DOCSLIB.ORG

Immunohistochemical Analysis of Unc13b and Ubap2 in Prostate Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Immunohistochemical Analysis of Unc13b and Ubap2 in Prostate Cancer IMMUNOHISTOCHEMICAL ANALYSIS OF UNC13B AND UBAP2 IN PROSTATE CANCER Timo Kopponen Syventävien opintojen kirjallinen työ University of Tampere Institute of Biomedical Technology Molecular Biology of Prostate Cancer -Group May 2014 1 Tampereen yliopisto Institute of Biomedical Technology Molecular Biology of Prostate Cancer –Group KOPPONEN TIMO: IMMUNOHISTOCHEMICAL ANALYSIS OF UNC13B AND UBAP2 IN PROSTATE CANCER Kirjallinen työ, 18 s. Ohjaajat: Professori Tapio Visakorpi ja FT Leena Latonen Toukokuu 2014 Avainsanat: geenimonistuma, immunohistokemia, karsinogeneesi, proteiiniekspressio Eturauhassyöpä on miesten yleisin syöpä Euroopassa, poislukien ihosyövät. Syövän geneettisiä mekanismeja tunnetaan puutteellisesti. Geneettisen materiaalin monistumia ja deleetioita on tunnistettu useita. Tässä tutkimuksessa selvitettiin proteiinien UNC13B ja UBAP2 ilmentymistä eturauhassyöpänäytteissä, sekä niiden mahdollista yhteyttä kliinispatologisiin muuttujiin. Tutkittavat proteiinit värjättiin vasta-aineilla immunohistokemiallisesti. Yhteensä 477 prostatektomia-, sekä 230 hormoniriippumatonta eturauhassyöpänäytettä sisällytettiin analyysiin. Näytteet analysoitiin manuaalisesti virtuaalimikroskoopilla ja luokiteltiin neljään luokkaan värjäyksen intensiteetin mukaan. Intensiteettiä verrattiin PSA:han, Gleason-luokkaan, kuolleisuuteen, diagnoosi-ikään, TNM-luokitukseen, Ki-67:n ekspressioon sekä androgeenireseptorin ekspressioon. UNC13B:n ekspressio oli merkittävästi suurempi hormoniriippumattomissa näytteissä. Molempien proteiinien ekspressio kasvoi prostatektomianäytteissä yhdessä Ki-67:n ja androgeenireseptorin ekspression kanssa. Tulosten perusteella vaikuttaisi siltä, että UNC13B ja UBAP2-proteiinit ovat yhteydessä eturauhassyövän kehittymiseen. Niiden yhteyttä kliinispatologisiin muuttujiin ei kuitenkaan voitu osoittaa. Lisäksi näiden proteiinien vahva korrelaatio Ki-67:ään voisi auttaa ennakoimaan eturauhassyövän uusiutumista, mutta tämä tarvitsee lisätutkimuksia. 2 University of Tampere Institute of Biomedical Technology Molecular Biology of Prostate Cancer –Group KOPPONEN TIMO: IMMUNOHISTOCHEMICAL ANALYSIS OF UNC13B AND UBAP2 IN PROSTATE CANCER Study report, 18 s. Supervisors: Prof. Tapio Visakorpi and PhD Leena Latonen May 2014 Keywords: genetic amplification, immunohistochemistry, carcinogenesis, protein expression Prostate cancer is the most common non-skin cancer in men in Europe. Only a few genetic mechanisms of prostate cancer are known. Some amplifications and deletions of genetic material have been recognized. This study’s purpose was to investigate protein expression of UNC13B and UBAP2 in prostate cancer specimen and their possible association to clincopathological variables. Target proteins were immunohistochemically stained. A total of 477 primary prostatectomy samples and 230 hormone-refractory samples were included in the analysis. Specimens were analyzed manually with digital microscope. They were divided into 4 groups according to their staining intensity. Intensity level scores were compared to PSA-levels, Gleason scores, progression free survival, survival, age at diagnosis, tumors T-stage, Ki-67 expression and androgen receptor expression. Expression of UNC13B was significantly higher in hormone- refractory samples. Expression of protein Ki-67 and androgen receptor increased when scoring intensities of UNC13B and UBAP2 increased in prostatectomy samples. Findings suggest that expression of UNC13B and UBAP2 increase during prostate cancer development. However, associations between expression levels of these proteins and clinicopathological variables were not found. Strong correlation between Ki-67 and these two proteins in prostatectomy samples could mean that UNC13B and UBAP2 would predict cancer recurrence but this needs further research. 3 Table of Contents 1. INTRODUCTION ......................................................................................................... 1 2. REVIEW OF THE LITERATURE ................................................................................ 2 2.1. Prostate cancer ............................................................................................................................................... 