks. The dried compost was mixed well by hand and the samples were weighed (2 g ± 0.5 mg) into 250 mL round bottom flasks. D. H2O (5 mL) and concentrated nitric acid (5 mL, doubly distilled in quartz, Seastar) were added to each flask. The flasks were fitted with a reflux apparatus187 and the samples were boiled for 15 min. by using a heating mantle. The flasks were cooled to room temperature, a second aliquot of nitric acid (5 mL) was added to the flasks and the samples were boiled with the same apparatus for 30 min. The flasks were cooled to room temperature, a final aliquot of nitric acid (5 mL) was added to each flask and the samples were boiled for 45 min. The flasks were cooled to room temperature and hydrogen peroxide (9 mL, 30% (w/v) in water, reagent grade, Fisher) was added to each flask. The flasks were boiled for 30 min. then cooled to room temperature. Hydrochloric acid (5 mL, 35% (w/v) in water, environmental grade, Alfa) was added to each flask and the flasks were boiled for 30 min. After cooling to room temperature, the clear solutions were diluted to 100 mL with d. H2O, were filtered through a 0.45 am syringe filter (Pall Acrodisc, 25 mm) and were stored at 4 °C until analysis. The samples were analysed by using HG-GC-AAS (Section 3.2.3.5) by the method of standard additions. 116 5.2.3.3 Compost Incubation Six purge-and-trap flasks (Section 2.4.1.2) were prepared as described in Table 5.4. Compost (100 g, Section 5.2.3.2) was aseptically placed in each autoclaved flask. An autoclaved purge-and-trap head (Section 2.4.1.2) was attached to each of flasks C through E. The blanks, flasks A and B, were closed with foam plugs (Jaece) and autoclaved at 121 °C for 20 min. After autoclaving, the foam plugs were replaced with autoclaved purge-and-trap heads. The flasks that were incubated aerobically, flasks A, C and D, were purged with air from a compressed gas cylinder for 30 min at 100 mL min"1. The flasks that were incubated anaerobically, flasks B and E, were similarly purged with a mixture of 85% nitrogen, 10% carbon dioxide and 5% hydrogen from a compressed gas cylinder (anaerobic gas mixture, Praxair). Filters (0.2 pm Supor Acrodisc® 25; Gelman Sciences) were attached to the inlet and to the outlet tubing on the flasks prior to purging to prevent microbial contarnination of the flask contents and the laboratory. The inlet and the outlet tubing on the heads were closed after purging with hose clamps and the flasks were incubated at 61 °C for two weeks. After incubation was complete, the headspace gases of each flask were purged into U-tubes cooled in a dry ice/acetone bath (Section 2.6.1.1). Air, helium and anaerobic gas mixture from the compressed gas cylinders were also each purged at 100 mL min"1 for 30 min into cooled U-tube traps. The contents of the U-tubes were analysed for the presence of volatile arsenic, antimony, bismuth, tellurium, tin, lead, mercury, cadmium and iodine compounds by using GC-ICP-MS (Section 2.6). 117 Table 5.4 Compost incubation conditions Flask Sterilized? Type of Incubation A Yes Aerobic B Yes Anaerobic C No Aerobic D No Aerobic E No Anaerobic 5.2.4 Arsenic Uptake and Volatilization by Biota from Hot Springs of South• western British Columbia 5.2.4.1 Meager Creek Hot Springs The Meager Creek hot springs are located 70 km north-west of Pemberton, BC. These springs consist of two sources, which flow into several pools. The map in Figure 5.1 shows the layout of the Meager Creek hot springs. The pools are rich in themiophilic biota. Pool 1 contains large microbial mats that extend 30 cm in depth from a deep-green phototrophic layer at the surface of the pool to a brown/black layer near the mud at the bottom of the pool. Pool 5 contains 10-cm thick microbial mats that are orange at the surface, green in the middle layers and white in the bottom layer. A small, green microbial mat is located near the geothermal drill hole (Location 4). 118 J. Feldmann collected samples of the microbial mats from pools 1 and black sediment from pool 2, for the incubation experiments described in Section 5.2.4.2, in July 1997. This author collected the samples of the mats from pool 1 and the drill hole (location 4), and sediment from pool 2, for the incubation experiments described in Section 5.2.4.3 in November 1998. Precautions were taken to minimize microbial contamination of the biota. The biota was collected by hand and sterile gloves (ethanol spray) were worn. The biota was collected into autoclaved Erlenmeyer flasks capped with cotton plugs. The temperature of the pools where the biota was collected was also measured. The gases evolving from the mats in of pools 1 and 5 were collected in November 1998. A foam ring was placed around the acrylic dish described in Section 5.2.3.1 to enable the dish to float on the surface of the pools. The gases from a pool were allowed to collect in the dish for one hour. They were then transferred to an evacuated glass chamber (Section 5.2.3.1) and, upon return to the laboratory (24 hours later), the glass chambers were purged into U-tubes cooled in a dry-ice/acetone bath (Section 2.6.1.1). The contents of the tubes were analyzed for the presence of volatile arsenic, antimony, bismuth, tellurium, tin, lead, mercury, cadmium and iodine by using GC-ICP-MS (Section 2.6). 119 120 5.2.4.2 Incubation of Microbial Mats and Sediment Samples of the microbial mats from pool 1 and sediment from pool 2 that were collected by J. Feldmann in July 1997 (Section 5.2.4.1) were incubated in the laboratory under controlled conditions. The incubation conditions are described in Table 5.5. The biota was added asepticalfy to autoclaved purge-and-trap flasks (Section 2.4.1.2). D. H2O was added, as necessary, such that the total volume of biota and water in the flasks was 800 mL. The concentration of tin and antimony was increased in some of the 123 flasks by adding isotopically enriched species (80 /ig each of Sb(OH)6" and 118 + Sn(OH)3 per flask). The flasks were fitted with purge-and-trap heads (Section 2.4.1.2). After closing the tubing on the purge-and-trap heads with hose clamps, the flasks were incubated in the dark for 14 days at either 37 °C in an incubator or at 4 °C in a refrigerator, to examine the effect of temperature on the production of volatile compounds. When the incubation was complete, the headspace gases of each flask were analysed for the presence of volatile arsenic, antimony, bismuth, tellurium, tin, lead, mercury, cadmium and iodine by using GC-ICP-MS (Section 2.6). The flasks were purged with helium into U-tube traps cooled in dry ice/acetone (Section 2.6.1.1). 