Mitochondrial DNA Diversity in Francolinus Pondicerianus Interpositus (Grey Francolin, Galliformes) from Pakistan IMRAN KHALIQ1,2 , M

Hereditas 148: 70–76 (2011)

Mitochondrial DNA diversity in Francolinus pondicerianus interpositus (grey francolin, Galliformes) from Pakistan IMRAN KHALIQ1,2 , M. TERESA TEJEDOR3 , LUIS V. MONTEAGUDO3 , MARIA RIAZ2 and ALEEM A. KHAN2 1 Department of Biological Sciences, Government College Dera Ghazi Khan, Pakistan 2 Institute of Pure and Applied Biology, Bahaudin Zakariya University, Multan, Pakistan 3 Department of Anatomy, Embryology and Genetics, Faculty of Veterinary Sciences, Universidad de Zaragoza, Zaragoza, Spain

Khaliq, I., Tejedor, M. T., Monteagudo, L. V., Riaz, M. and Khan, A. A. 2011. Mitochondrial DNA diversity in Francolinus pondicerianus interpositus (grey francolin, Galliformes) from Pakistan. – Hereditas 148 : 70–76. Lund, Sweden. eISSN 1601-5223. Received 22 November 2010. Accepted 15 March 2011.

Francolinus pondicerianus interpositus (grey francolin, Galliformes) is the only francolin present in the Suleiman Range (central Pakistan), one of the poorest and least developed areas in Pakistan. As a game bird, the francolin is an important income source for the region, but no demographic data are available. Therefore, the aim of this work was to study the polymorphism pattern of the Control Region gene (mitochondrial DNA, mtDNA), in order to obtain some initial information about genetic diversity, possible structure and demographic dynamics in this population. In 29 individuals captured in four sampling areas in the western and the eastern Suleiman Range, we detected nine polymorphic sites in a 511 bp fragment of the mtDNA Control Region gene, resulting in seven haplotypes. Haplotype (h ϭ 0.818 Ϯ 0.032) and nucleotide diversity (π  % ϭ 0.308 Ϯ 0.210) values suggested a large popula- Φ ϭ ϭ tion size and a low divergence among the haplotypes. AMOVA ( ST 0.005; P 0.352) did not detect any signiﬁ cant differences among the western and eastern populations; therefore, specimens of both sampled areas could be considered as drawn from a single population. The observed distribution of pairwise mismatches was bimodal, revealing signiﬁ cant departure from a growing–decreasing population model (P ϭ 0.030); these results would point to a demographic equilibrium. Tribal control of hunting might provide an explanation for this situation, but future overhunting would threaten the survival of this population.

Luis V. Monteagudo, Department of Anatomy, Embryology and Genetics, Faculty of Veterinary Sciences, Universidad de Zaragoza, Miguel Servet 177, ES-50013 Zaragoza, Spain . E-mail: [email protected]

Francolinus pondicerianus (Gmelin 1789) (Galliformes) (D EL HOYO et al. 1994), although the global population is one of the most common game birds in the Indostan size is unknown. Asian area. Its distribution range spreads along a large Only the subspecies F. p. interpositus occurs in the proportion of Pakistan: the lower hills of Makran and Suleiman Range ( ALI and RIPLEY 1983; ROBERTS 1992). Lasbela, Sindh, and the Punjab including the Salt Range, The Suleiman Range (central Pakistan) lies between a large proportion of the Thar Desert and the Suleiman 28 ° 05′ N to 31 ° 80′ N and between 67° 20 ′ to 71 ° 55′ E Range ( ALI and RIPLEY 1983; ROBERTS 1992). (Fig. 1). The average elevation is about 1500 m, even Three F. pondicerianus subspecies are recognised though the hills in the extreme north reach 3441 m. The ( CLEMENTS et al. 2007). Francolinus p. pondicerianus lives climate of the region is exceedingly dry in these hills in in southern India and SriLanka and is characterized by summer as well as in winter. This ecoregion is made up of showing the centre of throat ochraceous. Francolinus. p. gravel and scree slopes with widely scattered isolated tufts interpositus is found in northwestern India and Pakistan of bunch grasses, thorny hassock-shaped clumps of plants and it shows paler colours, with the centre of throat such as Onobrychis and Acantholimon spp. Forest cover is creamy-white. Francolinus. p. mecranensis lives in arid sparse and highly concentrated in gullies. As it refers to southeastern Iran and south Pakistan; its plumage is the biodiversity features, it is predominantly Palearctic in origin palest, generally greyer and less chestnut than the other but does contain some Indo-Malay afﬁ nities (WWF 2008). subspecies. This subspecies mostly occurs along permanent water According to ROBERTS (1992), populations of F. pondic- sources during late summer and fall (R OBERTS 1992). It erianus are on the verge of decline in Asia because of the roosts at night and rests during the day, primarily on the loss of food, excessive predation, hunting and habitat ground in dense cover (tamarisk thickets, reeds grass clumps destruction and extended use of guns for hunting. How- and cultivated crops) and it lives singly or in scattered pairs ever, F. pondicerianus is common in most parts of its range and parties of 3-5 individuals ( MAHMOOD et al. 2010).