2 2.2. Biology of prostate cancer .............................................................................................................................. 3 2.3. Genetic aberrations in prostate cancer ........................................................................................................... 5 3. MATERIALS AND METHODS .................................................................................... 6 3.1. Clinical prostate TMAs .................................................................................................................................... 6 3.2. Statistical analyses .......................................................................................................................................... 8 4. RESULTS ................................................................................................................... 8 5. DISCUSSION ............................................................................................................ 15 6. REFERENCES .......................................................................................................... 17 4 1. INTRODUCTION The molecular and genetic mechanisms of prostate cancer are still insufficiently defined. Prostate cancer, like other cancers, is formed when the cellular mechanisms of controlling proliferation and/or apoptosis break down. This is thought to happen partly at chromosomal level, where deletions, gains, amplifications or translocations of the genes result in their deregulation, that affect the previously mentioned cellular mechanisms (Saramaki, 2006). Prostate cancer cells usually have somatic genome alterations and some of them are genetic (alterations in DNA sequence) and some epigenetic (DNA sequence unaltered). Of gene copy number alterations, both gains and deletions are common in prostate cancer. For better understanding of carcinogenesis of prostate cancer, these chromosomal alterations should be further studied to identify the tumor suppressor genes and oncogenes driving the cancer (Damber & Aus, 2008; Gurel et al., 2008). Researchers have access to a number of different xenografts, transplantations of human prostate cancer tissue to a different species, which are used to study the biology of prostate cancer. Using high resolution array-comparative genomic hybridization (aCGH), a novel amplification at chromosome 9p13.3 was recently identified in prostate cancer xenograft LuCaP35 (Saramaki et al., 2006). Further research continued to study the amplification in 9p13.3 in prostate cancer xenografts and cell lines, aiming to identify genes whose amplified copy number increases their expression level. In clinical patient material, amplification of 9p13.3 area was slightly more common in hormone refractory prostate cancer specimens than in untreated prostatectomy tumors. A number of possible target genes were found, including UNC13B and UBAP2 (Leinonen, 2007). UNC13B is a cytosolic diacylglycerol -binding protein that belongs to the UNC13/munc13 family of proteins. It is involved in vesicle maturation during exocytosis as part of neurotransmitter release. Hyperglycemia is known to up-regulate UNC13B. Nevertheless, relevance of UNC13B in both epithelial cells and prostate cancer cells remains unknown. UBAP2 (ubiquitin associated protein 2) has a UBA domain and its function is also unknown (National Center for Biotechnology Information, ). The purpose of this study was to analyze UNC13B and UBAP2 protein expression levels in clinical prostatectomy and hormone-refractory tumor samples. One aim was also to discover possible associations between protein expression levels and clinical and pathological parameters. Ultimate goal 1 is, eventually, to determine if these two genes are potential oncogenes. This research project was conducted in Molecular Biology of Prostate Cancer –Group at University of Tampere. Supervision was performed by Professor Tapio Visakorpi and Leena Latonen, PhD. Collecting and analyzing the data were done during winter 2012-2013. 2. REVIEW OF THE LITERATURE The data for this literature review was collected from Ovid MEDLINE(R) Daily Update - and Ovid MEDLINE(R) In-Process & Other Non-Indexed Citations and Ovid MEDLINE(R) 1946 to Present -databases in June 2013. 