A Specific Component of the Intestinal Microbiota Exacerbates the Severity of Allergic Asthma

A dissertation submitted to the

Division of Research and Advanced Studies

of the University of Cincinnati

In partial fulfillment of the requirements for the degree of

Doctor of Philosophy (Ph.D.)

In the Graduate Program of Immunobiology

of the College of Medicine

February 2013

by Stacey Burgess

B.S., Marietta College, 2008

Committee Chair: Marsha Wills-Karp, Ph.D.

George Deepe, M.D. Simon P. Hogan, Ph.D. Edith Janssen, Ph.D. Malak Kotb, Ph.D.

Thesis Abstract Asthma is a complex inflammatory respiratory disorder that is driven by inappropriate Th cell-mediated immune responses to inhaled allergens. While mild forms of the disease are driven by Th2-mediated immune responses, recent evidence suggests that more severe forms of the disease are driven by the combination of Th2 and Th17-mediated immune responses. The incidence of asthma in developed nations has increased significantly in the past few decades and this increase in incidence has occurred at the same time as changes in lifestyle that have altered the milieu of commensal and pathogenic organisms that humans encounter and are colonized by.

Specifically, changes in the composition of the bacterial intestinal microbiota in early life, including shifts in Clostridia species, have been associated with an increased risk of the development of asthma and allergic diseases in humans. Furthermore, several specific bacteria have been shown to be protective in murine models of asthma, largely via induction of regulatory immune responses. However bacterial species that might drive more severe disease remain less defined. Segmented filamentous bacteria (SFB), or

Candidatus savagella, are Clostridia related bacteria and a component of both the mouse and the human intestinal microbiota at a young age. They also are known to drive potent IL-17A induction in the intestine and to influence extra intestinal autoimmune diseases. Thus, we explored the hypothesis that SFB in early life contributes to severe asthma in a murine model. Through a series of approaches, we specifically show that intestinal colonization with SFB drives more severe asthma in a mouse model of allergic asthma. Furthermore we demonstrate that the ability of this gut tropic bacterium to drive severe asthma is dependent upon its ability to induce Th17 cytokine production. SFB-driven IL-17A alone is insufficient to enhance asthma severity, ii but when in the presence of IL-13, it is able to drive the severe phenotype. In exploring the mechanisms by which SFB may drive Th17-dependent severe asthma, we adoptively transferred bone marrow derived dendritic cells from SFB-colonized and

SFB-free mice. Strikingly, we show that BMDDCs from SFB-colonized mice drive both

Th17 cytokine production in the lung and more severe AHR. The ability of DCs from

SFB-colonized mice to drive heightened airway responses is further associated with enhanced production and responsiveness to the Th17-promoting serum factor, serum amyloid A. This work thus suggests that transient colonization with SFB is sufficient to drive lasting changes to the ability of dendritic cell precursors to drive T cell responses that alter the severity of allergic asthma. This observation might also help to explain human data suggesting that early childhood colonization with certain bacteria can drive lasting changes in susceptibility to asthma. Our studies also highlighted the potential use of translation blocking oligonucleotides to target specific bacteria in vivo. In conclusion, our studies show for the first time that colonization with a specific gut microbe early in life can predispose towards Th17-skewed immune responses to subsequent encounters with aeroallergens resulting in the development of severe asthma.

iii

Contents Chapter One: Introduction ...... 1 1.1 Asthma definition and incidence ...... 1 1.2 Asthma pathogenesis...... 2 1.3 Asthma subtypes ...... 3 1.4 CD4+ T lymphocytes in asthma pathogenesis ...... 4 1.5 Genetic and environmental determinants of asthma ...... 10 1.6 Immune crosstalk between intestine and lung ...... 14 1.7 The bacterial microbiota and asthma ...... 15 1.8 Bacteria induced T cell responses and allergic disease ...... 20 1.9 Segmented Filamentous Bacteria ...... 22 Chapter 2: Methods development ...... 30 2.1 Introduction ...... 30 2.2 Results ...... 31 2.3 Discussion ...... 33 2.4 Figures ...... 35 2.5 Methods ...... 43 Chapter 3: Segmented Filamentous Bacteria Drive Severe Experimental Asthma ...... 47 3.1 Introduction ...... 47 3.2 Results ...... 50 3.3 Discussion: ...... 58 3.4 Figures ...... 64 3.5 Methods: ...... 81 Chapter 4. The effects of diet on allergic inflammation...... 86 4.1 Introduction ...... 86 4.2 Results ...... 87 4.3 Discussion ...... 89 4.4 Figures ...... 93 4.5 Materials and Methods ...... 99 Chapter 5. Use of morpholinos to selectively knockdown SFB colonization...... 102 5.1 Introduction ...... 102

5.2 Results ...... 105 5.3 Discussion ...... 106 5.4 Figures ...... 110 5.5 Materials and Methods ...... 116 Chapter 6: Major conclusions, discussion and future research ...... 119 6.1 SFB colonization in the modulation of severity of allergic asthma ...... 119 6.2 Potential mediators driving Th17 induction in SFB colonized mice ...... 121 6.3 Epigenetics, SFB colonization and Th17 induction ...... 125 6.4 Possible ablation of SFB ...... 131 6.5 Closing Statements ...... 135

LIST OF ABBREVIATIONS

AHR Airway hyperresponsiveness APCs Antigen presenting cell FEV1 Forced expiratory volume in 1 second HDM House dust mite IgE Immunoglobulin E LPS Lipopolysaccharide SFB Segmented filamentous bacteria PRR Pattern recognition receptor DC Dendritic cell ADPRTs ADP-ribosyl transferases BMDC Bone marrow derived dendritic cell SAA Serum amyloid A HDAC Histone deacetylases PMO Phosphorodiamidate morpholino oligomers IgA Immunoglobulin A FISH Fluorescent In situ hybridization RT-PCR Real time polymerase chain reaction ELISA Enzyme-linked immunosorbent assay DIG Digoxigenin QPCR Quantitative polymerase chain reaction 16S rRNA 16S ribosomal RNA SAF Shafer’s altered flora OVA Ovalbumin SLIT Sublingual immunotherapy EC Epicutaneous IP Intraperitoneal IV Intravenous pDCs Plasmacytoid dendritic cells mDCs Myeloid dendritic cells

vii

Chapter One: Introduction

1.1 Asthma definition and incidence

Asthma is a chronic inflammatory disease of the lung. The term asthma is derived from the Greek word aazein; meaning to pant [1]. The first known references to asthma appear in medical texts from Aretaeus of Cappadocia (1st century A.D.) and in the epic poem the Iliad by Homer. Although the disease has been recognized since antiquity, the incidence of disease has dramatically increased in the later part of the 21st century [2, 3]. Worldwide 300 million people currently suffer from asthma. However, the incidence of asthma varies greatly with geographical area, race, age and relative income levels. The rates of asthma are markedly higher in industrialized nations such as the USA, England, and Australia than in developing countries [4]. In the US alone, it was estimated that 7.8% of the U.S. population had asthma in 2008, as compared to

3.0% in 1970. Adults living in urban areas had higher rates of asthma than those living in rural or suburban areas [5, 6]. The disease burden is also higher among those reporting as multiracial (14.8%), in Puerto Rican Hispanics (14.2%), and among non-

Hispanic blacks (9.5%) than among non-Hispanic whites (7.8%). Of great concern is the fact that prevalence rates are higher among children (9.3%) than among adults (7.3%).

The poor have higher rates (11.2%) of asthma than those living above the poverty line

(7.0%) [3, 7]. Because of the relatively short time frame in which these increases in asthma incidence have occurred and the unequal geographical distribution of disease, the increase in disease burden is likely to be due to changing environmental factors.

1.2 Asthma pathogenesis

Asthma is a complex clinical syndrome that is characterized by recurrent episodes of wheezing, coughing, and difficulty breathing [5, 8-10]. It is a heterogeneous disorder with variations in the age of onset, severity of disease and underlying pathogenesis. Although asthma is multi-factorial in origin with both environmental and genetic influences, atopy-the propensity to mount IgE responses, to otherwise innocuous airborne allergens is the strongest identifiable predisposing factor for the development of asthma [8, 10-13]. In atopic asthma, the inflammatory process is thought to arise as a result of inappropriate immune responses to commonly inhaled allergens (those proteins which cause allergic inflammation)[8, 11]. The inflammatory response in the asthmatic lung is characterized by infiltration of the airway wall with lymphocytes, eosinophils and degranulated mast cells. However, other more severe forms of the disease are associated with infiltration with neutrophils as well [12, 14, 15].

Structurally the airways of asthmatics are characterized by airway smooth muscle hypertrophy, mucus cell hyperplasia and subepithelial membrane thickening which often increases with severity of disease [10, 16, 17]. These cellular findings have consistently been associated with the main physiologic abnormalities of the disease, including variable airflow obstruction and airway hyperresponsiveness (AHR). AHR refers to the tendency of asthmatic airways to contract more vigorously to a number of specific and non-specific stimuli including: allergens, exercise, cold air, chemical irritants, and airborne pollutants (ozone, cigarette smoke) [3, 18-20]. It is assessed clinically by changes in FEV1 (forced expiratory volume in 1 second) after challenge with

2 endogenous airway broncho-constrictors such as the cholinergic agonist methacholine

[10].

1.3 Asthma subtypes

Although airway obstruction and airway hyperresponsiveness are the main physiological manifestations of asthma, the disease is heterogeneous and varies from patient to patient [9, 12, 14, 16]. There are at least four, if not more subtypes of asthma which can be classified based on the type of airway inflammation observed including: eosinophilic; neutrophilic or noneosinophilic; mixed granulocytic, and paucigranulocytic asthma, in which there are normal numbers of neutrophils and little to no eosinophil infiltration[8, 14, 16]. Eosinophilic asthma is the most common subtype and occurs primarily in atopic patients. Those with atopic asthmatic generally have mild to moderate asthma, which is responsive to standard treatments such as -agonists and/or inhaled steroids [21].

Severe asthma shares many of the main characteristics of asthma such as atopy, but it is marked by more severe, and often irreversible airway remodeling, pronounced airway smooth muscle hypertrophy, higher risk of mortality during acute exacerbations and is generally characterized by neutrophilic or mixed neutrophilic and eosinophilic inflammation[12, 14, 16, 22]. Those with severe asthma are also highly refractory to treatment, which contributes to the increased mortality rate seen in the disease [14, 15].

1.4 CD4+ T lymphocytes in asthma pathogenesis

Although the etiology of asthma is not known, it is thought that it arises as a result of inappropriate immune responses to inhaled aeroallergens. As T lymphocytes are the primary orchestrators of specific immune responses, it has been hypothesized that aberrant T cell responses underlie disease pathogenesis [11, 23]. CD4+ T lymphocytes specifically are key in driving the immunopathology seen in asthma. These cells originate in the thymus and differentiate into unique subsets through signals provided through interactions in the periphery [11]. These signals including ligation of the T cell receptor (TCR) by antigen presenting cells (APCs) in the context of the

MHCII molecule, costimulatory molecule receptor ligation and stimulation by unique patterns of cytokines which are produced by surrounding cells such as epithelial cells or

APCs such as dendritic cells[24]. These differentiated CD4+ cells include: Th1, Th17,

Th2 and T regulatory cells. More recently, Th22 and Th9 cells have been described

[25]. Each subset is regulated by a specific pattern of cytokines. Specifically, IL-12, produced by DCS and macrophages, drives Th1 expansion, while IL-1, IL-6, TGF- and IL-23, also often produced by DCs, induce Th17 differentiation [24, 26]. On the other hand, epithelial cells produce IL-25, IL-33 and TSLP and each plays a role in Th2 cell differentiation and expansion [27]. T regulatory cells differentiate in the presence of

TGF-while IL-6 and TNF-α drive Th22 differentiation and IL-4 and TGF-drive Th9 induction [24, 28, 29].

Maintenance of CD4+ T cell subsets and their differentiated properties is generally accomplished via expression of unique transcription factors. These include T- bet (Th1), RORC or RORγt in mice (Th17), GATA-3 (Th2), FoxP3 (Tregs), and both

PU.1 and IRF4 for Th9 cells. The transcription factor driving Th22 cell induction is unknown [25, 29, 30]. Furthermore, these cells also each produce a unique profile of cytokines that regulates different effector functions within the body and allows the immune system to respond to varied challenges. However there is some plasticity between T cell subsets, particularly T-regulatory cells and Th17 cells, so CD4+ cells may often be present with intermediate phenotypes [31, 32]. Th1 cells primarily respond to intracellular pathogens and are the primary regulators of cell-mediated immunity, macrophage activation, and complement fixing antibody isotypes. They produce many cytokines including IFN- TNF-and TNF-α. Th17 cells, which produce IL-17, IL-21 and IL-22, are also part of the normal immune response to microorganisms and are needed for the clearance of extracellular pathogens such as Staphylococcus aureus, and Candida albicans [26, 34, 35]. IL-17A produced by these cells is particularly important in clearance of epithelial S. aureus infection [35]. However, Th17 cells are also known to drive and increase the severity of inflammatory diseases and autoimmunity through the production of effector molecules, such as IL-17A, IL-21, IL-22,

GM-CSF, and CCL20 [26, 36]. Th2 cells are important in immunity to parasites such as helminths and regulate antibody class switching to IgE subtypes and drive eosinophil and mast cell activation through the production of IL-4, IL-5, and IL-13 individually or in concert with each other [11, 33, 37].T regulatory cells, as their name implies, have regulatory functions and dampen the immune response and drive immune tolerance.

They produce high levels of IL-10 and TGF-, which serves to decrease cytokine production from a number of cell subsets including Th1, Th17 and Th2 cells. For example, IL-10 can decrease production of IFN-y and IL-13 by Th1 and Th2 cells respectively [38-40]. Th9 and Th22 cells may have roles in immunity to some organisms, regulation of immune responses and in maintaining homeostasis of epithelial barriers [29, 41, 42]. Th9 cells can produce several cytokines including IL-

9,10, and 21, IL-9 in particular has been implicated in maintaining tissue homeostasis and has been shown to be important in driving tolerance to tissue grafts during transplantation studies, however the cytokine may also be important in immunity to helminths and contribute to the development of autoimmunity and exacerbate allergic disease [29, 42]. Th22 cells produce significant quantities of IL-22 and low levels of IL-

13. CD4+ T cell derived IL-22 has been shown to be critical in host defense against infection with Citrobacter rodentium, suggesting that Th22 cells are an important component of mucosal antimicrobial host defense [43]. Th22 cells and IL-22 may also have a significant role in tissue repair following inflammation [41, 43, 44].

Since classically Th2 associated cytokines such as IL-4, IL-5, and IL-13 orchestrate the recruitment and activation of the primary effector cells of the asthmatic response, the mast cell and eosinophil, it has been hypothesized that Th2 cell derived cytokines play a pivotal role in driving the pathogenesis of asthma [10, 11, 38, 45].

Indeed several lines of evidence support an important role for Th2 cells and cytokines in the induction of asthma symptoms in humans [13, 16-19]. For example, Th2 like T cell clones specific to aeroallergens have been isolated from patients with atopy, and high levels of Th2 cells and Th2 cytokines such as IL-4, IL-5, and IL-13 are found in the

6 airways, BAL and bronchial biopsies of those with asthma [33, 46, 47]. The Th2 transcription factor GATA 3 is also expressed at high levels in the lungs of patients with atopic asthma [48]. Successful treatment of asthma is further marked by a decrease in

Th2 cytokines in the lung [49] . There is also a significant body of research in murine models that supports the role of Th2 cells and cytokines in driving allergic asthma.

CD4+ Th2 cells have been shown to be capable of driving the primary features of asthma in many models and the cytokines they produce influence the development and progression of the disease in several distinct ways [50-52]. Using a model of ovalbumin exposure and T cell transfers into mice Cohn et. al. demonstrated that transfer of OVA specific Th2 cells, rather than Th1 cells, drove airway inflammation and mucus production in mice[51]. They further explored the role of cytokines, specifically IL-4, produced by these cells and found that OVA-specific Th2 cells from IL-4–deficient mice were not recruited to the lung and did not induce mucus production, suggesting a role for IL-4 in these events, they went on to demonstrate that IL-4 was not directly involved in mucus production however, further work has suggested that it has some limited role in this [51, 52]. Several studies have demonstrated that inhibition of IL-4 can prevent both Th2 induction and allergic airway disease, including airway eosinophilia and IgE production, but that inhibition does not influence established AHR or mucus production and goblet cell hyperplasia [53-55]. In murine models knockout of the Th2 produced cytokine IL-5 ablates eosinophilia and overexpression of IL-5 drives eosinophillia in several organs including the lungs, liver and spleen, suggesting a key role for this cytokines in recruiting these cells [45]. IL-13 in particular has been shown to have a significant role in driving the immune pathology of asthma [56]. Although IL-13 has

7 pleiotropic functions that overlap with IL-4, as they share components of the same receptor, it has been shown to function independently of IL-4 and have a more important role than IL-4 in driving AHR and mucus cell metaplasia [10, 11, 38, 53].

Indeed, IL-13 is also significantly increased in the BAL of those with both mild and severe asthma [57, 58]. Furthermore, when IL-13 was blocked in a murine model of allergic asthma by administration of a soluble IL-13a2-IgGFc fusion protein (sIL-13Ra2-

Fc) which binds IL-13 prior to intratracheal (I.T) allergen (OVA) challenge there was a complete reversal of allergen-induced AHR in the model [53, 56]. Importantly, administration of rIL-13 to naïve mice elicits all of the features of the disease including:

AHR, eosinophilia, mucus hypersecretion, and subepithelial fibrosis [11, 21, 56, 59].

Blockade of the cytokine in mice is highly effective in suppressing AHR and goblet cell hyperplasia, but has less of an effect on eosinophilia or IgE production than inhibition of

IL-4 [53, 60, 61]. A recent murine study utilizing bi-specific antibodies that target both IL-

4 and IL-13 was also utilized in a model of OVA exposure driven asthma and was found to reduce the IL-4 dependent increase in serum IgE as well as IL-13 dependent AHR , lung inflammation and mucin expression[62]. Inhibition of IL-13 has seen some success in the treatment of disease in atopic patients with milder asthma [63, 64]. A recently developed anti IL-13 antibody, Tralokinumab ,has also been successful in decreasing severity of uncontrolled asthma when patients have high levels of sputum IL-13 [65].

However, it is becoming increasingly apparent that while IL-13 and Th2 cells are both necessary and sufficient to drive the primary features of asthma, other cytokines and T cell subsets may be important in modulating the severity of asthma[23].

Recent evidence is emerging that suggests that Th17 cells and cytokines derived from them can influence the outcome of asthma [23, 66-68]. Cytokines produced by Th17 cells including IL-17A can drive potent neutrophil recruitment into the airways by inducing the release of mediators such as IL-6 and IL-8 from the airway epithelium [69-

75]. IL-17 can also drive increased Muc5a induction in the airway, which may contribute to mucus hyperplasia and airway obstruction in asthma. It can further act on B cells to drive IgE induction [69-75]. Indeed, studies show that expression of IL-17A in the lungs is highest in patients with severe forms of the disease and severe asthma is often associated with neutrophillic or mixed neutrophillic and eosinophillic lung infiltration [76].

Similar patterns have been shown in murine models [77-79]. For example in a mouse model of differential susceptibility to severe asthma, mice that develop severe AHR (A/J mice) produce both IL-17A and Th2 cytokines, while a strain that develops less severe

AHR (C3H/HeJ mice) produces only Th2 cytokines and negligible levels of IL-17A following challenge to house dust mite [77, 80]. Blocking IL-17A in the susceptible

(A/J) mice decreased the severity of AHR, while administration of IL-17A in concert with allergen (HDM), induced a more severe phenotype in the C3H/HeJ mice. Interestingly, administration of rIL-17A alone to the A/J mice was not sufficient to drive AHR, however, concurrent administration of rIL-17A and rIL-13 recapitulated the severe phenotype. Taken together these results indicated that IL-17A enhances the severity of disease by acting in concert with IL-13 produced during the immune response to aeroallergens to drive more severe disease [77]. However the role of Th2 cytokines, IL-

17 and IL-17A in asthma ,and in murine models in particular, is still being explored [53].

Route of treatment can significantly influence the type of T cell response that mice

9 develop as well as the type of lung cell infiltration observed [79]. Wilson et. al. demonstrated that mice sensitized I.P. develop very strong Th2 responses in the lung and predominantly eosinophilic inflammation while mice sensitized via the airway developed mixed neutrophilic and eosinophilic infiltration and modest Th2 responses but very strong Th17 responses[79]. Blockade or administration of IL-17A at different time points further influences the outcomes of studies. Blockade of IL-17A at allergen challenge in murine models of asthma seems to decrease severity of disease [77].

However, in one study IL-17A inhibition after OVA sensitization actually exacerbated airway eosinophilia and AHR in C57BL/6 mice indicating that at some time points IL-

17A induction may serve a protective role [53, 78]. Much of this variability may be driven by differences in genetics between mouse strains but there does seem to be an association between IL-17 induction and neutrophillia in both murine models of asthma and in severe asthma in humans, suggesting that the cytokine, and possibly Th17 cells, are an important factor in modulating the severity of allergic asthma and that this may be driven in part via neutrophil infiltration into the airway [53, 77, 81]. The contribution of

Th17 cells and cytokines in driving certain subsets of asthma may also explain why blockade of IL-13 or other Th2 cytokines is not always effective in decreasing severity of symptoms in human trials [82].

1.5 Genetic and environmental determinants of asthma

Asthma is often hereditary, and presents in early childhood, with many members of a family developing the disease. Additionally, genome wide association studies have linked single nucleotide polymorphisms in a number of specific genes, including:

ORMDL3, IL33, IL1RL1/IL18R1, SMAD3 and IL13, to the development of asthma [19, 10

83-86]. These studies have further linked polymorphisms in certain genes, such as

ORMDL3, to onset of asthma at specific ages, for example in childhood. Genetic studies have also corroborated functional and observational studies in humans and mice linking certain cytokines to asthma as there have been associations of both IL-13 and IL-17A polymorphisms with an increased risk of the development of asthma [68, 85-87].

However, while there is distinct genetic and familial component to asthma, a number of studies have indicated that genetics do not fully account for the risk of development of asthma [88]. Mono and dizygotic twins have often been observed to both develop asthma, which might suggest that a shared genetic makeup underlies the development of asthma [85, 88]. However there are also many in depth surveys and studies that show discordance between the development of asthma in identical, or monozygotic twins and this difference has been associated with non germline changes in gene expression such as decreased FOXP3 protein expression, the transcription factor for T regulatory cells, in the twin that developed asthma, suggesting a strong non genetic component to the development of asthma [85, 88, 89].

Thus, despite the evidence for a heritable component to the disease, the lack of concordance of disease in monozygotic twins suggest that environmental factors also play an important role in the etiology of asthma [90]. Indeed, exposures to a variety of environmental stimuli have been shown to be associated with asthma. These include: allergens (house dust mites, cockroach, pollens), viral and bacterial infections, airborne irritants (diesel exhaust, cigarette smoke), and diet [10, 18, 91]. The differences in geographical distribution of asthma around the globe also points to environmental changes as the culprits in driving increases in asthma prevalence. Because of the

11 relatively short time frame in which these increases in asthma incidence have occurred, and the length of time needed for population level genetic changes to occur, this rise in disease prevalence is unlikely to be explained by changes in genetics alone. Thus, environmental changes are again likely driving the increase in incidence of this disease.

Comparisons of lifestyles between individuals living in developing and developed nations suggest that changes in diet, antibiotic use, family size, frequency of cesarean births, hygiene and exposure to animals, have driven distinct shifts in the type and magnitude of commensal and pathogenic organisms present in these populations[92-

95]. Correspondingly, changes in the composition of this microbiota, particularly in early childhood, have been correlated with both the presence and risk of future development of allergies and asthma [96-99].

Humans, and our mammalian model organism the mouse, normally have complex communities of eukaryotic, bacterial, fungal and viral microorganisms that exist in many locations throughout the body, including the skin and mucosal surfaces such as the lung and gastrointestinal track. This microbiome is acquired shortly after birth, evolves throughout our lifetimes, and is profoundly affected by our environment, which might include the microbiome of our parents and our food, and the nutritional composition of our diet [95, 100]. The mammalian immune system evolved in the context of this constant exposure from both beneficial and pathogenic organisms and it has been hypothesized that in the absence of microbial exposure immune pathology such as allergies and autoimmunity might develop[101].

The idea that exposure to certain microorganisms and the development of allergies and asthma might be interconnected has existed for some time. In 1936,

Stevens et al noted that those with asthma and hay fever had differing seroreactivity to a number of bacteria when compared to healthy controls[102].The modern hygiene hypothesis, an extension of this observation and many others, was proposed by David

P. Strachan and arose from the observation that individuals from larger families were

13 less prone to developing atopic diseases[101, 103].He hypothesized that decreasing family sizes in developed nations led to decreased opportunity to acquire infectious diseases in childhood, and that these diseases, despite their morbidity and mortality, could drive immune responses that would prevent or be protective in the context of atopic disease[101]. This “hygiene hypothesis” is still being explored, however, newer research suggests that atopic diseases result from an imbalance in immune cell subsets that were once modulated by commensal bacteria, protists and helminths or “old friends” that have decreased or are no longer present in the human microbiota [104].

Thus it is possible that components of the intestinal microbiota, particularly components of it present during early childhood, might influence the etiology of asthma by altering immune responses that underlie the pathophysiology of the disease.

1.6 Immune crosstalk between intestine and lung

The exact mechanisms by which an immune response induced in the intestine or at other mucosal sites might influence the lung have not been determined. However, it has long been hypothesized, as well as demonstrated in many models, that mucosal tolerance to food antigens or other ingested components can drive systemic tolerance to those antigens in healthy individuals and that mucosal vaccination can drive systemic immunity [11, 24, 40, 105]. It has further been shown that induction of Th17 responses at sites remote to the lung can contribute to the development of AHR in a murine model.

He, et al have shown that epicutaneous (EC) immunization of mice with OVA can drive induction of IL-17A-producing T cells in the lung, draining lymph nodes and spleen as well as increase serum IL-17A levels. These mice also have more severe AHR than i.t. sensitized mice and this increase in AHR was reversed upon IL-17A blockade [67]. 14

Furthermore, there is a plethora of research suggesting that tolerogenic responses to allergens in atopic individuals can be elicited by sublingual immunization with those allergens, linking the sinus, lung and oral mucosal immune systems[106].

