Haplotype-Based Localization of an Alcohol Dependence Gene to the 5Q34 ³-Aminobutyric Acid Type a Gene Cluster

ORIGINAL ARTICLE Haplotype-Based Localization of an Alcohol Dependence Gene to the 5q34 ␥-Aminobutyric Acid Type A Gene Cluster

Marta Radel, MD, PhD; Roger L. Vallejo, PhD; Nakao Iwata, MD, PhD; Richard Aragon, PhD; Jeffrey C. Long, PhD; Matti Virkkunen, MD; David Goldman, MD

Context: Pharmacobehavioral and pharmacogenetic evi- Results: Sib-pair linkage of GABRG2 to alcohol depen- ␥ dence links -aminobutyric acid type A (GABAA) recep- dence was observed in Finns (P=.008). Association of tors and chromosomal regions containing GABAA recep- the GABRB2 1412T allele with alcohol dependence was tor genes to ethanol-related responses. The GABAA gene detected in both populations (Finns, P=.01; Southwest- cluster on chromosome 5q34 is of particular interest in ern Native Americans, P=.008), and the GABRA6 1519T the genetics of alcohol dependence because of the ␥2 sub- allele was associated in both Finns (P=.01) and South- unit requirement for ethanol’s modulatory action on western Native Americans (P=.03). Linkage disequilibrium mapping with 3-locus haplotypes yielded evi- GABAA receptors, previous linkage findings in mice and humans implicating both GABRA6 and GABRG2, and re- dence for an alcohol-dependence locus at the GABAA gene ported associations of GABRA6, GABRB2, and GABRG2 cluster region in both populations. The most highly significant signals were at 3-locus haplotypes that in- alleles with alcohol dependence. cluded 1 or more GABRA6 polymorphisms, with the peak signal at a GABRA6 3-locus haplotype (Finns, empirical Objective: To determine whether variation at the 5q34 P=.004; Southwestern Native Americans, empirical GABAA gene cluster is implicated in differential suscep- P=.02). tibility to alcohol dependence. Conclusions: We detected sib-pair linkage of 5q34 Methods: Two large psychiatrically interviewed samples, GABAA receptor genes to alcohol dependence in Finns a Southwestern Native American population sample and found association both in Finns and in Southwest- (N=433) and a Finnish sample (N=511) with alcohol- ern Native Americans. In both populations, the haplo- dependent subjects and unaffected individuals, were genotype localization implicates the region containing the typed for 6 single nucleotide polymorphisms at the 5q34 Pro385Ser GABRA6 polymorphism and 2 other polymor- GABAA gene cluster. In addition to sib-pair linkage and phisms at GABRA6. case-control association analyses, linkage disequilibrium mapping with haplotypes was used. Arch Gen Psychiatry. 2005;62:47-55

LCOHOL DEPENDENCE (“AL- lated in the pharmacokinetic genetic risk coholism”) is a common domain (ie, in genes coding for aldehyde (10% in men, 4% in wom- dehydrogenase type 26 and for alcohol de- en),1 genetically influ- hydrogenase type 27), they are common enced disorder with heri- in East Asians but not in most other popu- tability estimates ranging from 40% to lations. Pharmacodynamic-specific gene A2-4 Author Affiliations: Laboratory 60%. The vulnerability/protective alle- targets for predisposition to alcohol de- of Neurogenetics, National les for alcoholism represent both the phar- pendence include the genes that encode Institute on Alcohol Abuse and macokinetic (detected and widely repli- receptors at which ethanol (alcohol) first Alcoholism, National Institutes cated) and the pharmacodynamic acts in the brain and that may act as gate- of Health, Rockville, Md (detected but still putative) domains. A keepers in alcohol response. (Drs Radel, Vallejo, Aragon, substantial part of the genetic compo- ␥-Aminobutyric acid (GABA) is the ma- Long, and Goldman); nent of variance in alcoholism vulnerabil- jor inhibitory neurotransmitter in the Department of Psychiatry, Fujita ity is substance specific, that is, not cross- mammalian central nervous system8 and Health University School of 5 Medicine, Toyoake, Japan inherited with vulnerability to other drugs. exerts most of its actions at GABA type A (Dr Iwata); and Department of Such genetic epidemiological data impli- (GABAA) receptors, which are ligand- Psychiatry, University of cate genes that are relatively substance spe- gated chloride-channel complexes. ␥-Ami- Helsinki, Helsinki, Finland cific. Although a few substance-specific nobutyric acid type A receptor com- (Dr Virkkunen). polymorphisms have already been iso- plexes are generally heteropentamers