121 Table 5.5 Microbial mats and sediment incubation conditions Flask Source Mass (g) Isotopes Added? Temperature (°C) 1 Mats 434 No 37 Pool 1 2 Mats 533 Yes 37 Pool 1 3 Mats 572 Yes 37 Pool 1 4 Mats 625 No 4 Pooll 5 Sediment 620 No 37 Pool 2 6 Sediment 817 Yes 37 Pool 2 7 Sediment 797 Yes 37 Pool 2 8 Sediment 834 No 4 Pool 2 122 5.2.4.3 Aerobic/Anaerobic Incubation of Microbial Mats Samples of the microbial mats from pool 1 and the drill hole (location 4), and sediment from pool 2 that were collected in November 1998 (Section 5.2.4.1) were incubated in the laboratory aerobically and anaerobically. Table 5.6 describes the incubation conditions. Approximately 100 g of biota was added aseptically to autoclaved purge-and-trap flasks as described in Section 5.2.4.2. D. H20 (100 mL) was added to each flask. Two aerobic and two anaerobic control flasks (flask 1,2 and 7,8) were prepared. These flasks were closed with foam plugs and were autoclaved after the water and the biota were added. All of the flasks were then closed with autoclaved purge-and-trap heads (Section 2.4.1.2). The flasks that were incubated aerobically, flasks 1 to 6, were purged with air, and the flasks that were incubated anaerobically, flasks 7 to 12, were similarly purged with a mixture of 85% nitrogen, 10% carbon dioxide and 5% hydrogen from a compressed gas cylinder (anaerobic gas mixture, Praxair) as described in Section 5.2.3.3. After purging, the inlet and outlet hoses on the flasks were closed with hose clamps. The flasks were incubated at 37 °C for 14 days in an incubator in the dark. ' When the incubation was complete, the headspace gases of each flask were analysed for the presence of volatile arsenic, antimony, bismuth, tellurium, tin, lead, mercury, cadmium and iodine by using GC-ICP-MS (Section 2.6). The flasks were purged with helium into the cooled U-tube traps (Section 2.6.1.1). 123 Table 5.6 Microbial mats aerobic/anaerobic incubation conditions Flask Source Mass (g) Atmosphere Autoclaved? 1 Mats 100 Aerobic Yes Pool 1 2 Mats 100 Aerobic Yes Pool 1 3 Sediment 99 Aerobic No Pool 2 4 Drill Hole 99 Aerobic No Location 4 5 Mats 99 Aerobic No Pool 1 6 Mats 135 Aerobic No Pool 1 7 Mats 99 Anaerobic Yes Pool 1 8 Mats 108 Anaerobic Yes Pool 1 9 Sediment 102 Anaerobic No Pool 2 10 Drill Hole 100 Anaerobic No Location 4 11 Mats 103 Anaerobic No Pool 1 12 Mats 101 Anaerobic No Pool 1- 124 5.2.5 Clear Creek Hot Spring The Clear Creek hot spring is located 190 km northeast of Vancouver. This spring emerges from a fern-filled grotto and flows into a 7-m long, 3-m wide and 0.5-m deep, muddy, man-made pool. The pool contained two visible types of algae: net-like algae, which float on the surface and fine strings of algae located throughout the pool. No microbial mats were present. The temperature, pH and EH of the source and of the pool were measured (I. Q. 200 meter, I. Q. Scientific Instruments). Samples of the ferns (Western Swordfern, Polystichum munitum) growing in the grotto, and of both types of algae were collected. A fine fish-tank net was used to collect the algae. The biota were stored in Ziploc® bags and were kept cool until they were processed in the laboratory. In the laboratory, the biota were rinsed with a minimum amount of d. H2O. C. Bordon (Botany Department, UBC) identified the biota. A portion (2 g) of the biota was freeze-dried and'ground. The dry, ground biota was digested in nitric acid (250-mg biota, triplicate digests) as described in Section 3.2.2.1. Water samples (100 mL) were collected from the spring source and from the pool. The water samples were acidified with concentrated nitric acid (Seastar, doubly distilled in quartz) to a final concentration of 1% (v/v) acid. The digests and the water samples were analysed by using FIA-ICP-MS (Section 2.5) to determine the concentrations of germanium, arsenic, selenium, tin, antimony, tellurium, lead, bismuth, mercury and cadmium All samples were filtered through 0.45 am syringe filters (Millipore) prior to analysis. 125 The gases evolving from the pool were collected in the same manner as described in Section 5.2.4.1. Again, the gases were transferred to an evacuated glass chamber (Section 5.2.3.1) and, upon return to the laboratory (6 hours later), the glass chamber was purged into cooled U-tubes (Section 2.6.1.1). The contents of the tubes were analyzed by using GC-ICP-MS (Section 2.6) for the presence of volatile arsenic, antimony, bismuth, tellurium, tin, lead, mercury, cadmium and iodine. 126 5.3 RESULTS AND DISCUSSION 5.3.1 Volatilization of Arsenic by Fungi Isolated from Sheepskin Bedding Materials Each of the three fungi that methylate arsenic, namely S. koningii, F. pinicola and P. hirsutum, was examined for its ability to produce volatile arsenic compounds. S. koningii, which methylates antimony, was also examined for its abihty to form volatile antimony compounds. The fungi were incubated in hquid medium with the arsenicals or antimonals for 28 days in a closed flask with 600 mL of headspace. The fungi grew well and appeared healthy over the 28-day growth period so it is assumed that the cultures were not oxygen limited. Volatile arsenic compounds were not detected in the headspace of any of the flasks in which F. pinicola was incubated with MMA(V). No volatile antimony compounds were detected in the headspace of the flasks containing S. koningii and potassium antimonyl tartrate. Volatile trimethylarsine was detected in the headspace of some of the flasks in which S. koningii was incubated with MMA(V) and with As(III), and in the headspace of some of the flasks in which P. gladioli was incubated with MMA(V). Although other PenicUlium and Scopulariopsis species are known to volatilize arsenic811152, these fungal species have not previously been shown to volatilize arsenic. 127 The production of volatile trimethylarsine is dependent on the concentration of the arsenic substrate. P. gladioli converted 0.0003 (SD = 0.0001)% of the starting MMA(V) to trimethylarsine, during the 28 day incubation, when the MMA(V) concentration in the medium was 50 ppm as As but yielded no trimethylarsine when the MMA(V) concentration was 5.0 ppm as As. S. koningii yielded trimethylarsine only when the concentration of As(III) or of MMA(V) was 100 ppm as As in the medium No volatile arsenic compounds were detected at lower concentrations of these arsenicals. S. koningii converted 0.0003 (SD = 0.0001)% ofthe As(III) and 0.00020 (SD = 0.0006)% of the MMA(V) to trimethylarsine, during the 28 day incubation. The yield of volatile trimethylarsine by P. gladioli and S. koningii is small. The highest concentration of arsenic in the sheepskin bedding materials is 380 ppb in the SIDS1 sheepskin. The formation of sufficient trimethylarsine to harm a child by F. pinicola, P. gladioli or S. koningii from sheepskin bedding materials is highly unlikely. 5.3.2 Volatilization of Arsenic from Sheepskin Bedding Materials by S. brevicaulis S. brevicaulis is the microorganism most often considered in connection with the "toxic gas hypothesis".55 Furthermore, the yield of trimethylarsine from inorganic arsenic by S. brevicaulis is much higher than that of S. koningii or of P. gladioli (Section 5.3.1, Andrewes189). For these reasons, the ability of S. brevicaulis to volatilize arsenic from sheepskin bedding material was examined. 