The aim of this study is to describe the polymorphism pattern of the CR in F. pondicerianus interpositus for the ﬁ rst time, in order to get some initial information about genetic diversity, possible structure and demographic dynamics for the Suleiman Range population. The data obtained could be the basis for further decisions about management and protection of this population.

MATERIAL AND METHODS

Biological sampling Fig. 1. The Sulaiman Range (SR) position in Pakistan. Samples were collected in the four areas indicated. Feathers were obtained post-mortem from twenty nine Francolinus pondicerianus interpositus individuals shot The Suleiman Range is a Provincially Administered Tribal by hunters at four different locations in the Suleiman Area (PATA), i.e. under the control of different Balouch Range: Khalchas (69 ° 33 ’ N, 29 ° 23 ’ E; n ϭ 12), Higlon tribes. The whole area is one of the poorest and least devel- (70 ° 01 ’ N, 30 ° 30 ’ E; n ϭ 4), Berg (69 ° 80 ’ N, 30 ° 25 ’ E; oped in Pakistan. The main source of income in the area is n ϭ 11) and Bait Suwai (30 ° 45 ’ N, 70 ° 50 ’ E; n ϭ 2) in either through rearing goats or through cultivation depend- the 2008 winter hunting season (Fig. 1). We grouped ing upon the seasonal rainfall. However, due to the lack of these locations, located in both sides of the Suleiman income and due to the increasing population in some areas Range, as western side (Kalchas) and eastern side (Berg, of Suleiman Range, people have started exploiting the for- Hinglon and Bait Suwai) populations. merly undisturbed wildlife of the area. A single grey franco- We clipped eight to ten feathers from each bird by lin can be sold for 5 – 10 US dollars in the market. Therefore, means of canine nail clippers. As the birds are dead when hunting is becoming a very attractive and easy option for the feathers are collected, we can take a number of feathers locals. In recent years this trend has increased (K HALIQ suitable to carry out several analyses in both Pakistan and unpubl.), but the possible impacts on population genetics Spain. We cleaned the birds ’ skin with 10% Povidone- and demography have not yet been evaluated. iodine surgical scrubs before clipping for preventing even- In some parts of Pakistan, only a small amount of popu- tual contamination. We air dried feather snips prior to lation data is available about F. pondicerianus . MAHMOOD placing them in individual sterile marked plastic bags. All et al. (2010) estimated an averaged population density of the work with the birds complied with all Spanish and 0.47 Ϯ 0.09 individuals ha Ϫ1 and a total size of 3327 birds Pakistani laws. in the Lehri Nature Park (Punjab, Pakistan), but no information is available about the Suleiman Range. DNA extraction Mitochondrial DNA (mtDNA) is relatively easy, rapid For each individual, we cut off 2 mm fragments from the and inexpensive to sequence and research on rapidly proximal tip of two feathers. The fragments were immersed evolving loci provides suffi cient variation to draw infer- in 200 μ l of a 5% Chelex 100 resin solution in pH 8 TE ences on the structure of populations ( BROWN et al. 1982, buffer (10 mM TrisHCl, 0.1 mM EDTA) containing C LAYTON 1984, SACCONE et al. 1991). The Control Region Proteinase K (1.2 mg ml–1 ) and 2% sodium dodecyl gene (CR, also called hypervariable region or D-loop) sulfate. After overnight incubation at 55 ° C, samples were often evolves faster than the rest of the mtDNA (B AKER vortexed and incubated for 10 min at 100° C. They were and MARSHALL 1997) and it appears to be highly variable vortexed again and incubated for 15 min at the same in birds (W ENINK et al. 1994). In birds, several studies temperature before centrifugation at 11 000 g for three showed that the CR is not the fastest evolving locus in min. The supernatant was transferred to a fresh tube and mtDNA and that this trend is genus specifi c ( ZINK and conserved at – 20 ° C. This supernatant was included at B LACKWELL 1998; ZINK et al. 1998; LEE et al. 2001; 35 v/v % (volume/volume percentage) in the fi nal PCR R UOKONEN and KVIST 2002); several mtDNA coding loci, reaction mix. Neither RNAse treatment nor DNA precipi- such