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 47

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 composed of genetically distinct subunits; 16 related mam- unit gene clusters appear to have ethanol response– 9,10 23 malian subunits have been reported. The human GABAA associated quantitative trait loci nearby. In the mouse, receptor subunit genes are grouped into 7 classes (␣, ␤, the Ala11Thr variant of the ␥2 subunit correlates with ␥, ␦, ε, ␲, and ␪).10 Within these classes, protein se- acute ethanol withdrawal severity,24 and in the rat, an ␣6 quence identity is approximately 70% (ie, ␣1-␣6, ␤1- Arg100Gln amino acid substitution that differentiates al- ␤3, or ␥1-␥3) and protein sequence identity is approxi- cohol tolerant and nontolerant has been reported to al- 25 mately 30% between classes. Most of the human GABAA ter response to benzodiazepines. receptor subunit genes have been assigned to chromo- In the human, preliminary linkage findings have also some regions, and subunit gene clusters have been iden- indicated that variation in GABAA receptor subunit genes tified on chromosomes 4, 5, 15, and X.10 Because of the plays a role in differential vulnerability to alcohol de- ␣ number of subunits, the diversity of expressed GABAA pendence, and a specific polymorphism of the 6 sub- receptor pentamers is large and would be larger except unit gene (ie, GABRA6) encoding an amino acid substi- that these receptors are usually assembled from defined tution (Pro385Ser) was implicated.26 As measured by proportions of ␣, ␤, and ␥ subunits and except that there slowing of saccadic eye movement velocity, sons of al- is considerable variation in the localization and devel- coholics appear to have diminished sensitivity to ben- opmental timing of expression of the different sub- zodiazepines as compared with young men who are at units.11-14 The most abundant subunit combinations ob- lower risk for alcohol dependence, leading to the pro- served so far are ␣1␤2␥2, ␣2␤3␥2, and ␣3␤3␥2, which posal that differences in the expression or function of make up about 80% of all GABAA receptors. The recep- GABAA receptors alter vulnerability to alcohol depen- ␣ ␤ ␥ 27 ␣ tors containing a 1 2 2 combination, believed to as- dence. In these same subjects, the GABAA 6 subunit semble following the coordinated expression of GABRA1, Pro385Ser polymorphism was shown to predict benzo- GABRB2, and GABRG2 genes on 5q34, constitute the ma- diazepine sensitivity.28 jor GABAA receptor subtype in the adult central nervous When ethanol itself is administered as a drug chal- system (about 50%), have been identified in neurons at lenge, decreased intoxication, motor effects, and hor- all levels of the neuraxis, and are believed to mediate the monal responses are observed in sons of alcoholics,29 basic pharmacological spectrum of the classical, high- which has been extensively replicated. In a 15-year fol- affinity BZ site ligands, except CL 218872.12,15 A variety low-up study of 450 men, Schuckit30,31 showed that low of central nervous system–depressant drugs that show level of response to alcohol in young adulthood is a pre- cross-tolerance, including ethanol, benzodiazepines, and dictor of later alcoholism. The risk attributable to the level barbiturates, as well as inhalant anesthetics and some en- of response is substantial (approximately 40% of the vari- dogenous neuroactive steroids, positively modulate the ance in vulnerability), largely independent of family his- 8,16-18 31 GABAA receptors. Many behavioral effects of etha- tory, and largely unshared with other drugs of abuse. nol (eg, anxiolytic, ataxic, and sedative/hypnotic) may By selective genotyping of a subsample of this same co- 26 be explained by allosteric enhancement of GABAA recep- hort, Schuckit et al found preliminary evidence that the ␣ tor–mediated ionic influx and consequent hyperpolar- GABAA 6 Pro385Ser amino acid substitution is associ- ization of the neuronal membrane.8 Agents that in- ated both with alcohol sensitivity and with increased risk crease GABAA receptor activity in the central nervous for alcohol dependence. Associations of markers at the system by acting as GABA positive modulators (ie, ben- 5q34 GABAA gene cluster have also been reported in Scot- zodiazepines, barbiturates, and depressant steroids) en- tish,32 German,33 and Japanese34 samples. hance acute sensitivity to ethanol and maintain ethanol Here we report both locus-based linkage analyses in preference, whereas drugs that act as GABA antagonists sib pairs and allele-based localization by association us- at GABAA receptors, such as picrotoxin, decrease many ing GABAA haplotypes in this Finnish population and in acute actions of ethanol and reduce ethanol prefer- a second semi-isolated population of Southwestern Na- ence.19 In addition, signs of ethanol withdrawal are di- tive Americans. minished following treatments with those GABA ago- nists that increase GABAA receptor function, whereas METHODS GABA antagonists at GABAA receptors increase such 19 signs. Effects of ethanol on GABAA receptor function and expression make the GABAA receptor subunit genes SAMPLES STUDIED excellent candidates for vulnerability to alcohol dependence.20,21 In addition, genetic differences in the ethanol Subjects were selected from 2 semi-isolated populations: a Finn- ish population and a Southwestern Native American popula- sensitivity of GABAA receptors were observed in short- sleep and long-sleep mice that differ in the sedative re- tion. sponse to ethanol. Differential ␥ subunit function was observed between the 2 lines, which has been proposed as FINNISH SAMPLE a critical determinant of individual differences in ethanol sensitivity.22 In BxD RI strains and other rodent ge- A total of 511 psychiatrically interviewed Finns included 110 alcoholic offender probands, 277 relatives, and 124 unrelated netic stocks, quantitative trait loci for sensitization of lo- controls.35 Participants were studied under a human research comotor activation by ethanol and for predisposition to protocol approved by the institutional review board of the Na- acute ethanol withdrawal map to the region containing tional Institutes of Health, Bethesda, Md; the National Insti- the gene cluster that includes the ␥2 and ␣6 subunit genes tute of Mental Health, Bethesda; Office for Protection from Re- (gabrg2 and gabra6), and all of the mouse GABAA sub- search Risks, Bethesda; the University of Helsinki Department

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 48

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 of Psychiatry institutional review board, Helsinki, Finland; and the University of Helsinki Central Hospital institutional re- Table 1. Primer and Enzymes for PCR-RFLP Assays* view board. All subjects were 17 years or older and provided written informed consent. Primer Name Primer Sequence Enzyme The probands were male criminal offenders undergoing fo- A6.1031GϾC.f GGATCACCACTGTTTTAACT Hae III rensic psychiatric evaluation as inpatients in the Department A6.1031GϾC.b AGTAGCTTTTGATATTGTCA of Psychiatry, University of Helsinki. Therefore, the sample is A6.1236CϾT.f CTGACTCCAAATATCATCTG Fok I enriched for the early-onset form of alcoholism associated with A6.1236CϾT.b GAGAAGCATCTACACAAGTC 36 impulsivity and antisocial behaviors, so-called type II. Re- A6.1519TϾC.f GGAGGCACCAGTAAAATAGACCAG Alw NI cently, it has become recognized that in addition to scoring high A6.1519TϾC.b AATACTGAACAATGGAAGACAAAAG in novelty seeking (as hypothesized by Cloninger36), such al- B2.1412CϾT.f TCTGAGGCTGTGATGGGACTTGGAG Ban I coholics also tend to have higher harm avoidance and anxi- B2.1412CϾT.b GGTATTTTAGCGTCACTTTTGTCCTGCAT ety,37 and these particular alcoholics were above the norm for G2 + 99CϾA.f TTTCCATTGGCACCATTGAAA Bam HI harm avoidance measured on the Tridimensional Personality G2 + 99CϾA.b TTGTTATGGCCTGGCTAAAATCA Scale Questionnaire (data not shown). G2 + 3145AϾG.f AATTTACCAACTGGTCTAGCCGG Nci I A total of 110 women and 167 male relatives were ascer- G2 + 3145AϾG.b TGTCAACAATGTTTACCTACATGT tained through the index cases. There were 275 sib pairs among whom 82 sib pairs were concordant for alcoholism (DSM-III- Abbreviation: PCR-RFLP, polymerase chain reaction–restriction fragment R38 alcohol dependence), 64 were discordant, and 129 were un- length polymorphism. *Primer sequences are given in the 5Ј to 3Ј direction. Hae III cleaves the affected. The 124 unaffected controls were unrelated healthy 1031C 233-base pair (bp) amplicon of GABRA6 into 177-bp, 33-bp, and Finnish male volunteers recruited through local newspaper ad- 23-bp fragments. Fok I cleaves the GABRA6 1236CϾT 1236T amplicon into vertisements. Controls were also psychiatrically interviewed 261-bp and 104-bp fragments. Alw NI digests the 1519T 423-bp amplicon of (Structured Clinical Interview for DSM-III-R38) and were paid GABRA6 1519TϾC into 257-bp and 166-bp fragments. When there is a for their participation. Controls were in a good state of gen- cytosine, but not a thymine, at position 1412 of GABRB2, Ban I digests the eral health as established by physical examination, erythro- 253-bp amplicon into 2 fragments of 229 bp and 24 bp. When a cytosine is present at position +99 of GABRG2 IVS9, Bam HI does not cut the 130-bp cyte and lymphocyte indices, liver enzyme and thyroid hor- fragment, whereas when an adenine is present at the same position, Bam HI mone levels, and serum electrolyte and creatinine concentrations. makes 90-bp and 40-bp fragments. When an adenine is present at position +3145 of GABRG2 IVS10, Nci I does not cut the 92-bp fragment, whereas when a guanine is present at the same position, Nci I cuts the 92-bp SOUTHWESTERN NATIVE AMERICAN SAMPLE fragment into 2 fragments, 72-bp and 20-bp fragments.