128 S. brevicaulis grew well on the Usedl sheepskin. After 20 days of growth, the sheepskin bedding material was almost completely consumed by the fungus. S. brevicaulis is keratinolytically active190,191 and hydrolyzes the keratin of wool fibers to amino acids192. This certainly increases the availabihty of the arsenic in the skin and in the wool to the fungus. The incubation of S. brevicaulis and Usedl bedding material, the incubation of S. brevicaulis alone and the incubation of Usedl bedding material alone, are compared, after 20 days, in the photograph in Figure 5.2. After incubation for 20 days, the headspace gases of the flasks were analysed by using GC-ICP-MS. Volatile antimony compounds were not detected in the headspace of any of the flasks. The control flasks containing only iriiiiimal salts/glucose medium (flask A) and containing medium and Usedl sheepskin (flasks CI and C2) yielded no volatile arsenic compounds. A trace amount of trimethylarsine was detected in the headspace of the flask containing S. brevicaulis and medium (flask B). Trimethylarsine was detected in the headspace of the flasks containing S. brevicaulis, medium and Usedl sheepskin (flasks DI and D2). The chromatogram obtained for arsenic (m/z = 75) obtained by GC-ICP-MS of the gases in the headspace of flask D2 is shown in Figure 5.3. The amounts of trimethylarsine in the headspace gases were determined semi- quantitatively by the method described in Section 2.6.1.3. Flask B yielded 0.08 ng of trimethylarsine. This trimethylarsine likely originates from the methylation of the trace amounts of arsenic in the medium Flasks DI and D2 yielded 0.26 and 0.50 ng of trimethylarsine, respectively. 129 Pieces of SIDS1 sheepskin were moistened with d. H2O and were incubated for 28 days in closed flasks. No volatile arsenic or antimony compounds were detected in the headspace of these flasks. These results show that S. brevicaulis is able to volatilize arsenic from sheepskin bedding materials. The amount of volatile trimethylarsine produced, however, is very small. The amount produced in a cot environment would be even less and would be unlikely to harm an infant. 130 Figure 5.2 Incubation day 20 of: Flask B) S. brevicaulis Flask D2) S. brevicaulis and Usedl sheepskin Flask C2) Usedl sheepskin; all flasks contain minimal salts/glucose medium 131 2500 ! 2000 -{ Me As gn 1500 3 -t-» 11000 500 0 0 50 100 150 200 250 Time(s) Figure 5.3 GC-ICP-MS chromatogram (m/z =75) of headspace gas after 20 days incubation of S. brevicaulis with Usedl sheepskin bedding material 132 5.3.3 Compost Compost from the City of Vancouver garden waste compost site was collected and freeze-dried (Section 5.2.3.2). The dry compost was digested in acid. HG-GC-AAS analysis of the digests showed that the compost contained 3 (SD =1) ppm of As. The temperature of the windrow increased during the sanpling week from 48 °C to 61 °C while the air temperature outside the windrow was at an average of 16 °C. This indicates that the windrow was very biologically active. 5.3.3.1 Analysis of Compost Gases The gases produced by a new compost windrow were collected 10 cm below the surface of the pile over the period of 1 week. GC-ICP-MS analysis of these gases showed only one peak. This peak was for a volatile iodine (m/z = 127) species. Correlation of the retention time to the boiling point (Section 2.6.1.2) indicated that this species was iodomethane. The chromatogram obtained for iodine (m/z = 127) is shown in Figure 5.4. Although the compost was biologically active, no volatile arsenic, antimony, bismuth, tellurium, tin, lead, mercury or cadmium species were detected. 133 6 E+5 T Figure 5.4 GC-ICP-MS chromatograrn (m/z = 127) of gas collected over 7 days from a new windrow of garden-waste compost 10 cm below the surface ofthe compost 134 5.3.3.2 Analysis of Compost Incubation Gases In order to better understand the composting process, fresh compost (Section 5.2.3.2) was incubated in the laboratory under controlled conditions, anaerobically and aerobically, at 61 °C. Analysis of the headspace gases of each of the flasks by using GC- ICP-MS again showed only one volatile species, iodomethane (identified by retention time-boiling point correlation). Iodomethane was present in the headspace of all of the flasks, including the aerobic and the anaerobic incubation flasks as well as the sterilized controls. The lack of production of volatile arsenic species may be due to the low concentration of arsenic in the compost. The air and the anaerobic gas mixture used to supply the atmospheres for the incubation experiments, as well as the helium used to purge the flasks, were analyzed by using GC-ICP-MS. These analyses showed that iodomethane was not present in the gases used in the incubation experiments. The biological production of iodomethane by organisms such as macro- and micro-algae, and wood-rotting fungi is well-known.193"195 Recently, Keppler et al have shown that volatile halogenated organic compounds, including iodomethane, can also be produced by the abiotic oxidation of organic material by electron acceptors such as iron(III).196 Because the sterile controls also produce iodomethane, it is likely that the production of iodomethane by composting is a chemical rather than a biological process. 19V 198 * Iodomethane plays a role in atmospheric ozone destruction. ' The contribution of composting to the atmospheric budget of volatile halogenated organic compounds would be a worthwhile consideration for future work. 135 5.3.4 Hot Springs of South-western British Columbia 5.3.4.1 Volatile Species at Meager Creek Hot Springs The Meager Creek hot springs, British Columbia, are rich in biota. Thick microbial mats are present in pool 1 and in pool 5. These hot springs are also rich in minerals.182 In this experiment, the gases evolving from the microbial mats in pools 1 and 5 were collected over the period of one hour and were analysed for the presence of volatile arsenic, antimony, bismuth, teUurium, tin, lead, mercury, cadmium and iodine species. Iodomethane was the only volatile species detected. Thus, hot springs may also contribute to the budget of volatile halogenated organic compounds. It is interesting that volatile arsenic species were not detected. Koch et alm measured the concentration of several arsenic species in the water and in the biota of Meager Creek hot springs. They found that the average concentration of arsenic in the hot spring waters was 280 ppb and that arsenic bio-accumulates in the microbial mats. The concentration of arsenic in the top layer of the microbial mat in pool 1 was 290 ppm and in the top layer of the microbial mat in pool 5 was 108 ppm The extractable arsenic in the mats was primarily a mixture of As(III) and As(V), but small amounts of MMAA and DMAA were also detected. The temperature of pool 1 was 52 °C at the bottom of the pool and 33 °C at the surface of the pool. The temperature of pool 2 was 46 °C at the bottom of the pool and 45 °C at the surface of the pool. The temperature of the drill hole was 58 °C. 136 Liao (unpublished) isolated 22 species of aerobic bacteria and one species of fungus from the microbial mat and water in pool 1. Although there are a variety of microorganisms in the hot springs that could interact with the arsenic also present in the springs, the concentration of arsenic in the waters surrounding the microorganisms is low, and the rate of volatilization, if it does occur in these springs, may be too low to be able to detect volatile arsenic species. 