It is then important to note that the largest mucosal surface in the body is located in the intestine. This surface is also densely populated by a community of bacteria whose composition is strongly influenced by many of the changes that have occurred in lifestyle in developed nations, changes that have also been correlated with the development of asthma [87-93]. The bacterial intestinal microbiota is also particularly well suited to alter the T cell milieu of the host as it forms a complex interaction that shapes the environment in which immune responses are initiated and mature.

Therefore, the bacterial microbiota and shifts in it may profoundly influence the induction of T cell populations important in driving asthma.

1.7 The bacterial microbiota and asthma

Commensal intestinal bacteria obtained from the environment and during birth can have a significant influence on the function, structure and composition of the immune system. Gnotobiotic, or germ free, mice have structural defects in Peyer’s patch formation, decreased or absent IgA production, few intra epithelial lymphocytes and a systemic defect in T regulatory cell induction which is reversed once the animals are recolonized with a normal murine fecal microbiota [107, 108]. Components of the intestinal microbiota such as Lactobacillus casei and bacteria present on vegetables and in the soil such as Lactobacillus plantarum and Bifidobacterium bifidum can also drive Th1 and T regulatory cell induction which may be antagonistic to Th2 driven

15 pathologies such as asthma and eczema [109-111]. However some commensal or pathogenic bacteria might also exacerbate atopic disease by driving immune responses that drive or augment Th2 or Th17 cell responses.

On average, the normal flora of the gastrointestinal tract is composed of at least several hundred species and consists of 1012 bacteria per gram of large bowel content.

There are far more bacterial cells than there are eukaryotic cells in the human body and these organisms form a symbiosis that influences many aspects of human physiology including the composition of the metabolome, which is the complete set of body wide small-molecule metabolites which includes hormones, chemokines, cytokines and other signaling molecules [92, 93, 112]. Precisely how the composition of the microbiota influences the metabolome and immune pathways downstream of it is an emerging science. However, it has become clear that, while where is a great deal of variability in the composition of the intestinal microbiota on a species level within individual humans, there is much more stability on a phyla and genera level within human populations [93,

112, 113].

There are a few distinct enterotypes, which are classification units based on the bacterial composition of the gut microbiome, present in humans. How many are present is yet to be determined, however at least three are present. These enterotypes are independent of ethnic background but appear to be influenced to some degree by the composition of diet. The three main types are identified largely by the variation in the levels of three genera, with significant contributions from other genera.

The main abundant genera in each group are: Bacteroides (enterotype 1),

Prevotella (enterotype 2), Ruminococcus (enterotype 3)[93]. These enterotypes can also be represented by analyzing clusters of bacterial families and this alternative analysis shows that these first two groups are also driven by Bacteroides and

Prevotella, whereas the third cluster is mostly driven by related groups of the order

Clostridiales, family Clostridiaceae, and order Blautia and unclassified

Lachnospiraceae. Early studies have suggested that specific enterotypes (2,3) might be associated with the development of intestinal autoimmunity and obesity. However, which organisms are responsible is still a point of contention. Advances in sequencing and bioinformatics will allow better definition of these groups however, and might suggest that a continuum of enterotypes is present as well as provide information about their presence and interaction with the host metabolome and RNA transcriptome[92, 93,

112, 113].

While the field is quite young, there are examples of how distinct enterotypes might influence extra intestinal diseases through interactions with the metabolome.

Wang et al have demonstrated that dietary biomarkers, such as phosphatidylcholine, that correlate with negative outcomes during cardiovascular disease and atherosclerosis in humans are only produced in mice with an intact microbiota (non- gnotobiotic), and note that specific, yet to be determined, components of the microbiota likely drive production of these mediators[114]. The composition of the microbiota might also influence the development of autoimmune diseases. Human studies of type 1 diabetes (T1D) have demonstrated that there are distinct taxonomic differences in the microbiome of infants that developed the disease compared to those that did not, with

17 decreased microbial diversity and a higher proportion of the Bacteroidetes phyla compared to Firmicutes in the group with the disease. It has also recently been shown that members of the Bacteroidetes and Firmicutes are heavily involved in metabolism of complex carbohydrates in the intestine [115, 116]. Thus, components of the microbiota can produce mediators and metabolites that may strongly influence the development of extra intestinal disease.

During the shift from an agricultural society to today’s modern urban environment and lifestyle there has been a profound shift in the types and number of organisms that people encounter on a daily basis. Much research has focused on the counter regulatory role of helminthic infection in the context of allergy and asthma and the general consensus, while still evolving, is that helminth infection, which no longer occurs in most developed nations, may provide some protection against the development of atopic and inflammatory disease. Helminthic therapy has even entered clinical trials in the treatment of inflammatory bowel disorders [103, 117]. However the intestinal bacterial microbiota also likely has a distinct, but less well characterized, effect on the development of allergies and asthma and has also been influenced by modern society.

Human epidemiological surveys such as the KOALA Birth Cohort study have suggested that altered microbial exposures during early childhood influence the development of atopy and asthma [98, 118]. Antibiotic treatment early in life, which is prevalent in developed nations, but often non-existent in the non-developed world, has also been associated with an increased risk of the development of allergies and asthma.

However, which species may have been protective in these cohorts is largely unknown

[119, 120]. There has also been an association between mode, type and place of birth,

18 indicating that non vaginal birth and birth in urban areas versus rural areas, both of which are associated with decreased bacterial exposure, increases risk of development of allergies and asthma later in life [96, 121, 122]. Associations have also been made between consumption of fermented foods (probiotics), particularly those containing

Lactobacillus species, and protection from the development of allergies and asthma

[123-126]. Further studies have noted that the composition of the intestinal bacterial microbiota differs between allergic and nonallergic infants, with a larger proportion of

Clostridia species present in atopic children[127]. This result is intriguing given that

Clostridia species tend to be more antibiotic resistant than other bacteria and expand after antibiotic treatment [128-130]. However, at this point, there is no definitive component of the bacterial intestinal microbiota that is directly associated with the development of atopy and asthma, aside from limited evidence that Clostridia species such as C. difficile may be more common in atopic infants and that Lactobacillus species may be protective [94].

The great deal of diversity in the specific bacteria that are associated with asthma and atopy in these studies is likely due to the significant differences in study design, including age and diet of cohorts, sample preparation, and method of microbiota analysis. Future microbiota studies will likely be more standardized and offer better means of comparison. However it is clear that shifts in components of the microbiota may have a role in the development of allergies and asthma in humans and may underlie the increased incidence of asthma and allergies in the developed world.

1.8 Bacteria induced T cell responses and allergic disease

A number of studies have examined how specific bacteria and components of the bacterial microbiota might influence immune responses key to the development of allergic asthma. As mentioned previously, mice raised under germ free conditions have systemic defects in their immune system, including poorly developed Peyer’s patches and decreased levels of T regulatory cells throughout the body. They also have increased susceptibility to autoimmune disease and poor clearance of infections by pathogenic bacteria and helminths. Reconstitution of the normal microbiota in these mice abrogates these effects (30). This occurs because intestinal bacterial colonization is capable of shaping the T cell repertoire of the host, which is also important in atopic disease (38,39). The overall composition and presence of a complex intestinal microbiota likely has a role in the development of proper intestinal immune cell architecture and atopic disease. However, T cell responses driven by individual bacterial species have also been shown to influence the outcome of allergic disease in murine models. This highlights the significant role that colonization by single organisms can play in modulation of disease.

One such study has shown that infection with Listeria monocytogenes, which drives a potent Th1 response, prior to OVA sensitization leads to suppression of allergic airway disease, including a decrease in eosinophilia in bronchoalveolar lavage, total

IgE, and OVA-specific IgE, IL-4 and IL-5 in the circulation. These effects are mediated by preventing Th2 skewing (38). Furthermore, maternal colonization with the soil bacteria Acinetobacter lwoffii has recently been shown to decrease the severity of airway disease in pups. This protection was conferred via persistent epigenetic changes 20 in the IFNγ promoter that decreased production of Th2 cytokines from T cells in the offspring [131, 132].

A number of studies have also examined the role of Lactobacillus and

Bifidobacteria species in driving regulatory responses that influence the development of atopic disease and generally show a beneficial role for colonization with these genera in asthma and allergy models [109, 133-136]. In one such study, treatment of neonatal

Balb/c mice with either Lactobacillus rhamnosus GG or Biﬁdobacterium lactis for 8 consecutive weeks during sensitization with ovalbumin suppressed all aspects of the asthmatic phenotype in that model including airway reactivity, IgE production and eosinophilia. This effect occurred alongside a 2-fold upregulation of Foxp3-expressing cells in the peribronchial lymph nodes of colonized mice, suggesting that induction of T regulatory cells was driving the phenotype [135]. Other bacterial genera can also drive a robust regulatory response in the context of asthma and allergic disease. Colonization with a defined mix of indigenous Clostridium species (clusters IV and XIVa) at an early age can drive T regulatory responses in mice as well as decrease OVA-specific IgE levels in OVA immunized mice [137]. Thus, specific organisms can drive T cell responses that are protective in atopic diseases and asthma and early exposure is particularly important. However, bacterial species that drive immune responses that might contribute to a more severe asthma phenotype remain considerably less well defined.

1.9 Segmented Filamentous Bacteria

Segmented filamentous bacteria (SFB), a group of bacteria closely related to

Clostridium have been shown to drive a potent Th17 response in mice and are present in humans [138-140]. Because of the presence of Clostridiaceae as a distinct component of human enterotypes, the potential contribution of Clostridium species in the development of asthma in humans, and the role of IL-17A in the pathogenesis of severe asthma, this organism may be an important factor to consider in the development of the disease [93, 96, 98, 100, 138, 141, 142]

Segmented filamentous bacteria (SFB) are a morphologically and genetically- defined, Clostridium related, spore-forming group of intestinal bacteria that colonize the digestive tracts of vertebrates ranging from trout to man[139, 140, 143-146]. They were originally described microscopically by Joseph Leidy in 1849 in the hindguts of termites and other arthropods. They have historically been assigned the species name arthromitus under the genus Bacillus and later Candidatus by Snel. However studies of the bacteria’s 16sRNA and later the entire genome show that the SFB present in vertebrates form a distinct lineage within the family Clostridiaceae while the arthropod

SFB have recently been shown to be a monophyletic lineage within the family

Lachnospiraceae[147, 148]. Therefore Candidatus arthromitus can no longer be used to refer to both SFB from vertebrates and arthropods. Thompson et al. thus proposed the provisional name Candidatus savagella to honor the microbiologist Dwayne C. Savage, who was the first to describe SFB in the mouse intestine [149, 150]. However, the genome of SFB (Candidatus savagella) was independently sequenced by two groups prior to the publication of this paper and submitted to genetics databases as Candidatus

22 arthromitus and many previous publications refer to the vertebrate SFB as C. arthromitus[139, 151] . This thesis focuses on vertebrate SFB (Candidatus savagella) and all references to SFB concern these genetically defined bacteria rather than morphologically defined segmented filamentous bacteria. SFB are obligate gut trophic, host specific, and have some unique physiology which has prevented their cultivation and made their classification difficult. They also drive potent activation of the immune system both locally and extra intestinally. Thus, they may play a role in the etiology of asthma and other inflammatory diseases [144, 147, 152-155].

SFBs inhabit the small intestine, particularly the terminal ileum, of a wide range of mammals. Early electron microscopy studies have demonstrated that the bacteria localize on epithelial surfaces, particularly M cells and Peyer’s patches, in the small bowel of mice and rats and that they interact with epithelial cells to form an attachment site and drive immune activation [150, 153, 154, 156, 157]. SFB are known to have a complex life cycle and formation of a holdfast cell at an epithelial attachment site is one stage of this life cycle. These holdfast cells have a hook like end that inserts into the epithelial cells of the host intestine and subsequent cells, which make up the “filaments” of SFB, attach from this site[150]. A spore forming body forms at the end of the longest filaments and sheds endospores into the intestine[156]. Whole genome sequencing of

SFB confirms that the bacteria has genes needed for spore formation and also suggests that it may possess flagellated life stages as well. Genome sequencing also reaffirms the very gut tropic nature of these bacteria. SFB are anaerobic and sequencing reveals that they also lack genes for de novo synthesis of many amino acids, vitamins/cofactors and nucleotides and have transporter genes that allow them to scavenge these factors

23 from the host intestine [139, 158]. Efforts to cultivate SFB using a variety of methods have been unsuccessful, possibly because of these fastidious nutrient requirements.

However the bacteria can be serially passaged in gnotobiotic mice to maintain a colony of mice that are exclusively colonized with SFB [143, 145, 150, 152, 156, 159].

SFB also have distinct kinetics of colonization within mice and humans. A number of murine studies have shown that SFB expand rapidly in the gut shortly after weaning and colonize the length of the intestine. SFB then slowly retracts over time to become established only in a small part of the cecum and terminal ileum. A recent study in humans has also suggested that the bacteria is not present at any appreciable level after 3 years of age[140].This suggests that SFB colonization is a transient feature of the early life intestinal microbiota of mammals.

In mice this transient spike in colonization occurs during the drop off in maternal

IgA that occurs after weaning and before the mouse mounts its own IgA response against the bacteria. In turn, IgA deficient mice have highly elevated levels of SFB colonization. SFB also seems to drive unusually high levels of IgA induction, but does not appear to influence IgE induction [143, 150, 155, 156, 160, 161]. Furthermore intestinal colonization by SFB is influenced by a number of factors, including diet, weaning, strain, housing, and the immune status of the mother. SFB colonization is particularly sensitive to level of retinoic acid, complex fiber and lectin from beans such as phytohemagglutinin in the diet, with more robust growth with higher levels of these nutrients [162-165] . The factors that influence the kinetics of SFB colonization in humans are largely unknown but may be influenced by duration of maternal breast feeding and secretion of IgA by the child [140]. However SFB colonization can also

24 drive a number of other striking changes to the immune system of mice, and possibly humans.

Colonizing gnotobiotic mice with SFB alone drives significant activation of the mucosal immune system. Colonization drives maturation of Peyer’s patches in gnotobiotic mice and drives production of high levels of both natural and SFB specific

IgA in both gnotobiotic mice and conventionally raised mice. In gnotobiotic mice SFB colonization drives potent induction of several subsets of CD4+ T cells including Tregs

(FoxP3+), Th1 cells (T-bet, IFN-y) and Th17 cells, however in conventionally raised mice they largely drive Th17 (Roryt, IL-17A) induction[138, 166-168]. Thus, in gnotobiotic mice SFB alone is capable of driving activation of the mucosal intestinal immune system similarly, but not identically, to that seen when a number of species, including cocktails such as Shafer’s altered flora, are given to these mice [169, 170].

However, the response that it drives in conventionally raised mice is likely more applicable to human health, as humans generally have an intact microbiota.

In 2008 and 2009 Ivanov et al. noted that colonizing gnotobiotic mice with

Shafer’s altered flora (SAF) did not drive IL-17A induction in the intestine of mice while colonization with fecal material from specific pathogen free (SPF), or conventionally raised mice, drove robust IL-17A induction[138, 171, 172]. This indicated that a component of the microbiota of mice, not present in SAF, could drive IL-17A induction in the intestine. They also noted that C57BL/6 mice from Jackson Laboratories did not have IL-17A induction in their intestines while mice from Taconic Farms did, suggesting that there was some difference in the microbiota of mice between these two vendors that might be driving this difference in cytokine induction. They went on to show, using

25 mice from these two vendors, gnotobiotic mice and fecal material from SFB monoassociated mice, that SFB were the component of the microbiota driving IL-17A induction in these mice. They further demonstrated that CD4+, Roryt+ , Th17 cells were the cell type responsible for IL-17A induction in the intestine of SFB colonized mice[138,

171, 172]. Independently, and prior to these studies, SFB, were also shown to be important in a gut specific inflammatory disease model, and that CD4+ T cells driven by these bacteria underlined this increased pathology[173]. Recent research has shown that the Th17 response driven by SFB has effects on the severity of disease models outside of the intestine. Their ability to induce IL-17A producing CD4+ T cells may be particularly important in the context of modulation of severity of asthma as well.

SFB has been implicated in driving increased severity in murine models of extra- intestinal autoimmune diseases such as inflammatory arthritis and experimental autoimmune encephalomyelitis (EAE) [174, 175]. Furthermore, SFB colonization correlated with protection from diabetes in non-obese diabetic mice [176]. In the first two models severity is known to be modulated by Th17 cytokines, and correspondingly blockade of IL-17A abrogated symptoms of disease while increasing disease severity in the diabetes model. Although it is not entirely known how SFB is protective in a diabetes model, the authors hypothesized that SFB colonization drove induction of a robust Th17 population in the gut, and that this population in turn inhibited the islet cell-directed Th1 response necessary for progression of the disease [176]. Therefore SFB, a gut tropic organism, can drive Th17 responses that influence extra intestinal autoimmune disorders.

Specific aims

The incidence of asthma is rapidly increasing in the developed world. At the same time lifestyle changes, including changes in diet, in those nations is driving shifts in the composition of the intestinal bacterial microbiota [177, 178]. Changes in the composition of the microbiota early in life, including shifts in Clostridia species, have been associated with an increased risk of developing asthma and atopic diseases in humans and several specific bacteria have been shown to be protective in murine models of asthma, largely via induction of regulatory T cells[40, 98, 118, 124, 134, 136].

However bacterial species that might drive more severe disease remain underexplored.

A specific, yet transient, component of the murine and human intestinal microbiota, the uncultivable Clostridia, SFB or Candidatus savagella drives a potent

Th17 response that influences extra intestinal autoimmune diseases [138, 140, 154,

162, 179]. As colonization with Clostridia species early in life has been associated with the development of asthma, SFB is present only in early development in humans and mice [98, 118],and increased Th17 cytokine induction in concert with Th2 induction have been associated with the development of severe asthma[76, 77, 180], we hypothesize that SFB colonization will drive more severe asthma in a murine model of allergic asthma.

The specific aims of this thesis are:

1.To determine if a specific component of the intestinal microbiota alters the severity of allergic asthma.

2.To determine the primary mechanisms by which asthma severity is modulated by the intestinal microbiota.

3.To explore how modulation of the diet influences the microbiota, in particular SFB colonization, and subsequent development of allergic asthma.

4.To explore the use of vivo-morpholinos to specifically ablate a component of the intestinal microbiota and to attenuate the severity of allergic asthma.

Chapter 2: Methods development

2.1 Introduction

SFB are historically characterized by their morphology, tissue tropism and the sequence of their 16S ribosomal RNA (16S rRNA) gene as described by Snel [147,

181]. Use of the 16S rRNA gene is one the more commonly used genetic approaches to define the presence of specific bacteria and determine the composition of bacterial communities [93, 99, 122, 182]. The 16S rRNA gene is well suited to this purpose because it is common to all bacteria and is composed of conserved stretches of sequences that can be used to design universal primers to all eubacteria (EUB)[183,

184]. The 16S rRNA gene also contains highly variable regions that are often specific to individual species or genera which can be utilized to specifically identity bacteria in a mixed community such as the terminal ileum. Furthermore, the expression of specific species can be normalized to the expression of total bacteria to determine the relative contribution of specific species to a total community [183, 184]. For this reason we utilized QPCR of SFB and EUB 16S rRNA to detect SFB colonization in mice. However,

QPCR is highly sensitive and will result in the amplification of sequences when only small segments of DNA are present, thus other methods, such as microscopy, are useful to confirm to the presence of vegetative bacteria[183, 184]. As SFB has distinct life stages, some of which are easily visualized via gram stains and phase contrast microscopy, we utilized this approach as well [143, 144, 154, 163, 181].

To determine the effects of SFB colonization on the prognosis of allergic asthma we utilized a modified version of a well characterized model of murine allergic asthma developed in part by the Wills-Karp Laboratory [56, 59, 80, 185]. In this model allergen exposure in mice (HDM) results in AHR, pulmonary eosinophilia, neutrophillia, increases in airway epithelial mucus content and airway inflammation as well as serum

IgE induction [64, 80, 186]. A number of other murine models of asthma exist including ones utilizing ovalbumin exposure, however this model closely resembles the pathology seen in atopic asthma and utilizes HDM, which the bulk of those with allergic asthma are sensitized to, and thus should provide a relevant model for analyzing the influence of components of the intestinal microbiota, including SFB, on the development of asthma[187].

2.2 Results

We utilized a variety of techniques to detect SFB in the terminal ileum of mice that reflected current knowledge about the morphology of the bacteria and genetic make-up of the SFB 16srRNA. QPCR was utilized to amplify SFB and determine colonization or lack thereof in mice from Taconic Farms and Jackson laboratories. We found that there was no amplification of SFB specific 16srRNA transcripts compared to water and primer containing samples in mice from Jackson Laboratories, yet there was amplification of SFB 16srRNA transcripts in the terminal ileum of mice from Taconic farms compared to Jackson samples (Fig.1). This result was consistent with studies by

Ivanov indicating differential colonization between the two vendors [138, 172]. We also utilized gram stains and phase contrast microscopy of lung and intestinal tissue homogenate to visualize filaments of SFB and found that these characteristic filaments 31 were not present in the lungs of mice from either vendor or in the intestine of mice from

Jackson laboratories, but were present in the intestine of mice from Taconic farms (Fig.

2). Finally, to determine if these filaments were representative of genetically defined

SFB we utilized a probe overlapping the 16srRNA primer sequence and fluorescent in situ hybridization to stain filaments fixed to slides from Jackson and Taconic mice.

There was no staining of filaments in Jackson samples, as none were present, and in

Taconic samples only SFB filaments stained, with no staining of round and oblong shapes that were likely other components of the intestinal microbiota, or intestinal epithelium (Fig. 3). However there was some diffuse fluorescence present on the slides.

It thus appears that the filaments present in the intestinal homogenate of SFB colonized mice are specific to SFB and can be considered representative of SFB colonization.

Filaments only stained at broken tips however, indicating incomplete permeablization of

SFB.

To determine whether HDM treatment would drive development of the asthma phenotype in mice lacking SFB colonization, we compared the development of AHR and airway inflammation in C57BL/6 mice from Jackson Laboratories treated with PBS and

HDM. HDM exposure induced statistically significant increases in airway responsiveness above PBS-control mice (Fig. 4b). The increase in AHR in the HDM- challenged mice was also associated with a significantly greater increase in bronchoalveolar lavage (BAL), eosinophils and neutrophils as compared to the PBS treated mice (Fig. 4c,d). Analysis of lung sections of HDM-challenged mice showed that these mice exhibited a greater number of PAS-positive cells, and a greater degree of cellular inflammation when compared to PBS treated mice (Fig.4e). Additionally, serum

32 levels of total IgE were higher in HDM mice (Fig. 4f). We also examined the cytokine profile of lung cells in response to HDM restimulation and found that HDM treatment of mice from Jackson laboratories produced significantly elevated levels of the Th2 cytokines IL-5 and IL-13 and IL-10 but no significant levels of IL-17A when compared to

PBS treated mice (data not shown) which is consistent with previous research showing that HDM exposure drives robust production of both IL-10 and Th2 cytokines in lung cells[188-194].

2.3 Discussion

Our method for detecting SFB via QPCR corroborates SFB colonization in mice previously reported to be SFB colonized (Taconic) or SFB free (Jackson) (Fig 1)[138] suggesting that it is a viable tool for detecting the presence of this bacteria in tissue and fecal samples. Furthermore, our microscopic method of detection of SFB does not show vegetative SFB filaments in the terminal ileum or lungs of non-colonized mice as determined by QPCR, further validating the PCR and providing another method of confirming SFB colonization. In order to definitively link the specificity of our QPCR primers to the presence of these filaments we utilized FISH with a probe overlapping the primer sequence and found that only SFB filaments were labeled. However they were only labeled at the tips of broken fragments and this is likely a product of the method utilized. The Fab fragments used to attach the fluorophores to the hybridizing oligo are quite large and may not have penetrated the disrupted cell membranes of the unbroken bacterial segments or the cell membranes of SFB may not have sufficiently disrupted.

This issue would likely be remedied by using fluorophores that were directly conjugated to the DNA and thus could more easily permeabilize the SFB filaments or utilizing other 33 permeablization methods. The methodology may be improved in the future, however, the goal of FISH was to validate the specificity of the primers and identity of the visualized filaments and these data are sufficient for that purpose. Thus, combined we feel that these methods justify the use of the published 16SrRNA primer for SFB for the detection of SFB in the tissue and fecal samples of mice.

Treatment of SFB free mice (Jackson mice) with HDM via our protocol also elicits

AHR, pulmonary eosinophilia, neutrophillia, increases in airway epithelial mucus content, airway inflammation and induction of serum IgE and lung Th2 cytokines consistent with other models of allergic asthma and human asthma [8, 57, 64, 80, 186].

Thus, these methods should provide a relevant, effective model in which we may study the role of SFB in the development of allergic asthma

2.4 Figures

Figure 1: Samples from the terminal ileum of SFB colonized mice amplify before water samples and SFB free samples during QPCR. Expression of the 16S rRNA of

SFB in intestine was measured by real-time PCR on a Biorad Icycler or StepOnePlus™

Real-Time PCR System from Applied Biosystems (a). This is a representative amplification curve from one such run on the Biorad Icycler. The red line indicates the crossing threshold (CT) value from which expression data was calculated as in methods. SFB colonized (Taconic), SFB free (Jackson) and water samples are noted.

Figure 2: SFB filaments are not present in the terminal ileum of mice from

Jackson Laboratories but are present in mice from Taconic Farms. Approximately

1cm of terminal ileum from mice from either vendor was homogenized at a low RPM setting with a tissuemizer in 1ml of sterile PBS then gram stained and photographed at

20X magnification with phase contrast microscopy. SFB filaments are noted.

Figure 3: SFB filaments specifically stain with a DIG labeled oligonucleotide probe. Intestinal tissue homogenate from mice from Taconic Farms was stained with

FISH using oligonucleotide probes specific for SFB as in methods. Slides were photographed under oil immersion (100X) with a fluorescent microscope. Staining was specific and was only present in SFB filaments, which stained at their tips only, indicating incomplete permeabilization of cells.