The Southwestern Native American sample (N=433) was col- lected without proband ascertainment bias for a family-based bers. Diagnoses were made by 2 blind raters: a clinical social 39 study on alcoholism and related psychiatric disorders. The worker and a clinical psychologist. Diagnostic differences were human research protocol was approved by the tribal council resolved in a consensus conference that included a senior psy- and by the institutional review board of the National Institute chiatrist experienced in diagnosis in Native American people. on Alcohol Abuse and Alcoholism, National Institutes of Health. In the Finnish sample, 1 patient was excluded because of All subjects provided written informed consent. Subjects were chronic schizophrenia. No patient was excluded from the South- ascertained based on familial relationship; both the original se- western Native American population sample. lection of the families and the later recruitment of subjects were performed blind to diagnoses. Participants were members of GENOTYPING OF POLYMORPHISMS AT 5Q34 the same genealogy, older than 21 years, in general good health, and eligible for tribal enrollment (ie, with at least one fourth GABAA RECEPTOR GENE CLUSTER tribal heritage). The 433 psychiatrically interviewed Southwestern Native Six polymorphisms at 3 GABAA receptor genes clustered on the Americans included 192 individuals affected with alcoholism long arm of human chromosome 5 were genotyped blind to di- (DSM-III-R38 alcohol dependence) and 241 unaffected indi- agnoses by polymerase chain reaction–restriction fragment Ͼ 40 viduals. There were 419 sib pairs, which included 188 sib pairs length polymorphism analysis: GABRA6 1031G C ; GABRA6 Ͼ 28 Ͼ 33 concordant for alcoholism, 168 discordant, and 63 unaf- 1236C T (Pro385Ser) ; GABRA6 1519T C ; GABRB2 Ͼ 33 Ͼ 41 fected. Use of the tribal name and exact reservation location is 1412C T ; GABRG2 IVS9+99C A (NCBI rs211014); and Ͼ 41 avoided because these details are unnecessary for the analyses GABRG2 IVS10+3145A G (NCBI rs211013). GenBank ac- set out here. cession numbers for GABRA6, GABRB2, and GABRG2 are GABRA6, number S81944; GABRB2, number S67368; and GABRG2, number NM000816. PSYCHIATRIC DIAGNOSES The primer pairs listed in Table 1 were used to amplify genomic DNA isolated from Epstein-Barr virus–immortalized The Finns were interviewed using the Structured Clinical In- lymphoblastoid cell lines. Each 25-µL polymerase chain reac- terview for DSM-III-R38 by 2 psychiatrists in the Department tion volume contained 50 to 100 ng of genomic DNA, 50 pmol of Psychiatry, University of Helsinki. Diagnoses were made in- of each primer, 0.125mM deoxyribonucleoside-5Ј- dependently and blindly by the 2 psychiatrists under the su- triphosphates (PerkinElmer, Fremont, Calif), and 1 unit of pervision of a senior research psychiatrist and according to cri- TaqGold (PerkinElmer) DNA polymerase. The final reaction teria from the DSM-III-R.38 The Southwestern Native Americans volume also contained 10mM Tris base pH 9, 50mM potas- were interviewed using the Schedule for Affective Disorders and sium chloride (KCl), 1.5mM magnesium chloride (MgCl2), 0.1% Schizophrenia–Lifetime Version by a psychologist experi- Triton X-100 (PerkinElmer), and 0.01% gelatin. The reac- enced in psychiatric assessment with this and other Native tions were performed using a hot-start procedure: TaqGold DNA American populations. Diagnoses for alcoholism and other psy- polymerase was activated only after a first denaturation step chiatric disorders according to criteria from the DSM-III-R38 were of 12 minutes at 95°C. Amplifications were carried out using a based on the interview data; medical, educational, court, and modified step-down thermocycling procedure.42 A 12-µL vol- other records; and corroborative information from family mem- ume of each amplicon was digested with the appropriate re-

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 49

0.56 (0.03)

0.28 (0.03) 0.91 (0.17) 1.00 (0.15) 0.22 (0.02) 0.84 (0.82)

cen B21412C>T A61031G>C A61236C>T A61519T>C G2 + 99C>A G2 + 3145A>G tel

0.16 (0.002) 0.97 (0.91) 0.03 (0.001)

0.48 (0.04)

0.08 (0.003)

0.37 (0.01)

B 0.24 (0.03) 0.76 (0.14) 0.23 (0.04)

1.00 (0.03)

0.52 (0.06) 0.32 (0.001) 0.69 (0.01) 0.23 (0.02) 0.89 (0.62)

cen B21412C>T A61031G>C A61236C>T A61519T>C G2 + 99C>A G2 + 3145A>G tel

0.34 (0.001) 0.63 (0.41) 0.24 (0.03)

1.00 (0.02)

0.005 (0.001)

0.12 (0.07)

Figure 1. Pair-wise normalized linkage disequilibrium (DЈ) and correlation (r 2, in parentheses) coefficients between the 6 loci (boxed) in a Finnish sample (A) and in a Southwestern Native American population (B). Coefficients with PϽ.05 are in bold font. Cen indicates centromere; and tel, telomere.

striction enzyme (New England Biolabs, Beverly, Mass) (Table 1) LINKAGE package version 5.244 and HOMOG.45 Population according to the manufacturer’s specifications. The digested stratification was also evaluated using a variance-components products were electrophoresed in 10% 1X TBE polyacryl- approach that compares the between- and within-family com- amide gels, at 100 V for 1.5 hours at room temperature. Gels ponents of association,46,47 which is implemented in the com- were stained with ethidium bromide and photographed under puter program QTDT version 2.2.1.47 UV light. Pair-wise linkage disequilibrium coefficients (D), normal- Genotypes were read by 2 independent raters blind to di- ized linkage disequilibrium (DЈ, D divided by the maximum agnoses and were checked for mendelian segregation. Discrep- possible value of D), and correlation coefficients (r 2, the squared ant genotypes were regenotyped. The error rate was estimated total linkage disequilibrium divided by the product of the al- to be less than 1%. lelic frequencies at both loci) were estimated with MLOCUS.48,49 Significance levels were estimated from the ␹2 distribution. STATISTICAL ANALYSIS The only phenotype analyzed was DSM-III-R38 alcohol dependence. Two-point linkage analysis was conducted using the Differences in allele and genotype frequencies and deviation nonparametric sib-pair regression method,50 as programmed in of genotypes from Hardy-Weinberg equilibrium were evalu- the Sibpal module of the S.A.G.E. package.51 Haplotype asso- ated using the ␹2 test and the Fisher exact test for Hardy- ciation and localization was performed with TRIMHAP, a family- Weinberg equilibrium, which is implemented in the com- based haplotype test for linkage disequilibrium.52 First, the 6 puter program MENDEL version 5.0.43 Extreme cases of 5q34 marker genotypes were used to estimate marker haplo- population admixture and/or stratification can be detected by types for all pedigree members using GENEHUNTER.53 After- marked departure from Hardy-Weinberg equilibrium. Evi- wards, TRIMHAP was used to define a subset of markers that dence for population heterogeneity or admixture was further were feasible as ancestral haplotypes and to determine iden- evaluated using the computer programs LINKMAP from the tity by descent within the pedigrees. For each 3-locus haplo-