as cytochrome b and ND2 (mitochondrially encoded tation are necessary. NADH dehydrogenase 2) evolve as fast as the CR. How- ever, analysis of polymorphism in the CR has proved to be Polymerase chain reaction and sequencing useful in preliminary studies on genetic variation and structure and phylogeography in birds ( MERIL Ä et al. 1997; We designed polymerase chain reaction (PCR) primers G ODOY et al. 2004; ROQUES et al. 2004; CADAH Í A et al. (MITOCF 5′ - GGCTTGAAAAGCCATTGTTG -3′ and 2007; KIRCHMAN and FRANKLIN 2007). MITOCR 5′ - CCCCAAAGAGAAAAGGAACC -3′ ) 72 I. Khaliq et al. Hereditas 148 (2011) by using the Primer-BLAST tool (Ͻ http://www.ncbi. (L IBRADO and ROZAS 2009). ARLEQUIN tests the good- nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC ϭ ness-of-fi t to this model by the SSD test statistic (the sum BlastHome Ͼ , accessed 7 March 2011). Even if the of squared differences between the observed and the esti- sequence of these primers is specifi cally based up on mated mismatch distributions; R OGERS and H ARPENDING the GenBank Francolinus pintadeanus mitochondrion 1992). DnaSPv5 calculates Tajima’s D (T AJIMA 1989), sequence NC011817 ( SHEN et al. 2009), their map position Fu’ s Fs ( FU 1997) and R 2 ( RAMOS-ONSINS and ROZAS on the mitochondrion is coincident with the positions 16 2002) statistics and estimates their signifi cance using a 739 to 16 758 (forward) and 668 to 649 (reverse) in the coalescent simulation algorithm (H UDSON 1990). We used numbering of the original D ESJARDINS and M ORAIS (1990) 1000 replicates in these coalescent simulations. chicken sequence (GenBank accession X52392.1). There- fore, the PCR is designed to amplify a fragment including the fi rst half of the CR, according to DESJARDINS RESULTS and M ORAIS (1990). The PCR conditions were: 95° C for For the fi rst time in this species, we obtained a partial 4 min followed by 36 cycles of 95 ° C for 40 s, 60 ° C for 511 bp mitochondrial CR sequence from a sample of 40 s, and 72 ° C for 1 min, with a fi nal extension at 72 ° C 29 Francolinus pondicerianus interpositus individuals for 10 min. The fi nal MgCl concentration was 3 mM 2 captured in Pakistan. These fi rst sequences from and the primer concentration was 0.25 μM of each. The F. pondicerianus interpositus were deposited in Genbank PCR was carried out in a Multigene thermal cycler (Genbank accession no. GU213075 to GU213103). (Labnet International, Woodbridge New Jersey, USA). The sequences obtained align with the fi rst half of The ECOTAQ/BIOTAQ Premium Taq polymerase the GenBank Francolinus pintadeanus mitochondrial (Bioline, London, UK) was used in the amplifi cations sequence NC011817 (S HEN et al. 2009), even if fi ve single (0.3 units/10 μl of fi nal volume reaction), following the nucleotide insertion/deletion events makes the sequence of manufacturer’ s instructions and using the amplifi cation this species 3 bp longer than that from F. p. interpositus . buffer supplied with the Polymerase. The quality of the chromatograms is good, lacking double The Central DNA sequencing service (Univ. de peaks; this fact, together with the correct alignment of the Zaragoza, Spain) performed DNA sequencing by means sequences with the ones available for a closely related of a MegaBACE 500 automatic sequencer (Amersham species in GenBank, led us to consider the amplifi cation Biosciences). of possible nuclear copies of mitochondrial genes as a very unlikely event. Sequences analysis Among the 29 individuals studied, we identifi ed seven

The sequences were aligned using BioEdit (H ALL 2004) unique haplotypes (HA – HG ), deﬁ ned by nine polymorphic and compared with published sequences retrieved from sites (seven transitions and two transversions), as showed the GenBank International Nucleotide Sequence Data- in Table 1. We did not ﬁ nd either insertions or deletions. base. We used ARLEQUIN Ver 3.1 (E XCOFFIER et al. 2005) Table 1 also shows state frequencies and expected diver- to estimate the number of polymorphic sites with state fre- sity for these polymorphic sites. Five polymorphic sites quencies and expected diversity, the haplotype diversity (124, 166, 226, 246 and 377) were found only in the