2.1. Prostate cancer In Europe, prostate cancer is the most common non-skin cancer in men with an estimated 382,000 new cases in 2008. It is also the third most common cause of death from cancer in men with almost 90,000 deaths. Incidence has been increasing, except latest trends show that in Sweden, Finland and The Netherlands incidence is not growing or has even started to decrease. In Finland, mortality has declined significantly by 2,9% annually during 1998—2007 (Bray et al., 2010). There are only a few established risk factors for prostate cancer. These include positive family history, age and ethnicity. Prostate cancer risk is highest at the age of 70—74 and risk begins to increase after 55 years of age. African Americans have 60% higher risk than Caucasians for developing prostate cancer and their mortality is approximately double that of Caucasians (Gann, 2002). The true incidence of prostate cancer is higher than epidemiological studies show because not everyone develops symptoms, which is confirmed by autopsy findings (Damber & Aus, 2008). Prostate
Load more

Recommended publications
  • UNIVERSITY of CALIFORNIA, SAN DIEGO Functional Analysis of Sall4
    UNIVERSITY OF CALIFORNIA, SAN DIEGO Functional analysis of Sall4 in modulating embryonic stem cell fate A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Molecular Pathology by Pei Jen A. Lee Committee in charge: Professor Steven Briggs, Chair Professor Geoff Rosenfeld, Co-Chair Professor Alexander Hoffmann Professor Randall Johnson Professor Mark Mercola 2009 Copyright Pei Jen A. Lee, 2009 All rights reserved. The dissertation of Pei Jen A. Lee is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Co-Chair ______________________________________________________________ Chair University of California, San Diego 2009 iii Dedicated to my parents, my brother ,and my husband for their love and support iv Table of Contents Signature Page……………………………………………………………………….…iii Dedication…...…………………………………………………………………………..iv Table of Contents……………………………………………………………………….v List of Figures…………………………………………………………………………...vi List of Tables………………………………………………….………………………...ix Curriculum vitae…………………………………………………………………………x Acknowledgement………………………………………………….……….……..…...xi Abstract………………………………………………………………..…………….....xiii Chapter 1 Introduction ..…………………………………………………………………………….1 Chapter 2 Materials and Methods……………………………………………………………..…12
    [Show full text]
  • Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure
    ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy.
    [Show full text]
  • Post-Transcriptional Exon Shuffling Events in Humans Can Be Evolutionarily Conserved and Abundant
    Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Research Post-transcriptional exon shuffling events in humans can be evolutionarily conserved and abundant Haya H. Al-Balool,1,7 David Weber,1,4,7 Yilei Liu,1,5 Mark Wade,1 Kamlesh Guleria,1,6 Pitsien Lang Ping Nam,1 Jake Clayton,1 William Rowe,1 Jonathan Coxhead,2 Julie Irving,2 David J. Elliott,1 Andrew G. Hall,3 Mauro Santibanez-Koref,1 and Michael S. Jackson1,8 1Institute of Genetic Medicine, Newcastle University, Newcastle NE1 3BZ, United Kingdom; 2NewGene Limited, Bioscience Building, International Centre for Life, Newcastle upon Tyne NE1 4EP, United Kingdom; 3Northern Institute for Cancer Research, Paul O’Gorman Building, Newcastle University, Newcastle upon Tyne NE2 4HH, United Kingdom In silico analyses have established that transcripts from some genes can be processed into RNAs with rearranged exon order relative to genomic structure (post-transcriptional exon shuffling, or PTES). Although known to contribute to transcriptome diversity in some species, to date the structure, distribution, abundance, and functional significance of human PTES transcripts remains largely unknown. Here, using high-throughput transcriptome sequencing, we identify 205 putative human PTES products from 176 genes. We validate 72 out of 112 products analyzed using RT-PCR, and identify additional PTES products structurally related to 61% of validated targets. Sequencing of these additional products reveals GT-AG dinucleotides at >95% of the splice junctions, confirming that they are processed by the spliceosome. We show that most PTES transcripts are expressed in a wide variety of human tissues, that they can be polyadenylated, and that some are conserved in mouse.