Figure 4: Treatment with HDM drives more severe allergic asthma.

4 week old SFB free C57BL/6 mice from Jackson Laboratories were sensitized with

HDM as in methods and sacrificed at 72 hours after the final HDM challenge (a). Airway function (b) and cellularity of BAL fluid (c,d) in mice treated with PBS or HDM was determined. Extent of staining of mucosa in HDM treated mice with periodic acid–Schiff

(PAS) d, left) and degree of inflammation (d,right) was determined from scoring of histological sections as described. Level of serum IgE was determined via ELISA (f).

Data represent means +/- SEM (n= 8 mice/group).* or ** indicates, P < 0.05 or P <

0.001, respectively, compared with PBS-sensitized/ challenged animals

2.5 Methods

Mice

4 week old male C57BL/6 (Jackson Laboratories, Bar Harbor, ME) were housed in a specific pathogen–free facility in micro isolator cages. Mice were provided autoclaved food (Lab diet 5010) and water ad libitum. All procedures were approved by the

Institutional Animal Care and Use Committee of Cincinnati Children's Hospital Medical

Center.

Quantitative real-time RT-PCR.

Gene expression in intestine was measured by real-time PCR on a Biorad Icycler or

StepOnePlus™ Real-Time PCR System from Applied Biosystems. Data were normalized to expression of the mouse ribosomal S14 gene or a conserved Eubacteria

16s RNA gene (EUB) for SFB and bacterial colonization experiments and expression was calculated using the standard 1/ct method. EUB primer sequences are as follows,

EUB Forward: 5’-ACTCCTACGGGAGGCAGCAGT-3’, EUB Reverse: 5’-

ATTACCGCGGCTGCTGGC-3’, SFB; SFB Forward: 5’-

GACGCTGAGGCATGAGAGCAT-3’ , SFB Reverse: 5’-

GACGGCACGGATTGTTATTCA-3’ .

Preparation and visualization of intestinal tissue homogenate

Approximately 1cm of terminal ileum from mice from either vendor was briefly (~5 seconds) homogenized at a low RPM setting with a tissuemizer in 1ml of sterile PBS.

50uL of this homogenate was dropped onto a glass slide and allowed to dry at room

43 temperature, once dried it was heat set by flaming over a bunsen burner then gram stained. Slides were then photographed under phase contrast microscopy.

Fluorescent In situ Hybridization (FISH)

Intestinal tissue homogenate from mice from each vendor was prepared as above but were not gram stained. Slides were then incubated at room temperature for 4 hours in

4% paraformaldyde in sterile PBS, then washed twice in PBS and allowed to dry overnight to further fix cells. Slides were then dehydrated by passing through ethanol solutions (50%,80%,100%, in DIWater) for three minutes each then air drying for 1 hour.

Cells on slides were then permeablized and incubated in TE buffer with lysozyme

(1mg/mL) for 10 minutes, washed in DI water and allowed to air dry. A digoxigenin labeled oligonucleotide probe (IDT, Coralville, Iowa) specific for SFB and overlapping the primer sequences (GCGAGCTTCCCTCATTACAAG) was utilized for FISH. 50ng of probe was added to 8uL of hybridization buffer (Enzo) and used to cover each slide in a humidified slide chamber which was then incubated at 45º C for 2 hours. DIG labeled oligonucleotides were detected with FITC labeled anti DIG fab fragments (Roche) by diluting fab fragments 1:4 in hybridization buffer (Enzo) and incubating for an hour at 27

º C for one hour. Slides were then washed in PBS and air dried overnight. The next morning slides were mounted in Citifluor (Citifluor LTD) and photographed on a fluorescent microscope.

Sensitization protocols and SFB colonization.

Mice were sensitized to HDM by intraperitoneal (i.p.) injection with HDM (30ug/100 uL,

Greer Laboratories, Lenoir, NC) or PBS (100uL) on days 1 and 7 then intratracheally

(100ug/30 uL) (I.T) on days 14 and 21 with HDM or PBS. Mice were sacrificed on day

24.

Assessment of allergen-induced AHR.

For analysis of AHR, mice were anesthetized and paralyzed with decamethonium bromide (25 mg per kg body weight), intubated, and respirated at a rate of 120 breaths per minute with a constant tidal volume (0.2 ml) 72 h after the final allergen challenge.

After a stable baseline was achieved, acetylcholine (50 mg per kg body weight) was injected into the inferior vena cava and dynamic airway pressure (cm H20 × s) was monitored for 5 min. Serum and BAL fluid were collected, processed and analyzed as described previously[195]

Histological scoring:

The histological mucus index and degree of inflammation of airways in PAS-stained lung sections was determined visually. The slides were examined with a 20x objective and a minimum of three cross sectioned airways were counted per animal. Only airways where the complete circumference of the airway could be visualized were utilized in the counts. The degree of PAS-positive staining in each airway was determined by an examiner using a 5 tiered grading system as follows: grade 0, no PAS staining; grade 1,

25% or less of the airway epithelium had PAS staining; grade 2, 26–50% of the airway epithelium had PAS staining; grade 3, 51–75% of the airway epithelium had PAS staining; and grade 4, >75% of the airway epithelium had PAS staining. Degree of inflammation severity was also determined using a 5 point scale as follows: 0, no inflammation; 1, 1–25% inflammation of section; 2, 26–50% inflammation of section; 3 ,

51–75% inflammation of section; 4 , 76–100% inflammation of section. This grading

45 system was used to calculate a mucus index score (PAS) and inflammation (Inflamm.) score for each group.

Statistical analysis.

ANOVA followed by the Tukey-Kramer test was used for analysis of differences among multiple groups. Student's t-test was used for comparisons between two groups. P values of less than 0.05 were considered significant.

Chapter 3: Segmented Filamentous Bacteria Drive Severe Experimental Asthma Abstract

Changes in the composition of the bacterial intestinal microbiota, including shifts in Clostridia species, have been associated with an increased risk of the development of asthma and atopic diseases in humans and several specific bacteria have been shown to be protective in murine models of asthma, largely via induction of regulatory T cells.

However bacterial species that might drive more severe disease remain underexplored.

Here we demonstrate that a specific component of the murine intestinal microbiota, the uncultivable Clostridia, Segmented filamentous bacteria or Candidatus savagella drives more severe asthma in C57BL/6 mice. We show that this gut tropic bacterium drives systemic changes in the immune system that drive induction of IL-17A in the lung, which in concert with allergen driven IL-13, drives this more severe disease. This data closely matches human data in which severe asthma is associated with the production of IL-

17A. Thus, these data demonstrate a specific role for a Clostridia species in the modulation of severe asthma.

3.1 Introduction Asthma is a chronic inflammatory disease of the lung characterized by airway hyperresponsiveness (AHR) to aeroallergens such as house dust mite (HDM), airway inflammation, and excess mucus production. Although the etiology of asthma is largely unknown, there is evidence that a combination of genetic and environmental triggers contribute to development of the disease. There has been a rapid increase in the incidence of asthma and other allergic diseases in developed nations over the last 30 years. However, the introduction of genetic susceptibilities in such a wide and diverse population would require a much longer span of time, and for this reason the rise in

47 asthma prevalence is unlikely to be explained by changes in genetics alone. Thus, environmental and lifestyle changes are likely a major contributing factor in the increase in allergic diseases like asthma.

Specific lifestyle elements unique to developed nations such as caesarian birth, lack of breast feeding and urban versus rural or agricultural habitation are associated with both an increased risk of asthma and changes in the composition of the gut microbiota. Thus, It has been postulated that exposure to pathogenic or commensal bacteria early in life may play a role in driving immune responses that influence the development of atopic diseases [123, 141, 178, 196, 197]. Those who have or go on to develop asthma also often have distinct differences in their gut microbiota which include shifts in the proportion of specific bacterial phyla that make up the microbiota as well as a decrease in overall bacterial diversity, with a larger proportion of the microbiota made up of genera such as Clostridium [96, 98, 118, 127, 196, 198-201].

Several clinical studies have indicated that exposure to Clostridium difficile may contribute to atopy and wheezing and is predictive of the development of allergy and asthma later in life. A recent study in mice has also indicated that some Clostridia species may drive a protective response during the development of atopy [137], Thus,

Clostridia may have a significant effect on immune responses that precede and augment the development of asthma [96, 98, 122, 127, 142].

Segmented filamentous bacteria (SFB), tentatively Candidatus savagella are genetically and morphologically unique members of the Clostridia and represent a component of the mammalian intestinal microbiota. [139, 148, 154-157]. They colonize

48 both mice and humans and have distinct kinetics of colonization with colonization dropping off over time in both humans and mice. The bacterium is not detected at any appreciable level in humans after three years of age [140, 150, 156]. SFB are obligate gut tropic and are known to drive potent intestinal immune responses [138, 144, 154,

155, 166]. Recently, Ivanov and colleagues also demonstrated that SFB colonization could drive a potent Th17 response in the intestine [138]. Several other studies have examined the role of SFB colonization in murine models of autoimmune diseases such as colitis, arthritis and encephalomyelitis and have found this organism can influence these diseases via induction of Th17 cells as well. [174-176]. The potential role of this organism in other extra intestinal diseases such as allergic asthma has been unexplored however.

Many of the key features of asthma including AHR are driven by an aberrant Th2 immune response to innocuous aeroallergens. However, recent clinical studies suggest that severe forms of asthma are associated not only with elevations in Th2 cytokines such as IL-13, but in Th17 cytokines as well [66, 76]. Consistent with these findings, we have recently shown that excessive IL-17A production underlies the development of more severe AHR in genetically susceptible mice [77]. Thus, as SFB has been shown to drive potent Th17 responses, early intestinal colonization with Clostridia species has been associated with the later development of asthma in humans, and the recent surge in asthma incidence is unlikely to be solely explained by genetic changes, we hypothesized that colonization with a component of the microbiota, SFB, may lead to the development of more severe allergic asthma.

Herein we demonstrate that intestinal SFB colonization is associated with exacerbated experimental allergic asthma in mice and that this more severe disease is driven by excess IL-17A in concert with allergen driven IL-13. We further show that SFB colonization can drive systemic changes to DC precursors that support excess IL-17A induction in the lung even in the absence of SFB colonization. Finally we show that IL-

17A induction is maintained even as SFB colonization decreases. These data suggest that transient colonization by SFB drives long term changes to the immune system that drive more severe asthma. Furthermore, the identification of a gut tropic member of the

Clostridia that can modulate the severity of asthma via induction of IL-17A in the lung may help to provide insight into possible ways in which a component of the microbiota might influence the development of severe asthma and other atopic diseases in humans and provide avenues of treatment for this rapidly increasing disease.

3.2 Results Differential colonization with SFB is associated with more severe AHR and airway inflammation.

Ivanov et al have shown that SFB drives potent gut tropic IL-17A induction and others have shown SFB induced IL-17A can contribute to extra intestinal autoimmune disease. Our laboratory has also recently shown a role for IL-17A in driving severe asthma [77, 138, 175, 176]. For this reason we examined the role SFB colonization might play in an extra intestinal allergic asthma model. As it has also recently been shown that the composition of the intestinal microbiota of mice varies considerably from vendor to vendor [202], we examined the allergic phenotype in mice of similar genetic background (C57BL/6) from two major vendors. We utilized mice (C57BL/6) from

Jackson Laboratories which have been reported to be SFB-free and mice from Taconic 50

Farms which have been previously shown to be colonized with SFB [138]. Prior to allergen sensitization we determined the SFB colonization status of these mice (Fig. 1a) and found that the intestinal tracts of mice from Taconic are indeed colonized with SFB, while mice from Jackson are not. As expected, there was no detectable SFB in the lungs of mice from either vendor. Consistent with previous reports [138, 172] we found that naïve SFB-colonized mice from Taconic Labs have a greater frequency of Th17 cells in their Peyer’s patches (Fig 1b) as compared to non-SFB-colonized mice from

Jackson Laboratories. Interestingly, we also found a similar increase in Th17 cytokine producing cells in the lungs of SFB-colonized Taconic mice, as compared to SFB- negative mice from Jackson Laboratories (Fig. 1c). The source of IL-17A was predominantly CD4+ T cells, as we did not find significant numbers of CD4-IL-17A+ cells in the lungs of mice from either vendor.

To determine whether SFB colonization would alter the development of the asthma phenotype, we compared the development of AHR and airway inflammation in

C57BL/6 mice from the two vendors. Despite elevations in IL-17A+ cells in the lungs of naïve Taconic mice, there were no differences in responsiveness to cholinergic agonist stimulation between the PBS-challenged mice from Taconic and Jackson (Fig. 1d).

Although HDM exposure induced statistically significant increases in airway responsiveness above PBS-control mice from both vendors, mice from Taconic exhibited statistically greater AHR than did mice from Jackson (Fig. 1d). The increase in

AHR in the HDM-challenged mice from Taconic Farms was associated with a significantly greater increase in bronchoalveolar lavage (BAL) neutrophils as compared to the Jackson mice (Fig. 1e). In contrast, BAL eosinophil numbers were equivalently

51 elevated in the HDM-challenged mice from each vendor as compared to PBS-control mice (Fig. 1f). Analysis of lung sections of HDM-challenged mice showed that mice from Taconic Farms exhibited a higher number of PAS-positive cells, and a greater degree of cellular inflammation when compared to those obtained from Jackson Labs

(Fig.1g). Although the serum levels of total IgE tended to be higher in HDM-exposed

Jackson mice, there were no statistically significant differences between the two groups of mice (Fig. 1h).

As the allergen phenotype was enhanced in SFB-colonized mice, we investigated whether this increase was associated with alterations in lung cytokine patterns. Lung cells from PBS- and HDM-challenged mice from both suppliers were stimulated ex vivo with HDM and the levels of IL-5, IL-13, IL-10, IFN-y and IL-17A in the supernatants were determined by ELISA (Fig. 1 i-m). Despite the more severe asthma phenotype observed in HDM-exposed Taconic mice, lung Th2 (IL-5, IL-13) cytokine induction, (IL-10) induction and Th1 cytokine induction (IFN-γ) was similar between

Jackson and Taconic mice (Fig. 1 i-l). In contrast, IL-17A was significantly induced following HDM treatment of lung cells harvested from HDM-exposed Taconic mice, but was low to undetectable in Jackson mice (Fig.1m). A similar pattern was observed in the percentage of lung and Peyer’s patches IL-17A+ CD4+ cells which were significantly greater in both PBS-challenged and HDM-challenged mice that were from Taconic

Farms than in mice from Jackson laboratories (Fig. 1n,o.). Taken together these results suggests that a component of the intestinal microbiota in mice from

Taconic Farms may be driving more severe asthma, possibly via induction of lung and gut Th17-derived cytokines.

SFB colonization is transferable, and associated with more severe experimental asthma.

To rule out the possibility that subtle genetic differences between C57BL/6 mice purchased from Jackson or Taconic rather than the presence of a component of the microbiota was driving the more severe AHR observed in mice from Taconic, we cohoused mice from Jackson and Taconic prior to allergen sensitization and challenge.

Following cohousing for two weeks with Taconic mice, mice from Jackson (Co-Jac) became colonized with SFB at levels similar to Taconic mice (Fig.2a). Co-housed mice

(Co-Jac) also exhibited more severe AHR (Fig.2b) and greater BAL neutrophil infiltration (Fig.2c) than non-co-housed Jackson mice following allergen sensitization

(Fig.2c), In contrast, BAL eosinophilia was equivalent between cohoused and non- cohoused mice from Jackson (Fig. 2d). Cohoused Jackson mice had significantly greater numbers of PAS-positive cells in the airways and a greater degree of inflammatory cell infiltration into their lungs (Fig.2e) as compared to non-SFB colonized

Jackson mice. Total IgE is elevated in the serum of mice in all groups following HDM exposure, however there is no significant difference between HDM treated groups

(Fig.2f). Again SFB-colonization was associated with significant elevations in lung IL-

17A levels as both HDM-challenged Taconic mice and cohoused Jackson mice have elevated Th17+ cells in their lungs as compared to non-colonized Jackson mice (Fig.

2.g,h). In lung cells harvested from PBS and HDM-challenged mice, and restimulated with HDM in vitro, Th2 cytokine levels (IL-5, IL-13) and IL-10 were induced similarly in all three groups following allergen re-stimulation (Fig. 2i-k ). In contrast, IL-17A levels

53 were significantly induced following HDM recall in Taconic and cohoused Jackson mice, while they were low to undetectable in Jackson mice, (Fig.2l). These data suggest that a transferable component of the intestinal microbiota, likely SFB, drove a more severe asthma phenotype which was associated with elevated IL-17A production.

SFB colonization drives more severe airway disease.

To specifically determine whether transfer of SFB alone is sufficient to induce more severe AHR, we gavaged mice from Jackson with their own feces or their own feces plus feces from SFB-monocolonized mice provided by the Yakult Central Institute for Microbiological Research (Japan), SFB-gavaged Jackson mice became colonized with the bacteria (Fig.3a). Jackson mice gavaged with SFB had more severe allergen-induced AHR (Fig.3b) and more pronounced BAL neutrophilia (Fig.3c) than did non-gavaged Jackson mice. However BAL eosinophil numbers were equivalent in these groups (Fig.3d). SFB-colonized mice displayed a greater number of mucus containing cells in their airways and inflammatory infiltrate into their lungs as compared to non-SFB-colonized mice (Fig. 3e, f). SFB-gavaged mice also had a significantly higher frequency of IL-17A+CD4+ cells in their lungs and Peyer’s patches both before and after allergen sensitization (Fig.3g,h). IL-17A levels were also higher in lung cells from SFB-colonized than in non-colonized Jackson mice restimulated in vitro, whereas no differences were observed in Th2 cytokine production (Fig3.i-k.). Consistent with the lack of differences in Th2 cytokine production in lung cell cultures, total serum IgE levels were elevated in both SFB- colonized and non-colonized Jackson mice following HDM stimulation (Fig. 3m). Taken

54 together these data suggest that SFB colonization is sufficient to exacerbate allergic asthma.

Blockade of IL-17A in SFB-colonized mice reduces allergen-driven AHR.

In order to examine the role of IL-17A in the exacerbation of allergic asthma in

SFB colonized mice, we treated mice from Taconic Farms with an anti-mouse IL-17A mAb (200 μg ,Clone M210; Amgen)DOSE) or an equivalent amount of an isotype control mAb (GL117) prior to and throughout HDM sensitization (Days -6, 4, 11, and 18) with or rat IgG2a (GL117) . Anti-IL-17A mAb treated HDM-sensitized and challenged

SFB-colonized mice developed less severe AHR than isotype-treated SFB-colonized animals (Fig. 4a). Anti-IL-17A mAb treated mice also had decreased serum IgE levels

(Fig. 6b) and developed less severe neutrophil and eosinophil infiltration into their BAL

(Fig. 4c,d), as compared to isotype-treated animals. Lung inflammation, PAS staining, and IL-5, IL-13 and 10 were significantly induced in both groups following allergen stimulation (Fig. 4 e-h), but were unaffected by anti-IL-17A treatment. This data suggests that IL-17A production in SFB colonized mice is sufficient to drive more severe

AHR and neutrophilia during HDM exposure.

SFB-driven IL-17A synergizes with allergen-induced IL-13 to enhance asthma severity.

We have previously shown that IL-17A can synergize with IL-13 to drive more severe AHR [77]. Thus we hypothesized that the enhanced AHR response observed in

SFB-colonized mice might be due to synergistic responses between Th2 cell-derived and Th17 cell-derived cytokines. To test this hypothesis, we examined IL-13-induced

AHR and airway inflammation in SFB-colonized mice from Jackson. Specifically,

Jackson mice were colonized with SFB monocolonized feces (Day -7) then treated with rIL-13 IT (2.5mg, Days 0, 3, 6). Seventy-two hrs after rIL-13 treatment, colonized mice exhibited significantly greater AHR, BAL neutrophilia, elevations in PAS-positive cells and inflammatory infiltration as compared to IL-13-treated non-colonized mice (Fig. 5a- e). Taken together, we conclude that SFB-colonization drives changes in the immune system that allow for robust gut and lung IL-17A induction, which synergizes with allergen driven IL-13 to induce more severe allergic asthmatic responses.

Adoptive transfer of bone marrow derived DCs (BMDCs) from SFB-colonized mice drives more severe AHR

In order to examine how SFB might drive systemic induction of IL-17A in colonized mice, we utilized RNA seq to examine gene expression in the terminal ileum and found that Saa1 was upregulated in SFB-colonized mice as previously reported[138, 172]. Consistent with the association between SFB and Saa1, we observed that Saa1 is also present at higher levels in the serum of SFB-colonized mice as compared to non-SFB-colonized mice (Fig. 6a). As Saa1 has previously been shown to be elevated in the serum and BAL of asthmatics and is known to drive Th17 differentiation and maturation via the induction of IL-1β, IL-6 and IL-23 from DCs[203,

204], we compared cytokine production (IL-23, IL-1β, IL-6) from LPS and SAA1-pulsed

BMDCs from naïve C57BL/6 mice from Jackson Laboratories and Taconic Farms [203,

204]. We found that BMDCs from SFB-colonized mice from Taconic produce significantly more IL-23 than Jackson mice yet similar levels of IL-6 and IL-1β following

LPS and SAA stimulation (Fig. 6b,c,d). These studies suggest that SFB colonization may confer enhanced responsiveness to Saa1 and TLR4 signaling.

To determine whether in vivo colonization with SFB was sufficient to condition BMDCs to drive Th17-dependent immune responses, we adoptively transferred LPS-pulsed BMDCs from SFB-colonized Taconic mice or SFB-free Jackson mice into recipient SFB-free Jackson mice prior to a single HDM challenge and found that the mice receiving BMDCs from SFB-colonized mice had much more severe AHR, lung neutrophil infiltration and airway inflammation (Fig. 7a,bc,d). In addition, these mice had significant elevations in the numbers of Th17 cells and IL-17A production in their lungs (Fig. 7e). Mice receiving BMDCs from either group also had low-level induction of IL-5, IL-13 and IL-10, however, there was no significant difference between groups (Fig. 7f-i). These data suggest that intestinal SFB colonization alters bone marrow precursors such that they have the propensity to drive Th17 expansion and IL-

17A production even in the absence of re-stimulation with SFB.

Th17 induction is maintained over time in SFB colonized mice despite decrease in

SFB colonization levels

In mice SFB has distinct kinetics of colonization, with levels peaking shortly after weaning then dropping over time (Fig. 8a)[150, 156]. This is true in humans as well as

SFB colonization drops off after 3 years of age [140, 150, 156]. In our studies the Th17 response in the lung is maintained, and increases, even while SFB colonization decreases in the intestine (Fig. 8 a-c). This maintenance of the Th17 response over time is likely driven by the aforementioned changes in bone marrow precursors and

57 suggests that transient intestinal SFB colonization can drive lasting changes to the T cell milieu of the lung.

3.3 Discussion:

It is becoming increasingly apparent that the composition of the intestinal microbiota and the risk of development of asthma and allergies are interrelated [98, 99,

123, 132, 199, 205]. The intestinal microbiota of those who have or are developing atopy and asthma often varies considerably from that of healthy patients, with an increased proportion of Clostridia and Bacteroides and a decrease in Bifidobacteria and

Lactobacilli [96, 98, 127, 141, 198]. The intestinal bacterial microbiota of young children who go on to develop allergies and asthma also varies from those that do not develop atopic disease. In the KOALA birth cohort an increased occurrence of Clostridium difficile increased the risk for the later development of atopy and wheezing [98].

Recently, Ivanov et al. demonstrated that Clostridia-related, segmented filamentous bacteria (SFB) , which constitute a component of the gut microbiota in children less than three years of age, could induce IL-17A production in the intestine

[34, 138, 140, 145]. In human asthma, level of IL-17A tracks with disease severity, and it is highest in severe asthmatics. Our laboratory has also previously shown that excessive IL-17A production in the lungs underlies the development of severe asthma in genetically susceptible mice, mainly that A/J mice develop more severe allergic asthma than C3HeJ mice due to genetic differences in complement component signaling [76,

77]. However the recent rise in asthma incidence is unlikely to be explained by genetic

58 changes alone and for this reason, we examined the role of a specific component of the microbiota, SFB, in modulating experimental murine asthma.

We demonstrate that colonization by segmented filamentous bacteria can drive more severe disease in a murine model of allergic asthma, and we show that this more severe disease is dependent on the production of IL-17A via the in vivo blockade of IL-

17A during sensitization in our model. We show that intestinal colonization with SFB drives a higher frequency of CD4+IL-17A+ cells and IL-17A induction not only in the intestines, as previously demonstrated (Ivanov), but also in the lungs. Our findings suggest that SFB can drive excess IL-17A outside of the gut, which is consistent with literature suggesting a role for SFB in the development of extra-intestinal diseases such as inflammatory arthritis and experimental autoimmune encephalomyelitis (EAE) [174,

175].

We also show that SFB driven IL-17A synergizes with IL-13 to drive more severe disease. We have previously observed that these two cytokines synergize in a model of genetically differing allergic asthma susceptibility. However this is the first example of a component of the intestinal microbiota driving an immune response that synergizes with an allergen driven Th2 response to drive severe allergic asthma [77].