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 50

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 Table 2. Genotype and Allele Associations of GABAA 5q Polymorphisms to Alcohol Dependence in Finns (n=234)*

Locus Genotypes Statistics Alleles Statistics B2 1412CϾT C/C C/T T/T C T 2 2 Alcohol dependence 82 (0.74) 26 (0.24) 2 (0.02) ␹ 2 = 6.05,P = .048 190 (0.86) 30 (0.14) ␹ 1 = 6.27,P = .01 Controls 108 (0.88) 15 (0.112) 1 (0.008) 231 (0.93) 17 (0.07) A6 1031GϾC G/G G/C C/C G C 2 2 Alcohol dependence 48 (0.44) 44 (0.40) 18 (0.16) ␹ 2 = 3.71,P = .15 140 (0.63) 80 (0.37) ␹ 1 = 0.18,P = .64 Controls 47 (0.38) 64 (0.51) 13 (0.11) 158 (0.64) 90 (0.33) A6 1236CϾT (Pro385Ser) C/C (Pro/Pro) C/T (Pro/Ser) T/T (Ser/Ser) C (Pro) T (Ser) 2 2 Alcohol dependence 105 (0.95) 5 (0.05) 0 (0) ␹ 2 = 2.96,P = .23 215 (0.98) 5 (0.02) ␹ 1 = 2.70,P = .12 Controls 111 (0.89) 13 (0.11) 0 (0) 235 (0.95) 13 (0.05) A6 1519TϾC T/T T/C C/C T C 2 2 Alcohol dependence 46 (0.42) 47 (0.43) 17 (0.15) ␹ 2 = 12.1,P = .01 139 (0.63) 81 (0.37) ␹ 1 = 6.5,P = .01 Controls 28 (0.22) 75 (0.65) 21 (0.13) 131 (0.53) 117 (0.47) G2 + 99CϾA C/C C/A A/A C A 2 2 Alcohol dependence 52 (0.47) 49 (0.45) 9 (0.08) ␹ 2 = 0.49,P = .80 153 (0.70) 67 (0.30) ␹ 1 = 0.64,P = .42 Controls 52 (0.42) 60 (0.48) 12 (0.01) 164 (0.66) 84 (0.34) G2 + 3145AϾG A/A A/G G/G A G 2 2 Alcohol dependence 42 (0.38) 52 (0.47) 16 (0.15) ␹ 2 = 1.51,P = .50 136 (0.62) 84 (0.38) ␹ 1 = 1,39,P = .24 Controls 40 (0.33) 60 (0.48) 24 (0.19) 140 (0.56) 108 (0.44)

*Values are presented as number (proportion in the sample).

type in the sample, a haplotype-sharing score was calculated. and Figure 2). For Finns, the most highly significant TRIMHAP determined the category of each haplotype, added signals were at 3-locus haplotypes that included GABRA6 it to the trimmed-haplotype table, and constructed the sum of polymorphisms, with the peak signal at a 3-locus hap- haplotype-sharing scores over all categories. The empirical P lotype with the 3 GABRA6 polymorphisms (empirical values for the trimmed-haplotype statistic were estimated us- P=.004). Results were also significant at haplotypes that ing 10000 replicate samples generated by permutation boot- Ͼ strapping. A feature of replicate samples constructed using a included combinations of GABRA6 1236C T, GABRA6 1519TϾC, GABRG2 IVS9+99CϾA, and GABRG2 permutation scheme is that replicates are formed assuming the Ͼ null hypothesis H0 of linkage but linkage disequilibrium is true. IVS10+3415A G polymorphisms (empirical P=.01 to The use of this method, which is a family-based test, also .03). For Southwestern Native Americans, the most highly addresses the issue of association analysis of affected and un- significant signal was also at a haplotype that included affected individuals who share some degree of relationship, the 3 GABRA6 polymorphisms (empirical P=.02). Re- which is the case in the Southwestern Native American popu- sults were also significant at a haplotype that included lation sample. the GABRB2 1412CϾT, GABRA6 1031GϾC, and GABRA6 1236CϾT polymorphisms (empirical P=.01). RESULTS COMMENT Reflecting the semi-isolated nature of both populations, the Finns and the Southwestern Native Americans differed in allele frequencies, in 6-locus haplotype frequencies, and in Alcohol dependence has recently been the object of both overall patterns of linkage disequilibrium across the 5q34 positional cloning, or “reverse genetics,” and candidate GABAA cluster region (Figure 1). Within both popula- gene, or “forward genetics,” approaches for gene map- tions, there were no significant deviations of genotypic dis- ping. Roles in alcoholism vulnerability for alcohol meta- tributions from Hardy-Weinberg equilibrium for all the bolic gene polymorphisms have been validated and re- polymorphisms in study. For both populations, there is no viewed,21,55 but these loci contribute a substantial portion evidence of population heterogeneity or admixture. of the variance in risk only in the Southeast Asian popu- Consistent with an autosomal linkage scan previ- lations in which they are abundant. These findings, ously performed,54 sib-pair linkage of GABRG2 to alco- achieved by forward genetics, were made by relating func- hol dependence was observed in Finns (P=.008), al- tional alleles to alcohol pharmacokinetics to pheno- though not in Southwestern Native Americans. type. On the other hand, positional cloning in hu- Association of the GABRB2 1412T allele with alcohol de- mans56,57 and rodents58-60 has yielded loci, several at least pendence was detected in both Finns (P=.01) (Table 2) partially replicated, but not determinant alleles. Suc- and Southwestern Native Americans (P=.008) (Table 3), cesses in other complex diseases, such as breast cancer61 and the GABRA6 1519T allele was also associated with and Alzheimer disease,62 clearly indicate that a combi- alcohol dependence in both Finns (P=.01) (Table 2) and nation of mapping methods can lead to the discovery of Southwestern Native Americans (P=.03) (Table 3). vulnerability alleles. Linkage disequilibrium mapping with haplotypes Both the positional cloning and the candidate gene yielded evidence for an alcohol dependence locus in the paradigms that have been applied to the genetics of etha- 20,21,55 GABAA gene cluster region in both populations (Table 4 nol-related behaviors in humans and rodent ge-

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 51

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 Table 3. Genotype and Allele Associations of GABAA 5q Polymorphisms to Alcohol Dependence in Southwestern Native Americans (N=433)*