(h), the mean number of pairwise differences (k) at haplotype H G. We only found the substitution at the site π haplotype level, the nucleotide diversity ( , % ) and the 177 in the haplotype HC . The highest diversity values haplotype frequencies. ARLEQUIN was also applied to corresponded to the sites 231 and 364. The relative pro- carry out a hierarchical analysis of molecular variance portion of segregating sites was 0.018. (AMOVA), in order to analyze the partitioning of genetic The frequencies of the observed haplotypes in the west- diversity within and between western and eastern side ern, eastern and Global populations are shown in Table 2. populations (E XCOFFIER et al. 1992). We quantiﬁ ed the The most common haplotypes were HA and HF in the west- genetic differentiation between both populations by means ern population and HB in the eastern one. Haplotypes HE Φ of ST, analogous to Wright’s F-statistics (W RIGHT 1951), and HG only occurred in two individuals from the west- based on haplotype frequency and nucleotide sequence ern population; together they account for the 16.67% of variations. We used 1000 permutations for determining total haplotypes in this sample. Only one bird from the Φ the statistical signiﬁ cance of ST. eastern population carried the haplotype HC (5.88% of For demographic analysis, we computed the distribu- total haplotypes in this sample). tion of the observed pairwise nucleotide differences We calculated several diversity indices for the western, (mismatch distribution) and the expected values for no eastern and Global populations (Table 3). Populations recombination in growing-declining populations ( ROGERS from both sides of the Suleiman Range were characterized and H ARPENDING 1992), using ARLEQUIN and DnaSPv5 by high values of haplotype diversity (h) and low values of Hereditas 148 (2011) Mitochondrial DNA diversity in the grey francolin 73

Table 1. Haplotype description, state frequencies and expected diversity for the nine polymorphic sites found .

Position (in bp)

Haplotype 102 124 166 177 226 231 246 364 377

HA GCTCAGCAC

HB .....A.C.

HC ...T...C.

HD ...... C.

HE A...... C.

HF .....A...

HG ATC . GAA . T State frequencies G:0.931 C:0.965 T:0.965 C:0.965 A:0.965 G:0.517 C:0.965 A:0.448 C:0.965 A:0.069 T:0.035 C:0.035 T:0.035 G:0.034 A:0.483 A:0.035 C:0.552 T:0.035 Exp. diversity 0.133 0.069 0.069 0.069 0.069 0.517 0.069 0.512 0.069

A: adenine; G: guanine; C: cytosine and T: thymine. nucleotide diversity (π , % ). The western population the control of tribes. To get easy excess in tribal areas showed the greatest diversity indices. is not possible as tribesman normally do not allow out- Considering the western and eastern populations, siders to enter their territory due to tribal disputes. the results from the hierarchical AMOVA (Table 4) This species is normally found scattered throughout the revealed that the 99.48% of the CR variation was distrib- Sulaiman Range in suitable habitats and can easily be seen uted within populations and the 0.52% between them. near cultivated land. The total lack of census makes it Φ The value of ST estimated from AMOVA was not signifi - impossible to estimate the proportion of animals sampled Φ ϭ ϭ cant ( ST 0.005, P 0.352). for this study. Figure 2 shows the observed and expected distributions Genetic diversity as estimated from mtDNA was rela- of mismatches under the model of growing–declining tively high as ascertained by the number of detected hap- populations in the Global population. The observed dis- lotypes and the haplotype diversity. Nucleotide diversity tribution of mismatches was bimodal. Table 5 shows a values (π , % ) were low; therefore the observed haplotypes signifi cant SSD value (P Ͻ 0.05), revealing signifi cant were closely related. According to A VISE (1998), large departure from the growing– decreasing model. On the population sizes might account for the high levels of other hand, Tajima’ s D, Fu’s Fs and R 2 values were not haplotype diversity (h) observed in this study. Haplotype signifi cant (P Ͼ 0.05). diversity was similar to that detected in many chicken populations traditionally bred ( MUCHADEYI et al. 2008). The observed values of haplotype and nucleotide diversity DISCUSSION are higher than those observed in bird species suffering The fragment of the CR amplifi ed and sequenced in this from major population declines and range fragmentation, study (fi rst hypervariable segment, HVS1), is commonly such as the white-headed duck Oxyura leucocephala used in order to assess mitochondrial DNA (mtDNA) ( MU Ñ OZ-FUENTES et al. 2008). diversity and phylogeographic structure in galliform birds We did not detect any genetic structure on the basis of Φ ( MUCHADEYI et al. 2008; MWACHARO et al. 2011). the results from AMOVA and the estimated ST value. The sample size is small, due to the remoteness and Since no signifi cant divergence was found between the the logistic diffi culties of the study region, a Tribal Area. western and eastern populations, both groups could be The total area covered for sampling is approximately considered as a single population. B AKER (1924), ROBERTS 350 km 2. Most of this area is mountainous, dry and under (1992) and GRIMMETT et al. (1998) studied F. pondicerianus

Table 2. Haplotype frequencies (Ϯ SD) from western, eastern and Global populations.