Furthermore, we show that SFB colonization drives changes in BMDCs which can in turn drive Th17 expansion and IL-17A induction when transferred to mice lacking

SFB. While the mechanism by which SFB drives excess IL-17A is not entirely clear, and is likely multifactoral, our data and the literature suggest that SFB promotes the production of serum amyloid protein (SAA), which can drive production of IL-1b, IL-6,

59 and IL-23 from dendritic cells [138, 204]. Our analysis reveals not only marked differences in sera SAA between non-SFB-gavaged and SFB-gavaged Jackson

C57BL/6 mice but significantly elevated IL-23 production in LPS and SAA pulsed

BMDCs from SFB colonized mice, yet similar levels of IL-1b and IL-6 (Fig 6). Of note,

BMDCs from SFB colonized mice also appear to be more responsive to both LPS and

SAA stimulation than BMDCs from non-colonized mice, suggesting that SFB colonization drives long term changes to these DC subsets (Fig 6). Interestingly, in this

BMDC protocol we did not have robust lung mucus production as compared to our previous studies (Fig.7d), this is likely a product of the short, single, HDM exposure protocol driving less robust Th2 cytokine induction (Fig.7 f-i). IL-13 in particular is implicated in driving mucus production in both humans and mice and was present at much lower levels than in our other studies [206]. We also observe a striking decrease in both IgE production and eosinophil infiltration with IL-17A blockage in SFB colonized mice (Fig.4 b) which is puzzling given that we did not see changes in IgE or eosinophilia with IL-17A induction in SFB colonized mice in other experiments or in previous experiments utilizing A/J mice [77]. However Grund et. al. have shown in a model of fish venom driven inflammation (Thalassophryne nattereri) that blockage of IL-

17A alone with a monocolonal antibody also drives a striking decrease in IgE induction[207]. Murdock et. al. have also shown that IL-17A drives extravasation of eosinophils from the blood into the lung during repeated exposure to Aspergillus fumigatus [208]. Thus, while SFB does not specifically drive IgE induction or eosinophillia via Th17 induction, systemic blockage of IL-17A in SFB colonized C57BL/6

60 mice may influence production of IgE and migration of eosinophils into the lung via yet to be determined mechanisms.

It is also important to note that while mice that lack SFB colonization have fewer

IL-17A producing CD4+ cells in their lungs and peyers patches, and little to no IL-17A induction in their lungs following allergen restimulation, they still have a significant population of these cells. This suggests that perhaps there is a threshold of IL-17A production that drives more severe disease or that the Th17 cells present in SFB colonized mice may be producing more of this cytokine or may be more inflammatory.

Indeed, it is becoming apparent that there is more than one “subset” of Th17 cells that differ not only in their level of IL-17A induction but also in production of other cytokines.

Classical Th17 cells are driven by TGF-β and IL-6 and produce lower levels of IL-17A,

IL-10 and higher levels of IL-21, IL-21 can drive T regulatory cell induction in addition to reinforcing the Th17 phenotype. Alternatively activated Th17 cells are driven by TGF-β

IL-6 and IL-23 and produce high levels of IL-17A, IL-22 and GMCSF and are the population associated with autoimmune disease in murine models [43]. In our model we find that IL-6 production does not significantly differ between BMDCs from Jackson and

Taconic, yet IL-23 induction is significantly elevated in the SFB colonized mice, this may suggest that the IL-17A producing CD4+ cells present in the Jackson mice are more akin to classically activated, non-pathogenic Th17 cells, while the population present in

Taconic mice and SFB colonized mice may represent more pathogenic alternatively activated Th17 cells. This possibility may be examined in the future with more extensive examination of the cytokine producing characteristics of CD4+ cell populations in this model.

Recent work by Guan et al. has shown that mice immunized with a vaccine against the IL-12p40 subunit had an improved prognosis in their lung inflammation model[209]. This data, combined with our observations in BMDCs would suggest that increased IL-23 production by dendritic cells in SFB colonized mice may underlie the increased IL-17A in our model. Overall these data indicate that SFB colonization drives long term changes to the immune system that can persist even in the absence of SFB colonization. This has important implications as SFB has distinct kinetics of colonization in both humans and mice.

In mice, SFB expand rapidly in the gut shortly after birth and colonize the length of the intestine. SFB then slowly retracts over time to become established only in a small part of the cecum and terminal ileum [143, 150, 156, 160]. In humans the bacteria is not detected after 3 years of age[140]. Accordingly, we observed SFB levels decrease over the length of our cohousing and allergen sensitization protocol but interestingly, levels of IL-17A remained elevated in the lung, even increasing over time.

This data suggests that a relatively transient component of the intestinal microbiota can drive lasting effects on the immune system, and may suggest that SFB leaves an epigenetic imprint that perpetuates an aberrant Th17 response. There is support for this idea as, maternal colonization with the bacteria Acinetobacter lwoffii has recently been shown to decrease the severity of airway disease in pups via epigenetic changes to

CD4+ T cell subsets [131, 132]. Thus it may be that short lived changes in the microbiota of individuals can drive lasting effects, both positive and negative, on the host, and perhaps their offspring’s, immune responses. In the future it will also be important to examine the broader influence of SFB colonization on the complete

62 microbiota. SFB has been shown to effectively outcompete some enteropathic bacteria and may have influences on other species that can in turn influence atopic disease, however of note we do not find a difference in FOXP3 expressing CD4+ T cells between

SFB colonized mice and SFB free mice which many models have shown to be important in modulation of microbiota drive allergic disease [125, 135, 136, 138, 210-

212].

Overall our data demonstrates that asthma severity can be modulated by the presence of gut SFB and this is driven by excess bacteria driven IL-17A interacting with allergen driven IL-13. The mechanism driving induction of IL-17A in SFB colonized mice is not entirely understood, but it is possible that soluble factors such as SAA may drive changes in dendritic cell populations that then support lung IL-17A production while concurrently SFB colonization drives changes that makes DCs more sensitive to these mediators. Further studies are needed to understand the mechanisms underlying this.

Ultimately however, we have demonstrated that a component of the gut microbiota can drive a systemic immune response that alters the severity of allergic asthma. This highlights the importance of further study of the role of the microbiota in the development of atopic diseases as well as the mechanisms by which intestinal microbes interact with our entire mucosal immune system.

3.4 Figures

Figure 1. SFB colonization in intestine of mice drives increased bronchial hyperresponsiveness, airway inflammation and lung Th17 induction.

SFB colonization status of 4 week old C57BL/6 mice from with Jackson Laboratories or

Taconic Farms was determined via real-time PCR of SFB 16S rRNA gene in terminal ileum (a). Lung or Peyer’s patch cells from 4 week old C57BL/6 mice from Jackson

Laboratories or Taconic Farms (b,c), were stained with specific antibodies to CD4 and

IL-17A for quantification of CD4+, IL-17A+ cells. Values indicate means +/- SEM (n=8 mice/group) of frequency of CD4+ population. 4 week old mice from each vendor were then sensitized and challenged with PBS or HDM as described in materials and methods. Airway function (d) and cellularity of BAL fluid (e,f) in mice treated with PBS or HDM was determined. Extent of staining of mucosa in HDM treated mice with periodic acid–Schiff (PAS) (g, left) and degree of inflammation (g,right) was determined from scoring of histological sections as described. Level of serum IgE was determined via ELISA (h). Lung cells from 8 week old C57BL/6 mice from Jackson Laboratories or

Taconic Farms after HDM or PBS treatment were cultured in media containing 30 µg/ml

HDM, and tissue culture supernatants were harvested after 72 h to determine production of IL-5 (i), IL-13 (j), IL-10 (k), IFN-7 (l) and IL-17A(m). Lungs cells from each group were stained with specific antibodies to CD4 and IL-17A for quantification of

CD4+, IL-17A+ cells ( n,o). Data represent means +/- SEM (n= 8 mice/group).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with PBS-sensitized/

64 challenged animals; † or ††, P < 0.05 or P < 0.001, respectively, compared with HDM treated animals, ⱡ or ⱡ ⱡ P < 0.05 or P < 0.001 compared to Jackson mice.

Figure 2. SFB colonization is transferable and correlates with more severe airway disease and Th17 induction. 3 week old C57BL/6 mice from Jackson Laboratories or

Taconic Farms were co-housed in a single cage for 2 weeks prior to, and throughout the allergen sensitization and challenge period as described in methods. SFB colonization status of these mice at the end of cohousing was determined via real-time PCR of SFB

16S rRNA gene in terminal ileum (a). Mice were sensitized and challenged with PBS or

HDM as described in materials and methods. Airway function (b) and cellularity of BAL fluid (c,d) in mice treated with PBS or HDM was determined. Extent of staining of mucosa in HDM treated mice with periodic acid–Schiff (PAS) (e, left) and degree of inflammation (e,right) was determined from scoring of histological sections as described. Level of serum IgE was determined via ELISA (f). Lung cells from mice were stained with specific antibodies to CD4 and IL-17A for quantification of CD4+, IL-17A+ cells ( g,h). Lung cells from each group were cultured in media containing 30 µg/ml

HDM, and tissue culture supernatants were harvested after 72 h to determine production of IL-5 (i), IL-13 (j), and IL-10 (k) and IL-17A(l). Data represent means +/-

SEM (n= 8 mice/group).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with PBS-sensitized/ challenged animals; † or ††, P < 0.05 or P < 0.001, respectively, compared with HDM treated animals, ⱡ or ⱡ ⱡ P < 0.05 or P < 0.001 compared to Jackson mice.

Figure 3. SFB colonization specifically drives more severe airway disease and

Th17 induction. 3 week old C57BL/6 mice from Jackson Laboratories were gavaged with their own feces (Jac) or their own feces plus feces from SFB monocolonized mice

(Jac+SFB) prior to sensitization at 4 weeks as described in methods. SFB colonization status of these mice prior to sensitization was determined via real-time PCR of SFB 16S rRNA gene in terminal ileum (a). Airway function (b) and cellularity of BAL fluid (c,d) in mice treated with PBS or HDM was determined. Extent of staining of mucosa in HDM treated mice with periodic acid–Schiff (PAS) (e, left) and degree of inflammation (e,right) was determined from scoring of histological sections (f) as described. Lung histology imaged at 40X (f), scale bar indicates 100 µm. Lung cells and Peyer’s patches were stained with specific antibodies to CD4 and IL-17A for quantification of CD4+, IL-17A+ cells (g,h). Lung cells from each group were cultured in media containing 30 µg/ml

HDM, and tissue culture supernatants were harvested after 72 h to determine production of IL-5 (i),and IL-10 (j), IL-13 (k), and IL-17A(l). Level of serum IgE was determined via ELISA (m). Data represent means +/- SEM (n= 8 mice/group).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with PBS-sensitized/ challenged animals; † or ††, P < 0.05 or P < 0.001, respectively, compared with HDM treated animals, ⱡ or ⱡ ⱡ P < 0.05 or P < 0.001 compared to Jackson mice.

Figure 4. Blockade of IL-17A in SFB colonized mice decreases severity of airway disease and does not influence Th2 cytokines. 3 week old C57BL/6 mice from

Taconic farms were treated intraperitoneally on days -6, +4, +11,+18 with 200 μg rat mAb to mouse IL-17A (M210; Amgen) or IgG2a (GL117). Sensitization and challenge was performed as in methods starting at 4 weeks of age. Airway function (a), Level of serum IgE ELISA (b) and cellularity of BAL fluid (c,d) in mice treated with PBS or HDM was determined. Lung cells from each group were cultured in media containing 30

µg/ml HDM, and tissue culture supernatants were harvested after 72 h to determine production of IL-5 (e), IL-10 (f), and IL-13 (g) and IL-17A(h). Data represent means +/-

SEM (n = 8 mice/group). ).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with PBS-sensitized/ challenged animals; † or ††, P < 0.05 or P < 0.001, respectively, compared with HDM treated animals.

Figure 5. Recombinant IL-13 drives more severe airway AHR in SFB colonized mice. 3 week old Jackson mice were colonized with SFB (day -7) (a) as in methods then treated IT with rIL-13 on days 0,3 and 6 with airway measurements 72 hours later as in methods (b). Extent of staining of mucosa in rIL-13 treated mice with periodic acid–Schiff (PAS) (c, left) and degree of inflammation (c,right) was determined from scoring of histological sections as described. Cellularity of BAL fluid (d,e) in mice was determined as in methods. Data represent means +/- SEM (n = 6 mice/group). ).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with PBS-sensitized/ challenged animals; † or ††, P < 0.05 or P < 0.001, respectively, compared with SFB colonized animals.

Figure 6. BMDCs from SFB colonized mice produce more IL-23.

Serum was collected from naïve 4 week old C57BL/6 mice from Jackson Laboratories or Taconic Farms and level of SAA was determined (a). BMDCs from mice from either vendor were pulsed with LPS or SAA and level of IL-23 (b), IL-1b,(c), and IL-6 (d) in supernatant after 24 hours was determined (b). Values indicate means +/- SEM (n=6 mice/group) of frequency of CD4+ population.* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with Jac or Jac BMDCs.

Figure 7. BMDCs from SFB colonized mice drive more severe AHR and Th17 induction. LPS pulsed BMDCs from mice from Jackson Laboratories or Taconic Farms were transferred i.t. to Jackson mice 8 days prior to a single it HDM challenge and airway function (a) and cellularity of BAL fluid (b,c) in mice was determined as in methods. Extent of staining of mucosa in HDM treated mice with periodic acid–Schiff

(PAS) (d, left) and degree of inflammation (d,right) was determined from scoring of histological sections as described. Lung cells were stained with specific antibodies to

CD4 and IL-17A for quantification of CD4+, IL-17A+ cells (e). Lung cells from each group were cultured in media containing 30 µg/ml HDM, and tissue culture supernatants were harvested after 72 h to determine production of IL-5 (f), and IL-10 (g), IL-13 (h), and IL-17A(i). Values indicate means +/- SEM (n=6 mice/group) of frequency of CD4+ population.* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with Jac or

Jac BMDCs.

Figure 8. SFB colonization decreases over time but Th17 induction is maintained

SFB expression of C57BL/6 mice was determined at several timepoints (a) Th17 induction in the lung was determined at 4 and 10 weeks (b,c). Data represent means +/-

SEM (n = 5 mice/group). ).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with Jackson mice.

3.5 Methods: Mice.

Male C57BL/6 (Jackson Laboratories, Bar Harbor, ME and Taconic Farms,

Germantown, NY) were housed in a specific pathogen–free facility in micro isolator cages. Mice were provided autoclaved food (Lab diet 5010) and water ad libitum. All procedures were approved by the Institutional Animal Care and Use Committee of

Cincinnati Children's Hospital Medical Center.

Sensitization protocols and SFB colonization.

Mice were sensitized to HDM starting at 4 weeks of age by intraperitoneal (i.p.) injection with HDM (30ug/100 uL, Greer Laboratories, Lenoir, NC) or PBS (100uL) on days 1 and 7 then intratracheally (100ug/30 uL) (I.T) on days 14 and 21 with HDM or

PBS. Mice were sacrificed on day 24. Where indicated, mice were treated intraperitoneally on days -6, 4, 11, and 18 with 200 μg rat anti-mouse IL-17A mAb

(Clone M210; Amgen) or rat IgG2a (GL117) isotype control. Where indicated mice were also gavaged with feces from SFB monocolonized mice (~0.01 mg in 100uL PBS,) a gift by the Yakult Central Institute for Microbiological Research (Japan), on day -7 prior to sensitization as described above. For DC transfer experiments mice were sensitized with HDM once intratracheally (100ug/30 uL) 8 days after DC transfer then sacrificed

72 hours later. For recombinant IL-13 experiments 3 week old Jackson mice were colonized with SFB (day -7) as above then treated IT with rIL-13 (2.5mg) on days 0,3 and 6 with airway measurements made 72 hours later as above.

Assessment of allergen-induced AHR.

Bone marrow derived dendritic cell (BMDC) culture

4 week old male C57BL/6 mice from Jackson Laboratories and Taconic Farms were sacrificed and bone marrow cells cultured in RPMI plus 10% (vol/vol) FBS supplemented on days 0 and 3 with granulocyte-macrophage colony-stimulating factor

(10 ng/ml; Peprotech) at 300,000 cells/ml. On day 6, cells were washed, and stimulated with PBS for in vivo treatment or were treated with LPS (100ng/mL), or SAA( 5 ug/mL, R and D, Minneapolis,MN) in 96 well plates at a density of 2.5 × 105 cells per well for in vitro cytokine analysis. On day 7, LPS (1 µg/ml) was added and BMDCs cultured overnight or supernatants from 96 well plates were collected for cytokine analysis. The following morning LPS pulsed cells were washed with PBS and used to sensitize mice as above.

Transfer of SFB via Co-housing.

To transfer SFB from mice from Taconic Farms to mice from Jackson Laboratories, a pair of 4 week old mice from each vendor were co-housed in a single cage (n=10 per

82 vendor) for 2 weeks prior to, and throughout, the HDM sensitization and challenge period.

Peyer’s patch and lung cell isolation.

In order to obtain a single cell suspension for flow cytometry or lung cell restimulations

Peyer’s patches or whole lungs were excised, minced and placed for 45 min at 37°C in

2 ml or 6 ml, respectively of serum-free RPMI medium containing Liberase CI (0.5 mg/ml; Roche, Madison, WI) and DNase I (0.5 mg/ml, Sigma, St. Louis, MO). Lung cells and cells isolated from Peyer’s patches were cultured as described[213].

In vitro culture and flow cytometry.

Lung cells (1×106) were stimulated for ~16 h with phorbol 12-myristate 13-acetate (100 ng/ml) and ionomycin (1 μg/ml), then brefeldin A and monensin (eBioscience, San

Diego, CA) were added for 4 h. Cells were fixed and permeabilized and stained at 4 °C after incubation for 30 min with Fc Block (2.4G2; derived from cell line HB-197;

American Type Culture Collection, Manassas, VA). Cells were stained with PE-Cy7 conjugated–anti-CD4 (RM4-5; 25-0042; eBioscience) and Alexa Fluor 647 conjugated anti-IL-17A (eBio17b7; 51-7177; ebioscience). Flow cytometry was performed on an

LSRII (BD Biosciences) and data analyzed via FloJo.

Measurement of cytokine concentrations.

Cytokine concentrations were measured by ELISA (Pharmingen, San Diego, CA (IL-4 and IL-5) or R&D Systems, Minneapolis, MN, (IL-10, IL-13, IL-17A, IL-23).

Measurement of serum IgE levels. Blood was collected from the posterior vena cava at sacrifice and total serum IgE levels were measured by ELISA using matched antibody pairs (BD Pharmingen, Franklin Lakes, NJ).

Quantitative real-time RT-PCR.

Gene expression in both lungs and intestine was measured by real-time PCR. Data were normalized to expression of the mouse ribosomal S14 gene or a conserved

Eubacteria 16s RNA gene (EUB) for SFB and bacterial colonization experiments. EUB primer sequences are as follows, EUB Forward: 5’-ACTCCTACGGGAGGCAGCAGT-3’,

EUB Reverse: 5’-ATTACCGCGGCTGCTGGC-3’, SFB; SFB Forward: 5’-

GACGCTGAGGCATGAGAGCAT-3’ , SFB Reverse: 5’-

GACGGCACGGATTGTTATTCA-3’ .

Assessment of SFB colonization of mice:

SFB colonization status was determined for mice prior to experiments and at conclusion of experiments via RT-PCR of terminal ileum or feces as above or via gram stain of fecal smears or slides of homogenized terminal ileum.

Histological scoring:

84 where the complete circumference of the airway could be visualized were utilized in the counts. The degree of PAS-positive staining in each airway was determined by an examiner using a 5 tiered grading system as follows: grade 0, no PAS staining; grade 1,

51–75% inflammation of section; 4 , 76–100% inflammation of section. This grading system was used to calculate a mucus index score (PAS) and inflammation (Inflamm.) score for each group.

Statistical analysis.

Chapter 4. The effects of diet on allergic inflammation.

4.1 Introduction

Diet influences the composition of the intestinal microbiota and changes in diet have been associated with the development of asthma in western nations [177, 214].

Non digestible carbohydrates and short chain fatty acids, generally derived from natural plant sources, are needed as prebiotics for maintenance of many species of bacteria.

Furthermore, the enterotype of those that consume a high percentage of fats and meat is rich in Bacteroides , while the enterotype of those that have higher intakes of carbohydrates has a much greater abundance of Prevotella[215, 216].Thus , the inclusion of plant based compounds in diet can have a significant effect on the composition of the microbiota.

Our research suggests that colonization with SFB, Candidatus savagella, drives more severe allergic asthma in a murine model via IL-17A, and possibly IL-23 dependent, mechanisms. SFB colonization is also strongly influenced by diet, particularly retinoic acid and plant components such as the skin and kernel fragments of the common bean Phaseolus vulgaris[163, 217]. Consequently, SFB colonization, and allergic asthma driven by it, might be influenced by changes in diet. Retioic acid has a number of physiological effects outside of its influence on the microbiota however, and is needed for the generation of Th17 responses [171, 218]. Thus, vitamin A would be a poor component to remove in a model dependent on robust IL-17A induction. A number of murine diets exist however that lack many indigestible carbohydrates and other components that are present in whole grains and beans.

Commercial mouse diets consist of purified diets in which each component is known and nutrients are derived from simple, distinct refined ingredients such as casein, sucrose, cornstarch, and cellulose and non-purified diets which are composed of a complex and variable mix of grains and added vitamins. Non-purified diets contain carbohydrates and phytochemicals that are not present in purified diets[219]. The literature suggests that SFB colonization may not be supported by a purified diet [159,

163, 164]. Thus we hypothesized that mice on a purified diet would have decreased

SFB colonization, IL-17A induction and possibly less severe allergic asthma.

4.2 Results In order to explore the role of diet in the modulation of SFB colonization,

IL-17A induction and severity of allergic asthma, three week old SFB positive, male

C57BL/6 mice (Taconic Farms, Germantown, NY) were provided a diet of autoclaved food (Lab diet 5010) or a purified diet of autoclaved food (Research Diets D12450Bi) for

3.5 weeks prior to (Days -26,1) and throughout (Days 1-24) HDM sensitization. We then measured relative bacterial colonization between mice on the two diets by using QPCR and primers for specific or conserved regions in the 16srRNA of SFB, two major phyla and one genus. Mice on the purified diet had a highly significant drop in SFB colonization in their terminal ileum after 3.5 weeks; however there was also a several log drop in Lactobacillus species, Firmicutes, which includes SFB, and Bacteroides species (Fig. 1a). This suggests that the diet, while it does profoundly influence SFB colonization, also disrupts the entire intestinal microbiota of the mice. Notably, there was a significant decrease, but not ablation, of IL-17A induction in the terminal ileum of mice on the purified diet, but no significant change in IL-23 induction (Fig. 1b,c) . To determine whether a decrease in SFB colonization and IL-17A in the intestine and 87 disruption of the microbiota via diet would alter the development of the asthma phenotype, we compared the development of AHR and airway inflammation in the mice on the two diets. There was no significant difference in AHR between mice on the two diets, however, there was a significant decrease in neutrophil infiltration into the lungs of mice on the purified diet (Fig.2 a,b).

As we have previously observed a correlation between increased IL-17A induction in the intestine an increased lung IL-17A induction, and IL-17A induction has been associated with neutrophil infiltration[76], we explored whether a diet that decreased IL-17A induction in the intestine might influence lung cytokine levels. Lung cells from PBS and HDM-challenged mice on both diets were stimulated ex vivo with

HDM and the levels of IL-5, IL-10, IL-13, and IL-17A in the supernatants were determined by ELISA (Fig. 3 a-d). There was a significant decrease in IL-5 and IL-10 in the lungs of mice on the purified diet; however the Th2 cytokine IL-13, and IL-17A, while slightly lower in mice on the purified diet, were not significantly different between the two groups. Overall, it appears that a purified diet does influence SFB colonization in the intestine; however, its effects are not limited to SFB as the diet also broadly decreases bacterial colonization in the intestine. AHR was unaffected between the two groups; however lung neutrophillia was decreased in the mice on the purified diet. Additionally, while induction of IL-17A message in the intestine was decreased in mice on the purified diet, induction of IL-17A protein in the lung did not differ between the two groups, suggesting that decreasing an already established Th17 response in the intestine may not influence lung IL-17A levels. Interestingly, while there was no change

88 in IL-13 induction, there was a decrease in both IL-5 and IL-10 in the lungs of mice on the purified diet.

4.3 Discussion A number of studies have suggested a correlation between the composition of diet, particularly the inclusion of plant based versus refined ingredients, the composition of the microbiota and the development of asthma [113, 177, 215, 220]. SFB colonization in particular is influenced by the components in a natural diet versus a purified diet[163].

For this reason we utilized a purified murine diet as a tool to determine if diet might be used to ablate SFB colonization in the intestine.

As we have previously shown that IL-17A driven by SFB is responsible for increased severity of allergic asthma we also aimed to explore if ablation, or decreasing

SFB colonization, might influence AHR and cellular infiltration in mice. Use of a purified diet does decrease SFB colonization compared to a conventional diet; however it also broadly decreases bacterial colonization across two phyla and significantly decreases

Lactobacillus colonization. This was not wholly unexpected as many bacterial species, particularly Lactobacillus and Bifidobacteria species, rely on plant based prebiotics such as carbohydrates like galactooligo-saccharides to establish colonization[221]. However, at the time, to our knowledge, there were no primary publications detailing the effects of a purified diet on the composition of the complete microbiota of mice. However, recently one publication has confirmed our observation that a purified diet decreases

Lactobacillus colonization[222].

While the purified diet does decrease SFB colonization and expression of IL-17A in the intestine there is no significant change in AHR is these mice compared to mice on

89 the normal diet. This might be explained by the similar level of IL-17A induction in the lungs of these mice in response to HDM in mice on both diets. In previous experiments in this model we’ve seen increased IL-17A induction in both the lungs and intestine of

SFB colonized mice, suggesting that the two were coupled, however it may be that once extra intestinal Th17 induction is established, it is no longer influenced by gut IL-17A induction. We do have some support for this idea as lung IL-17A induction is maintained even as SFB levels start to drop off over time (Chapter 2). Intestinal IL-23 is also unaffected by the purified diet and is an important cytokine in the systemic differentiation and expansion of Th17 cells [223]. In the context of this experiment however, this result is particularly puzzling as lung neutrophillia is decreased in mice on the purified diet, and neutrophil infiltration likely is influenced by IL-17A induction in the lung. It may be that lung IL-17A induction was transiently decreased at some point in time during the HDM sensitization that coincided with lung neutrophil influx, but in the absence of a time course of cytokine production in the lung, this cannot be assumed.

However another explanation for the decrease in neutrophils may lie in the composition of the purified diet and its influence on the immune system, possibly independent of changes to the microbiota. Phaseolus vulgaris is known to drive potent induction of IL-8 from cultured intestinal cell lines (Caco-2 cells) and secreted IL-8 induces extravasation of activated neutrophils into tissue [224]. Lectins from the plant are also known to trigger a respiratory burst in human neutrophils[225]. Purified diets have considerably lower levels of these lectins when compared to conventional diets and while it is not entirely clear how intestinal exposure to plant lectins might influence lung neutrophillia there may be a link between the two. Further study could explore links

90 between lung granulocyte infiltration and activity in asthma models and composition of diet to determine if this may be a further variable important in the modulation of severity of asthma.