Locus Genotypes Statistics Alleles Statistics B2 1412CϾT C/C C/T T/T C T 2 2 Alcohol dependence 29 (0.15) 111 (0.58) 52 (0.27) ␹ 2 = 11.22,P = .004 169 (0.44) 215 (0.56) ␹ 1 = 7.07,P = .008 Unaffected 63 (0.26) 137 (0.57) 41 (0.17) 263 (0.55) 219 (0.45) A6 1031GϾC G/G G/C C/C G C 2 2 Alcohol dependence 119 (0.62) 67 (0.35) 6 (0.03) ␹ 2 = 5.3,P = .07 305 (0.79) 79 (0.21) ␹ 1 = 3.1,P = .08 Unaffected 173 (0.72) 60 (0.25) 8 (0.03) 406 (0.84) 76 (0.16) A6 1236CϾT (Pro385Ser) C/C (Pro/Pro) C/T (Pro/Ser) T/T (Ser/Ser) C (Pro) T (Ser) 2 2 Alcohol dependence 188 (0.98) 4 (0.02) 0 (0) ␹ 2 = 2.516,P = .29 380 (0.99) 4 (0.01) ␹ 1 = 2.41,P = .12 Unaffected 240 (0.996) 1 (0.004) 0 (0) 481 (0.998) 2 (0.002) A6 1519TϾC T/T T/C C/C T C 2 2 Alcohol dependence 8 (0.04) 69 (0.36) 115 (0.60) ␹ 2 = 9.496,P = .01 85 (0.22) 299 (0.78) ␹ 1 = 4.52,P = .03 Unaffected 7 (0.03) 65 (0.27) 169 (0.70) 79 (0.16) 403 (0.84) G2 + 99CϾA C/C C/A A/A C A 2 2 Alcohol dependence 88 (0.46) 96 (0.50) 8 (0.04) ␹ 1 = 1.02,P = .60 272 (0.71) 112 (0.29) ␹ 1 = 0.12,P = .73 Unaffected 116 (0.48) 111 (0.46) 14 (0.06) 343 (0.71) 139 (0.29) G2 + 3145AϾG A/A A/G G/G A G 2 2 Alcohol dependence 75 (0.39) 100 (0.52) 17 (0.09) ␹ 2 = 1.42,P = .51 250 (0.65) 134 (0.35) ␹ 1 = 0.15,P = .72 Unaffected 103 (0.43) 112 (0.46) 26 (0.11) 318 (0.66) 164 (0.34)

*Values are presented as number (proportion in the sample).

Table 4. Trimmed-Haplotype Test* for Linkage Disequilibrium of GABAA 5q Polymorphisms† to DSM-III-R Alcohol Dependence (AD) in Finns and Southwestern Native Americans

Polymorphisms and Haplotypes

Statistic‡ P Value§ AD ሻ 123456 Finns (N = 511) 2.913 .004 3-4 1 1 AD 2 2.723 .006 2-3 1 AD 1 2 1.744 .01 4-5 1 2 AD 1 1.366 .03 3-4 1 AD 2 1 2.359 .01 4-5 2 AD 1 1 2.235 .02 5-6 2 1 AD 1 Southwestern Native Americans (N = 433) 2.216 .02 2-3 2 2 AD 1 2.031 .02 2-3 2 AD 1 1 2.020 .02 3-4 2 1 AD 1

*Three-locus haplotype configurations along the 6 polymorphisms (eg, 1-2-3, 2-3-4, 3-4-5, and 4-5-6) were tested for a total of 64 haplotypes (4 3-locus haplotype configurationsϫ8 haplotypes within haplotype configurationϫ2 disease locations within a haplotype). Only haplotypes with empirical P values Յ.05 are shown here. †Polymorphisms: 1=GABRB2 1412CϾT; 2=GABRA6 1031GϾC; 3=GABRA6 1236CϾT (Pro385Ser); 4=GABRA6 1519TϾC; 5=GABRG2 IVS9+99CϾA; 6=GABRG2 IVS10+3415AϾG. ‡The statistic was a category-similarity score, which was estimated using the trimming probability (MacLean et al52). This statistic measures the similarity between haplotypes in each category and their putative ancestral founder haplotype. §Empirical P values estimated using 10000 replicate samples generated by permutation bootstrapping. ࿣Location of the AD disease predisposition locus in the tested haplotype. The AD locus was located within the indicated interval between numbered polymorphisms.

netic models58-60 have produced convergent evidence im- observed both in Finns and in Southwestern Native Ameri- plicating the region (5q34 in humans) containing a GABAA cans narrow the region, so that it seems the linkage sig- 20,21 receptor gene cluster. These studies have focused fur- nals emanate from the GABAA gene cluster itself. Since ther interest on genetic variation in GABAA receptors, the GABAA cluster spans more than 700 kilobases and which had already been implicated by pharmacobehav- includes 4 receptor subunit genes, we applied haplotype- ioral and receptor-pharmacology data as potential gate- based localization to further narrow the location of the keepers in ethanol response.9,10 Furthermore, locus- risk gene, and we found the ␣6 Pro385Ser amino acid based linkage evidence in the Finnish sample studied here polymorphism positioned within the signal peak. positionally implicated the chromosome 5q34 region in Semi-isolated populations with relatively smaller sizes, alcohol dependence.54 The allele-based associations we low ethnic diversity, and more homogeneous environ-

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 52

Cen Tel

GABRB2 GABRA6 GABRA1 GABRG2

B P Values .006 .004 .01 .02

Finns B2 1412C>T A6 1031G>C A6 1236C>T A6 1519T>C G2 + 99C>A G2 + 3145A>G Tel (Pro385Ser)

Cen 390 9 1 450 4 Tel Kb

SWNA B2 1412C>T A6 1031G>C A6 1236C>T A6 1519T>C G2 + 99C>A G2 + 3145A>G Tel (Pro385Ser)

P Values .02 .02

Figure 2. (A) Chromosome 5q34 GABAA gene cluster fine structure and (B) haplotype-based localization of alcohol dependence to the 5q34 GABAA gene cluster: trimmed-haplotype test results. The P values correspond to the inter–single nucleotide polymorphism location for the putative alcohol-dependence susceptibility locus. Cen indicates centromere; SWNA, Southwestern Native Americans; and Tel, telomere.