    [Show full text]
  • UBAP2 Polyclonal Antibody Catalog Number PA5-54496 Product Data Sheet
    Lot Number: SI2453771A Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 thermofisher.com/contactus UBAP2 Polyclonal Antibody Catalog Number PA5-54496 Product Data Sheet Details Species Reactivity Size 100 µl Tested species reactivity Human Host / Isotype Rabbit / IgG Tested Applications Dilution * Class Polyclonal Immunocytochemistry (ICC) 1-4 µg/ml Type Antibody Immunofluorescence (IF) 1-4 µg/ml Immunogen Recombinant protein corresponding to Human UBAP2 Immunohistochemistry (IHC) 1:50-1:200 Conjugate Unconjugated * Suggested working dilutions are given as a guide only. It is recommended that the user titrate the product for use in their own experiment using appropriate negative and positive controls. Form Liquid Concentration Lot-Specific Purification Antigen affinity chromatography Storage Buffer PBS, pH 7.2, with 40% glycerol Contains 0.02% sodium azide Store at 4°C short term. For long Storage Conditions term storage, store at -20°C, avoiding freeze/thaw cycles. Product Specific Information Immunogen sequence: PEPSPVLSQL SQRQQHQSQA VTVPPPGLES FPSQAKLRES TPGDSPSTVN KLLQLPSTTI ENISVSVHQP QPKHIKLAKR RIPPASKIPA SAVEMPGSAD VTGLN Highest antigen sequence identity to the following orthologs: Mouse - 82%, Rat - 83%. Background/Target Information The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] For Research Use Only. Not for use in diagnostic procedures. Not for resale without express authorization. For Research Use Only. Not for use in diagnostic procedures.
    [Show full text]
  • Miz1 Is Required to Maintain Autophagic Flux
    ARTICLE Received 3 Apr 2013 | Accepted 3 Sep 2013 | Published 3 Oct 2013 DOI: 10.1038/ncomms3535 Miz1 is required to maintain autophagic flux Elmar Wolf1,*, Anneli Gebhardt1,*, Daisuke Kawauchi2, Susanne Walz1, Bjo¨rn von Eyss1, Nicole Wagner3, Christoph Renninger3, Georg Krohne1, Esther Asan3, Martine F. Roussel2 & Martin Eilers1,4 Miz1 is a zinc finger protein that regulates the expression of cell cycle inhibitors as part of a complex with Myc. Cell cycle-independent functions of Miz1 are poorly understood. Here we use a Nestin-Cre transgene to delete an essential domain of Miz1 in the central nervous system (Miz1DPOZNes). Miz1DPOZNes mice display cerebellar neurodegeneration characterized by the progressive loss of Purkinje cells. Chromatin immunoprecipitation sequencing and biochemical analyses show that Miz1 activates transcription upon binding to a non-palin- dromic sequence present in core promoters. Target genes of Miz1 encode regulators of autophagy and proteins involved in vesicular transport that are required for autophagy. Miz1DPOZ neuronal progenitors and fibroblasts show reduced autophagic flux. Consistently, polyubiquitinated proteins and p62/Sqtm1 accumulate in the cerebella of Miz1DPOZNes mice, characteristic features of defective autophagy. Our data suggest that Miz1 may link cell growth and ribosome biogenesis to the transcriptional regulation of vesicular transport and autophagy. 1 Theodor Boveri Institute, Biocenter, University of Wu¨rzburg, Am Hubland, 97074 Wu¨rzburg, Germany. 2 Department of Tumor Cell Biology, MS#350, Danny Thomas Research Center, 5006C, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, USA. 3 Institute for Anatomy and Cell Biology, University of Wu¨rzburg, Koellikerstrasse 6, 97070 Wu¨rzburg, Germany. 4 Comprehensive Cancer Center Mainfranken, Josef-Schneider-Strasse 6, 97080 Wu¨rzburg, Germany.