IL-13 is the major cytokine driving AHR in murine models of allergic asthma, and we suspect that IL-17A acts to modify severity of asthma and AHR in these models [56,

77]. There is no significant change in either of these cytokines in the lungs of mice on either diet, which likely explains why there is no difference in AHR in these mice.

Additionally, while lung inflammation is a key feature of asthma, inflammation and AHR do not always correlate with each other, which may explain how while lung neutrophillia is slightly decreased on a purified diet, there is no effect on AHR in this model[226,

227]. IL-10 and IL-5 are also decreased in the lungs of mice on a purified diet. The decrease in IL-10 may be due to the decrease in Lactobacillus colonization of the gut. A number of studies have shown that Lactobacillus species can drive systemic induction of IL-10 and that IL-10 produced by these bacteria can influence murine models of asthma[124, 133-136]. While IL-10 induction is decreased it is still produced at robust levels however, and may have prevented an increase in AHR in mice on the purified diet which may have occurred with complete ablation of Lactobacillus species. The decrease in IL-5 is a bit puzzling but may be a product of the purified diet and its influence on the microbiota and secondary metabolites ( the metabalome) produced by it. Production of a number of cytokines, including IL-10 and IL-5 , are influenced by the production of short chain fatty acids, breakdown products of complex carbohydrates, by the intestinal microbiota. These breakdown products would likely be present at lower levels in mice on the purified diet [228-230]. This also highlights the significant effect

91 that metabolism can have on the immune system. Ultimately however, this research shows that diet can profoundly influence the composition of the intestinal microbiota and may in turn influence both the cytokine milieu and level of inflammation present in the lung. It further suggests, but by no means proves, that once IL-17A induction outside of the intestine is established is it maintained even if levels decrease at the initial site of induction. This further supports our hypothesis that transient colonization by an IL-17A inducing component of the microbiota might drive lasting IL-17A induction.

Unfortunately, use of this diet does not provide a tool to specifically ablate SFB as we had hoped. This might be accomplished via other methods.

4.4 Figures

Figure 1. A purified diet ablates multiple components of the intestinal microbiota including SFB. Colonization of the terminal ileum by SFB, Lactobacillus, Firmicutes and Bacteroides of

6.5 week old C57BL/6 mice from Taconic farms after 3.5 weeks on a purified diet or a standard diet was determined by QPCR with 16S rRNA primers specific to each phyla genera or species (a). Expression of IL-17A, or IL-23 message was determined at this time point by QPCR as well (b,c). Data represent means +/- SEM (n= 6 mice/group).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with mice on the standard diet.

Figure 2. Mice on a purified diet have no difference in AHR compared to those on a standard diet but have decreased neutrophil infiltration into their lungs

6.5 week old mice on each diet were sensitized and challenged with PBS or HDM as described in materials and methods. Airway function (a) and cellularity of BAL fluid (b) in mice treated with PBS or HDM was determined (HDM shown). Data represent means

+/- SEM (n= 6 mice/group).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with mice on the standard diet.

Figure 3. Mice on a purified diet have decreased IL-5 and IL-10expression in their lungs compared to those on a standard diet. Lung cells from C57BL/6 mice on either diet were cultured in media containing 30 µg/ml HDM, and tissue culture supernatants were harvested after 72 h to determine production of IL-5 (a), IL-10 (b), and IL-13 (c) and IL-17A(d). Data represent means +/- SEM (n= 6 mice/group).* or ** indicates, P <

0.05 or P < 0.001, respectively, compared with mice on the standard diet.

4.5 Materials and Methods Mice and diets.

Three week old male C57BL/6 (Taconic Farms, Germantown, NY) were housed in a specific pathogen–free facility in micro isolator cages. Mice were provided a standard diet of autoclaved food (Lab diet 5010) or a purified diet of autoclaved food (Research

Diets D12450Bi) and water ad libitum for 3.5 weeks prior to (Days -26,1) and throughout

(Days 1-28) HDM sensitization. All procedures were approved by the Institutional

Animal Care and Use Committee of Cincinnati Children's Hospital Medical Center.

Sensitization protocols and SFB colonization.

Mice on either diet were sensitized to HDM by intraperitoneal (i.p.) injection with

HDM (30ug/100 uL, Greer Laboratories, Lenoir, NC) or PBS (100uL) on days 1 and 7 then intratracheally (100ug/30 uL) (I.T) on days 14 and 21 with HDM or PBS. Mice were sacrificed on day 24.

Assessment of allergen-induced AHR.

After a stable baseline was achieved, acetylcholine (50 mg per kg body weight) was injected into the inferior vena cava and dynamic airway pressure (cm H20 × s) was monitored for 5 min.

Lung cell isolation and restimulation.

In order to obtain a single cell suspension for lung cell restimulations whole lungs were excised, minced and placed for 45 min at 37°C in 6 ml of serum-free RPMI medium containing Liberase CI (0.5 mg/ml; Roche, Madison, WI) and DNase I (0.5 mg/ml,

Sigma, St. Louis, MO). Lung cells were cultured with PBS or HDM as previously described[213].

Measurement of cytokine concentrations.

Cytokine concentrations were measured by ELISA (Pharmingen, San Diego, CA (IL-4 and IL-5) or R&D Systems, Minneapolis, MN, (IL-10, IL-13, IL-17A, IL-23).

Quantitative real-time RT-PCR.

Gene expression in both lungs and intestine was measured by real-time PCR. Data were normalized to expression of the mouse ribosomal S14 gene or a conserved

Eubacteria 16s RNA gene (EUB) for SFB and bacterial colonization experiments.

Primer sequences are as follows, EUB Forward: 5’-ACTCCTACGGGAGGCAGCAGT-

3’, EUB Reverse: 5’-ATTACCGCGGCTGCTGGC-3’, SFB; SFB Forward: 5’-GACG-

CTGAGGCATGAGAGCAT-3’ , SFB Reverse: 5’ GACGGCACGGATTG-TTATTCA-

3’.Lactobacillus sp. Forward :AGCAGTAGGGAATCTTCCA Lactobacillus sp

Reverse:CACCGCTACACATGGAG , Bacteriodes Forward:GGTTCTGAGA-

GGAGGTCCC. Bacteriodes Reverse: GCTGCCTCCCGTAGGAGT, Firmicutes

Forward: GGAGYATGTGGTTTAATTCGAAGCA, , Firmicutes Reverse:

AGCTGACGACAACCATGCAC. mIL-17A. Forward: ACTACCTCAACCGTTCCACG,mIL-17A Reverse: AGAAT-

TCATGTGGTGGTCCAG, mIL-23 Forward: GACCCACAAGGACTCAAGGA mIL-23 Reverse: CATGGGGCTATCAGGGAGTA

Assessment of SFB colonization of mice:

100

Statistical analysis.

101

Chapter 5. Use of morpholinos to selectively knockdown SFB colonization 5.1 Introduction Antibiotics have been used extensively since the mid-20th century to combat infectious disease and more recently as therapy in colitis and other inflammatory diseases. Over this time they have become increasingly more specific; however they generally target conserved features of bacteria to prevent toxicity within their mammalian patient, and thus often only have genera level specificity at best and generally have much broader activity [231, 232]. Additionally, even though antibiotics attempt to target conserved and essential features of bacteria, bacteria frequently develop antibiotic resistance, often to multiple drugs. Then, given the time frame needed for development of new drugs, these bacteria persist in the population with no method for treatment. This has become a significant public health problem with

Clostridium difficile, as modern strains have become more virulent while at the same time developing resistance to multiple antibiotics [128, 129]. Excessive antibiotic use for more minor infections likely contributes to the antibiotic resistance seen in highly pathogenic strains of C. difficile and S. aureus but it also has a profound influence on the normal, commensal, intestinal microbiota. In fact disruption of this microbiota likely contributes to the spread of these pathogens as these bacteria might out compete pathogens for resources in a healthy, intact, microbiome [129, 198, 233, 234]. The bacterial microbiome also strongly influences the development of asthma and atopic disease and the incidence of asthma and allergy is much greater in populations with high levels of antibiotic use early in life [98, 199].

We’ve shown that a specific commensal, gut tropic, Clostridia species, SFB or

Candidatus savagella, drives more severe allergic asthma in a mouse model via

102 systemic induction of IL-17A. We hypothesize that ablation of this organism from the intestinal microbiota at an early age may prevent the development of a systemic Th17 response and severe asthma in this model. We’ve explored the use of a purified diet to ablate these bacteria. However this approach is both ineffective and nonspecific; the diet only partially knocks down SFB and has broad effects on the intestinal microbiota including decreasing colonization by Lactobacillus species which have been shown to be protective in murine models of asthma [109, 125, 133, 135, 136]. SFB, like C. difficile is highly refractory to antibiotic treatment, and requires a potent cocktail of antibiotics that includes vancomycin to decrease colonization, and it is not clear that these antibiotics actually ablate SFB [233]. Treatment with cocktails of antibiotics, like the purified diet, have broad effects on the microbiota, ablating both organisms that might drive, and mitigate, inflammation [233]. Additionally, following antibiotic treatment, the microbiota may remain disrupted for quite some time, thus it is difficult to control for the pre and post antibiotic state [234]. Furthermore, vancomycin has been shown to drive more severe allergic asthma in a murine model as well as allergic responses in occupational exposure [235-237]. Thus robust, systemic, antibiotic treatment is not a good approach for the ablation of SFB in murine models of allergic asthma, and furthermore may not be a sound approach for treating minor infections in humans given the possible downstream effects. There is an emerging technology using synthetic translation blocking oligonucleotides that allows one to specifically target expression of genes that may serve as a method to ablate SFB in vivo, in the intestines of mice.

Phosphorodiamidate morpholino oligomers (PMOs) are synthetic DNA that can inhibit the translation of speciﬁc mRNA in prokaryotic and eukaryotic cells [238, 239].

103

They are composed of the four natural base pairs and can be synthesized with sequences that are complementary to any region of a speciﬁc mRNA but generally are targeted to the 5 prime untranslated region to block translation of a gene. PMOs are considerably more stable than other translation blocking oligos however, because their ribose rings and phosphate backbone has been replaced with a morpholine group, and a phosphorodiamidate linkage respectively, making the oligo highly resistant to nucleases and pH changes, and thus able to easily survive passage through the stomach. They have been successfully utilized to kill bacteria in vitro and in vivo in an peritoneal sepsis model but have never been utilized to target commensal bacteria in a natural ecosystem, such as in the lumen of the intestine of mice [238-246].

We utilized vivo-morpholinos (Genetools) to target gut trophic SFB. In addition to the above properties, vivo-morpholinos have a large lipophilic region (eight guanidinium groups on a dendrimeric scaffold) attached to the morpholino ring that allows the oligos to pass through cell membranes, which would be necessary if the morpholinos (PMOs) were to permabilize SFB filaments and the intestinal epithelium.

As targets, three genes from the SFB genome, phosphopyruvate hydratase gene

(Enolase), the alpha subunit of the holoenzyme complex of DNA polymerase III and elongation factor G , were selected for their specificity to SFB (determined via BLAST) as well as their key role in glycolysis, DNA synthesis and protein synthesis. These genes have also been the target of antimicrobials effective against other Clostridia species or have been shown to interact with essential genes in other bacterial species in addition to their specific biological roles [245-247]. A pooled approach is being used as it is not known whether any of these genes are truly necessary for SFB survival and

104 to prevent the possible development of SFB mutants. We hypothesized that this cocktail of PMO’s would specifically, ablate, or decrease SFB colonization and possibly decrease the severity of allergic asthma in our model. Furthermore, the in vivo use of

PMOS might one day prove useful for treatment of human pathogens or for modification of the composition of the microbiome to mitigate inflammatory diseases.

5.2 Results In order to explore the effectiveness of SFB targeting PMOs in the modulation of SFB colonization, IL-17A induction and severity of allergic asthma, five week old C57BL/6 mice (Taconic) were orally gavaged with 4mg/kg of each of the three targeting vivo-morpholinos (12 mg/kg,100uL PBS, Genetools LLC, Philomath,) or the same total dose of a non targeting control morpholino provided by Genetools, on Day -3 and Day -1 prior to HDM sensitization. Mice were then sensitized and sacrificed as in previous experiments and in methods. Relative bacterial colonization in the terminal ileum was then measured via QPCR between control and treatment groups at 6 weeks of age, immediately after PMO treatment, and at the conclusion of the experiment at 10 weeks of age (Fig. 1a,b). Mice treated with targeting (treatment) PMO had a highly significant drop in SFB colonization in their terminal ileum after 1 week compared to mice treated with the non-targeting (control) PMO and the treatment appeared to be specific to SFB as there was no significant change in Lactobacillus species, Firmicutes, which includes SFB, or Bacteroides species (Fig. 1a). At 10 weeks of age at the end of the experiment the level of SFB in the terminal ileum of mice treated with ether morpholino was nearly identical; suggesting that any knockdown of SFB that had occurred was short lived (Fig. 1b). Interestingly, both Lactobacillus and Bacteroides populations expanded in the treatment group compared to the control group at 10 105 weeks, which may suggest that during the transient knockdown of SFB other species expanded to fill the niche left by the drop in colonization. However, despite the drop in

SFB colonization there was no change in the level of Th17 induction in either the lungs or the Peyer’s patches or in airway hyperresponsivness in the treatment group (Fig. 1a, b). There was also no change in Th2 cytokine induction (IL-5,IL-13) or IL-17A induction in the lung.

5.3 Discussion Validating the efficacy of SFB targeting vivo morpholinos poses some unique challenges. Previous studies that have examined the efficacy of morpholinos in ablating specific bacteria (E.coli) via knockdown of essential gene expression utilize a number of approaches to quantify bacterial knockdown that are not possible with SFB due to it’s in ability to be cultivated and quantified with standard microbiology techniques [238, 244,

247]. Thus we relied on expression of SFB 16S rRNA normalized to expression of total bacteria to compare the efficacy of SFB knockdown between the control, non-targeting

PMO and the targeting PMO. Furthermore, to determine whether or not the targeting

PMO had broad effects on the microbiota we examined expression of 16S rRNA from a conserved region found in all bacteria (Eubacteria), and from unique regions of two major phyla (Bacteroidetes and Firmicutes) and one genera (Lactobacillus). At the first timepoint (Fig. 1a) we find that SFB, and only SFB, is diminished, but not ablated, in the group treated with the targeting PMO compared to the control PMO. This suggests that the PMO cocktail that we selected was able to specifically knockdown SFB colonization in a mixed bacterial community, which would be the first instance of this being demonstrated.

106

There may be a number of reasons that SFB was not ablated. SFB holdfast cells embedded in the epithelium may have been shielded from the PMO[150]. As we saw no significant toxicity to the mice with three days of continuous PMO treatment, the same dose might be extended over a number of weeks, at great cost, in order to saturate the intestinal epithelium with targeting PMO. SFB also forms and sheds dense spores at the ends of its filaments that may not be influenced by PMO treatment [150, 153, 156].

While some studies have examined the ability of PMOs to penetrate bacterial species with more robust cell membranes, none have examined the ability of PMOs to penetrate bacterial spores [236, 241-243, 248]. Long-term treatments with SFB targeting morpholinos might prevent SFB from becoming established but would not likely kill spores. Another cocktail of gene targets may be more effective for SFB ablation, but because SFB cannot be grown in culture it is difficult to validate which targets were effective in the current cocktail. Thus, for the time being, given the great cost and inability to directly examine the efficacy of specific translation blocking oligos on protein expression within spores or individual filaments of SFB, it is not clear that PMOs may be used to successfully ablate SFB in a mixed bacterial community such as the intestinal epithelium. However, with advances in proteonomics that allow examination of the protein expression of individual bacteria, much like is currently possible with the transcriptome via sequencing [179]; this work might be pursued again in uncultivable bacteria, and perhaps other spore forming Clostridia species.

As SFB is not ablated after the targeting PMO treatment, at the conclusion of the experiment relative levels of SFB colonization are similar between mice treated with the treatment and control PMO as would be expected (Fig. 1b). Interestingly however, there

107 are some shifts in the composition of the microbiota as measured by 16srRNA primers between mice treated with the control and the targeting PMOs. Both Bacteroidetes and

Lactobacillus are increased after treatment with the targeting PMO as compared to the control PMO, which would suggest that they expanded to fill the niche left during transient SFB knockdown. SFB forms a dense mat on the intestinal epithelium during colonization, and drives the induction of antimicrobial peptides and large amounts of IgA from the intestinal epithelium [139, 155, 157, 162, 167, 169], thus perhaps a transient breakdown in this “biofilm” allowed other commensal species to expand.

Transient ablation of SFB had no effect on the level of Th17 cells in the lung or

Peyer’s patches or on airway hyper responsiveness and lung induction of Th2 cytokines or IL-17A. Our previous research and consideration of the normal colonization kinetics of SFB has suggested that once SFB has established Th17 induction, it is difficult to reverse. In this study we had hoped that early ablation of SFB, shortly after the mice were weaned, might prevent the expansion of Th17 cells that produce cytokines (IL-

17A) that later synergize with allergen driven Th2 cytokines (IL-13) to drive more severe allergic asthma. This assumption hinged on the idea that there is a developmental window during which components of the microbiota, such as SFB, might drive inflammatory responses that might prove to be pathogenic in allergic asthma given the development of a later Th2 response. However, as PMOs cannot completely ablate

SFB at specific time points, this hypothesis might be revisited in another model at a later date. Interestingly, while Th2 cytokines and IL-17A induction in the lung are not influenced by transient ablation of SFB, IL-10 is induced at slightly, but significantly, higher levels in mice treated with the targeting PMO. This may suggest that the

108 expansion of Lactobacillus and possibly Bacteroidetes, seen in these mice might be driving a tolerogenic response in the lung, and perhaps with more robust knockdown of

SFB, might drive a strong enough response to decrease the severity of allergic asthma in our model. Overall this work reveals that, while it is theoretically possible to knockdown specific components of the microbiota, such as SFB, the effects on the broader microbiota and level of cytokines driving the etiology of inflammatory diseases is difficult to model and predict. Thus, ablation of single species after they’ve become an established component of the microbiota may not be the strongest approach in the treatment of allergic and inflammatory diseases. Bacterial gene targeting PMOS may thus be better suited for targeting pathogenic bacteria. Perhaps future work will allow for a better understanding of the complexity and interactions of components of the intestinal microbiota and the mammalian host and it would be possible to foster an environment that would prevent SFB from ever becoming established.

109

5.4 Figures

Figure 1: Treatment with SFB targeting vivo-morpholinos specifically and partially knocks down SFB colonization short term and colonization recovers over time.

Colonization of the terminal ileum by SFB, Lactobacillus, Firmicutes and Bacteroides of

6.5 week old C57BL/6 mice from Taconic farms 1 week after treatment with control or treatment morpholinos (6 weeks of age) and at 10 weeks of age was determined by

QPCR with 16S rRNA primers specific to each phyla genera or species (a,b). Data represent means +/- SEM (n= 6 mice/group).* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with mice treated with control PMO.

110

111

Figure 2: Partial knockdown of SFB does not influence lung or Peyer’s patch

Th17 cell induction or AHR. Lung (a) or Peyer’s patch cells (b) from C57BL/6 mice from Taconic Farms treated with control or treatment morpholino and HDM as in methods were stained with specific antibodies to CD4 and IL-17A for quantification of

CD4+, IL-17A+ cells. Values indicate means +/- SEM (n=6 mice/group) of frequency of

CD4+ population.* or ** indicates, P < 0.05 or P < 0.001, respectively, compared with control morpholino.

112

113

Figure 3. Partial knockdown of SFB does not influence Th2 or Th17 cytokines but drives increased IL-10 induction.

C57BL/6 mice from Taconic Farms treated with control or treatment morpholino and HDM as in methods were cultured in media containing 30 µg/ml HDM, and tissue culture supernatants were harvested after 72 h to determine production of IL-5 (a), IL-10

(b), and IL-13 (c) and IL-17A (d). Data represent means +/- SEM (n= 6 mice/group).* or

** indicates, P < 0.05 or P < 0.001, respectively, compared with mice treated with control morpholino.

114

115

5.5 Materials and Methods Mice.

Five week old male C57BL/6 (Taconic Farms, Germantown, NY) were housed in a specific pathogen–free facility in micro isolator cages. Mice were provided a standard diet of autoclaved food (Lab diet 5010) throughout (Days -3-28) morpholino treatment and HDM sensitization. All procedures were approved by the Institutional Animal Care and Use Committee of Cincinnati Children's Hospital Medical Center.

Morpholino Treatment

Five week old mice were gavaged with 4mg/Kg in 100uL of PBS of each of three targeting vivo- morpholinos( Genetools LLC, Philomath, OR) (12mg/kg total dose) on

Day -3 and Day -1 prior to HDM sensitization or 12mg/Kg of a non targeting control morpholino provided by gene tools. Sequences in the 5 prime un-translated region of three genes from the SFB genome, (NCBI Reference Sequence: NC_015913.1), phosphopyruvate hydratase gene (Enolase), the alpha subunit of the holoenzyme complex of DNA polymerase III and elongation factor G , were selected as targets for their specificity to SFB as well as their key role in glycolysis, DNA synthesis and protein synthesis. Morpholino target sequences are as follows. Enolase TTAA-

CACTTACCTCCATAATTTCCT,Pol III alpha subunit ACCCAAATGGAAAGAA-

TAGTCCACT, Elongation factor G ATTTGAGAGGAA-TAAACCGCATGTT

116

Sensitization protocols and SFB colonization.

Mice were sensitized to HDM by intraperitoneal (i.p.) injection with HDM

(30ug/100 uL, Greer Laboratories, Lenoir, NC) or PBS (100uL) on days 1 and 7 then intratracheally (100ug/30 uL) (I.T) on days 14 and 21 with HDM or PBS. Mice were sacrificed on day 24.

Assessment of allergen-induced AHR.

After a stable baseline was achieved, acetylcholine (50 mg per kg body weight) was injected into the inferior vena cava and dynamic airway pressure (cm H20 × s) was monitored for 5 min.

Lung cell isolation and restimulation.

Sigma, St. Louis, MO). Lung cells were cultured with PBS or HDM as previously described[213].

Measurement of cytokine concentrations.

Cytokine concentrations were measured by ELISA (Pharmingen, San Diego, CA (IL-4 and IL-5) or R&D Systems, Minneapolis, MN, (IL-10, IL-13, IL-17A, IL-23).

Quantitative real-time RT-PCR.

117

Gene expression in both lungs and intestine was measured by real-time PCR. Data were normalized to expression of the mouse ribosomal S14 gene or a conserved

Eubacteria 16s RNA gene (EUB) for SFB and bacterial colonization experiments.

Primer sequences are as follows, EUB Forward: 5’-ACTCCTACGGGAGGCAGCAGT-

3’, EUB Reverse: 5’-ATTACCGCGGCTGCTGGC-3’, SFB; SFB Forward: 5’-GACG-

CTGAGGCATGAGAGCAT-3’ , SFB Reverse: 5’ GACGGCACGGATTG-TTATTCA-

3’.Lactobacillus sp. Forward :AGCAGTAGGGAATCTTCCA Lactobacillus sp

Reverse:CACCGCTACACATGGAG , Bacteriodes Forward:GGTTCTGAGA-

GGAGGTCCC. Bacteriodes Reverse: GCTGCCTCCCGTAGGAGT, Firmicutes

Forward: GGAGYATGTGGTTTAATTCGAAGCA, , Firmicutes Reverse:

AGCTGACGACAACCATGCAC. mIL-17A. Forward: ACTACCTCAACCGTTCCACG,mIL-17A Reverse: AGAAT-

TCATGTGGTGGTCCAG, mIL-23 Forward: GACCCACAAGGACTCAAGGA mIL-23 Reverse: CATGGGGCTATCAGGGAGTA

Assessment of SFB colonization of mice:

Statistical analysis.

118

Chapter 6: Major conclusions, discussion and future research 6.1 SFB colonization in the modulation of severity of allergic asthma

In the above work we have shown that colonization with a specific, and transient, component of the murine and human intestinal microbiota, SFB, drives more severe asthma in a murine model of allergic asthma. In examining the mechanisms underlying this we’ve demonstrated that severe allergic asthma in this model is mediated by excess induction of IL-17A, via CD4+ T cell subsets, at extra intestinal sites

(Ch3,Fig.1,2,3) in concert with IL-13 (Ch3, Fig.5) and that blockade of IL-17A abrogates this more severe disease (Ch3,Fig.4) . This indicates that IL-17A induction, in concert with allergen driven Th2 cytokines, is driving the increased severity of allergic asthma that we observed in SFB colonized mice. These findings are consistent with studies in humans showing that severe asthma is often associated with induction of both Th2 cytokines and IL-17A and with a previous report in a mouse model of asthma in which severe asthma is mediated by a mixed Th2/Th17 response [14, 58, 76, 77,

248]. This work is novel however in that it is the first report of a component of the intestinal microbiota driving lung IL-17A induction that is able to synergize with allergen driven cytokines (IL-13) to drive more severe allergic asthma.

In exploring potential mechanisms for SFB-driven skewed Th17 immune responses, we have shown that SFB colonized mice produce higher levels of the serum soluble component SAA, which is known to drive Th17 induction via IL-23 production

[16, 204, 249-251] [204]. SAA circulates in the serum and is elevated in other lymphoid organs including the spleen following infection and inflammatory challenges and is further known to be elevated in the BAL of asthmatics [16, 203, 204, 249, 250] . Its

119 presence provides an avenue by which a gut tropic organism such as SFB might drive systemic Th17 induction. Indeed there are conserved evolutionary reasons that intestinal bacteria might drive systemic immune responses, particularly Th17 induction[252].Th17 cells possibly serve to help maintain a balance between healthy colonization of the intestine by commensal organisms and sepsis driven by bacterial breach of the intestine. Pathology likely results from Th17 induction only in the presence of a poorly regulated immune response, as in the context of autoimmune disease, or in concert with other deregulated responses, such as Th2 driven responses to allergens.