Haplotype

Population HA H B H C H D HE H F HG Western side 0.250 Ϯ 0.130 0.167 Ϯ 0.112 – 0.167 Ϯ 0.112 0.083 Ϯ 0.083 0.250 Ϯ 0.130 0.083 Ϯ 0.083 Eastern side 0.235 Ϯ 0.106 0.353 Ϯ 0.119 0.059 Ϯ 0.059 0.235 Ϯ 0.106 – 0.118 Ϯ 0.080 – Global 0.241 Ϯ 0.081 0.276 Ϯ 0.084 0.035 Ϯ 0.035 0.207 Ϯ 0.076 0.035 Ϯ 0.035 0.172 Ϯ 0.071 0.034 Ϯ 0.035 74 I. Khaliq et al. Hereditas 148 (2011)

Table 3. Diversity indices from western, eastern and Global populations .

No. of No. of Number of Population n polymorphic sites ts. sites tv. sites h k π ( % )

Western side 12 8 6 2 0.879 Ϯ 0.059 2.212 Ϯ 1.312 0.433 Ϯ 0.289 Eastern side 17 3 2 1 0.794 Ϯ 0.056 1.132 Ϯ 0.773 0.222 Ϯ 0.169 Global 29 9 7 2 0.818 Ϯ 0.032 1.576 Ϯ 0.966 0.308 Ϯ 0.210

Ts.: transitions; tv.: transversions; h: haplotype diversity; k: mean number of pairwise differences; π : nucleotide diversity, % in Pakistan and considered this species as a sedentary bird. populations, while populations at demographic equilib- Therefore, mt DNA studies would suggest that at least the rium give multimodal mismatch distributions. Tajima’s D females disperse across the mountains of this territory, and Fu ’ s Fs (neutrality indices) are also useful for detect- although alternative explanations could not be excluded ing demographic changes (S IMONSEN et al. 1995; FU 1997). (recent common ancestry, a formerly continuous popula- Especially for neutral loci, as for the CR, signiﬁ cant nega- tion submitted to isolation by distance at present etc.) . tive D and F s values would indicate recent population Since mtDNA is a maternal marker, sex-biased expansion, while signiﬁ cant positive values would point dispersal could confound the lineage history ( ZINK and to genetic drift (N YAKAANA et al. 2008). As demonstrated

BARRACLOUGH 2008). On the other hand, mutation rates in by FU (1997), Fs is a more powerful test than D for demo- microsatellites are generally higher than in mtDNA, so graphic changes, but the R2 test is even superior for small that these two types of genetic markers expose different size samples (R AMOS-ONSINS and ROZAS 2002) such as the time scales (Z INK and BARRACLOUGH 2008). MtDNA stud- one we have studied. Coalescent simulation as imple- ies provide a valuable preliminary description of the pop- mented in DnaSPv5 is the most adequate method for esti- ulation structure and demographic history, but nuclear mating signifi cance for D, Fs and R 2 in small size samples markers like microsatellites would provide valuable infor- (L IBRADO and ROZAS 2009). mation to complete this kind of analysis (S AILLANT et al. The Global population in the Suleiman Range would be 2004; BOWIE et al. 2009; KVIST et al. 2011). With this in demographic equilibrium, as suggested by the shape of objective, we tested a set of seven chicken microsatellite the mismatches distribution and the signifi cant departure loci ( MCW135, MCW225, MCW276, MCW280, MCW295, from growing-declining model. No signifi cant values for

LEI31 and ADL0142) in F. pondicerianus interpositus ; we Tajima’s D, Fu’s Fs and R2 tests would point again to this have previously used them for population studies in Alec- situation. toris genus with good results (details in T EJEDOR et al. The tribesmen in the Suleiman Range watch over their 2007). Only four of them (MCW225, MCW276, MCW280 areas very carefully mainly due to traditional rivalry with and ADL014 2) successfully amplifi ed, but they were not the neighbouring tribes. This tradition resulted in a strict suffi ciently variant for population studies; only MCW225 control of the use of the natural resources and provided shows two different alleles in one individual while the rest protection for the wildlife as strangers and non-tribesmen were monomorphic loci. These problems demonstrate the are not allowed to enter the tribe ’ s territory easily. Such diffi culties in inter-specifi c microsatellite analysis and areas can prove very good conservation units for undis- highlight the eventual need for a complete sequencing of turbed and naturally protected wildlife habitats. It has the F. pondicerianus interpositus genome; however no been proved time and again that local communities can be funding is presently available for this purpose. Therefore, very infl uential in conservation efforts ( RAJ 2010). In the we could only use mtDNA data for population studies in area sampled in this study, hunting trips are arranged this subspecies and additional research to confi rm these once per year, during the winter season. Local authorities results using nuclear DNA is needed. organize payment for francolin hunting trips once per Demographic history analysis can be based on mismatch year during the winter season (November to January). distributions ( ROGERS and HARPENDING 1992); unimodal The number of birds to be killed during these trips is mismatch distributions are expected in growing–declining strictly controlled in order to maintain a sustainable use