5.3.4.2 Microbial Mat and Sediment Incubations Incubation of microbial mat and sediment samples was carried out so that any gases produced by the mats could be collected over a longer period of time. This also allowed the examination of the effects of temperature and of isotope addition on the formation of volatile species. Trimethylarsine and trimethylstibine were detected in all of the flasks described in Table 5.5. The amounts produced are given in Table 5.7. Iodomethane was also detected in all of the flasks. Volatile bismuth, tellurium, tin, lead, mercury or cadmium species 118 + were not detected in any of the flasks. Even with amendment of Sn(OH)3 to flasks 2, 3, 6 and 7, these flasks did not produce volatile tin species. The amount of trimethylarsine produced by the mats from pool 1 was much greater than the amount produced by the sediment from pool 2. A decrease in temperature resulted in a significant decrease in the amount of trimethylarsine produced 123 by the mats from pool 1. The addition of Sb(OH)6_ to flasks 2, 3, 6 and 7 did not alter 123 121 the ratio of Me3 Sb to Me3 Sb. 137 The microbial mat and sediment incubations indicate that volatile arsenic, trimethylarsine, is likely produced at the Meager Creek hot springs, particularly in pool 1. The amount of trimethylarsine measured in the flasks is small; even the most productive flask, flask 3, yielded, on average, 0.14 ng h"1. It is not surprising that volatile arsenic species were not detected above the mats at the springs. Trace amounts of trimethylstibine are probably also produced at the Meager Creek hot springs. 5.7 Yield of trimethylarsine and trimethylstibine from incubations of sediment and microbial mats from Meager Creek hot springs Flask Amount of Amount of Amount of (Table 5.5) 121 123 Me3As (ng) Me3 Sb (ng) Me3 Sb (ng) 1 44 3.2 3.8 2 10 1.7 2.0 3 48 14 20 4 0.6 1.7 2.0 5 2.0 1.7 2.2 6 3.0 1.9 2.0 7 1.0 0.4 0.5 8 1.0 0.4 0.4 138 5.3.4.3 Aerobic/Anaerobic Incubation of Microbial Mats Koch et a/188 measured the oxygen concentration at various locations in the Meager Creek hot springs. They found that the microbial mats in pool 1 were well- oxygenated near the surface of the pool, but that the oxygen concentration was low below the mats. Reducing conditions were also present in the sediment in pool 2. The microorganisms present in the microbial mats could include aerobes, facultative anaerobes and obligate anaerobes. The aim of this experiment was to determine whether the production of volatile trimethylarsine and trimethylstibine was biologically mediated and, if so, whether aerobic or anaerobic microorganisms were responsible for the production of these volatile compounds. Trimethylarsine was produced by only two of the aerobic incubation flasks, the flasks containing microbial mats from pool 1. After 14 days of incubation, flask 5 yielded 4.05 ng and flask 6 yielded 0.06 ng of trimethylarsine. Trimethylarsine was not detected in the aerobic blank flasks in which biota from pool 1 was autoclaved prior to incubation, or in the anaerobic incubations of microbial mats from pool 1. These results indicate that the production of trimethylarsine by the microbial mats in pool 1 is primarily an aerobic biological process. Aerobic or anaerobic incubation of sediment from pool 2 and of microbial mats from the drill hole did not produce any trimethylarsine. The previous microbial mat and sediment incubation experiment (Section 5.3.4.2) showed that the sediment from pool 2 does produce trimethylarsine. In the present experiment, the amount of biota was likely too small to produce a detectable amount of trimethylarsine. 139 The anaerobic blank flasks, flasks 7 and 8, did yield 0.86 and 1.4 ng of trimethylarsine, respectively. Autoclaving may have released trimethylarsine from the biota in these flasks and incubation in an anaerobic environment may have prevented subsequent oxidation of the trimethylarsine to non-volatile species199. Trimethylstibine was detected in only one flask, the anaerobic incubation of microbial mats from the drill hole. Trimethylstibine could certainly have been generated in the flasks containing microbial mats from pool 1 or sediment from pool 2, based on the previous sediment and microbial mat incubation results, but again the amount of trimethylstibine may have been below the detection limit. The amounts of volatile species generated in this experiment were, in general, much less than the amounts generated in the previously described microbial mat and sediment incubation experiment. It was necessary to keep the amount of biota in the flasks small in order, to maintain the desired aerobic or anaerobic environment. This results in a lower production of volatile species. Further larger-scale experiments in a bioreactor could yield more information about the volatile species produced by the Meager Creek hot spring biota. 140 5.3.5 Clear Creek Hot Spring The source of the Clear Creek hot spring was at 44 °C, had a pH of 8.4 and had a EH of 49 mV. The pool was at 33 °C, had a pH of 7.8 and had a EH of 49 mV. The spring water is basic which indicates that these waters are high in bicarbonate, typical of 200 201 hot springs in volcanic areas such as the Coast Mountains. ' The EH values show that the source and the pool are well-oxygenated and can support aerobic microorganisms. C. Borden (Botany Department, UBC) identified the surface alga as a Spirogyra species and the alga found throughout the pond as a Rhizoclonium species. These species are green algae commonly found in freshwater. The concentrations of the metal(loid)s in the Clear Creek water and biota are given in Table 5.8. Tin, antimony, tellurium, bismuth and cadmium were not detected in any of the samples. The concentration of arsenic in the Spirogyra and in the Rhizoclonium species was more than 1000 times greater than in the pool in which they grow. The bio-concentration202 of arsenic has been noted for other green algae. Koch et al found that an unidentified species of green algae in pool 2 of Meager Creek hot springs had an arsenic concentration of 249 ppm while the concentration of arsenic in the pool was 277 ppb.188 Chlorella vulgaris, a freshwater green alga, and Dunaliella sp., marine green algae, also have been shown to bio-concentrate arsenic.203'204 141 Polystichum munitum, growing in the grotto at the hot springs source, had ppm level concentrations of both arsenic and lead. Lead was not detected in the water of the hot springs source and the fern may have bio-concentrated the lead from the soil in which it was growing. The use of ferns for the phytoremediation of arsenic in soil has been 205 proposed. Table 5.8 Total concentrations of metal(loid)s in Clear Creek water and biota obtained by FIA-ICP-MS analysis directly (water) or of digests (biota) Concentration (SD)a Element Clear Creek Clear Creek Polystichum Spirogyra Rhizoclonium Source Pool munitum sp. sp. (PPb) (PPb) (ppm) (ppm) (ppm) Ge 2.3 (0.2) 1.3 (0.1) n.d. n.d. n.d. As 42 (4) 24 (1) 60 (30) 22 (5) 66 (4) Se 3.6 (0.7) 1.2 (0.2) n.d. n.d. n.d. Pb n.d. n.d. 130 (80) n.d. n.d. Hg 8 (2) 8 (2) n.d. n.d. n.d. aSD = standard deviation, calculated from duplicate analysis (water) or from duplicate analysis of duplicate digests (biota) bn.d. = not detected; detection limits 0.2 to 5 ppb 142 GC-ICP-MS analysis of the gases collected above the hot spring showed only the presence of iodomethane. No volatile species of arsenic, antimony, bismuth, tellurium, tin, lead, mercury or cadmium were detected. Although freshwater algae are known to synthesize methylated arsenic species, the formation of volatile arsines by these organisms has not been reported.206 Microorganisms which can volatilize arsenic could be present in the Clear Creek hot springs, but the concentration of arsenic in the springs is low and the concentration of any volatile arsenic compounds would likely be below the detection limit. 