    [Show full text]
  • The Roles of Trim15 and UCHL3 in the Ubiquitin-Mediated Cell Cycle Regulation Katerina Jerabkova
    The roles of Trim15 and UCHL3 in the ubiquitin-mediated cell cycle regulation Katerina Jerabkova To cite this version: Katerina Jerabkova. The roles of Trim15 and UCHL3 in the ubiquitin-mediated cell cycle regulation. Cellular Biology. Université de Strasbourg; Univerzita Karlova (Prague), 2019. English. NNT : 2019STRAJ034. tel-02884583 HAL Id: tel-02884583 https://tel.archives-ouvertes.fr/tel-02884583 Submitted on 30 Jun 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTÉ IGBMC - CNRS UMR 7104 - Inserm U 1258 THÈSE présentée par : Kateřina JEŘÁBKOVÁ soutenue le : 09 Octobre 2019 pour obtenir le grade de : Docteur de l’université de Strasbourg Discipline/ Spécialité : Aspects moléculaires et cellulaires de la biologie Les rôles de Trim15 et UCHL3 dans la régulation, médiée par l’ubiquitine, du cycle cellulaire. The roles of Trim15 and UCHL3 in the ubiquitin-mediated cell cycle regulation. THÈSE dirigée par : Mme SUMARA Izabela PhD, Université de Strasbourg Mme CHAWENGSAKSOPHAK
    [Show full text]
  • Essential Genes Shape Cancer Genomes Through Linear Limitation of Homozygous Deletions
    ARTICLE https://doi.org/10.1038/s42003-019-0517-0 OPEN Essential genes shape cancer genomes through linear limitation of homozygous deletions Maroulio Pertesi1,3, Ludvig Ekdahl1,3, Angelica Palm1, Ellinor Johnsson1, Linnea Järvstråt1, Anna-Karin Wihlborg1 & Björn Nilsson1,2 1234567890():,; The landscape of somatic acquired deletions in cancer cells is shaped by positive and negative selection. Recurrent deletions typically target tumor suppressor, leading to positive selection. Simultaneously, loss of a nearby essential gene can lead to negative selection, and introduce latent vulnerabilities specific to cancer cells. Here we show that, under basic assumptions on positive and negative selection, deletion limitation gives rise to a statistical pattern where the frequency of homozygous deletions decreases approximately linearly between the deletion target gene and the nearest essential genes. Using DNA copy number data from 9,744 human cancer specimens, we demonstrate that linear deletion limitation exists and exposes deletion-limiting genes for seven known deletion targets (CDKN2A, RB1, PTEN, MAP2K4, NF1, SMAD4, and LINC00290). Downstream analysis of pooled CRISPR/Cas9 data provide further evidence of essentiality. Our results provide further insight into how the deletion landscape is shaped and identify potentially targetable vulnerabilities. 1 Hematology and Transfusion Medicine Department of Laboratory Medicine, BMC, SE-221 84 Lund, Sweden. 2 Broad Institute, 415 Main Street, Cambridge, MA 02142, USA. 3These authors contributed equally: Maroulio Pertesi, Ludvig Ekdahl. Correspondence and requests for materials should be addressed to B.N. (email: [email protected]) COMMUNICATIONS BIOLOGY | (2019) 2:262 | https://doi.org/10.1038/s42003-019-0517-0 | www.nature.com/commsbio 1 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0517-0 eletion of chromosomal material is a common feature of we developed a pattern-based method to identify essential genes Dcancer genomes1.