Table 4. Results from th e hierarchical AMOVA. Φ Source of variation df Sum of squares Variance components Percentage of variation ST P Between populations (western and eastern) 1 0.843 0.004 0.52 0.005 0.352 Whitin populations 27 21.225 0.786 99.48 df ϭ degrees of freedom. Hereditas 148 (2011) Mitochondrial DNA diversity in the grey francolin 75

to detect eventual changes in demography. On the other hand, the present set of CR sequences from one of the subspecies of F. pondicerianus opens the way for possible future comparisons with the rest of species and subspecies of the genus and even with other genera.

Acknowledgements – The authors want to thank Dr. D. Savva (Univ. of Reading, UK) for help in polishing the English original. The authors also thank the referees for helping to improve the original manuscript.

REFERENCES Fig. 2. Observed and expected distributions of pairwise nucle- Ali, S. and Ripley, D. S. 1983. Handbook of the birds of India otide differences (mismatches) under the model of growing- and Pakistan together with those of Bangladesh, Nepal, declining populations in the Global population. Bhuttan and Srilanka. Vol. VI. – Oxford Univ. Press. Allendorf, F.W. and Luikart, G. 2007. Conservation and the genetics of populations. – Blackwell Publishing. Avise, J. 1998. Phylogeography. – Harvard Univ. Press. of the resources. This control would have managed to Baker, E. C. S. 1924. The Fauna of British India, including keep the population in demographic equilibrium; how- Ceylon and Burma Birds. – Taylor and Francis. ever, this situation could change rapidly. As mentioned in Baker, A. J. and Marshall, H. D. 1997. Mitochondrial control Introduction, hunting is increasing and population size region sequences as tools for understanding evolution. – In: could suddenly be reduced. Mindell, D. P. (ed.), Avian molecular evolution and systematics. Academic Press, p. 51 – 82. To date, neither conservation plans nor restocking Bowie, R. C. K., Fjeldsa, J. and Kiure, J. 2009. Multilocus nor artifi cial translocations of populations have been molecular DNA variation in Winifred ’ s warbler Scepomycter carried out in the area. However, they could be needed winifredae suggests cryptic speciation and the existence of a in a few years if the present exploitation tendency con- threatened species in the Rubeho– Ukaguru Mountains of tinues. But before any conservation plans are started, Tanzania. – Ibis 151: 709 – 719. Brown, W. M., Prager, E. M., Wang, A. et al. 1982. Mitochondrial basic data on the population structure of the wild species DNA sequences of primates: tempo and mode of evolution. must be understood to obtain the maximum desirable – J. Mol. Evol. 18: 225 – 239. effect. Management and protection of wild populations Cadah í a, L., Negro, J. J. and Urios, V. 2007. Low mitochondrial must be based on the knowledge of their genetic struc- DNA diversity in the endangered Bonelli’ s eagle (Hieraaetus fasciatus) from SW Europe (Iberia) and NW Africa. – J. ture (M ORITZ 1999 , ALLENDORF and L UIKART 2007). On Ornithol. 148: 99 – 104. the other hand, the protection of distinct populations of Clayton, D. A.1984. Transcription of the mammalian mito- the same species contributes to maintain high level of chondrial genome. – Annu. Rev. Biochem. 53: 573– 594. biodiversity and therefore, to decrease extinction risk Clements, J. F., Diamond, J., White, A. W. et al. 2007. The ( WAPLES 1991, M ARTIN et al. 2007). The loss of genetic Clements checklist of birds of the World, 6th ed. – Cornell diversity is not desirable, since it reduces the ability of Univ. Press, p. 65. del Hoyo J., Elliot, A. and Sargatal, J. (eds) 1994. Handbook of species to cope with environmental changes (F RANKHAM birds of the World. Vol. 2. New world vultures to guineafowl. et al. 2002). – Lynx Edicions. In conclusion, the results from this initial study could Desjardins, P. and Morais, R. 1990. Sequence and gene organiza- be the basis for a better understanding of such an impor- tion of the chicken mitochondrial genome. A novel gene tant group of game birds and future interventions on them order in higher vertebrates. – J. Mol. Biol. 212: 599 – 634. Excoffi er, L., Smouse, P. E. and Quattro J. M.1992. Analysis of (limits for captures, restocking or translocations, etc.). molecular variance inferred from metric distances among In the future, similar studies might be carried out in order DNA haplotypes, application to human mitochondrial DNA restriction data. – Genetics 131: 479 – 491. Table 5. Summary statistics about the demographic history Excoffi er, L., Laval, G. and Schneider, S. 2005. Arlequin ver. for the Global population. 3.0: an integrated software package for population genetics data analysis. – Evol. Bioinf. Online 1: 47 – 50. SSD (P-value) D (P-value) F (P-value) R (P-value) Frankham, R., Ballou, B. D. and Briscoe, D. A. 2002. Introduction s 2 to conservation genetics. – Cambridge Univ. Press. 0.026 (0.030) * – 0.978 (0.184) – 1.256 (0.303) 0.121 (0.541) Fu, Y. X. 1977. Statistical tests of neutrality of mutations against population growth hitchhiking and background SSD ϭ sum of squared differences; D ϭ Tajima ’ s statistics; selection. – Genetics 147: 915 – 925. ϭ ϭ Fs Fu’ s statistics; R 2 R AMOS-ONSINS and ROZA ’ s statistics; Godoy, J. A., Negro, J. J., Hiraldo, F. et al. 2004. Phylogeography, * P Ͻ 0.05. genetic structure and diversity in the endangered bearded 76 I. Khaliq et al. Hereditas 148 (2011)