143 5.4 SUMMARY Two of the isolates, from the bedding material on which an infant perished of SIDS, S. koningii and P. gladioli, formed volatile trimethylarsine. S. koningii converted (as arsenic) 0.0080% of As(III) substrate and 0.0050% of MMA(V) substrate in 28 days to volatile trimethylarsine when the concentrations of these substrates in media were 100 ppm as arsenic. P. gladioli converted (as arsenic) 0.0072% of the MMA(V) substrate to volatile trimethylarsine when the concentration of MMA(V) in the media was 100 ppm as arsenic. No volatile antimony compounds were detected when S. koningii was incubated with potassium antimonyl tartrate (100 ppm as Sb). The volatilization of arsenic by S. koningii and by P. gladioli has not previously been reported. Although both S. koningii and P. gladioli convert a significant amount of starting arsenic substrate to trimethylarsenic(V) species (Section 4.3.3), the amounts of volatile trimethylarsine formed by these microorganisms are very small. No volatile trimethylarsine was detected when the concentrations of the starting arsenic substrates in the medium were less than 100 ppm for S. koningii and less than 50 ppm for P. gladioli. The amounts of arsenic in the sheepskin bedding materials are between 90 and 380 ppb. It is improbable that S. koningii and P. gladioli can form enough trimethylarsine from the sheepskin bedding materials to harm an infant. 144 S. brevicaulis was incubated with Usedl sheepskin bedding material. This fungus is keratinolytically active, grew well on the bedding material, and volatilized arsenic as trimethylarsine from the bedding material. The yield of trimethylarsine, however, was very small, 0.26 to 0.50 ng over 28 days. The formation of volatile metal(loid) compounds by composting of garden waste (City of Vancouver) was investigated. Acid digestion of the compost showed that it contained 3 ppm of arsenic. Although the compost was very biologically active, no volatile arsenic or other organometal(loid) compounds were detected in the gases collected from the compost. Aerobic and anaerobic incubation of the compost also yielded no volatile organometal(loid) compounds. It is likely that concentration of the arsenic in the compost was too low to yield volatile arsenic compounds. Iodomethane was detected in the gases collected from the compost and in the incubation flasks. Iodomethane was detected in the both the active and in the sterilized compost incubations. This indicates that the formation of iodomethane may be a chemical rather than or in addition to a biological process. The formation of volatile organometal(loid) species in the Meager Creek and in the Clear Creek hot springs (south-western British Columbia) were also investigated. No volatile organometal(loid) species were detected in the gases collected above either hot spring. Iodomethane was present in the gases collected from both hot springs. A fern, Polystichum munitum, growing in the grotto of the Clear Creek hot springs, bio- concentrated both arsenic and lead. Two species of algae found in the pool of the Clear Creek hot springs, Spirogyra sp. and Rhizoclonium sp., bio-concentrated arsenic. 145 Aerobic incubation, over a period of 15 days, of microbial mats and of sediment collected from two pools of the Meager Creek hot springs yielded trimethylarsine (0.6 to 44 ng) and trimethylstibine (0.4 to 20 ng). The amount of trimethylarsine generated by the mats was greater than the amount generated by the sediment. Comparison of aerobic and anaerobic incubations showed that the production of trimethylarsine by the microbial mats was primarily an aerobic process. The incubation results indicate that very small amounts of volatile trimethylarsine and volatile trimethylstibine are generated by the biota in the Meager Creek hot springs. 146 CHAPTER 6 SUMMARY The primary aim of this work was to determine whether the aerobic microorganisms present on sheepskin bedding materials can volatilize sufficient arsenic to be acutely toxic to infants. This is the "Toxic Gas Hypothesis" of Sudden Infant Death Syndrome. Existing analytical methods were refined to determine inorganic and methylated, arsenic and antimony species. The concentrations of inorganic and methylated, arsenic and antimony species in samples of media and in biota extracts were measured by using HG-GC-AAS. The concentrations of As(III) were determined by removing As(V) from aliquots of the samples via elution through strong anion exchange cartridges followed by HG-GC-AAS analysis of the eluate. As(V) concentrations were calculated by the difference between total inorganic arsenic and the As(III) concentrations. Volatile organometal(loid) compounds were measured by using GC-ICP-MS. Volatile arsenic compounds were deteraiined by using purge and trap-GC-AAS. The aerobic microorganisms were isolated from samples of sheepskin bedding materials that were new, that were used by a healthy infant and that were used by an infant who perished of SIDS. These bedding materials contain 90 to 380 ppb of As. Three species of fungi that methylate arsenic were isolated from the bedding material that was used by an infant who perished of SIDS. These fungi were identified as 147 Scopulariopsis koningii, Fomitopsis pinicola and PenicUlium gladioli by amplification and sequencing of their 265 rDNA. Although other species of PenicUlium and Scopulariopsis are known to methylate arsenic, this is the first time that these species have been shown to methylate arsenic. S. koningii, as well as two other sheepskin isolates, Mycobacterium neoaurum and Acinetobacter junii, are human pathogens.146'147 In particular, A. junii causes life- tlireateriing sepsis in pre-term infants.149'150 The presence of these pathogens on bedding materials should also be of interest in connection with SIDS. In future work, the numbers of arsenic methylating, as well as, pathogenic microorganisms present on the sheepskin bedding materials should be measured. F. pinicola methylated only MMA(V) yielding DMAs and TMAs(V). It is possible that other arsenic substrates are methylated, but the amount of product is below the detection limit. P. gladioli exhibited selective methylation: MMA(V) and MMA(III) were methylated, inorganic As species were not. More studies are needed to determine whether this selective methylation is due to differences in availabihty of the arsenicals to the fungus or whether it is due to the inability of the fungus to oxidatively methylate As(III). The highest yield of methyl products by P. gladioli was from MMA(III) where 38% of the starting arsenical was converted to TMAs(V). S. koningii methylated As(III), As(V), MMA(III) and MMA(V). The highest yield of methyl products by S. koningii was from As(V) where 23% of the starting arsenical was converted to TMAs(V). 