Thus circulating SAA driven by intestinal bacteria by its self may not necessarily be pathogenic and may represent a normal mechanism for maintaining a surveying population of Th17 cells that might help clear bacteria if they expand beyond the intestine. In support of this idea, despite the elevated serum levels of SAA, mice from

Taconic have similar lung function to mice from Jackson at baseline. It is only after they mount an allergen driven Th2 response that they develop more severe allergic asthma.

Our studies show that SFB colonization may lead to Th17 cell expansion through altering dendritic cell function. Specifically, colonization with SFB drives changes to

BMDCs that support excess IL-17A induction upon transfer to mice that have never been colonized with SFB (Ch3, Fig.7).These DCs also produce more IL-23 in response to the same level of in vitro SAA, suggesting that they are more responsive to SAA mediated signaling. SAA is expressed in the lungs during mixed Th2/Th17 allergic sensitization models and is known to induce pulmonary inflammation upon inhalational exposure [204]. Given that more SAA is present in the serum, and possibly the lungs of

SFB colonized mice and BMDCs from SFB colonized mice drive more robust IL-23

120 induction, which is known to drive increased Th17 induction and IL-17A, it is possible that SAA signaling pathways are important in driving the more severe disease seen in colonized mice during exposure to HDM. This data also suggests the intriguing hypothesis that SFB colonization drives lasting changes to bone marrow precursors that support Th17 induction, and would help to explain how while SFB colonization drops off over time (Ch3,Fig.8) Th17 induction is still maintained (Ch3,Fig.8). A number of questions remain however, including: how exactly does gut tropic intestinal

SFB colonization drive lung induction of Th17; how does SFB colonization drive long term changes to bone marrow derived precursors and can SFB be ablated?

Excess IL-17A induction in the lungs of SFB colonized mice might be driven by two complimentary and concurrent pathways, induction of mediators, possibly serum soluble ones such as SAA that can systemically drive Th17 induction and epigenetic changes to DC precursors in bone marrow that makes them more responsive to Th17 polarizing mediators. Then, this SFB induced excess IL-17A drives more severe asthma in concert with allergen (HDM) driven IL-13 in our model of allergic asthma. This idea is summarized in a model below (Fig.1).

6.2 Potential mediators driving Th17 induction in SFB colonized mice

SFB colonization is known to drive up regulation of expression of a few genes in the host intestine that drive production of mediators that may be able to systemically influence T cell, and Th17, induction and survival [138]. These include sphingomyelin phosphodiesterase, SAA1 and SAA2 [138].

121

Sphingomyelin phosphodiesterase acid-like 3B, is an acid sphingomyelinase

(aSMase), which are lysosomal enzymes that catalyze the hydrolysis of membrane- resident sphingomyelin into ceramide and phosphorylcholine. They have also been reported to be involved in regulating glucocorticoid-induced cell death of T lymphocytes

[253-255]. Tischner et al have further shown that aSMase production protects against glucocorticoid-induced cell death of activated, effector memory CD4+ T lymphocytes and a number of studies have indicated that products of the breakdown and metabolism of sphingomyelin can influence the differentiation and expansion of T cell subsets including Th17 cells, largely via preventing or driving apoptosis [253-256]. Thus SFB colonization might influence Th17 induction by driving increased survival of CD4+ subsets via aSMase induction. Ivanov et al. explored gene induction in total RNA from the terminal ileum, so it is not clear what subsets of cells this aSMase is upregulated in, further SFB is not known to penetrate cells in the intestinal epithelium, just very closely associate with them [138, 154, 157, 160, 181], thus is it not entirely clear how SFB colonization is driving up regulation of this lysosomal gene. Further studies could examine the expression of aSMase genes however, and susceptibility to apoptosis

(caspase 3 induction, phosphatidylserine expression), of FACS sorted CD4+ T cell subsets, epithelial cells and APCs from the lung and intestine of SFB colonized mice to determine if this may be a possible mechanism driving systemic Th17 induction in SFB colonized mice. Various aSMase knockout strains of mice are also available and might be utilized to determine if endogenous aSMase influences both the allergic phenotype and Th17 expansion in knockout mice colonized with the bacteria [257]. It is also pertinent to note that polymorphisms in ORMDL3 have been strongly associated with

122 the later development of asthma [258-263] and that ORMDL family genes are heavily involved in lipid biosynthesis pathways, including production of sphingomyelin, ceramide and phosphorylcholine [264]. The development of asthma is also known to be influenced by a number of lipid mediators such as prostaglandin E2 [265]. Thus, components of the microbiome that might influence these pathways, such as SFB, may also have a significant influence on the etiology of asthma.

Serum amyloid A (SAA) is an acute phase protein produced by the epithelium and liver during inflammation[249]. There are several isoforms of the gene encoding it and there is significant homology between human and mouse genes. SAA1 and SAA2 , collectively referred to as SAA, are found in the serum while the other isoforms are found largely in the tissue of mice and humans[249]. Serum concentrations of SAA significantly increase within 24 hours of inflammatory stimulus, such as infection, in both humans and mice [249]. SAA is also elevated in the sputum and serum of those with asthma [203]. Recently, Ather et al have also demonstrated that treatment with SAA can drive more severe asthma in a murine model of OVA exposure. They further showed that SAA can drive Th17 induction via activation of the NLRP3 inflammasome in DCs and macrophages. NLRP3 is a cytoplasmic sensor that drives induction of mediators such as IL-1b and IL-6 needed for Th17 expansion and differentiation [266]. Thus SAA induction in the serum and lung may be a significant mechanism driving Th17 induction in the lung, and the development of severe asthma. Correspondingly we see more induction of serum SAA in SFB colonized mice with more severe asthma (Ch2).

Therefore to test the hypothesis that SAA induced in the serum of SFB colonized mice drives more severe allergic asthma we might block SAA induction in these mice and

123 examine the influence on the allergic phenotype. There are no commercial in vivo inhibitors specific to SAA. However, SAA1 has been systemically inhibited in mice through i.p. injection with two monocolonal antibodies (50 mg/kg, mc29 and mc4; 1:1) against the invariant region of SAA and via the use of heparin or PVS [249, 266]. A highly specific peptide inhibitor of SAA has also been tested in cell cultures, but not mice [250, 267].

However, BMDCs from SFB colonized mice also produce more IL-23 in response to the same level of SAA as BMDCs from SFB free mice (Ch2), suggesting that these BMDCs are also more responsive to SAA and that the presence of SAA is not the sole mechanism driving the increased systemic Th17 induction seen in SFB colonized mice.

124

6.3 Epigenetics, SFB colonization and Th17 induction Our work suggests that transient gut tropic SFB colonization drives long term systemic IL-17A induction and that excess IL-17A induction underlies the move severe allergic asthma seen in SFB colonized mice. We have further shown that SFB colonization drives changes to bone marrow derived DCs that can support increased IL-

17A induction, and more severe asthma, upon transfer to mice that have never been colonized by SFB (Ch3). While, the mechanism driving this systemic and possibly long term induction of IL-17A is unclear, it may be mediated by epigenetic effects.

Epigenetics refers to heritable changes in gene expression that are not transmitted via changes in genetic code and represents a major mechanism for regulation of gene expression. There are several common epigenetic mechanisms which include histone modifications, such as methylation or acylation of histone proteins

(H2A, H2B, H3,and H4) that form the nucleosome core of DNA, and direct DNA methylation, both of which can affect gene transcription through effects on the DNA ultra-structure. Acylation of histones or methylation of DNA can regulate transcription by stericly influencing binding of proteins to promoter regions. Acetylation of histones causes DNA to bind less tightly to the nucleosome, while methylation of DNA causes it to bind more tightly, and thus be less accessible [2]. Thus, generally, when transcription is silenced, dinucleotides are methylated and histones are deacetylated through histone deacetylase (HDAC) activity, conversely, In the transcriptionally active state, CpG dinucleotides are unmethylated and histones H3 and H4 are acetylated via HAT activity[268]. Many unique epigenetic modifications govern the fate and final differentiation of CD4+ T cells subsets, however histone acetylation, or a lack thereof, in particular is known to have a role in driving induction and expansion of Th17cells. 125

Furthermore, induction of IL-17A and IL-23 may be influenced by epigenetic modifications driven by the intestinal bacterial microbiota [269, 270].

Askar et. al. have shown that in Th1 and Th2 cells in a culture system the IL-17 promoter regions were hypo-acetylated at histone H3, while in IL-17 producing cells these regions were acetylated suggesting that acetylation of these histones is a feature of IL-17A producing cells [270]. Ghadimi et. Al. have further shown that commensal, probiotic, intestinal bacteria can influence acylation and methylation and expression of

IL-17 and IL-23 [271]. Askar et al examined the effects of colonization with

Bifidobacterium breve, and Lactobacillus acidophilus (LGG) on the expression of IL-17 and IL-23 and the “epigenetic machinery” in a 3D coculture model of the human gut which consisted of human intestinal HT-29/B6 or T84 cells and PBMCs. The cell cultures were treated with LPS in the presence or absence of bacteria and expression of a number of inflammatory cytokines and signaling molecules including, IL-17, IL-23 and NF-κB was determined along with accumulation of Ac-H4 (acetylation of histone

H4) and DNA methylation sites. Colonization with B. breve and LGG decreased LPS- induced expression of IL-17, IL-23, NF-κB translocation and overall histone acetylation while at the same time enhancing DNA methylation. As histone deacetylation and DNA methylation have been associated with silencing of IL-17 and IL-23 induction, their work suggests that these two probiotics might drive epigenetic down regulation of these cytokines. This would be consistent with previous literature suggesting a protective role for these bacteria in models of inflammatory disease [271]. How these bacteria might drive these epigenetic changes is unknown. These results may be germane to our model of allergic asthma in SFB colonized mice however.

126

Certain epigenetic modifications may be associated with the development, and characteristics of severe asthma. PMBCs from those with severe asthma have decreased HDAC activity compared to those with moderate and mild asthma and decreased HDAC activity has also been associated with corticosteroid insensitivity, a key characteristic of severe asthma [16, 272]. Th17 induction is also influenced by

HDAC activity and induction of Th17 cytokines (IL-17,IL-23) can be inhibited by HDAC inhibitors[273]. SFB, which represents a normal component of the commensal microbiota, also drives Th17 induction which is associated with severe asthma. Thus,

SFB might be driving robust and sustained IL-17A induction through epigenetic modifications to DC precursors. These modifications might involve hyper acetylation of the IL-23 promoter in these DCs. Again, there is some basis for this idea as components of the microbiota are known to decrease IL-23 and IL-17A induction, possibly via hypo acetylation (decreased HDAC activity)[271]. Epigenetic modifications to Th1 cells driven by soil bacteria are also known to be passed to the next generation of mice, and this effect is dependent on H4 acetylation [131, 271]. However, it is not known if SFB colonization can drive histone acetylation and direct experiments similar to the 3D coculture system designed by Askar are not yet possible with the organism due to its inability to be cultivated under normal culture conditions. However HDAC activity in the intestine, lungs and BMDCs of SFB colonized mice can be measured and these mice could also be gavaged with HDAC inhibitors and their systemic induction of

Th17, and response to our allergic asthma model, and CHIP preformed to test the hypothesis that SFB colonization is driving more severe asthma in a murine model via histone hyperacetylation of chromatin regions near the IL-23 promoter in dendritic cell

127 precursors or in DC populations in the lung, intestine and spleen. It is not known if SFB colonization influences acetylation of histones and it is not specifically clear how SFB, or other components of the microbiota, might influence the epigenetic mechanisms of cytokine production by CD4+ cells or the etiology of asthma. However, some unique features of the SFB genome suggest that it might be able to specifically drive at least one type of little explored epigenetic change that might influence the development of a

Th17 response.

It has recently become clear that ADP ribosylation of histones may have epigenetic effects. Poly(ADP-ribose) polymerase-1 (PARP-1) is a ubiquitous nuclear enzyme with pleiotrophic functions in many cellular processes including DNA repair pathways, stress activated pathways and more recently transcriptional regulation[274].

Ricardo et. al. have recently shown that PARP-1 can act on nucleosomes to drive epigenetic effects. They show that lipopolysaccharide (LPS) stimulation induces both

PARP-1 activity and ADP-ribosylation of histones at transcriptionally active and accessible chromatin regions in macrophages. They further show that histone ADP- ribosylation directly destabilizes histone-DNA interactions in the nucleosome and increases the site accessibility of the nucleosomal DNA to nucleases. They suggested that PARP-1 enzymatic activity facilitates gene transcription via histone ADP- ribosylation and that it accomplishes this via decreasing steric inhibition of promoter accessibility[275]. Thus ADP-ribosylation via ADP ribosyltranferases such as PARP-1 may be a significant mechanism driving epigenetic modifications in genes.

128

The SFB genome expresses a number of unique genes not seen in many other gut tropic bacteria; these include genes for scavenging nutrients from the intestinal tract, and a group of what appear to be secreted proteins. While the exact function of many of these potentially secreted proteins is unknown, they likely allow the bacteria to attach to the epithelium of the host, out compete other components of the microbiota and procure nutrients from the intestinal lumen [139]. SFB expresses four novel predicted ADP- ribosyl transferases (ADPRTs), predicted to be secreted, which have significant sequence similarity to known ADPRTs that ribosylate actin and act to inhibit its polymerization. During SFB colonization expression of these ADPRTs likely helps to anchor SFB holdfasts in the intestinal epithelium, one step of the bacterial lifecycle, however they may also have a role in the induction of the Th17 response by these bacteria [179].

SFB ADPRTs might induce expansion of Th17 cells through modulation of dendritic cell cytokine production, possibly via acetylation of chromatin in the promoter regions of IL-23 or IL-17A [179, 276]. ADP-ribosylation is known to influence Th1 induction during stomach Helicobacter pylori infection and this induction is reversed with

PARP-1 inhibitors, but it is not known if it might influence Th17 induction [277]. It might be possible to test the hypotheses that SFB ADPRTs have epigenetic regulatory properties similar of that of PARP-1 and that SFB ADPRTs can act on Th17 cytokine production in mammalian dendritic cells both inside and outside of the intestine by treating SFB colonized mice with PARP-1 inhibitors only in the gut, via gavage, and systemically then examining the induction of Th17 cells and cytokines at various sites including the intestines and lungs as well as ADP ribosylation of promoter sites in lung,

129 gut and BMDCs via CHIP. Ideally a mutant SFB would be created that lacked these

ADPRT genes and mice would be colonized with it and subjected to our allergic asthma model. However given the limitations in SFB cultivation this sort of genetic manipulation, commonly done with other species, is not currently possible.

Overall there is a distinct possibility that the IL-17A dependent, severe allergic asthma that is observed in SFB colonized mice in our model is driven by epigenetic changes to DC precursors. Perhaps this is mediated via histone acetylation or ADP- ribosylation of chromatin near the IL-23 promoter, which in turn drives long term induction of IL-17A. Furthermore, if these loci are epigenetically modified in such a way that they are more “open” this may explain our observation of increased IL-23 induction in response to LPS and SAA in SFB colonized mice (Chapter 2). In this case any stimulation that would normally drive IL-23 induction, like both SAA and LPS are known to do, would be expected to drive significantly higher levels of the cytokine, which would in turn influence Th17 activation, expansion and production of IL-17A. Again, exactly how gut trophic SFB might be influencing epigenetic programming of BMDCs is a bit puzzling, but many microbial mediators, often components of the metablalome such as short chain fatty acids, are generated in the intestine then translocate into the blood stream [115, 177]. SFB ADPRT proteins might very well make it into the blood stream and from there act on BMDCs. This sort of mechanism would possibly explain our observation that LPS pulsed BMDCs transferred from SFB colonized mice into SFB free mice were able to drive robust Th17 induction even in the absence of SFB colonization.

This would also support our hypothesis that a number of serum soluble mediators were driving Th17 induction in SFB colonized mice. This idea likely has broader implications

130 outside of this model however. If transient colonization by intestinal bacteria can drive immune responses that exacerbate the severity of asthma via epigenetic mechanisms, particularly histone acetylation, then the use of HDAC inhibitors in the treatment of severe asthma may not just be influencing the responsiveness of corticosteroids as has been suggested[16], it may be altering microbiota driven CD4+ polarization as well. A better understanding of the mechanisms of experimental pharmacological mediators often leads to more effective treatments, which are sorely needed in the field of severe asthma.

As we have shown that SFB significantly contributes to allergic inflammation and neutrophilia, we have also explored several potential mechanisms to ablate SFB colonization in vivo. First, as changes in diet are likely to have a major impact on the gut microflora, we explored the role of different diets on SFB colonization. We show that specific diets influence SFB colonization and neutrophil inflammation (Ch4,Fig.1).

Second we show that the use of SFB specific gene targeting morpholinos(Ch5,Fig.1), can decrease SFB colonization, but that decreasing SFB colonization does not necessarily influence Th17 induction or the severity of allergic asthma (Ch4,Fig.2,

Ch5,Fig.2), further supporting the idea that transient colonization with SFB drives lasting changes in the immune system that support the development of severe asthma.

However both of these approaches also had broader influences on the microbiota that might be relevant to human health and this model.

6.4 Possible ablation of SFB We used two distinct, non-antibiotic, approaches to ablate SFB from the microbiota of mice, neither of which were successful in completely eliminating the bacteria. We specifically avoided antibiotic approaches as they would have been 131 somewhat ineffective against SFB and incompatible with a murine model of allergic asthma as discussed previously [235-237]. Use of a purified diet, lacking many of the complex carbohydrates found in plant based diets, decreased SFB colonization but also significantly decreased all bacterial colonization non-specifically. Furthermore, this approach, while a potentially useful tool, would not have been particularly applicable to human studies as diets rich in plant based components have been associated with improved prognosis in most inflammatory diseases, including asthma [196, 278-280].

Other dietary approaches to the ablation of SFB, more in line with human epidemiological studies, might be used in the future as the nutritional requirements of

SFB colonization are better understood.

Use of a vivo-morpholino targeting SFB did specifically decrease SFB colonization transiently (Ch5). Interestingly, decreasing SFB colonization also may have driven shifts in the composition of the microbiota, specifically an expansion of

Lactobacillus (Ch5). This observation is consistent with studies that have examined the dynamics of disrupted and establishing microbial communities [281-283]. Removal of key organisms can drive shifts in the composition of the microbiota, driving it into either a disrupted and constantly fluctuating state, or a new stable state that varies considerably from the original microbiota [281, 282, 284]. This shift in the microbiota, towards expansion of Lactobacillus species, might underlie the increased IL-10 induction observed in the lungs of mice treated with the targeting morpholino (Ch5, Fig

3). This data might further suggest an interaction between SFB and Lactobacillus species that might be utilized to prevent the expansion of SFB or drive a tolerogenetic response that might counter the inflammatory response driven by SFB.

132

There is research suggesting that SFB interacts with Lactobacillus species during its colonization of the mouse intestine. Early microscopy studies by Koopman have suggested that for a brief period during the SFB lifecycle it is sub-colonized by

Lactobacillus like bacteria [153]. Ivanov et al noted that the second largest difference in the microbiota of mice from Taconic Farms, when compared to mice from Jackson

Laboratories, was the increased presence of Lactobacillus murinis in mice from Taconic

[138]. A study by Fuentes et al also examined the influence of Lacobacillus plantarum on colonization by SFB in immunosuppressed mice (cyclophosphamide treated) and found that SFB colonization of the intestine was abolished in these mice [285]. L. plantarum is found in a number of fermented foods including kimchi and has been shown to be protective in several murine models of allergic disease and has shown potential as a probiotic utilized in the treatment of human inflammatory disease [40, 109,

124, 198, 205, 211, 212, 285-290]. Because of the established role of Lactobacillus species in modulating inflammatory disease models, the potential interaction of SFB and Lactobacillus species in the intestine, and the ability of L. plantarum to “ablate” or outcompete SFB in immunocompromised mice, we briefly explored the role that L. plantarum administration might have in decreasing SFB colonization in our model. We found that treatment of 3 week old SFB colonized mice (Taconic) with L. plantarum, decreased SFB colonization, however not significantly (n=3) compared to gavage with

PBS (Fig 2). This study was quite limited in sample size however and relies on the assumption that a single bacterial species might be sufficient to out compete SFB.

Thus, future, larger studies, might utilize L. plantarum, or a cocktail of Lactobacillus species, to prevent SFB colonization and development of the Th17 response.

133

Furthermore, we might examine the effect of maternal Lactobacillus colonization on the development of allergic asthma in SFB colonized mice. This approach might be more effective than ablating SFB in the current generation if the goal is to both ablate SFB and decrease the Th17 induction that underlies severe asthma in our model. One study has indicated that T cell polarization driven by the microbiota of mothers is inherited by pups [131] and our research suggests that significantly decreasing SFB colonization does not decrease Th17 induction (Ch4,5). However, it is important to note that neither of our approaches was able to completely eliminate SFB colonization and that colonization with bacteria is generally passed from mother to pup, however in this above study this was controlled via caesarian delivery of pups. This idea, that transient SFB colonization might drive irreversible Th17 induction, can be explored in more depth once

SFB can be ablated at specific time points and may have implications for the treatment of asthma in humans.

Azad et al and other authors have recently explored the connection between the intestinal microbiota and “perinatal programming”, or the contribution of environmental exposures during the in utero and ex utero time periods, and their role in the development of asthma [119, 120, 122, 132, 199]. The overriding idea of this work has been that this early period in childhood, and the composition of the microbiota during this period, influences the later development of the immune system and the development of inflammatory diseases such as asthma. As SFB has recently been shown to colonize humans during this same developmental period[140] further study of the kinetics, and make up, of the human immune response to this bacteria are in order.

Furthermore, studies examining its association with the development of asthma and

134 possible probiotics, or other approaches, that might prevent colonization with the bacteria may be useful in treating human disease if SFB or other Clostridia species are found to be associated with the development of severe asthma.

6.5 Closing Statements

Herein we’ve shown a role for SFB, or Candidatus savagella, in driving severe asthma in a murine model. This represents the first study directly showing that a

Clostridia species can drive more severe allergic asthma and corroborates human epidemiological data showing a role for Clostridia species in the development of asthma

[98, 118]. It also highlights the importance of the composition of the early life microbiota of mammals and its ability to shape T cell responses that might influence the later development of a plethora of inflammatory diseases, including asthma. This idea and work is an extension of Strachan’s hygiene hypothesis that early life exposure to microorganisms could affect the later development of allergic and inflammatory diseases and provides further support for the idea that differences in the composition of the microbiota between developed and undeveloped nations may underlie the increase in asthma incidence in the former [94, 97, 101, 119, 127, 237]. This work accomplishes this by providing a salient example of a bacterium, which is a component of both the mouse and human microbiota, that can drive more severe allergic asthma in a murine model and by exploring mechanisms underlying this more severe disease [140].

We’ve thus shown that SFB colonization drives more severe allergic asthma in our model via systemic IL-17A induction in concert with IL-13 induction, which agrees with previous work by the laboratory as well as human data showing that severe

135 asthma is mediated by a mixed Th2, Th17 immune response, however this work is novel in that we show for the first time that the lung Th17 response can be regulated by a component of the intestinal microbiota[76, 77]. Our work further and more significantly, suggests that SFB colonization drives lasting changes to bone marrow derived dendritic cell precursors that can drive systemic and protracted Th17 induction in the absence of SFB colonization. This work suggests that transient colonization by

SFB might drive lasting susceptibility to severe asthma, and is particularly topical as

SFB has recently been discovered to colonize humans for a short time period from birth to three years of age[140]. This observation may therefore help to provide an explanation for how transient childhood bacterial infections might be able to influence the development of asthma and allergies many years later. These infections might drive persistent changes to the immune system.

In our work we’ve also demonstrated the first report of specific knockdown of a component of the intestinal microbiota within the mammalian intestine by the use of gene targeting oligonucleotides unique to the bacteria. This may have implications in treatment of infectious disease in the future. Antibiotic resistance among pathogenic bacteria is a significant challenge presently facing the medical community and world and treatment with modern antibiotics has further been associated with increases in the risk of the development of asthma and allergies, and of infection with enteropathic bacteria [95, 97, 120, 231-234, 237]. Targeted therapies that can eliminate specific organisms from a host while leaving beneficial organisms intact would represent a significant tool in solving this problem.

136

Overall this work represents a significant, novel, contribution to the field of immunobiology and highlights the importance of continued study of the intestinal bacterial microbiota. Intestinal bacteria and the immune system form symbiosis’s and interactions that strongly influence the development of diseases far removed from the intestine and a better understanding of these interactions will help in the development of better treatments for a wide variety of inflammatory diseases.

137

Figure 1. Model for induction of severe allergic asthma in SFB colonized mice.

Excess IL-17A induction in the lung might be driven by two complimentary pathways in

SFB colonized mice, induction of serum soluble mediators that can systemically drive

Th17 induction and epigenetic changes to DC precursors that makes them more responsive to Th17 polarizing mediators. Then, this SFB induced excess IL-17A drives more severe asthma in concert with allergen (HDM) driven IL-13 in our model of allergic asthma.

138

139

Figure 2. Colonization with Lactobacillus plantarum and influence on SFB colonization.

Mice were orally gavaged with 100uL (4.8X108 CFUs per ML) L.plantarum ( ATCC

14917) suspended in PBS or PBS and their feces was monitored for SFB colonization via QPCR at two weeks.