    [Show full text]
  • A Catalogue of Stress Granules' Components
    Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration Master in Oncobiology – Molecular Mechanisms of Cancer This work was done under the supervision of: Clévio Nóbrega, Ph.D UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 i ii A catalogue of Stress Granules’ Components: Implications for neurodegeneration Declaração de autoria de trabalho Declaro ser a autora deste trabalho, que é original e inédito. Autores e trabalhos consultados estão devidamente citados no texto e constam na listagem de referências incluída. I declare that I am the author of this work, that is original and unpublished. Authors and works consulted are properly cited in the text and included in the list of references. _______________________________ (Catarina Nunes) iii Copyright © 2019 Catarina Nunes A Universidade do Algarve reserva para si o direito, em conformidade com o disposto no Código do Direito de Autor e dos Direitos Conexos, de arquivar, reproduzir e publicar a obra, independentemente do meio utilizado, bem como de a divulgar através de repositórios científicos e de admitir a sua cópia e distribuição para fins meramente educacionais ou de investigação e não comerciais, conquanto seja dado o devido crédito ao autor e editor respetivos. iv Part of the results of this thesis were published in Nunes,C.; Mestre,I.; Marcelo,A. et al. MSGP: the first database of the protein components of the mammalian stress granules. Database (2019) Vol. 2019. (In annex A). v vi ACKNOWLEDGEMENTS A realização desta tese marca o final de uma etapa académica muito especial e que jamais irei esquecer.
    [Show full text]
  • Computational Proteogenomic Identification and Functional
    bioRxiv preprint doi: https://doi.org/10.1101/168377; this version posted July 25, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Computational proteogenomic identification and functional interpretation of translated fusions and micro structural variations in cancer Yen Yi Lin1;y, Alexander Gawronski1;y, Faraz Hach1;3;y, Sujun Li2, Ibrahim Numanagic,´ 1, Iman Sarrafi1;3, Swati Mishra5, Andrew McPherson1, Colin Collins3;4, Milan Radovich5, Haixu Tang2, S. Cenk Sahinalp 1;2;3; ∗ 1School of Computing Science, Simon Fraser University, Burnaby, BC, Canada, 2School of Informatics and Computing, Indiana University, Bloomington, IN, USA, 3Vancouver Prostate Centre, Vancouver, BC, Canada, 4Dept. of Urologic Sciences, University of British Columbia, Vancouver, BC, Canada 5Department of Surgery, Indiana University, School of Medicine, Indianapolis, IN, USA Motivation: Rapid advancement in high throughput genome and transcriptome sequencing (HTS) and mass spectrometry (MS) technologies has enabled the acquisition of the genomic, transcriptomic and proteomic data from the same tissue sample. In this paper we in- troduce a novel computational framework which can integratively analyze all three types of omics data to obtain a complete molecular profile of a tissue sample, in normal and disease conditions. Our framework includes MiStrVar, an algorithmic method we developed to identify micro structural variants (microSVs) on genomic HTS data. Coupled with deFuse, a popular gene fusion detection method we devel- oped earlier, MiStrVar can provide an accurate profile of structurally aberrant tran- scripts in cancer samples. Given the breakpoints obtained by MiStrVar and deFuse, our framework can then identify all relevant peptides that span the breakpoint junc- tions and match them with unique proteomic signatures in the respective proteomics data sets.