148 All three fungi excrete most of the methylarsenic products into the media. This is an indication that methylation is a mechanism of detoxifying arsenic in the cell via conversion to arsenicals that can easily be excreted. Few microorganisms have been shown to methylate antimony. S. koningii methylated the Sb(III) compounds, potassium antimonyl tartrate and antimony trioxide. Very little is known about the demethylation of methylarsenicals. One of the sheepskin isolates, M. neoaurum, demethylated methylarsenic compounds. M. neoaurum demethylated MMA(V) and MMA(III) to mixtures of As(III) and As(V). A time study of the demethylation of MMA(V) showed that the concentration of As(III), in the media, increased rapidly during the growth phase of the bacterium and then decreased rapidly during the stationary and death phases. The concentration of As(V) increased slowly during the growth phase and then increased rapidly during the stationary and death phases. This indicates that MMA(V) is reductively demethylated to As(III) which is then oxidized to As(V). Demethylation of methylarsenicals may follow the reverse of the Challenger mechanism, but much more work is needed to elucidate the mechanism of demethylation. Iodide decreased the demethylation of MMA(V) by M. neoaurum and increased the methylation of MMA(V) by P. gladioli and by S. koningii. Iodide could reduce As(V) species to As(III) species hindering demethylation and enhancing methylation. Future work to determine the effects of other ions such bromide or selenate on arsenic methylation would be interesting. Although P. gladioli and S. koningii yield a significant amount of TMAs(V) from monomethyl or inorganic arsenic compounds, these organisms form very little volatile 149 trimethylarsine; only 0.0050 to 0.0080% of the starting arsenicals were volatilized as trimethylarsine over a 28 day period. S. brevicaulis, which was not found on the sheepskin bedding materials, volatilized arsenic as trimethylarsine from these materials. The yield of trimethylarsine, again, was very small, 0.26 to 0.50 ng over 28 days. Thus, it is improbable that the microorganisiTis present on the sheepskin bedding materials can volatilize sufficient arsenic to be acutely toxic to an infant. The triple-risk model of SIDS, postulates that some infants have defects in brainstem neurotransmitter receptors in regions responsible for autonomic cardiopulmonary control or have an altered trajectory in the development of autonomic control.44"46 When these infants enter a critical developmental period for homeostatic responses and are exposed to an external stressor during sleep, they succumb to SIDS.47,48 It is possible that exposure to low levels of organic or inorganic materials, generated from or present in bedding materials, could be such a stressor and could be hannful to 907 susceptible uifants especially at the crucial three month development state of the brain. The techniques developed for studying the volatilization of arsenic by the microorganisms on sheepskin bedding materials were applied to two other environments - garden waste compost and Meager creek hot springs. Composting of garden waste yielded iodomethane. Aerobic incubation of microbial mats and sediment from Meager creek hot springs yielded trimethylarsine and trimethylstibine. The formation of these species is a biological process. It would be worthwhile, in future work, to isolate the rnicroorganisms present in the mats and sediment and to examine the volatilization of arsenic and antimony by these microorganisms. 150 F. pinicola, P. gladioli, S. koningii and M. neoaurum are commonly found in soil and water. The study of their ability to methylate, volatilize and demethylate arsenic furthers understanding of the environmental cycle of arsenic. 151 REFERENCES 1. Tanaka, T. Appl. Organomet. Chem. 1988, 2, 283. 2. Boyle, R. W.; Jonasson, I. R. J. Geochem. Explor. 1973, 2, 251. 3. Flis, I. E.; Mishchenko, K. P.; Tumanova, T. A.; Russ, J. /. Inorg. Chem 1959, 4, 120. 4. Cullen, W. R.; Reirner, K. J. Chem. Rev. 1989, 89, 713. 5. Bentley, R. Adv. Appl. Microbiol. 2001, 48, 229. 6. Sanger, C. R. Proc. Am. Acad. Arts Sci. 1893, 29, 148. 7. Challenger, F.; Higginbottom, C; Ellis, L. /. Chem. Soc. 1933, 95. 8. Challenger, F. Chem. Rev. 1945, 36, 315. 9. Cheng, C. N.; Focht, D. D. Appl. Environ. Microb. 1979, 38, 494. 10. Shariatpanahi, M.; Anderson, A. C; Abdelghani, A. A.; Englande, A. J. J. Environ. Sci. Health B 1981,16, 35. 11. Bird, M. L.; Challenger, F.; Charlton, P. T.; Smith, J. O. Biochem. J. 1948, 43, 78. 12. Frankenberger, W. T. Soil. Biol. Biochem. 1998, 30, 269. 13. Cullen, W. R. Adv. Organomet. Chem. 1966, 4, 145. 14. Antonio, T.; Chopra, A. K.; Cullen, W. R.; Dolphin, D. H. Inorg. Nucl. Chem. 1979, 41, 1220. 15. Challenger, F.; Lisle, D. B.; Dransfield, P. B. /. Chem. Soc. 1954, 1760. 16. Cullen, W. R.; Froese, C. L.; Lui, A.; McBride, B. C; Patmore, D. J.; Reimer, M. J. Organomet. Chem. 1977,139, 61. 17. Simmonds, S.; Keller, E. B.; Chandler, J. P.; Vigneaud, V. d. /. Biol. Chem. 1950, 183, 191. 152 18. Bentley, R.; Chasteen, T. G. Microbiol. Mol. Biol. R. 2002, 66, 250. 19. Haller, J. S. Pharm. Hist. 1975,17, 87. 20. Bentley, R.; Chasteen, T. G. Chem. Educator 2002, 7, 51. 21. Cohen, M. H.; Hirschfeld, S.; Honig, S. F.; Ibrahim, A.; Johnson, J. R.; O'Leary, J. J.; White, R. M.; Williams, G. A.; Pazdur, R. Oncologist 2001, 6, 4. 22. Pryzgoda, G.; Feldmann, J.; Cullen, W. R. Appl. Organomet. Chem. 2001, 15, 457. 23. Mandal, B. K.; Suzuki, K. T. Talanta 2002, 58, 201. 24. IARC Monographs, 1987; Vol. 23, Suppl. 2. 25. Mass, M. J.; Tennant, A.; Roop, B. C; Cullen, W. R.; Styblo, M.; Thomas, D. J.; Kligerman, A. D. Chem. Res. Toxicol. 2001,14, 355. 26. Vega, L.; Styblo, M.; Patterson, R.; Cullen, W.; Wang, C; Germolec, D. Toxicol. Appl. Pharmacol. 2001,172, 225. 27. Ayala-Fierro, F.; Barber, D. S.; Rael, L. T.; Carter, D. E. Toxicol. Sci. 1999, 52, 122. 28. Yamauchi, H.; Kaise, T.; Takahashi, K.; Yamamura, Y. Fund. Appl. Toxicol. 1990,14, 399. 29. Irvin, T. R.; Irgohc, K. J. Appl. Organomet. Chem. 1995, 9, 315. 30. Beckwith, J. B., Seattle 1970; University of Washington Press; 14-22. 31. URL: http://www.hc-sc.gc.camppb/socialmarketmg/yir-99-00_final- 3/enghsh/sids_e.html; Health Canada, 2002. 32. Leach, C. E.; Blair, P. S.; Rerriing, P. J.; Smith, I. J.; Piatt, M. W.; Berry, P. J.; Golding, J. Pediatrics 1999,104, e43. 153 33. Williarns, S. M.; Mitchell, E. A.; Taylor, B. J. Arch. Dis. Child. 2002, 87, 21 A. 34. Daltveit, A. K.; Irgens, L. M.; Oyen, N.; Skjaerven, R.; Markestad, T.; Aim, B.; Wennergren, G.; Norvenius, G.; Helweg-Larsen, K. Acta Paediatr. 1998, 87, 284. 35. Blair, P. S.; Heming, P. J.; Bensley, D.; Smith, I.; Bacon, C.; Taylor, E.; Berry, J.; Golding, J.; Tripp, J. Brit. Med. J. 1996, 313, 1332. 36. Douglas, A. S.; Helms, P. J.; Jolliffe, I. T. Arch. Dis. Child. 1998, 269. 37. Tappin, D.; Brooke, H.; Ecob, R.; Gibson, A. Brit. Med. J. 2002, 325, 981. 38. Li, K. D.; Daling, J. R. Am. J. Epidemiol. 1991,134, 958. 39. Galland, B. C; Taylor, B. J.; Bolton, D. P. G. /. Paediatr. Child Health 2002, 38, 332. 