ments are invaluable in the genetic analysis of complex pendence in both Finns and Southwestern Native Ameri- disorders because reduction in genetic and environmen- cans. The GABRA6 1519T associations are consistent with tal heterogeneity facilitates the identification of specific previous studies in a Scottish sample32 and a German factors that affect vulnerability.63 Since alcohol depen- sample.33 The GABRB2 1412T associations in Finns and dence is a complex disorder with diverse genetic and en- Southwestern Native Americans are consistent with the Scot- vironmental contributions, we decided to study samples tish population findings but not the German sample find- from 2 semi-isolated populations with well-defined ge- ings. Furthermore, although we found sib-pair linkage to netic compositions and relatively homogeneous envi- GABRG2 in 1 population (Finns) and neither population ronments (ie, Finns and members of a Southwestern Na- showed association of alcohol dependence with GABRG2 tive American population). In addition, because of founder alleles, association between alcoholism and GABRG2 effects and reduced population size, linkage disequilib- IVS10+3145 G has been reported in a Japanese sample.34 rium in such populations is enhanced, leading to con- In addition to sib-pair linkage and association analy- servation of haplotypes containing disease alleles.64,65 The ses, we also applied a family-based haplotype localiza- strategy was to increase the odds of finding out whether tion strategy, which exploits the power of linkage dis- genetic changes in the 5q34 GABAA gene cluster have a equilibrium to identify ancestrally related chromosomes role in the susceptibility to alcohol dependence. In ad- that carry an allele that influences disease.52 The trimmed- dition to the testing for significant departure from Hardy- haplotype statistic allows detecting linkage disequilib- Weinberg equilibrium, which occurs in more extreme rium due to ancestral haplotypes, and the algorithm is cases of population admixture and/or stratification and designed to be repeated with the disease-susceptibility which was not detected in either population, the results locus located at a grid of positions covering a chromo- from the tests that were used for detection of more subtle somal region in study. This method addressed the need population heterogeneity or admixture and for popula- of a family-based association test for related individuals tion stratification confirmed the low genetic heteroge- in the Southwestern Native American sample and al- neity for both populations. lowed the localization of a putative alcohol-dependence In this study, there were several instances where we susceptibility locus within the 5q34 GABAA cluster, with found allele-based association in the absence of sib-pair the lowest P values implicating GABRA6 polymor- linkage of the same phenotype to the same locus, and we phisms in both Finnish and Southwestern Native Ameri- detected linkage of GABRG2 to alcohol dependence in the can population samples (Figure 2). Finnish sample but not in the Southwestern Native Ameri- Several disease-vulnerability alleles have been shown can sample. The explanation for this disparity need not to reside on characteristic haplotype backgrounds so that be a biological mechanism whereby allele-based associa- their detection would have been possible through asso- tions could occur in populations in the absence of locus ciation to ancestrally related haplotypes.69,70 Linkage dis- linkage in families.66 Sib-pair linkage may fail to detect link- equilibrium coefficient estimates between alleles at the 67 age to loci of minor effect, whereas allele effects at these 6 loci in the 5q34 GABAA gene cluster did not clearly vary loci may be readily detectable by association.68 as a function of distance in either Finns or Southwest- The results we obtained are convergent with previ- ern Native Americans, nor did the correlation coeffi- ously published data, despite the ethnic diversity of the cients (Figure 1). Decoupling between the extent of link- populations represented. The GABRA6 1519T and the age disequilibrium and physical distance can reflect a GABRB2 1412T alleles were associated with alcohol de- variety of complexities in the histories (eg, mutation, se-