140

141

References

1. Marketos, S.G. and C.N. Ballas, Bronchial asthma in the medical literature of Greek antiquity. J Asthma, 1982. 19(4): p. 263-9. 2. Lovinsky-Desir, S. and R.L. Miller, Epigenetics, asthma, and allergic diseases: a review of the latest advancements. Curr Allergy Asthma Rep. 12(3): p. 211-20. 3. Moorman, J.E., et al., Current asthma prevalence - United States, 2006-2008. MMWR Surveill Summ. 60 Suppl: p. 84-6. 4. Reddel, H.K., et al., An official American Thoracic Society/European Respiratory Society statement: asthma control and exacerbations: standardizing endpoints for clinical asthma trials and clinical practice. Am J Respir Crit Care Med, 2009. 180(1): p. 59-99. 5. Wieringa, M.H., et al., Higher occurrence of asthma-related symptoms in an urban than a suburban area in adults, but not in children. Eur Respir J, 2001. 17(3): p. 422-7. 6. Wieringa, M.H., et al., Higher asthma occurrence in an urban than a suburban area: role of house dust mite skin allergy. Eur Respir J, 1997. 10(7): p. 1460-6. 7. Arif, A.A., et al., Prevalence and risk factors of asthma and wheezing among US adults: an analysis of the NHANES III data. Eur Respir J, 2003. 21(5): p. 827-33. 8. Wenzel, S.E., Asthma phenotypes: the evolution from clinical to molecular approaches. Nature Medicine. 18(5): p. 716-25. 9. Cockcroft, D.W. and V.A. Swystun, Asthma control versus asthma severity. J Allergy Clin Immunol, 1996. 98(6 Pt 1): p. 1016-8. 10. Fireman, P., Understanding asthma pathophysiology. Allergy Asthma Proc, 2003. 24(2): p. 79-83. 11. Wills-Karp, M., Immunologic basis of antigen-induced airway hyperresponsiveness. Annu Rev Immunol, 1999. 17: p. 255-81. 12. Colice, G.L., Categorizing asthma severity: an overview of national guidelines. Clin Med Res, 2004. 2(3): p. 155-63. 13. Frieri, M., Asthma concepts in the new millennium: update in asthma pathophysiology. Allergy Asthma Proc, 2005. 26(2): p. 83-8. 14. Jatakanon, A., et al., Neutrophilic inflammation in severe persistent asthma. Am J Respir Crit Care Med, 1999. 160(5 Pt 1): p. 1532-9. 15. Benayoun, L., et al., Airway structural alterations selectively associated with severe asthma. Am J Respir Crit Care Med, 2003. 167(10): p. 1360-8. 16. Poon, A.H., et al., Pathogenesis of severe asthma. Clin Exp Allergy. 42(5): p. 625-37. 17. Lambrecht, B.N. and H. Hammad, The airway epithelium in asthma. Nat Med, 2012. 18(5): p. 684-92. 18. Ahluwalia, S.K. and E.C. Matsui, The indoor environment and its effects on childhood asthma. Curr Opin Allergy Clin Immunol. 11(2): p. 137-43. 19. Custovic, A., S. Marinho, and A. Simpson, Gene-environment interactions in the development of asthma and atopy. Expert Rev Respir Med. 6(3): p. 301-8. 20. Platts-Mills, T.A. and J.A. Woodfolk, Allergens and their role in the allergic immune response. Immunol Rev. 242(1): p. 51-68. 21. Ingram, J.L. and M. Kraft, IL-13 in asthma and allergic disease: Asthma phenotypes and targeted therapies. J Allergy Clin Immunol. 130(4): p. 829-42. 22. Holgate, S.T. and R. Polosa, The mechanisms, diagnosis, and management of severe asthma in adults. Lancet, 2006. 368(9537): p. 780-93.

142

23. Lloyd, C.M. and E.M. Hessel, Functions of T cells in asthma: more than just T(H)2 cells. Nat Rev Immunol. 10(12): p. 838-48. 24. Kenneth Murphy, P.T., Mark Walport, Janeway's Immunobiology. 7th ed. . 2008: Garland science, Taylor and Francis Group, LLC. 25. Wisniewski, J.A. and L. Borish, Novel cytokines and cytokine-producing T cells in allergic disorders. Allergy Asthma Proc. 32(2): p. 83-94. 26. Maddur, M.S., et al., Th17 cells: biology, pathogenesis of autoimmune and inflammatory diseases, and therapeutic strategies. Am J Pathol. 181(1): p. 8-18. 27. Bartemes, K.R. and H. Kita, Dynamic role of epithelium-derived cytokines in asthma. Clin Immunol, 2012. 143(3): p. 222-35. 28. Benoist, C. and D. Mathis, Treg cells, life history, and diversity. Cold Spring Harb Perspect Biol. 4(9): p. a007021. 29. Tan, C. and I. Gery, The unique features of Th9 cells and their products. Crit Rev Immunol. 32(1): p. 1-10. 30. AH, A.A.a.L., Cellular and Molecular Immunology. 6th ed. 2007, Philadelphia: Elsevier. 31. Cannons, J.L., K.T. Lu, and P.L. Schwartzberg, T follicular helper cell diversity and plasticity. Trends Immunol. 32. Nakayamada, S., et al., Helper T cell diversity and plasticity. Curr Opin Immunol. 24(3): p. 297- 302. 33. Neurath, M.F., S. Finotto, and L.H. Glimcher, The role of Th1/Th2 polarization in mucosal immunity. Nat Med, 2002. 8(6): p. 567-73. 34. Rubino, S.J., K. Geddes, and S.E. Girardin, Innate IL-17 and IL-22 responses to enteric bacterial pathogens. Trends Immunol. 35. Miller, L.S. and J.S. Cho, Immunity against Staphylococcus aureus cutaneous infections. Nat Rev Immunol. 11(8): p. 505-18. 36. Lin, L., et al., Th1-Th17 cells mediate protective adaptive immunity against Staphylococcus aureus and Candida albicans infection in mice. PLoS Pathog, 2009. 5(12): p. e1000703. 37. Bosnjak, B., et al., Treatment of allergic asthma: modulation of Th2 cells and their responses. Respir Res. 12: p. 114. 38. Holgate, S.T., Innate and adaptive immune responses in asthma. Nat Med. 18(5): p. 673-83. 39. Bohle, B., et al., Sublingual immunotherapy induces IL-10-producing T regulatory cells, allergen- specific T-cell tolerance, and immune deviation. J Allergy Clin Immunol, 2007. 120(3): p. 707-13. 40. Van Overtvelt, L., et al., IL-10-inducing adjuvants enhance sublingual immunotherapy efficacy in a murine asthma model. Int Arch Allergy Immunol, 2008. 145(2): p. 152-62. 41. Akdis, M., et al., TH17 and TH22 cells: a confusion of antimicrobial response with tissue inflammation versus protection. J Allergy Clin Immunol. 129(6): p. 1438-49; quiz1450-1. 42. Noelle, R.J. and E.C. Nowak, Cellular sources and immune functions of interleukin-9. Nat Rev Immunol. 10(10): p. 683-7. 43. Basu, R., et al., Th22 cells are an important source of IL-22 for host protection against enteropathogenic bacteria. Immunity. 37(6): p. 1061-75. 44. Souwer, Y., et al., IL-17 and IL-22 in atopic allergic disease. Curr Opin Immunol. 22(6): p. 821-6. 45. Hamelmann, E. and E.W. Gelfand, IL-5-induced airway eosinophilia--the key to asthma? Immunol Rev, 2001. 179: p. 182-91. 46. Glimcher, L.H. and K.M. Murphy, Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev, 2000. 14(14): p. 1693-711. 47. Robinson, D.S., et al., Evidence for Th2-type T helper cell control of allergic disease in vivo. Springer Semin Immunopathol, 1993. 15(1): p. 17-27.

143

48. Nakamura, Y., et al., Gene expression of the GATA-3 transcription factor is increased in atopic asthma. J Allergy Clin Immunol, 1999. 103(2 Pt 1): p. 215-22. 49. Wilkinson, J.R., S.J. Lane, and T.H. Lee, Effects of corticosteroids on cytokine generation and expression of activation antigens by monocytes in bronchial asthma. Int Arch Allergy Appl Immunol, 1991. 94(1-4): p. 220-1. 50. Wills-Karp, M., et al., Role of interleukin-4 in the development of allergic airway inflammation and airway hyperresponsiveness. Adv Exp Med Biol, 1996. 409: p. 343-7. 51. Cohn, L., et al., Induction of airway mucus production By T helper 2 (Th2) cells: a critical role for interleukin 4 in cell recruitment but not mucus production. J Exp Med, 1997. 186(10): p. 1737-47. 52. Steinke, J.W. and L. Borish, Th2 cytokines and asthma. Interleukin-4: its role in the pathogenesis of asthma, and targeting it for asthma treatment with interleukin-4 receptor antagonists. Respir Res, 2001. 2(2): p. 66-70. 53. Finkelman, F.D., et al., Importance of cytokines in murine allergic airway disease and human asthma. J Immunol. 184(4): p. 1663-74. 54. Finkelman, F.D., et al., IL-4 is required to generate and sustain in vivo IgE responses. J Immunol, 1988. 141(7): p. 2335-41. 55. Kips, J.C., et al., Importance of interleukin-4 and interleukin-12 in allergen-induced airway changes in mice. Int Arch Allergy Immunol, 1995. 107(1-3): p. 115-8. 56. Wills-Karp, M., et al., Interleukin-13: central mediator of allergic asthma. Science, 1998. 282(5397): p. 2258-61. 57. Prieto, J., et al., Increased interleukin-13 mRNA expression in bronchoalveolar lavage cells of atopic patients with mild asthma after repeated low-dose allergen provocations. Respir Med, 2000. 94(8): p. 806-14. 58. Saha, S.K., et al., Increased sputum and bronchial biopsy IL-13 expression in severe asthma. J Allergy Clin Immunol, 2008. 121(3): p. 685-91. 59. Wills-Karp, M., IL-12/IL-13 axis in allergic asthma. J Allergy Clin Immunol, 2001. 107(1): p. 9-18. 60. Grunig, G., et al., Requirement for IL-13 independently of IL-4 in experimental asthma. Science, 1998. 282(5397): p. 2261-3. 61. Wills-Karp, M., Interleukin-13 in asthma pathogenesis. Curr Allergy Asthma Rep, 2004. 4(2): p. 123-31. 62. Kasaian, M.T., et al., An IL-4/IL-13 Dual Antagonist Reduces Lung Inflammation, Airway Hyperresponsiveness, and IgE Production in Mice. Am J Respir Cell Mol Biol. 63. Gauvreau, G.M., et al., Effects of interleukin-13 blockade on allergen-induced airway responses in mild atopic asthma. Am J Respir Crit Care Med. 183(8): p. 1007-14. 64. Grünig, G., et al., Interleukin 13 and the evolution of asthma therapy. Am J Clin Exp Immunol 2012. 1(1): p. 20-27. 65. Antohe, I., R. Croitoru, and S. Antoniu, Tralokinumab for uncontrolled asthma. Expert Opin Biol Ther. 13(2): p. 323-6. 66. Barczyk, A., W. Pierzchala, and E. Sozanska, Interleukin-17 in sputum correlates with airway hyperresponsiveness to methacholine. Respir Med, 2003. 97(6): p. 726-33. 67. He, R., et al., Epicutaneous antigen exposure induces a Th17 response that drives airway inflammation after inhalation challenge. Proc Natl Acad Sci U S A, 2007. 104(40): p. 15817-22. 68. Chen, J., et al., The polymorphism of IL-17 G-152A was associated with childhood asthma and bacterial colonization of the hypopharynx in bronchiolitis. J Clin Immunol, 2010. 30(4): p. 539-45. 69. Laan, M., et al., Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol, 1999. 162(4): p. 2347-52. 70. Milovanovic, M., et al., Interleukin-17A promotes IgE production in human B cells. J Invest Dermatol. 130(11): p. 2621-8. 144

71. Fujisawa, T., et al., Regulation of airway MUC5AC expression by IL-1beta and IL-17A; the NF- kappaB paradigm. J Immunol, 2009. 183(10): p. 6236-43. 72. Hirata, T., et al., Recruitment of CCR6-expressing Th17 cells by CCL 20 secreted from IL-1 beta-, TNF-alpha-, and IL-17A-stimulated endometriotic stromal cells. Endocrinology, 2010. 151(11): p. 5468-76. 73. Chang, Y., et al., TH17 cytokines induce human airway smooth muscle cell migration. J Allergy Clin Immunol, 2011. 127(4): p. 1046-53 e1-2. 74. Chang, Y., et al., Th17-associated cytokines promote human airway smooth muscle cell proliferation. FASEB J. 75. Kudo, M., et al., IL-17A produced by alphabeta T cells drives airway hyper-responsiveness in mice and enhances mouse and human airway smooth muscle contraction. Nat Med. 18(4): p. 547-54. 76. Al-Ramli, W., et al., T(H)17-associated cytokines (IL-17A and IL-17F) in severe asthma. J Allergy Clin Immunol, 2009. 123(5): p. 1185-7. 77. Lajoie, S., et al., Complement-mediated regulation of the IL-17A axis is a central genetic determinant of the severity of experimental allergic asthma. Nat Immunol, 2010. 11(10): p. 928- 35. 78. Schnyder-Candrian, S., et al., Interleukin-17 is a negative regulator of established allergic asthma. J Exp Med, 2006. 203(12): p. 2715-25. 79. Wilson, R.H., et al., Allergic sensitization through the airway primes Th17-dependent neutrophilia and airway hyperresponsiveness. Am J Respir Crit Care Med, 2009. 180(8): p. 720-30. 80. Wills-Karp, M. and S.L. Ewart, The genetics of allergen-induced airway hyperresponsiveness in mice. Am J Respir Crit Care Med, 1997. 156(4 Pt 2): p. S89-96. 81. Linden, A., H. Hoshino, and M. Laan, Airway neutrophils and interleukin-17. Eur Respir J, 2000. 15(5): p. 973-7. 82. Pelaia, G., A. Vatrella, and R. Maselli, The potential of biologics for the treatment of asthma. Nat Rev Drug Discov. 11(12): p. 958-72. 83. Binia, A. and M. Kabesch, Respiratory medicine - genetic base for allergy and asthma. Swiss Med Wkly. 142: p. w13612. 84. Moffatt, M.F., et al., A large-scale, consortium-based genomewide association study of asthma. N Engl J Med. 363(13): p. 1211-21. 85. Kauffmann, F. and F. Demenais, Gene-environment interactions in asthma and allergic diseases: challenges and perspectives. J Allergy Clin Immunol. 130(6): p. 1229-40; quiz 1241-2. 86. Slager, R.E., et al., Genetics of asthma susceptibility and severity. Clin Chest Med. 33(3): p. 431- 43. 87. Wang, J.Y., et al., The polymorphisms of interleukin 17A (IL17A) gene and its association with pediatric asthma in Taiwanese population. Allergy, 2009. 64(7): p. 1056-60. 88. Bijanzadeh, M., P.A. Mahesh, and N.B. Ramachandra, An understanding of the genetic basis of asthma. Indian J Med Res. 134: p. 149-61. 89. Runyon, R.S., et al., Asthma discordance in twins is linked to epigenetic modifications of T cells. PLoS One. 7(11): p. e48796. 90. Thomsen, S.F., K.O. Kyvik, and V. Backer, Etiological relationships in atopy: a review of twin studies. Twin Res Hum Genet, 2008. 11(2): p. 112-20. 91. Prester, L., Arthropod allergens in urban homes. Arh Hig Rada Toksikol. 63 Suppl 1: p. 47-56. 92. Cho, I. and M.J. Blaser, The human microbiome: at the interface of health and disease. Nat Rev Genet, 2012. 13(4): p. 260-70. 93. Arumugam, M., et al., Enterotypes of the human gut microbiome. Nature, 2011. 473(7346): p. 174-80.

145

94. Russell, S.L. and B.B. Finlay, The impact of gut microbes in allergic diseases. Curr Opin Gastroenterol. 28(6): p. 563-9. 95. Costello, E.K., et al., The application of ecological theory toward an understanding of the human microbiome. Science. 336(6086): p. 1255-62. 96. van Nimwegen, F.A., et al., Mode and place of delivery, gastrointestinal microbiota, and their influence on asthma and atopy. J Allergy Clin Immunol. 97. Noverr, M.C. and G.B. Huffnagle, Does the microbiota regulate immune responses outside the gut? Trends Microbiol, 2004. 12(12): p. 562-8. 98. Penders, J., et al., Gut microbiota composition and development of atopic manifestations in infancy: the KOALA Birth Cohort Study. Gut, 2007. 56(5): p. 661-7. 99. Blaser, M.J. and S. Falkow, What are the consequences of the disappearing human microbiota? Nat Rev Microbiol, 2009. 7(12): p. 887-94. 100. Cho, I. and M.J. Blaser, The human microbiome: at the interface of health and disease. Nat Rev Genet. 13(4): p. 260-70. 101. Strachan, D.P., Family size, infection and atopy: the first decade of the "hygiene hypothesis". Thorax, 2000. 55 Suppl 1: p. S2-10. 102. Jordani, F.A.S.a.L., Delayed and Immediate reactions to bacterial nucleoproteins in asthma, hay fever, and in a group of miscellaneous diseases. Journal of Immunology, 1936. 31: p. 477-481. 103. Wills-Karp, M., J. Santeliz, and C.L. Karp, The germless theory of allergic disease: revisiting the hygiene hypothesis. Nat Rev Immunol, 2001. 1(1): p. 69-75. 104. Guarner, F., et al., Mechanisms of disease: the hygiene hypothesis revisited. Nat Clin Pract Gastroenterol Hepatol, 2006. 3(5): p. 275-84. 105. Viswanathan, R.K. and W.W. Busse, Allergen immunotherapy in allergic respiratory diseases: from mechanisms to meta-analyses. Chest. 141(5): p. 1303-14. 106. Moingeon, P. and L. Mascarell, Induction of tolerance via the sublingual route: mechanisms and applications. Clin Dev Immunol. 2012: p. 623474. 107. Umesaki, Y. and H. Setoyama, Structure of the intestinal flora responsible for development of the gut immune system in a rodent model. Microbes Infect, 2000. 2(11): p. 1343-51. 108. Jiang, H.Q., et al., Interactions of commensal gut microbes with subsets of B- and T-cells in the murine host. Vaccine, 2004. 22(7): p. 805-11. 109. Schwarzer, M., et al., Neonatal colonization of mice with Lactobacillus plantarum producing the aeroallergen Bet v 1 biases towards Th1 and T-regulatory responses upon systemic sensitization. Allergy. 66(3): p. 368-75. 110. von Hertzen, L. and T. Haahtela, Disconnection of man and the soil: reason for the asthma and atopy epidemic? J Allergy Clin Immunol, 2006. 117(2): p. 334-44. 111. Baba, N., et al., Selected commensal-related bacteria and Toll-like receptor 3 agonist combinatorial codes synergistically induce interleukin-12 production by dendritic cells to trigger a T helper type 1 polarizing programme. Immunology, 2009. 128(1 Suppl): p. e523-31. 112. Siezen, R.J. and M. Kleerebezem, The human gut microbiome: are we our enterotypes? Microb Biotechnol. 4(5): p. 550-3. 113. Wu, G.D., et al., Linking long-term dietary patterns with gut microbial enterotypes. Science. 334(6052): p. 105-8. 114. Wang, Z., et al., Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease. Nature. 472(7341): p. 57-63. 115. Flint, H.J., et al., Microbial degradation of complex carbohydrates in the gut. Gut Microbes. 3(4): p. 289-306. 116. Giongo, A., et al., Toward defining the autoimmune microbiome for type 1 diabetes. ISME J. 5(1): p. 82-91. 146

117. Pritchard, D.I., et al., Parasitic worm therapy for allergy: is this incongruous or avant-garde medicine? Clin Exp Allergy, 2011. 42(4): p. 505-12. 118. Mommers, M., et al., Timing of infection and development of wheeze, eczema, and atopic sensitization during the first 2 yr of life: the KOALA Birth Cohort Study. Pediatr Allergy Immunol, 2010. 21(6): p. 983-9. 119. Murk, W., K.R. Risnes, and M.B. Bracken, Prenatal or early-life exposure to antibiotics and risk of childhood asthma: a systematic review. Pediatrics. 127(6): p. 1125-38. 120. Risnes, K.R., et al., Antibiotic exposure by 6 months and asthma and allergy at 6 years: Findings in a cohort of 1,401 US children. Am J Epidemiol. 173(3): p. 310-8. 121. Ege, M.J., et al., Exposure to environmental microorganisms and childhood asthma. N Engl J Med. 364(8): p. 701-9. 122. Fallani, M., et al., Intestinal microbiota of 6-week-old infants across Europe: geographic influence beyond delivery mode, breast-feeding, and antibiotics. J Pediatr Gastroenterol Nutr. 51(1): p. 77- 84. 123. Ly, N.P., et al., Gut microbiota, probiotics, and vitamin D: interrelated exposures influencing allergy, asthma, and obesity? J Allergy Clin Immunol. 127(5): p. 1087-94; quiz 1095-6. 124. Giovannini, M., et al., A randomized prospective double blind controlled trial on effects of long- term consumption of fermented milk containing Lactobacillus casei in pre-school children with allergic asthma and/or rhinitis. Pediatr Res, 2007. 62(2): p. 215-20. 125. Lue, K.H., et al., A trial of adding Lactobacillus johnsonii EM1 to levocetirizine for treatment of perennial allergic rhinitis in children aged 7-12 years. Int J Pediatr Otorhinolaryngol. 76(7): p. 994-1001. 126. Ege, M.J., et al., Environmental bacteria and childhood asthma. Allergy. 67(12): p. 1565-71. 127. Kalliomaki, M., et al., Distinct patterns of neonatal gut microflora in infants in whom atopy was and was not developing. J Allergy Clin Immunol, 2001. 107(1): p. 129-34. 128. Ethapa, T., et al., Multiple factors modulate biofilm formation by the anaerobic pathogen Clostridium difficile. J Bacteriol, 2012. 129. Rennie, R.P., Current and future challenges in the development of antimicrobial agents. Handb Exp Pharmacol, 2012(211): p. 45-65. 130. Burr, D.H. and H. Sugiyama, Susceptibility to enteric botulinum colonization of antibiotic-treated adult mice. Infect Immun, 1982. 36(1): p. 103-6. 131. Brand, S., et al., Epigenetic regulation in murine offspring as a novel mechanism for transmaternal asthma protection induced by microbes. J Allergy Clin Immunol, 2011. 128(3): p. 618-625 e7. 132. Azad, M.B. and A.L. Kozyrskyj, Perinatal programming of asthma: the role of gut microbiota. Clin Dev Immunol, 2012. 2012: p. 932072. 133. Li, C.Y., et al., Oral administration of Lactobacillus salivarius inhibits the allergic airway response in mice. Can J Microbiol. 56(5): p. 373-9. 134. Blumer, N., et al., Perinatal maternal application of Lactobacillus rhamnosus GG suppresses allergic airway inflammation in mouse offspring. Clin Exp Allergy, 2007. 37(3): p. 348-57. 135. Feleszko, W., et al., Probiotic-induced suppression of allergic sensitization and airway inflammation is associated with an increase of T regulatory-dependent mechanisms in a murine model of asthma. Clin Exp Allergy, 2007. 37(4): p. 498-505. 136. Forsythe, P., M.D. Inman, and J. Bienenstock, Oral treatment with live Lactobacillus reuteri inhibits the allergic airway response in mice. Am J Respir Crit Care Med, 2007. 175(6): p. 561-9. 137. Atarashi, K., et al., Induction of colonic regulatory T cells by indigenous Clostridium species. Science, 2011. 331(6015): p. 337-41.

147

138. Ivanov, II, et al., Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell, 2009. 139(3): p. 485-98. 139. Kuwahara, T., et al., The Lifestyle of the Segmented Filamentous Bacterium: A Non-Culturable Gut-Associated Immunostimulating Microbe Inferred by Whole-Genome Sequencing. DNA Res, 2011. 140. Yin, Y., et al., Comparative analysis of the distribution of segmented filamentous bacteria in humans, mice and chickens. ISME J, 2012. 141. Colldahl, H., The Intestinal Flora in Patients with Bronchial Asthma and Rheumatoid Arthritis. Acta Allergol, 1965. 20: p. 94-104. 142. Woodcock, A., et al., Clostridium difficile, atopy and wheeze during the first year of life. Pediatr Allergy Immunol, 2002. 13(5): p. 357-60. 143. Klaasen, H.L., et al., Mono-association of mice with non-cultivable, intestinal, segmented, filamentous bacteria. Arch Microbiol, 1991. 156(2): p. 148-51. 144. Klaasen, H.L., et al., Apathogenic, intestinal, segmented, filamentous bacteria stimulate the mucosal immune system of mice. Infect Immun, 1993. 61(1): p. 303-6. 145. Child, M.W., et al., Studies on the effect of system retention time on bacterial populations colonizing a three-stage continuous culture model of the human large gut using FISH techniques. FEMS Microbiol Ecol, 2006. 55(2): p. 299-310. 146. Urdaci, M.C., B. Regnault, and P.A. Grimont, Identification by in situ hybridization of segmented filamentous bacteria in the intestine of diarrheic rainbow trout (Oncorhynchus mykiss). Res Microbiol, 2001. 152(1): p. 67-73. 147. Snel, J., et al., Comparison of 16S rRNA sequences of segmented filamentous bacteria isolated from mice, rats, and chickens and proposal of "Candidatus Arthromitus". Int J Syst Bacteriol, 1995. 45(4): p. 780-2. 148. Thompson, C.L., et al., 'Candidatus Arthromitus' revised: segmented filamentous bacteria in arthropod guts are members of Lachnospiraceae. Environ Microbiol, 2012. 14(6): p. 1454-65. 149. Thompson, C.L., et al., 'Candidatus Arthromitus' revised: segmented filamentous bacteria in arthropod guts are members of Lachnospiraceae. Environ Microbiol. 14(6): p. 1454-65. 150. Davis, C.P. and D.C. Savage, Habitat, succession, attachment, and morphology of segmented, filamentous microbes indigenous to the murine gastrointestinal tract. Infect Immun, 1974. 10(4): p. 948-56. 151. Sczesnak, A., et al., The genome of th17 cell-inducing segmented filamentous bacteria reveals extensive auxotrophy and adaptations to the intestinal environment. Cell Host Microbe. 10(3): p. 260-72. 152. G.W. Tannock a, C.M.C.a.a.D.C.S.b., A method for harvesting non-cultivable filamentous segmented microbes inhabiting the ileum of mice. FEMS Microbiology Ecology, 1987. 45: p. 329-332. 153. Koopman, J.P., et al., The attachment of filamentous segmented micro-organisms to the distal ileum wall of the mouse: a scanning and transmission electron microscopy study. Lab Anim, 1987. 21(1): p. 48-52. 154. Umesaki, Y., et al., Segmented filamentous bacteria are indigenous intestinal bacteria that activate intraepithelial lymphocytes and induce MHC class II molecules and fucosyl asialo GM1 glycolipids on the small intestinal epithelial cells in the ex-germ-free mouse. Microbiol Immunol, 1995. 39(8): p. 555-62. 155. Ohashi, Y., M. Hiraguchi, and K. Ushida, The composition of intestinal bacteria affects the level of luminal IgA. Biosci Biotechnol Biochem, 2006. 70(12): p. 3031-5.