40. Beal, S. M. /. Paediatr. Child Health 2000, 36, 540. 41. Wigfield, R.; Gilbert, R.; Fleming, P. J. Early Hum. Dev. 1994, 38, 161. 42. Read, J. C; Jeffery, H. E.; Rahilly, P. Med. J. Aust. 1982, 1, 82. 43. Filiano, J. J.; Kinney, H. C. Biol. Neonate 1994, 65, 194. 44. Kinney, H. C; Filiano, J. J.; Sleeper, L. A.; Mandell, F.; Valdes-Dapena, M.; White, W. F. Science 1995, 269, 1446. 45. Okado, N.; Narita, M.; Narita, N. Med. Hypotheses 2002, 58, 232. 46. Filer, W. P.; Myers, M. M. Semin. Perinatol. 2002, 26, 89. 47. Harper, R. M.; Kinney, H. C; Fleming, P. J.; Thach, B. T. Resp. Physiol. 2000, 119, 123. 48. Franco, P.; Szliwowski, H.; Dramaix, M.; Kahn, A. Pediatr. Res. 1999, 46, 33. 49. Morris, J. A.; Haran, D.; Smith, A. Med. Hypth. 1987, 22, 211. 50. Morris, J. A. FEMS Immunol. Med. Mic. 1999, 25, 11. 154 51. Jeffery, H. E.; Megevand, A.; Page, M. Pediatrics 1999,104, 263. 52. Bolton, D.; Taylor, B.; Campbell, A; Garland, B.; Cresswell, C. Arch. Dis. Child. 1993,69, 187. 53. Tonkin, S. L.; Gunn, T. R.; Bennet, L.; Vogel, S. A.; Gunn, A. J. Early Hum. Dev. 2002, 66, 107. 54. Pamphlett, R.; Raisanen, J.; Kum-Jew, S. Pediatrics 1999,103, 460. 55. Richardson, B. A. Lancet 1990, 335, 670. 56. Turner Report. Sudden Infant Death Syndrome. HMSO: London, 1991. 57. Richardson, B. A. JFSS 1994, 34, 199. 58. Howatson, A. G.; Patrick, W. J.; Fell, G. S.; Lyon, T. D.; Gibson, A. A. Lancet 1995, 345, 1044. 59. Limerick Report. Expert Group to Investigate Cot Death Theories: Toxic Gas Hypothesis; HMSO: London, 1998. 60. Andrewes, P.; Cullen, W. R.; Feldmann, J.; Koch, I.; Polishchuk, E.; Reimer, K. J. Appl. Organomet. Chem. 1998,12, 827. 61. Jenkins, R. O.; Craig, P. J.; Goessler, W.; Miller, D.; Ostah, N.; Irgolic, K. J. Environ. Sci. Technol. 1998, 32, 882. 62. Warnock, D. W.; Delves, H. T.; Campbell, C. K.; Croudace, I. W.; Davey, K. G.; Johnson, E. M. Lancet 1995, 346, 1516-1520. 63. Kelley, J.; Allsopp, D.; Hawksworth, D. L. Hum. Exp. Toxicol. 1992,11, 347. 64. Mitchell, E. A.; Thompson, J. M. D.; Ford, R. P. K; Taylor, B. J. /. Pediatr. 1998,133, 701. 65. Raab, A.; Hansen, H. R.; Zhuang, L.; Feldmann, J. Talanta 2002, 58, 67. 155 66. Campbell, W. A. Chem. Brit. 1965,1, 198. 67. Marsh, J. New Edinburgh Phil. J. 1836, 229. 68. Johnson, D. L.; Pilson, M. E. Q. Anal. Chim. Acta 1972, 58, 289-299. 69. Celkova, A.; Kubova, J.; Stresko, V. Fresen. J. Anal. Chem. 1996, 355, 150. 70. Saeki, K.; Sakakibara, H.; Sakai, H.; Kunito, T.; Tanabe, S. Biometals 2000,13, 241. 71. Townsend, A. T.; O'Sullivan, J.; Featherstone, A. M.; Butler, E. C. V.; Mackey, D. J. /. Environ. Monit. 2001, 3, 113. 72. Davidowski, L. Atom. Spectrosc. 1994, 15, 140. 73. Creed, J. T.; Magnuson, M. L.; Brockhoff, C. A.; Chamberlain, I.; Sivaganesan, M. J. Anal. Atom. Spectrom. 1996,11, 505. 74. Harrington, C. F.; Ojo, A.; Lai, V. W.-M.; Reimer, K. J.; Cullen, W. R. Appl. Organomet. Chem. 1997,11,931. 75. Ivanov, K.; Bekjarov, G.; Angelova, V. Anal. Lab. 1998, 7, 28. 76. Madeddu, B.; Rivoldini, A. Atom. Spectrosc. 1996,17, 148. 77. Beauchemin, D. Mikrochim. Acta 1989, 3, 273. 78. Aggett, J.; Aspell, A. C. Analyst 1976,101, 912. 79. Carvalho, L. H. M.; Koe, T. d.; Tavares, P. B. Ecotox. Environ. Rest. 1998,1, 13. 80. Braman, R. S.; Foreback, C. C. Science 1973,182, 1247. 81. Gong, Z.; Lu, X.; Ma, M.; Watt, C.; Le, X. C. Talanta 2002, 58,11. 82. Szpunar, J. Trends Anal. Chem. 2000,19, 121. 83. IARC Monographs, 1989; Vol. 47, pp 291. 84. Smichowski, P.; Madrid, Y.; Camara, C. Fresen. J. Anal. Chem. 1998, 360, 623. 156 85. Nash, M. J.; Maskall, J. E.; Hill, S. J. /. Environ. Monit. 2000, 2, 97. 86. Krachler, M.; Emons, H.; Zheng, J. Trends Anal. Chem. 2001, 20, 79. 87. Feldmann, J.; Naels, L.; Haas, K. /. Anal. Atom. Spectrom. 2001,16, 1040. 88. Wickenheiser, E. B.; Michalke, K.; Drescher, C; Himer, A. V.; Hensel, R. Fresen. J. Anal. Chem. 1998, 362, 498. 89. Pantsar-Kallio, M.; Korpela, A. Anal. Chim. Acta 2000, 410, 65-70. 90. Feldmann, J.; Hirner, A. V. Int. I. Environ. Anal. Chem. 1995, 60, 339. 91. Smith, L. M.; Maher, W. A.; Craig, P. J.; Jenkins, R. O. Appl. Organomet. Chem. 2002,16, 287. 92. Chau, Y. K; Wong, P. T. S.; Goulden, P. D. Anal. Chem. 1975, 47, 2279. 93. Parris, G. E.; Blair, W. R.; Brinckman, F. E. Anal. Chem. 1977, 49, 378. 94. Burrows, G. J.; Turner, E. E. J. Am. Chem. Soc. 1921, 119, 426. 95. Merijanian, A.; Zingaro, R. A. Inorg. Chem. 1966, 5, 187. 96. Morgan, G. T.; Davies, G. R. Proc. Royal Soc. Ser. A 1926, 523. 97. Holak, W. Anal. Chem. 1969, 41, 1712. 98. Fassel, V. A.; Kniseley, R. N. Anal. Chem. 1974, 46, 1111 A. 99. Robbins, W. B.; Caruso, J. A. Anal. Chem. 1979, 51, 889A. 100. Grueter, U. M.; Kresimon, J.; Hirner, A. V. Fresen. J. Anal. Chem. 2000, 368, 67. 101. Vuchkova, L.; Arpadjan, S. Talanta 1996, 43, 479. 102. Godden, W. B.; Thomerson, D. R. Analyst 1980, 105, 1137. 103. Edmonds, J. S.; Francesconi, K. A. Experientia 1982, 38, 643. 104. Laborda, F.; Bolea, E.; Baranguan, M. T.; Castillo, J. R. Spectrochim. Acta B 2002, 57, 797. 157 105. Krupp, E., Universitaet-GH Essen, Essen, 1999. 106. Lide, D. R., Ed. CRC Handbook of Chemistry and Physics, 76 ed.; CRC: Boca Raton, 1995. 107. Andreae, M. O.; Asmode, J.-F.; Foster, P.; dack, L. V. t. Anal. Chem. 1981, 53, 1766. 108. Craig, P. J.; Forster, S. N.; Miller, D.; Jenkins, R. O. Analyst 1999,124, 1243. 109. Koch, I.; Wang, L.; Feldmann, J.; Andrewes, P.; Reimer, K. J.; Cullen, W. R. Int. I. Environ. An. Ch. 2000, 77, 111. 110. Dodd, M.; Grundy, S. L.; Reimer, K. J.; Cullen, W. R. Appl. Organomet. Chem. 1992, 6, 207. 111. Smichowski, P.; Madrid, Y.; Guntinas, M. B. D.; Camara, C. /. Anal. Atom. Spectrom. 1995,10, 815. 112. Lintschinger, J.; Koch, I.; Serves, S.; Feldmann, J.; Cullen, W. R. Fresen. I. Anal. Chem. 1997, 359, 484. 113. Burguera, M.; Burguera, J. L. Talanta 1997, 44, 1581. 114. Braman, R. S.; Johnson, D. L.; Foreback, C. C; Amnions, J. M.; Bricker, J. L. Anal. Chem. 1977, 49, 621. 115. Pure Appl. Chem. 1992, 6"4, 575. 116. Yalcin, S.; Le, X. C. /. Environ. Monit. 2001, 3, 81-85. 117. Pierce, F. D.; Brown, H. R. Anal. Chem. 1976, 48, 693. 118. Sandhu, S.; Nelson, P. Anal. Chem. 1978, 50, 322. 119. Cullen, W. R.; Li, H.; Hewitt, G.; Reimer, K. J.; Zalunardo, N. Appl. Organomet. Chem. 1994, 8, 303. 158 120. Le, X.-C.; Cullen, W. R.; Reimer, K. J.; Brindle, I. D. Anal. Chim. Acta 1992, 258, 307. 121. Wang, X.; Barnes, R. M. Spectrochim. Acta B 1987, 42B, 139. 122. Li, H., University of British Columbia, Vancouver, 1994. 123. Bievre, P. D.; Barnes, I. L. Int. I. Mass. Spectrom. 1985, 65, 211. 124. Andrewes, P.; Cullen, W. R.; Polischuk, E. Appl. Organomet. Chem. 1999, 13, 659. 125. Feldmann, J.; Griimping, R.; Hirner, A. V. Fresen. I. Anal. Chem. 1994, 350, 228. 126. Reifenhauser, W.; Heumann, K. G. Chemosphere 1992, 24, 1293. 127. Feldmann, J., Essen, Essen, 1995. 128. Feldmann, J. /. Anal. Atom. Spectrom. 1997,12, 1069. 129. Telford, D. R.; Morris, J. A.; Hughes, P.; Conway, A. R.; Lee, S.; Barson, A. J.; Drucker, D. B. J. Infection 1989, 18, 125. 130. Siarakas, S.; Brown, A. J.; Murrell, W. G. FEMS Immunol. Med. Mic. 1999, 25, 37. 131. Lindsay, J. A. Crit. Rev. Microbiol. 1996, 22, 257. 