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 53

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 lection, genetic drift, and migration) of popula- 7. Thomasson HR, Crabb DW, Edenberg HJ, Li TK, Hwu HG, Chen CC, Yeh EK, Yin tions64,65,71,72 and can vary even within the same popula- SJ. Low frequency of the ADH2*2 allele among Atayal natives of Taiwan with 64,65 alcohol use disorders. Alcohol Clin Exp Res. 1994;18:640-643. tion from one chromosome region to the other. 8. Suzdak PD, Schwartz RD, Skolnick P, Paul SM. Ethanol stimulates gamma- Given that our findings in these 2 semi-isolated popu- aminobutyric acid receptor-mediated chloride transport in rat brain lations, in conjunction with data in the literature, strongly synaptoneurosomes. Proc Natl Acad Sci U S A. 1986;83:4071-4075. 9. Macdonald RL, Olsen RW. GABAA receptor channels. Annu Rev Neurosci. 1994; implicate the 5q34 GABAA cluster in alcohol dependence, the next critical steps in evaluating the genes in 17:569-602. 10. Whiting PJ, Bonnert TP, McKernan RM. Molecular and functional diversity of the this region are likely to be single nucleotide polymor- expanding GABAA receptor gene family. Ann N Y Acad Sci. 1999;868:645- phism genotyping across the 5q34 GABAA gene cluster 653. and the identification of functional alleles that may in- 11. Benke D, Mertens S, Trzeciak A, Gillessen D, Mohler H. GABAA receptors dis- fluence gene expression and of alleles that alter receptor play association of ␥2-subunit with ␣1- and ␤2/3 subunits. J Biol Chem. 1991; 266:4478-4483. structure. Among the 5q34 GABAA receptor genes, ␣ 12. Mertens S, Benke D, Mohler H. GABAA receptor populations with novel subunit GABRA6, which encodes the 6 subunit, is peculiar in combinations and drug binding profiles identified in brain by ␣5- and ␦-sub- showing selective expression in the cerebellum. It is im- units specific immunopurification. J Biol Chem. 1993;268:5965-5973. plicated in alcohol dependence both by haplotype local- 13. Fritschy JM, Mohler H. GABAA-receptor heterogeneity in the adult rat brain: dif- ization and by association with Ser385, a relatively abun- ferential regional and cellular distribution of seven major subunits. J Comp Neurol. 1995;359:154-194. dant nonconservative missense variant, which may alter 14. Bohlhalter S, Weinman O, Mohler H, Fritschy JM. Laminar compartmentaliza- 40 phosphorylation of the receptor protein. However, function of GABAA-receptor subtypes in the spinal cord. J Neurosci. 1996;16:283- tionality of Ser385 or any other human GABAA subunit 297. 15. Benke D, Fritschy JM, Trzeciak A, Bannwarth W, Mohler H. Distribution, preva- variant has yet to be demonstrated. For GABAA receptors, this challenge is complicated by the heteropenta- lence and drug-binding profile of GABAA-receptors subtypes differing in ␤-subunit isoform. J Biol Chem. 1994;269:27100-27107. meric nature of the receptor channel (creating a poten- 16. Hoffman PL, Tabakoff B, Szabo G, Suzdak PD, Paul SM. Effect of an imidazo- tial need to express subunit alleles in different molecular benzodiazepine, Ro15-4513, on the incoordination and hypothermia produced contexts) and the possibility that differences in cellular by ethanol and pentobarbital. Life Sci. 1987;41:611-619. environment can affect the ability of an allele to alter ex- 17. Franks NP, Lieb WR. Molecular and cellular mechanisms of general anaesthesia. pression or protein posttranslational modification. Iso- Nature. 1994;367:607-614. 18. Harrison NL, Majewska MD, Harrington JW, Barker JL. Structure-activity rela- lation of the vulnerability allele(s) located within the chro- tionships for steroid interaction with the gamma-aminobutyric acidA receptor mosome 5q GABAA gene complex will enable us to better complex. J Pharmacol Exp Ther. 1987;241:346-353. understand interindividual variation in vulnerability to 19. Boyle AE, Segal R, Smith BR, Amit Z. Bidirectional effects of GABAergic ago- alcohol dependence and would lead to improvements in nists and antagonists on maintenance of voluntary ethanol intake in rats. Phar- macol Biochem Behav. 1993;46:179-182. detection and treatment of at least a subset of patients 20. Loh EW, Ball D. Role of the GABA(A)beta2, GABA(A)alpha6, GABA(A)alpha1 and with this common, debilitating disorder. GABA(A)gamma2 receptor subunit genes cluster in drug responses and the de- velopment of alcohol dependence. Neurochem Int. 2000;37:413-423. 21. Radel M, Goldman D. Pharmacogenetics of alcohol response and alcoholism: Submitted for Publication: December 12, 2003; final re- the interplay of genes and environmental factors in thresholds for alcoholism. vision received August 3, 2004; accepted August 19, 2004. Drug Metab Dispos. 2001;29:489-494. Correspondence: Marta Radel, MD, PhD, Bioconsult, 22. Wafford KA, Burnett DM, Dunwiddie TV, Harris RA. Genetic differences in the 17702 Calabar Dr, Gaithersburg, MD 20877 (martaradel ethanol sensitivity of GABAA receptors expressed in Xenopus oocytes. Science. 1990;249:291-293. @verizon.net). 23. Crabbe JC, Belknap JK, Buck KJ. Genetic animal models of alcohol and drug abuse. Funding/Support: This study was supported by grants Science. 1994;264:1715-1723. ␥ from the National Institute on Alcohol Abuse and Alco- 24. Buck KJ, Hood HM. Genetic association of a GABAA receptor 2 subunit variant holism, National Institutes of Health, Bethesda, Md (Dr with severity of acute physiological dependence on alcohol. Mamm Genome. 1998; Goldman). 9:975-979. 25. Korpi ER, Kleingoor C, Kettenmann H, Seeburg PH. Benzodiazepine-induced mo- Acknowledgment: We would like to thank Longina tor impairment linked to point mutation at cerebellar GABAA receptor. Nature. Akhtar, MS, and Lisa Moore for their excellent techni- 1993;361:356-359. cal assistance. 26. Schuckit MA, Smith TL, Radel M, Iwata N, Goldman D. Selective genotyping for the role of 5-HT2A, 5-HT2C, and the GABAA ␣6 receptors and the serotonin trans- porter in the level of response to alcohol: a pilot study. Biol Psychiatry. 1999; REFERENCES 45:647-651. 27. Cowley DS, Roy-Byrne PP, Radant A, Hommer DW, Greenblatt DJ, Vitaliano PP, 1. Kessler RC, McGonagle KA, Zhao S, Nelson CB, Hughes M, Eshleman S, Wittchen Godon C. Eye movement effects of diazepam in sons of alcoholic fathers and H-U, Kendler KS. Lifetime and 12-month prevalence of DSM-III-R psychiatric dis- male control subjects. Alcohol Clin Exp Res. 1994;18:324-332. orders in the United States. Arch Gen Psychiatry. 1994;51:8-14. 28. Iwata N, Cowley D, Radel M, Roy-Byrne P, Goldman DA. Pro385Ser substitution 2. Bohman M, Sigvardsson S, Cloninger CR. Maternal inheritance of alcohol abuse: in the GABAA receptor ␣6 subunit gene associates with benzodiazepine sensitivity. cross-fostering analysis of adopted women. Arch Gen Psychiatry. 1981;38: Am J Psychiatry. 1999;156:1447-1449. 965-969. 29. Schuckit MA. Ethanol-induced changes in body sway in men at high alcoholism 3. Cloninger CR, Bohman M, Sigvardsson S. Inheritance of alcohol abuse: cross- risk. Arch Gen Psychiatry. 1985;42:375-379. fostering analysis of adopted men. Arch Gen Psychiatry. 1981;38:861-866. 30. Schuckit MA. Low level of response to alcohol as a predictor of future alcoholism. 4. Kendler KS, Heath AC, Neale MC, Kessler RC, Eaves LJ. A population-based twin Am J Psychiatry. 1994;151:184-193. study of alcoholism in women. JAMA. 1992;268:1877-1882. 31. Schuckit MA. Alcohol-related disorders. In: Kaplan HI, Sadok BJ, eds. Compre- 5. Goldman D, Bergen A. General and specific inheritance of substance abuse and hensive Textbook of Psychiatry. 6th ed. New York, NY: Plennum Press; 1995: alcoholism. Arch Gen Psychiatry. 1998;55:964-965. 775-791. 6. Shibuya A, Yoshida A. Genotypes of alcohol-metabolizing enzymes in Japanese 32. Loh EW, Smith I, Murray R, McLaughlin M, McNulty S, Ball D. Association be- with alcohol liver diseases: a strong association of the usual Caucasian-type al- tween variants at the GABAAbeta2, GABAAalpha6 and GABAAgamma2 gene clus- dehyde dehydrogenase gene (ALDH2) with the disease. Am J Hum Genet. 1988; ter and alcohol dependence in a Scottish population. Mol Psychiatry. 1999; 43:744-748. 4:539-544.