vulture (Gypaetus barbatus L.) as revealed by mitochondrial France, Ͻ http://hal.archives-ouvertes.fr/ISDA2010 Ͼ , accessed DNA. – Mol. Ecol. 13: 371 – 390. 7 March 2011. Grimmett, R., Inskipp, C. and Inskipp, T. 1998. Birds of the Ramos-Onsins, S. E. and Rozas, J. 2002. Statistical properties of Indian sub-continent. – Helm Publications. new neutrality tests against population growth. – Mol. Biol. Hall, T. 2004. BioEdit. Biological sequence alignment editor for Evol. 19: 2092 – 2100. Win95/98/NT/2K/XP. Ͻ http://www.mbio.ncsu.edu/BioEdit/ Roberts, T. J. 1992. The birds of Pakistan. Vol. I (Non-Passerines). bioedit.html Ͼ , accessed 7 March 2011. – Oxford Univ. Press. Hudson, R. R. 1990. Gene genealogies and the coalescent process. Rogers, A. R. and Harpending, H. 1992. Population growth – In: Futuyma, D. and Antonovics, J. (eds), Oxford surveys in makes waves in the distribution of pairwise genetic evolutionary biology. Vol. 7. Oxford Univ. Press, p. 1-44. differences. – Mol. Biol. Evol. 9: 552 – 569. Kirchman, J. J. and Franklin, J. D.2007. Comparative phylogeo- Roques, S., Godoy, J. A., Negro, J. J. et al. 2004. Organization graphy and genetic structure of Vanuatu birds: control region and variation of the mitochondrial control region in two variation in a rail, a dove, and a passerine. – Mol. Phylogenet. vulture species, Gypaetus barbatus and Neophron Evol. 43:14 – 23. percnopterus. – J. Hered. 95: 332 – 337. Kvist, L., Giralt, D., Valera, F. et al. 2011. Population decline is Ruokonen, M. and Kvist, L. 2002. Structure and evolution of accompanied by loss of genetic diversity in the lesser grey the avian mitochondrial control region. – Mol. Phylogenet. shrike Lanius minor . – Ibis 153: 98 – 109. Evol. 23: 422 – 432. Lee, P. L. M., Richardson, L. J. and Bradbury, R. B. 2001. The Saccone, C., Pesole, G. and Sbisá , E.1991. The main regulatory phylogenetic status of the corn bunting Miliaria calandra region of mammalian mitochondrial DNA: structure – function based on mitochondrial control-region DNMA sequences. model and evolutionary pattern. – J. Mol. Evol. 33: 83 – 91. – Ibis 143: 299 – 303. Saillant, E., Patton, J. C., Ross, K. E. et al. 2004. Conservation Librado, P. and Rozas, J. 2009. DnaSP v5: a software genetics and demographic history of the endangered for comprehensive analysis of DNA polymorphism data. Cape Fear shiner (Notropis mekistocholas ). – Mol. Ecol. 13: – Bioinformatics 25: 1451– 1452. 2947 – 2958. Mahmood, S., Mahmood, T., Rais, M. et al. 2010. A com- Shen, Y. Y., Shi, P., Sun, Y. B. et al. 2009. Relaxation of selective parative study on the populations of the grey francolin constraints on avian mitochondrial DNA following the Francolinus pondicerianus and the black francolin degeneration of fl ight ability. – Genome Res. 19: 1760– 1765. Francolinus francolinus in Lehri Nature Park, Punjab, Simonsen, K. L., Churchill, G. A. and Aquadro, C. F. 1995. Pakistan. – Podoces 5: 42 – 53. Properties of statistical tests of neutrality for DNA Martin, J., Kitchens, W. M. and Hines, J. E. 2007. Importance of polymorphism data. – Genetics 141: 413 – 429. well designed monitoring programs for the conservation of Tajima, F. 1989. Statistical methods for testing the neutral endangered species: case study of the Snail Kite. – Conserv. mutation hypotesis for DNA polymorphism. – Genetics 123: Biol. 21: 472 – 481. 