132. Blackwell, C. C; Gordon, A. E.; James, V. S.; MacKenzie, D. A. C; Mogensen- Buchanan, M.; Ahmer, O. R. E.; Madani, O. M. A.; Toro, K.; Csukas, Z.; Sotonyi, P.; Weir, D. M.; Busuttil, A. Int. I. Med. Microbiol. 2002, 291, 561. 133. Jenkins, R. O.; Morris, T.-A.; Craig, P. J.; Goessler, W.; Ostah, N.; Wills, K. M. Hum. Exp. Toxicol. 2000,19, 693. 134. Kolacz, R.; Bodak, E.; Dobrzanski, Z.; Patkowska-Sokola, B. Czech I. Anim. Sci. 1999,44, 509-514. 159 135. Kurtzman, C. P.; Robnett, C. J. Antonie v. Leeuwenhoek 1998, 73, 331. 136. Bondgaard, M.; Norum, U.; Bjerregaard, P. Mar. Biol. 2000, 137, 995-1004. 137. Madigan, M. T.; Martinko, J. M.; Parker, J. In Brock Biology of Microorganisms, 8 ed.; Prentice Hall: Upper Saddle River, NJ, 1996, p. 188. 138. Madigan, M. T.; Martinko, J. M.; Parker, J. In Brock Biology of Microorganisms; 8 ed.; Prentice Hall: Upper Saddle River, NJ, 1996; pp. 374-375. 139. O'Donnell, K. In The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics; Reynolds, D. R., Taylor, J. W., Eds.; CAB International: Wallingford, UK, 1993, pp. 225-233. 140. Lane, D. J. In Nucleic Acid Techniques in Bacterial Systematics; Stackebrandt, E., Goodfellow, M., Eds.; Academic Press: Chichester, England, 1991, pp. 115-175. 141. Warburg, O.; Christian, W. Biochem. Z1942, 310, 384. 142. Madigan, M. T.; Martinko, J. M.; Parker, J. In Brock Biology of Microorganisms, 8 ed.; Prentice Hall: Upper Saddle River, NJ, 1996, pp. 192-193. 143. Patkowska-Sokola, B.; Gorecka, H.; Dobrzanski, Z.; Popiolek, R. Chemia dia Rolnictwa 1996, 45, 368-375. 144. Chin, J. C; Microbiol, J. E. W. Vet. Microbiol. 1992, 32, 63. 145. Challenger, F. Adv. Enzym. 1951,12, 429. 146. Marchisio, V. F.; Fusconi, A. Med. Mycol. 2001. 147. Davison, M. B.; McCormack, J. G.; Blacklock, Z. M.; Dawson, D. J.; Tilse, M. H.; Criirimins, F. B. /. Clin. Microbiol. 1988, 26, 762. 148. Woo, P. C; Tsoi, H. W.; Leung, K. W.; Lum, P. N.; Leung, A. S.; Ma, C. H.; Kam, K. M.; Yuen, K. Y. /. Clin. Microbiol. 2000, 38, 3515. 160 149. Beaufort, A. J. d.; Bernards, A. T.; Dijkshoorn, L.; Boven, C. P. v. Acta Paediatr. 1999, 88, 772. 150. Pillay, T.; Pillay, D. G.; Adhikaari, M.; Pillay, A.; Sturm, A. W. J. Hosp. Infect. 1999, 43, 299. 151. Thorn, C.; Raper, K. B. Science 1932, 76, 548. 152. Cox, D. P.; Alexander, M. Bull. Environ. Contam. Toxicol. 1973, 9, 84. 153. Cullen, W. R.; McBride, B.C.; Manji, H.; Pickett, A. W.; Reglinski, J. Appl. Organomet. Chem. 1989, 3, 71. 154. Gurleyiik, H.; Fleet-Stalder, V. V.; Chasteen, T. G. Appl. Organomet. Chem. 1997, 11, All. 155. Jenkins, R. O.; Craig, P. J.; Miller, D. P.; Stoop, L. C. A. M.; Ostah, N.; Morris, T. A. Appl. Organomet. Chem. 1998,12, 449. 156. Smith, L. M.; Craig, P. J.; Jenkins, R. O. Chemosphere 2002, 47, 401. 157. Andrewes, P.; Cullen, W. R.; Polishchuk, E.; Reimer, K. J. Appl. Organomet. Chem. 2001,15, 473. 158. Michalke, K.; Wickenheiser, E. B.; Mehring, M.; Hirner, A. V.; Hensel, R. Appl. Environ. Microb. 2000, 66, 2791. 159. Shariatpanahi, M.; Anderson, A. C; Abdelghani, A. A. Trace Subst. Environ. Health 1982,16, 170. 160. Gao, S.; Burau, R. G. /. Environ. Qual. 1997, 26, 753. 161. Turpeinen, R.; Pantsar-Kallio, M.; Kairesalo, T. In Science ofthe Total Environment, 2002; Vol. 285, pp 133-145. 162. Crecelius, E. A. Bull. Environ. Contam. Toxicol. 1977,18, 227. 161 163. Cullen, W. R.; McBride, B. C; Picket, A. W. Can. J. Microbiol. 1979, 25, 1201. 164. Quinn, J. P.; McMullan, G. Microbiol. 1995, 141, 721. 165. Shibata, Y.; Morita, M. Appl. Organomet. Chem. 1992, 6, 343. 166. Lai, V. W.-M.; Cullen, W. R.; Harrington, C. F.; Reimer, K. J. Appl. Organomet. Chem. 1997,11, 797. 167. Madigan, M. T.; Martinko, J. M.; Parker, J. In Brock Biology of Microorganisms, 8 ed.; Prentice Hall: Upper Saddle River, NJ, 1996, pp. 151-158. 168. Zulay, M. P.; Paez, G.; Ferrer, J. R. Rev. Tec. Fac. Ing. 1995, 18, 321-332. 169. Koch, A. L. /. Gen. Microbiol. 1975, 89, 209-216. 170. Tsukamura, M.; Mizuno, S. Med. Biol. 1972, 85, 229. 171. Heynes, A. M.; Pistorius, C. W. F. T. Spectrochim. Acta A 1976, 32, 535. 172. Wrench, J.; Fowler, S. W.; Unlii, M. Y. Mar. Pollut. Bull. 1988, 2, 297. 173. Cuilen, W. R.; Nelson, J. Appl. Organomet. Chem. 1992, 6, 179. 174. He, Y.; Inamori, Y.; Mizuochi, M.; Kong, H; Iwami, N.; Sun, T. Environ. Sci. Technol. 2001, 35, 2347. 175. Haus, R.; Kaeding, H; Leipnitz, W.; Bautzer, W. In Air Pollution and Visibility Measurements. Proc. S.P.I.E. 2506, 1995, pp. 748-755. 176. Beck-Friis, B.; Pell, M.; Sonesson, U.; Jonsson, H.; Kirchrnaiin, H. Environ. Monit. Assess. 2000, 62, 317. 177. Krzymien, M.; Day, M.; Shaw, K; Zaremba, L. /. Air Waste Manage. 1999, 49, 804. 178. Smet, E.; Langenhove, H. V.; Bo, I. D. Atmos. Environ. 1999, 33, 1295. 179. Rickabaugh, J.; Noyes, G. Hazard. Indust. Wastes 1993,1993, 429. 162 180. Krogmann, U.; Woyczechowski, H. Waste Manage. Res. 2000,18, 235. 181. Feldmann, J.; Koch, I.; Cullen, W. R. Analyst 1998, 123, 815. 182. Hirner, A.; Feldmann, J.; Krupp, E.; Grumping, R.; Goguel, R.; Cullen, W. R. Org. Geochem. 1998, 29, 1765. 183. Ballantyne, J. M; Moore, J. N. Geochim. Cosmochim. Ac. 1988, 52, 475. 184. Giggenbach, W. F. Bull. Volcanol. 1975, 39, 132. 185. Jordan, A.; Harnisch, J.; Borchers, R.; Guern, F. L.; Sliinahara, H. Environ. Sci. Technol. 2000, 34, 1122. 186. Keith, L. H., Ed. Compilation of EPA's Sampling and Analysis Methods, 2 ed.; Lewis Publishers: Boca Raton, 1996. 187. Bajo, S.; Suter, U. Anal. Chim. Acta 1983,149, 321. 188. Koch, I.; Feldmann, J.; Wang, L.; Andrewes, P.; Reimer, K. J.; Cullen, W. R. Sci. Tot. Envt. 1999, 236, 101. 189. Andrewes, P.; Cullen, W. R.; Polishchuk, E. Environ. Sci. Technol. 2000, 34, 2249. 190. Kaul, S.; Sumbali, G. Mycopathologia 1997,139, 137. 191. Malviya, H.; Rajak, R. C; Hasija, S. K. /. Indian Bot. Soc. 1991, 70, 213. 192. Sankov, E. A.; Suchkova, G. G.; Andreeva, K. I. Izv. Vyssh. Ucheb. Zaved., Tekhnol. Tekst. Prom. 1972, 154. 193. Baker, J. M.; Sturges, W. T.; Sugier, J.; Sunnenberg, G.; Lovett, A. A.; Reeves, C. E.; Nightingale, P. D.; Penkett, S. A. Chemosphere 2001, 3, 93. 194. Li, H.-J.; Yokouchi, Y.; Akimoto, Ft.; Narita, Y. Geochem. J. 2001, 35, 137. 195. Harper, D. B. Nature 1985, 315, 55. 163 196. Keppler, F.; Eiden, R.; Niedan, V.; Pracht, J.; Schoeller, H. F. Nature 2000, 403, 298. 197. Davis, D.; Crawford, J.; Liu, S.; McKeen, S.; Bandy, A.; Thornton, D.; Rowland, F.; Blake, D. /. Geophys. Res.-Atmos. 1996,101, 2135. 198. Amachi, S.; Kamagata, Y.; Kanagawa, T.; Muramatsu, Y. Appl. Environ. Microb. 2001,67,2718. 199. Parris, G. E.; Brinckman, F. E. Environ. Sci. Technol. 1976, 10, 1128. 200. Mariner, R. H.; Presser, T. S.; Evans, W. C. Chemical and isotopic compostion of water from thermal and mineral springs of Washington. USGS: Report OFR-82- 98, Menlo Park, CA, 1982, pp. 1-20. 201. Frank, D. /. Volcanol. Geotherm. Res. 1995, 65, 51. 202. Dushenko, W. T.; Bright, D. A; Reimer, K. J. J. Aquat. Bot. 1995, 50, 141. 203. Suhendrayatna, O. A.; Kuroiwa, T.; Maeda, S. Appl. Organomet. Chem. 1999,13, 127. 204. Takimura, O.; Fuse, H.; Yukiho, Y. Appl. Organomet. Chem. 1990, 4, 265. 205. Ma, L. Q.; Komar, K. M.; Tu, C.; Zhang, W.; Cai, Y.; Kennelley, E. D. Nature 2001, 409, 579. 206. Tamaki, S.; Jr., W. T. F. Rev. Environ. Contam. T. 1992. 207. Herschkowitz, N.; Kagan, J.; Zilles, K. Neuropediatrics 1997, 28, 296. 164