148

156. Chase, D.G. and S.L. Erlandsen, Evidence for a complex life cycle and endospore formation in the attached, filamentous, segmented bacterium from murine ileum. J Bacteriol, 1976. 127(1): p. 572-83. 157. Meyerholz, D.K., T.J. Stabel, and N.F. Cheville, Segmented filamentous bacteria interact with intraepithelial mononuclear cells. Infect Immun, 2002. 70(6): p. 3277-80. 158. Merrell, B.R., et al., Scanning electron microscopy observations of the effects of hyperbaric stress on the populations of segmented filamentous intestinal flora on normal mice. Scan Electron Microsc, 1979(3): p. 28-32. 159. Banwell, J.G., et al., Intestinal microbial flora after feeding phytohemagglutinin lectins (Phaseolus vulgaris) to rats. Appl Environ Microbiol, 1985. 50(1): p. 68-80. 160. Caselli, M., et al., Morphology of segmented filamentous bacteria and their patterns of contact with the follicle-associated epithelium of the mouse terminal ileum: implications for the relationship with the immune system. Gut Microbes, 2010. 1(6): p. 367-72. 161. Suzuki, K., et al., Aberrant expansion of segmented filamentous bacteria in IgA-deficient gut. Proc Natl Acad Sci U S A, 2004. 101(7): p. 1981-6. 162. Jiang, H.Q., N.A. Bos, and J.J. Cebra, Timing, localization, and persistence of colonization by segmented filamentous bacteria in the neonatal mouse gut depend on immune status of mothers and pups. Infect Immun, 2001. 69(6): p. 3611-7. 163. Klaasen, H.L., et al., Influence of a natural-ingredient diet containing Phaseolus vulgaris on the colonization by segmented, filamentous bacteria of the small bowel of mice. Int J Vitam Nutr Res, 1992. 62(4): p. 334-41. 164. Koopman, J.P., et al., The influence of stress and cheese-whey on intestinal parameters in mice. Vet Q, 1989. 11(1): p. 24-9. 165. Cha, H.R., et al., Downregulation of Th17 cells in the small intestine by disruption of gut flora in the absence of retinoic acid. J Immunol, 2012. 184(12): p. 6799-806. 166. Gaboriau-Routhiau, V., et al., The key role of segmented filamentous bacteria in the coordinated maturation of gut helper T cell responses. Immunity, 2009. 31(4): p. 677-89. 167. Umesaki, Y., et al., Differential roles of segmented filamentous bacteria and clostridia in development of the intestinal immune system. Infect Immun, 1999. 67(7): p. 3504-11. 168. Talham, G.L., et al., Segmented filamentous bacteria are potent stimuli of a physiologically normal state of the murine gut mucosal immune system. Infect Immun, 1999. 67(4): p. 1992- 2000. 169. Keilbaugh, S.A., et al., Activation of RegIIIbeta/gamma and interferon gamma expression in the intestinal tract of SCID mice: an innate response to bacterial colonisation of the gut. Gut, 2005. 54(5): p. 623-9. 170. Cebra, J.J., Influences of microbiota on intestinal immune system development. Am J Clin Nutr, 1999. 69(5): p. 1046S-1051S. 171. Ivanov, II, et al., The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell, 2006. 126(6): p. 1121-33. 172. Ivanov, II, et al., Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host Microbe, 2008. 4(4): p. 337-49. 173. Stepankova, R., et al., Segmented filamentous bacteria in a defined bacterial cocktail induce intestinal inflammation in SCID mice reconstituted with CD45RBhigh CD4+ T cells. Inflamm Bowel Dis, 2007. 13(10): p. 1202-11. 174. Wu, H.J., et al., Gut-residing segmented filamentous bacteria drive autoimmune arthritis via T helper 17 cells. Immunity, 2010. 32(6): p. 815-27. 175. Lee, Y.K., et al., Proinflammatory T-cell responses to gut microbiota promote experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A, 2010. 108 Suppl 1: p. 4615-22. 149

176. Kriegel, M.A., et al., Naturally transmitted segmented filamentous bacteria segregate with diabetes protection in nonobese diabetic mice. Proc Natl Acad Sci U S A, 2011. 108(28): p. 11548- 53. 177. Maslowski, K.M. and C.R. Mackay, Diet, gut microbiota and immune responses. Nat Immunol. 12(1): p. 5-9. 178. McLoughlin, R.M. and K.H. Mills, Influence of gastrointestinal commensal bacteria on the immune responses that mediate allergy and asthma. J Allergy Clin Immunol. 127(5): p. 1097-107; quiz 1108-9. 179. Pamp, S.J., et al., Single-cell sequencing provides clues about the host interactions of segmented filamentous bacteria (SFB). Genome Res. 22(6): p. 1107-19. 180. Wakashin, H., et al., IL-23 and Th17 cells enhance Th2-cell-mediated eosinophilic airway inflammation in mice. Am J Respir Crit Care Med, 2008. 178(10): p. 1023-32. 181. Snel, J., et al., Interactions between gut-associated lymphoid tissue and colonization levels of indigenous, segmented, filamentous bacteria in the small intestine of mice. Can J Microbiol, 1998. 44(12): p. 1177-82. 182. Mariat, D., et al., The Firmicutes/Bacteroidetes ratio of the human microbiota changes with age. BMC Microbiol, 2009. 9: p. 123. 183. Blaut, M., et al., Molecular biological methods for studying the gut microbiota: the EU human gut flora project. Br J Nutr, 2002. 87 Suppl 2: p. S203-11. 184. Case, R.J., et al., Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. Appl Environ Microbiol, 2007. 73(1): p. 278-88. 185. Walters, D.M., M. Wills-Karp, and W. Mitzner, Assessment of cellular profile and lung function with repeated bronchoalveolar lavage in individual mice. Physiol Genomics, 2000. 2(1): p. 29-36. 186. Lewkowich, I.P., et al., Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice. PLoS One, 2008. 3(12): p. e3879. 187. Nials, A.T. and S. Uddin, Mouse models of allergic asthma: acute and chronic allergen challenge. Dis Model Mech, 2008. 1(4-5): p. 213-20. 188. de Boer, J.D., et al., Lipopolysaccharide Inhibits Th2 Lung Inflammation Induced by House Dust Mite Allergens in Mice. Am J Respir Cell Mol Biol. 189. van de Pol, M.A., et al., Increase in allergen-specific IgE and ex vivo Th2 responses after a single bronchial challenge with house dust mite in allergic asthmatics. Allergy. 67(1): p. 67-73. 190. Shin, S.H. and M.K. Ye, Th2 responses elicited by nasal epithelial cells exposed to house dust mite extract. Clin Exp Otorhinolaryngol, 2009. 2(4): p. 175-80. 191. Hammad, H., et al., Monocyte-derived dendritic cells induce a house dust mite-specific Th2 allergic inflammation in the lung of humanized SCID mice: involvement of CCR7. J Immunol, 2002. 169(3): p. 1524-34. 192. Nurse, B., et al., PBMCs from both atopic asthmatic and nonatopic children show a TH2 cytokine response to house dust mite allergen. J Allergy Clin Immunol, 2000. 106(1 Pt 1): p. 84-91. 193. Yu, C.K., et al., Attenuation of house dust mite Dermatophagoides farinae-induced airway allergic responses in mice by dehydroepiandrosterone is correlated with down-regulation of TH2 response. Clin Exp Allergy, 1999. 29(3): p. 414-22. 194. Neumann, C., et al., Comparative analysis of the frequency of house dust mite specific and nonspecific Th1 and Th2 cells in skin lesions and peripheral blood of patients with atopic dermatitis. J Mol Med (Berl), 1996. 74(7): p. 401-6. 195. Krutzik, P.O., et al., Analysis of protein phosphorylation and cellular signaling events by flow cytometry: techniques and clinical applications. Clin Immunol, 2004. 110(3): p. 206-21.

150

196. Maslowski, K.M. and C.R. Mackay, Diet, gut microbiota and immune responses. Nat Immunol, 2010. 12(1): p. 5-9. 197. Wu, Q. and H.W. Chu, Role of infections in the induction and development of asthma: genetic and inflammatory drivers. Expert Rev Clin Immunol, 2009. 5(1): p. 97-109. 198. Hart, A.L., et al., The role of the gut flora in health and disease, and its modification as therapy. Aliment Pharmacol Ther, 2002. 16(8): p. 1383-93. 199. Fallani, M., et al., Intestinal microbiota of 6-week-old infants across Europe: geographic influence beyond delivery mode, breast-feeding, and antibiotics. J Pediatr Gastroenterol Nutr, 2010. 51(1): p. 77-84. 200. Hilty, M., et al., Disordered microbial communities in asthmatic airways. PLoS One, 2010. 5(1): p. e8578. 201. Bezirtzoglou, E., A. Tsiotsias, and G.W. Welling, Microbiota profile in feces of breast- and formula-fed newborns by using fluorescence in situ hybridization (FISH). Anaerobe. 202. Hufeldt, M.R., et al., Variation in the gut microbiota of laboratory mice is related to both genetic and environmental factors. Comp Med. 60(5): p. 336-47. 203. Ozseker, F., et al., Serum amyloid A (SAA) in induced sputum of asthmatics: a new look to an old marker. Int Immunopharmacol, 2006. 6(10): p. 1569-76. 204. Ather, J.L., et al., Serum amyloid A activates the NLRP3 inflammasome and promotes Th17 allergic asthma in mice. J Immunol, 2011. 187(1): p. 64-73. 205. Ozdemir, O., Various effects of different probiotic strains in allergic disorders: an update from laboratory and clinical data. Clin Exp Immunol, 2010. 160(3): p. 295-304. 206. Whittaker, L., et al., Interleukin-13 mediates a fundamental pathway for airway epithelial mucus induced by CD4 T cells and interleukin-9. Am J Respir Cell Mol Biol, 2002. 27(5): p. 593-602. 207. Grund, L.Z., et al., IL-5 and IL-17A are critical for the chronic IgE response and differentiation of long-lived antibody-secreting cells in inflamed tissues. Cytokine. 59(2): p. 335-51. 208. Murdock, B.J., et al., Interleukin-17 drives pulmonary eosinophilia following repeated exposure to Aspergillus fumigatus conidia. Infect Immun. 80(4): p. 1424-36. 209. Guan, Q., et al., Targeting IL-23 by employing a p40 peptide-based vaccine ameliorates murine allergic skin and airway inflammation. Clin Exp Allergy, 2012. 42(9): p. 1397-405. 210. Heczko, U., A. Abe, and B.B. Finlay, Segmented filamentous bacteria prevent colonization of enteropathogenic Escherichia coli O103 in rabbits. J Infect Dis, 2000. 181(3): p. 1027-33. 211. Murosaki, S., et al., Heat-killed Lactobacillus plantarum L-137 suppresses naturally fed antigen- specific IgE production by stimulation of IL-12 production in mice. J Allergy Clin Immunol, 1998. 102(1): p. 57-64. 212. Repa, A., et al., Mucosal co-application of lactic acid bacteria and allergen induces counter- regulatory immune responses in a murine model of birch pollen allergy. Vaccine, 2003. 22(1): p. 87-95. 213. Schulz, K.R., et al., Single-cell phospho-protein analysis by flow cytometry. Curr Protoc Immunol, 2007. Chapter 8: p. Unit 8 17. 214. Kim, J.H., P.E. Ellwood, and M.I. Asher, Diet and asthma: looking back, moving forward. Respir Res, 2009. 10: p. 49. 215. Flint, H.J., The impact of nutrition on the human microbiome. Nutr Rev. 70 Suppl 1: p. S10-3. 216. Jacobs, D.M., et al., (1)H NMR metabolite profiling of feces as a tool to assess the impact of nutrition on the human microbiome. NMR Biomed, 2008. 21(6): p. 615-26. 217. Cha, H.R., et al., Downregulation of Th17 cells in the small intestine by disruption of gut flora in the absence of retinoic acid. J Immunol, 2010. 184(12): p. 6799-806. 218. Wang, C., et al., Retinoic acid determines the precise tissue tropism of inflammatory Th17 cells in the intestine. J Immunol, 2010. 184(10): p. 5519-26. 151

219. Council., N.R., Nutrient requirements of laboratory animals (4th revised ed.). National Academy Press,, 1995. 220. Ellwood, P., et al., Do fast foods cause asthma, rhinoconjunctivitis and eczema? Global findings from the International Study of Asthma and Allergies in Childhood (ISAAC) Phase Three. Thorax. 221. Toward, R., et al., Effect of prebiotics on the human gut microbiota of elderly persons. Gut Microbes. 3(1): p. 57-60. 222. Sahasakul, Y., N. Takemura, and K. Sonoyama, Different impacts of purified and nonpurified diets on microbiota and toll-like receptors in the mouse stomach. Biosci Biotechnol Biochem. 76(9): p. 1728-32. 223. McGeachy, M.J., et al., The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17-producing effector T helper cells in vivo. Nat Immunol, 2009. 10(3): p. 314-24. 224. Rodriguez-Juan, C., et al., Lens culinaris, Phaseolus vulgaris and vicia faba lectins specifically trigger IL-8 production by the human colon carcinoma cell line CACO-2. Cytokine, 2000. 12(8): p. 1284-7. 225. Timoshenko, A.V. and S.N. Cherenkevich, [H2O2 generation and human neutrophil aggregation as affected by lectins]. Gematol Transfuziol, 1995. 40(4): p. 32-5. 226. Kariyawasam, H.H., et al., Remodeling and airway hyperresponsiveness but not cellular inflammation persist after allergen challenge in asthma. Am J Respir Crit Care Med, 2007. 175(9): p. 896-904. 227. Southam, D.S., et al., Components of airway hyperresponsiveness and their associations with inflammation and remodeling in mice. J Allergy Clin Immunol, 2007. 119(4): p. 848-54. 228. Kurita-Ochiai, T., K. Fukushima, and K. Ochiai, Volatile fatty acids, metabolic by-products of periodontopathic bacteria, inhibit lymphocyte proliferation and cytokine production. J Dent Res, 1995. 74(7): p. 1367-73. 229. Nanau, R.M. and M.G. Neuman, Metabolome and inflammasome in inflammatory bowel disease. Transl Res. 160(1): p. 1-28. 230. Maslowski, K.M., et al., Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43. Nature, 2009. 461(7268): p. 1282-6. 231. Wright, G.D., The origins of antibiotic resistance. Handb Exp Pharmacol, (211): p. 13-30. 232. Silva Junior, M., Recent changes in Clostridium difficile infection. Einstein (Sao Paulo). 10(1): p. 105-9. 233. Croswell, A., et al., Prolonged impact of antibiotics on intestinal microbial ecology and susceptibility to enteric Salmonella infection. Infect Immun, 2009. 77(7): p. 2741-53. 234. Ubeda, C., et al., Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. J Clin Invest. 120(12): p. 4332-41. 235. Tilles, S.A. and C.G. Slatore, Hypersensitivity reactions to non-beta-lactam antibiotics. Clin Rev Allergy Immunol, 2003. 24(3): p. 221-8. 236. Choi, G.S., et al., A case of occupational asthma caused by inhalation of vancomycin powder. Allergy, 2009. 64(9): p. 1391-2. 237. Russell, S.L., et al., Early life antibiotic-driven changes in microbiota enhance susceptibility to allergic asthma. EMBO Rep. 13(5): p. 440-7. 238. Geller, B.L., et al., Inhibition of gene expression in Escherichia coli by antisense phosphorodiamidate morpholino oligomers. Antimicrob Agents Chemother, 2003. 47(10): p. 3233-9. 239. Summerton, J. and D. Weller, Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev, 1997. 7(3): p. 187-95.

152

240. Summerton, J.E., Morpholino, siRNA, and S-DNA compared: impact of structure and mechanism of action on off-target effects and sequence specificity. Curr Top Med Chem, 2007. 7(7): p. 651- 60. 241. Hosseini, A., et al., Efficacy of a phosphorodiamidate morpholino oligomer antisense compound in the inhibition of corneal transplant rejection in a rat cornea transplant model. J Ocul Pharmacol Ther. 28(2): p. 194-201. 242. Mitev, G.M., et al., Inhibition of intracellular growth of Salmonella enterica serovar Typhimurium in tissue culture by antisense peptide-phosphorodiamidate morpholino oligomer. Antimicrob Agents Chemother, 2009. 53(9): p. 3700-4. 243. Tilley, L.D., et al., Antisense peptide-phosphorodiamidate morpholino oligomer conjugate: dose- response in mice infected with Escherichia coli. J Antimicrob Chemother, 2007. 59(1): p. 66-73. 244. Tilley, L.D., et al., Gene-specific effects of antisense phosphorodiamidate morpholino oligomer- peptide conjugates on Escherichia coli and Salmonella enterica serovar typhimurium in pure culture and in tissue culture. Antimicrob Agents Chemother, 2006. 50(8): p. 2789-96. 245. Geller, B.L., et al., Antisense phosphorodiamidate morpholino oligomer inhibits viability of Escherichia coli in pure culture and in mouse peritonitis. J Antimicrob Chemother, 2005. 55(6): p. 983-8. 246. Deere, J., P. Iversen, and B.L. Geller, Antisense phosphorodiamidate morpholino oligomer length and target position effects on gene-specific inhibition in Escherichia coli. Antimicrob Agents Chemother, 2005. 49(1): p. 249-55. 247. Mellbye, B.L., et al., Cationic phosphorodiamidate morpholino oligomers efficiently prevent growth of Escherichia coli in vitro and in vivo. J Antimicrob Chemother. 65(1): p. 98-106. 248. Chakir, J., et al., Airway remodeling-associated mediators in moderate to severe asthma: effect of steroids on TGF-beta, IL-11, IL-17, and type I and type III collagen expression. J Allergy Clin Immunol, 2003. 111(6): p. 1293-8. 249. Kisilevsky, R. and S.P. Tam, Acute phase serum amyloid A, cholesterol metabolism, and cardiovascular disease. Pediatr Pathol Mol Med, 2002. 21(3): p. 291-305. 250. Sander, L.E., et al., Hepatic acute-phase proteins control innate immune responses during infection by promoting myeloid-derived suppressor cell function. J Exp Med. 207(7): p. 1453-64. 251. He, R., et al., Serum amyloid A is an endogenous ligand that differentially induces IL-12 and IL-23. J Immunol, 2006. 177(6): p. 4072-9. 252. Ohnmacht, C., et al., Intestinal microbiota, evolution of the immune system and the bad reputation of pro-inflammatory immunity. Cell Microbiol. 13(5): p. 653-9. 253. Herold, M.J., K.G. McPherson, and H.M. Reichardt, Glucocorticoids in T cell apoptosis and function. Cell Mol Life Sci, 2006. 63(1): p. 60-72. 254. Tischner, D., et al., Acid sphingomyelinase is required for protection of effector memory T cells against glucocorticoid-induced cell death. J Immunol. 187(9): p. 4509-16. 255. Cifone, M.G., et al., Dexamethasone-induced thymocyte apoptosis: apoptotic signal involves the sequential activation of phosphoinositide-specific phospholipase C, acidic sphingomyelinase, and caspases. Blood, 1999. 93(7): p. 2282-96. 256. Liao, J.J., M.C. Huang, and E.J. Goetzl, Cutting edge: Alternative signaling of Th17 cell development by sphingosine 1-phosphate. J Immunol, 2007. 178(9): p. 5425-8. 257. Otterbach, B. and W. Stoffel, Acid sphingomyelinase-deficient mice mimic the neurovisceral form of human lysosomal storage disease (Niemann-Pick disease). Cell, 1995. 81(7): p. 1053-61. 258. Berce, V., C.E. Kozmus, and U. Potocnik, Association among ORMDL3 gene expression, 17q21 polymorphism and response to treatment with inhaled corticosteroids in children with asthma. Pharmacogenomics J, 2012.

153

259. Jin, R., et al., Characterization of a novel isoform of the human ORMDL3 gene. Cell Tissue Res. 346(2): p. 203-8. 260. Kavalar, M.S., et al., Association of ORMDL3, STAT6 and TBXA2R gene polymorphisms with asthma. Int J Immunogenet. 39(1): p. 20-5. 261. Lluis, A., et al., Asthma-associated polymorphisms in 17q21 influence cord blood ORMDL3 and GSDMA gene expression and IL-17 secretion. J Allergy Clin Immunol. 127(6): p. 1587-94 e6. 262. Miller, M., et al., ORMDL3 is an inducible lung epithelial gene regulating metalloproteases, chemokines, OAS, and ATF6. Proc Natl Acad Sci U S A. 109(41): p. 16648-53. 263. Galanter, J., et al., ORMDL3 gene is associated with asthma in three ethnically diverse populations. Am J Respir Crit Care Med, 2008. 177(11): p. 1194-200. 264. Han, S., et al., Orm1 and Orm2 are conserved endoplasmic reticulum membrane proteins regulating lipid homeostasis and protein quality control. Proc Natl Acad Sci U S A. 107(13): p. 5851-6. 265. Stumm, C.L., et al., Airway remodeling in murine asthma correlates with a defect in PGE2 synthesis by lung fibroblasts. Am J Physiol Lung Cell Mol Physiol. 301(5): p. L636-44. 266. Ather, J.L., et al., Serum amyloid A activates the NLRP3 inflammasome and promotes Th17 allergic asthma in mice. J Immunol. 187(1): p. 64-73. 267. Elimova, E., et al., Amyloidogenesis recapitulated in cell culture: a peptide inhibitor provides direct evidence for the role of heparan sulfate and suggests a new treatment strategy. FASEB J, 2004. 18(14): p. 1749-51. 268. North, M.L. and A.K. Ellis, The role of epigenetics in the developmental origins of allergic disease. Ann Allergy Asthma Immunol. 106(5): p. 355-61; quiz 362. 269. Mukasa, R., et al., Epigenetic instability of cytokine and transcription factor gene loci underlies plasticity of the T helper 17 cell lineage. Immunity. 32(5): p. 616-27. 270. Akimzhanov, A.M., X.O. Yang, and C. Dong, Chromatin remodeling of interleukin-17 (IL-17)-IL-17F cytokine gene locus during inflammatory helper T cell differentiation. J Biol Chem, 2007. 282(9): p. 5969-72. 271. Ghadimi, D., et al., Epigenetic imprinting by commensal probiotics inhibits the IL-23/IL-17 axis in an in vitro model of the intestinal mucosal immune system. J Leukoc Biol. 92(4): p. 895-911. 272. Hew, M., et al., Relative corticosteroid insensitivity of peripheral blood mononuclear cells in severe asthma. Am J Respir Crit Care Med, 2006. 174(2): p. 134-41. 273. Bosisio, D., et al., Blocking TH17-polarizing cytokines by histone deacetylase inhibitors in vitro and in vivo. J Leukoc Biol, 2008. 84(6): p. 1540-8. 274. Kraus, W.L., Transcriptional control by PARP-1: chromatin modulation, enhancer-binding, coregulation, and insulation. Curr Opin Cell Biol, 2008. 20(3): p. 294-302. 275. Martinez-Zamudio, R. and H.C. Ha, Histone ADP-ribosylation facilitates gene transcription by directly remodeling nucleosomes. Mol Cell Biol. 32(13): p. 2490-502. 276. Datta, S.K., et al., Mucosal adjuvant activity of cholera toxin requires Th17 cells and protects against inhalation anthrax. Proc Natl Acad Sci U S A. 107(23): p. 10638-43. 277. Toller, I.M., et al., Inhibition of ADP ribosylation prevents and cures helicobacter-induced gastric preneoplasia. Cancer Res. 70(14): p. 5912-22. 278. Calder, P.C., et al., Inflammatory disease processes and interactions with nutrition. Br J Nutr, 2009. 101 Suppl 1: p. S1-45. 279. Torres-Borrego, J., G. Moreno-Solis, and A.B. Molina-Teran, Diet for the prevention of asthma and allergies in early childhood: much ado about something? Allergol Immunopathol (Madr). 40(4): p. 244-52. 280. Allan, K. and G. Devereux, Diet and asthma: nutrition implications from prevention to treatment. J Am Diet Assoc. 111(2): p. 258-68. 154

281. Jenq, R.R., et al., Regulation of intestinal inflammation by microbiota following allogeneic bone marrow transplantation. J Exp Med. 209(5): p. 903-11. 282. Flint, H.J., P.W. O'Toole, and A.W. Walker, Special issue: The Human Intestinal Microbiota. Microbiology. 156(Pt 11): p. 3203-4. 283. Van den Abbeele, P., et al., Microbial community development in a dynamic gut model is reproducible, colon region specific, and selective for Bacteroidetes and Clostridium cluster IX. Appl Environ Microbiol. 76(15): p. 5237-46. 284. Fernando Baquero, T.M.C., Rafael Cantón, Antibiotic usage increases disorder at different biological levels, promoting the emergence of alternative orders in the microbiosphere in Microbe Magazine. 2003, American Society for Microbiology. 285. Fuentes, S., et al., A strain of Lactobacillus plantarum affects segmented filamentous bacteria in the intestine of immunosuppressed mice. FEMS Microbiol Ecol, 2008. 63(1): p. 65-72. 286. Rigaux, P., et al., Immunomodulatory properties of Lactobacillus plantarum and its use as a recombinant vaccine against mite allergy. Allergy, 2009. 64(3): p. 406-14. 287. Snel, J., et al., Strain-specific immunomodulatory effects of Lactobacillus plantarum strains on birch-pollen-allergic subjects out of season. Clin Exp Allergy. 41(2): p. 232-42. 288. Daniel, C., et al., Modulation of allergic immune responses by mucosal application of recombinant lactic acid bacteria producing the major birch pollen allergen Bet v 1. Allergy, 2006. 61(7): p. 812-9. 289. Kruisselbrink, A., et al., Recombinant Lactobacillus plantarum inhibits house dust mite-specific T- cell responses. Clin Exp Immunol, 2001. 126(1): p. 2-8. 290. Knox, K.W. and A.J. Wicken, Serological studies on the teichoic acids of Lactobacillus plantarum. Infect Immun, 1972. 6(1): p. 43-9.

155