585 – 595. Meril ä , J., Bjö rklund, M. and Baker, A. J. 1997. Historical Tejedor, M. T., Monteagudo, L. V., Mautner, S. et al. 2007. demography and present day population structure of the Introgression of Alectoris chukar genes into a Spanish wild greenfi nch, Carduelis chloris . An analysis of mtDNA control- Alectoris rufa population. – J. Hered. 98: 179 – 182. region sequences. – Evolution 51: 946 – 956. Waples, R. S. 1991. Pacifi c Salmon Oncorhynchus spp. and Moritz, C. 1999. Conservation units and translocation: strat- the defi nition of “ species ” under the Endangered Species egies for conserving evolutionary process. – Hereditas 130: Act. – Mar. Fish. Rev. 53:11 – 22. 217 – 228. Wenink, P. W., Baker, A. J. and Tilanus, M. J. 1994. Mitochondrial Muchadeyi, F. C., Eding, H., Simianer, H. et al. 2008. control-region in two shorebird species, the turnstone and the Mitochondrial DNA D-loop sequences suggest a southeast dunlin, and their utility in population genetic studies. – Mol. Asian and Indian origin of Zimbabwean village chickens. Biol. Evol. 11: 22 – 31. – Anim. Genet. 39: 615 – 622. WWF (McGinley, M., topic ed.) 2008. Sulaiman Range alpine Mu ñ oz-Fuentes, V., Green, A. J. and Sorenson, M. D. 2008. meadows. – In: Cleveland, C. J. (ed.), Encyclopedia of Earth. Comparing the genetics of wild and captive populations of Environmental Information Coalition, National Council for white-headed ducks Oxyura leucocephala: consequences for Science and the Environment, Washington, DC. Ͻ http:// recovery programmes. – Ibis 150: 807 – 815. www.eoearth.org/article/Sulaiman_Range_alpine_meadows Ͼ , Mwacharo, J. M., Bj ø rnstad, G., Mobegi, V. et al. 2011. accessed on 7 March 2011. Mitochondrial DNA reveals multiple introductions of Wright, S. 1951. The genetical structure of populations. – Ann. domestic chicken in East Africa. – Mol. Phylogenet. Evol. Eugen. 15: 323 – 354. 58: 374 – 382. Zink, R. M. and Blackwell, R. C.1998. Molecular systematics Nyakaana, S., Tumusiime, C., Oguge, N. et al. 2008. and biogeography of aridland gnatcatchers (genus Polioptila ) Mitochondrial DNA diversity and population structure of and evidence supporting species status of the California a forest-dependent rodent, Praomys taitae (Rodentia: gnatcatcher (Polioptila california ). – Mol. Phylogenet. Evol. Muridae) Heller 1911, in the fragmented forest patches of 9: 26 – 32. Taita Hills, Kenya. – S. Afr. J. Sci. 104: 499 – 504. Zink, R. M. and Barroclough, G. F. 2008 Mitochondrial DNA under Raj, S. 2010. Traditional knowledge, innovation systems siege in avian phylogeography. – Mol. Ecol. 17: 2107 – 2121. and democracy for sustainable agriculture: a case study Zink, R. M., Weller, S. J. and Blackwell, R. C.1998. Molecular on Adi tribes of eastern Himalayas of northeast India. phylogenetics of the avian genus Pipilo and a biogeographic – Symp. Proc. ISDA 2010 (Innovation and Sustainable argument for taxonomic uncertainty. – Mol. Phylogenet. Development in Agriculture and Food), Montpellier, Evol. 10: 191 – 201.