    [Show full text]
  • A Systematic Genome-Wide Association Analysis for Inflammatory Bowel Diseases (IBD)
    A systematic genome-wide association analysis for inflammatory bowel diseases (IBD) Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Christian-Albrechts-Universität zu Kiel vorgelegt von Dipl.-Biol. ANDRE FRANKE Kiel, im September 2006 Referent: Prof. Dr. Dr. h.c. Thomas C.G. Bosch Koreferent: Prof. Dr. Stefan Schreiber Tag der mündlichen Prüfung: Zum Druck genehmigt: der Dekan “After great pain a formal feeling comes.” (Emily Dickinson) To my wife and family ii Table of contents Abbreviations, units, symbols, and acronyms . vi List of figures . xiii List of tables . .xv 1 Introduction . .1 1.1 Inflammatory bowel diseases, a complex disorder . 1 1.1.1 Pathogenesis and pathophysiology. .2 1.2 Genetics basis of inflammatory bowel diseases . 6 1.2.1 Genetic evidence from family and twin studies . .6 1.2.2 Single nucleotide polymorphisms (SNPs) . .7 1.2.3 Linkage studies . .8 1.2.4 Association studies . 10 1.2.5 Known susceptibility genes . 12 1.2.5.1 CARD15. .12 1.2.5.2 CARD4. .15 1.2.5.3 TNF-α . .15 1.2.5.4 5q31 haplotype . .16 1.2.5.5 DLG5 . .17 1.2.5.6 TNFSF15 . .18 1.2.5.7 HLA/MHC on chromosome 6 . .19 1.2.5.8 Other proposed IBD susceptibility genes . .20 1.2.6 Animal models. 21 1.3 Aims of this study . 23 2 Methods . .24 2.1 Laboratory information management system (LIMS) . 24 2.2 Recruitment. 25 2.3 Sample preparation. 27 2.3.1 DNA extraction from blood. 27 2.3.2 Plate design .
    [Show full text]
  • A SARS-Cov-2 Protein Interaction Map Reveals Targets for Drug Repurposing
    Article A SARS-CoV-2 protein interaction map reveals targets for drug repurposing https://doi.org/10.1038/s41586-020-2286-9 A list of authors and affiliations appears at the end of the paper Received: 23 March 2020 Accepted: 22 April 2020 A newly described coronavirus named severe acute respiratory syndrome Published online: 30 April 2020 coronavirus 2 (SARS-CoV-2), which is the causative agent of coronavirus disease 2019 (COVID-19), has infected over 2.3 million people, led to the death of more than Check for updates 160,000 individuals and caused worldwide social and economic disruption1,2. There are no antiviral drugs with proven clinical efcacy for the treatment of COVID-19, nor are there any vaccines that prevent infection with SARS-CoV-2, and eforts to develop drugs and vaccines are hampered by the limited knowledge of the molecular details of how SARS-CoV-2 infects cells. Here we cloned, tagged and expressed 26 of the 29 SARS-CoV-2 proteins in human cells and identifed the human proteins that physically associated with each of the SARS-CoV-2 proteins using afnity-purifcation mass spectrometry, identifying 332 high-confdence protein–protein interactions between SARS-CoV-2 and human proteins. Among these, we identify 66 druggable human proteins or host factors targeted by 69 compounds (of which, 29 drugs are approved by the US Food and Drug Administration, 12 are in clinical trials and 28 are preclinical compounds). We screened a subset of these in multiple viral assays and found two sets of pharmacological agents that displayed antiviral activity: inhibitors of mRNA translation and predicted regulators of the sigma-1 and sigma-2 receptors.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name ubiquitin-associated protein 2 Gene Symbol Ubap2 Organism Mouse Gene Summary Description Not Available Gene Aliases 1190005K07Rik, AA408600, AU045235, UBAP-2, mKIAA1491 RefSeq Accession No. NC_000070.6, NT_187032.1 UniGene ID Mm.41864 Ensembl Gene ID ENSMUSG00000028433 Entrez Gene ID 68926 Assay Information Unique Assay ID qMmuCID0012233 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000108068, ENSMUST00000134782, ENSMUST00000030143 Amplicon Context Sequence TACAGTCATGTAGGGCCACGATGCATTCATCCTGATTTTTTCCCGTCACTTCCAT AAGCTGCTTAACTTTAGCTTCAAAATCTGAATCATTCTTATCAAAGATCACTTGAG CAAGCCGCATCTGCTCAGC Amplicon Length (bp) 100 Chromosome Location 4:41233657-41235588 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 R2 0.9986 cDNA Cq 20.69 cDNA Tm (Celsius) 79 gDNA Cq 34.98 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ubap2, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]