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 54

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 33. Sander T, Ball D, Murray R, Patel J, Samochowiec J, Winterer G, Rommels- 55. Li TK. Pharmacogenetics of responses to alcohol and genes that influence alco- pacher H, Schmidt LG, Loh EW. Association analysis of sequence variants of the hol drinking. J Stud Alcohol. 2000;61:5-12. GABAA alpha6, beta2, and gamma2 gene cluster and alcohol dependence. Al- 56. Reich T, Edenberg HJ, Goate A, Williams JT, Rice JP, Van Eerdewegh P, Foroud cohol Clin Exp Res. 1999;23:427-431. T, Hesselbrock V, Schuckit MA, Bucholz K, Porjesz B, Li TK, Conneally PM, Nurn- 34. Loh EW, Higuchi S, Matsushita S, Murray R, Chen CK, Ball D. Association analy- berger JI Jr, Tischfield JA, Crowe RR, Cloninger CR, Wu W, Shears S, Carr K, sis of the GABA(A) receptor subunit genes cluster on 5q33-34 and alcohol de- Crose C, Willig C, Begleiter H. Genome-wide search for genes affecting the risk pendence in a Japanese population. Mol Psychiatry. 2000;5:301-307. for alcohol dependence. Am J Med Genet. 1998;81:207-215. 35. Lappalainen J, Long JC, Eggert M, Ozaki N, Robin RW, Brown GL, Naukkarinen 57. Long JC, Knowler WC, Hanson RL, Robin RW, Urbanek M, Moore E, Bennett H, Virkkunen M, Linnoila M, Goldman D. Linkage of antisocial alcoholism to the PH, Goldman D. Evidence for genetic linkage to alcohol dependence on chro- serotonin 5-HT1B receptor gene in 2 populations. Arch Gen Psychiatry. 1998; mosomes 4 and 11 from autosome-wide scan in an American Indian population. 55:989-994. Am J Med Genet. 1998;81:216-221. 36. Cloninger CR. Neurogenetic adaptive mechanisms in alcoholism. Science. 1987; 58. Crabbe JC, Belknap JK, Mitchell SR, Crawshaw LI. Quantitative trait loci map- 236:410-416. ping of genes that influence the sensitivity and tolerance to ethanol-induced hy- 37. Babor TF, Hofmann M, DelBoca FK, Hesselbrock V, Meyer RE, Dolinsky ZS, Roun- pothermia in BXD recombinant inbred mice. J Pharmacol Exp Ther. 1994;269: saville B. Types of alcoholics, I: evidence for an empirically derived typology based 184-188. on indicators of vulnerability and severity. Arch Gen Psychiatry. 1992;49:599- 59. Johnson TE, DeFries JC, Markel PD. Mapping quantitative trait loci for behav- 608. ioral traits in the mouse. Behav Genet. 1992;22:635-653. 38. American Psychiatric Association. Diagnostic and Statistical Manual of Mental 60. Carr LG, Foroud T, Bice P, Gobbett T, Ivashina J, Edenberg H, Lumeng L, Li TK. Disorders, Revised Third Edition. Washington, DC: American Psychiatric Press; A quantitative trait locus for alcohol consumption in selectively bred rat lines. 1987. Alcohol Clin Exp Res. 1998;22:884-887. 39. Robin RW, Long JC, Rasmussen JK, Albaugh B, Goldman D. Relationship of binge 61. Hall JM, Lee MK, Newman B, Morrow JE, Anderson LA, Huey B, King MC. Link- drinking to alcohol dependence, other psychiatric disorders, and behavioral prob- age of early-onset familial breast cancer to chromosome 17q21. Science. 1990; lems in an American Indian tribe. Alcohol Clin Exp Res. 1998;22:518-523. 250:1684-1689. 40. Iwata N, Virkkunen M, Goldman D. Identification of a naturally occurring Pro385- 62. Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW, Ser385 substitution in the GABA(A) receptor alpha6 subunit gene in alcoholics Roses AD, Haines JL, Pericak-Vance MA. Gene dose of apolipoprotein E type 4 and healthy volunteers. Mol Psychiatry. 2000;5:316-319. allele and the risk of Alzheimer’s disease in late onset families. Science. 1993; 41. Cheng AT, Loh EW, Cheng CY, Wang YC, Hsu YP. Polymorphisms and intron 261:921-923. sequences flanking the alternatively spliced 8-amino-acid exon of gamma2 sub- 63. Lander E, Kruglyak L. Genetic dissection of complex traits: guidelines for inter- unit gene for GABAA receptors. Biochem Biophys Res Commun. 1997;238: 683-685. preting and reporting linkage results. Nat Genet. 1995;11:241-247. 42. Cotton RGH. Mutation detection. In: E.E.A.F.S., ed. The Practical Approach Se- 64. Taillon-Miller P, Bauer-Sardina I, Saccone NL, Putzel J, Laitinen T, Cao A, Kere ries. New York, NY: Oxford University Press; 1998:241. J, Pilia G, Rice JP, Kwok PY. Juxtaposed regions of extensive and minimal link- 43. Lange K, Cantor R, Horvath S, Perola M, Sabatti C, Sinsheimer J, Sobel E. Men- age disequilibrium in human Xq25 and Xq28. Nat Genet. 2000;25:324-328. del version 4.0: a complete package for the exact genetic analysis of discrete 65. Eaves IA, Merriman TR, Barber RA, Nutland S, Tuomilehto-Wolf E, Tuomilehto traits in pedigree and population data sets. Am J Hum Genet. 2001;69(suppl) J, Cucca F, Todd JA. The genetically isolated populations of Finland and Sardinia :A1886. may not be a panacea for linkage disequilibrium mapping of common disease 44. Lathrop GM, Lalouel JM, Julier C, Ott J. Strategies for multilocus linkage analy- genes. Nat Genet. 2000;25:320-323. sis in humans. Proc Natl Acad Sci U S A. 1984;81:3443-3446. 66. Hodge SE. What association analysis can and cannot tell us about the genetics 45. Ott J. Analysis of Human Genetic Linkage. Rev ed. Baltimore, Md: Johns Hop- of complex disease. Am J Med Genet. 1994;54:318-323. kins University Press; 1991. 67. Lander ES, Schork NJ. Genetic dissection of complex traits. Science. 1994;265: 46. Fulker DW, Cherny SS, Sham PC, Hewitt JK. Combined linkage and association 2037-2048. sib-pair analysis for quantitative traits. Am J Hum Genet. 1999;64:259-267. 68. Risch N, Merikangas K. The future of genetic studies of complex human diseases. 47. Abecasis GR, Cardon LR, Cookson WOC. A general test of association for quan- Science. 1996;273:1516-1517. titative traits in nuclear families. Am J Hum Genet. 2000;66:279-292. 69. Tishkoff SA, Goldman A, Calafell F, Speed WC, Deinard AS, Bonne-Tamir B, Kidd 48. Long JC. Multiple Locus Haplotype Analysis. Version 2.0. Bethesda, Md: Na- JR, Pakstis AJ, Jenkins T, Kidd KK. A global haplotype analysis of the myotonic tional Institutes of Health; 1999. dystrophy locus: implications for the evolution of modern humans and for the 49. Long JC, Williams RC, Urbanek M. An E-M algorithm and testing strategy for origin of myotonic dystrophy mutations. Am J Hum Genet. 1998;62:1389- multiple locus haplotypes. Am J Hum Genet. 1995;56:799-810. 1402. 50. Haseman JK, Elston RC. The investigation of linkage between a quantitative trait 70. Osier MV, Pakstis AJ, Soodyall H, Comas D, Goldman D, Odunsi A, Okonofua F, and a marker locus. Behav Genet. 1972;2:3-19. Parnas J, Schulz LO, Bertranpetit J, Bonne-Tamir B, Lu RB, Kidd JR, Kidd KK. 51. S.A.G.E.: Statistical Analysis for Genetic Epidemiology. Release 2.2. New Or- A global perspective on genetic variation at the ADH genes reveals unusual pat- leans, La: Department of Biometry and Genetics, LSU Medical Center; 1996. terns of linkage disequilibrium and diversity. Am J Hum Genet. 2002;71:84- 52. MacLean CJ, Martin RB, Sham PC, Wang H, Straub RE, Kendler KS. The trimmed- 99. haplotype test for linkage disequilibrium. Am J Hum Genet. 2000;66:1062-1075. 71. Kidd KK, Morar B, Castiglione CM, Zhao H, Pakstis AJ, Speed WC, Bonne-Tamir 53. Kruglyak L, Daly MJ, Reeve-Daly MP, Lander ES. Parametric and nonparametric B, Lu RB, Goldman D, Lee C, Nam YS, Grandy DK, Jenkins T, Kidd JR. linkage analysis: a unified multipoint approach. Am J Hum Genet. 1996;58: A global survey of haplotype frequencies and linkage disequilibrium at the DRD2 1347-1363. locus. Hum Genet. 1998;103:211-227. 54. Vallejo RL, Long JC, Hoopes D, Virkkunen M, Goldman D. Autosomal genome 72. Peterson RJ, Goldman D, Long JC. Nucleotide sequence diversity in non-coding scan for loci linked to alcohol abuse and related psychiatric disorders in Finnish regions of ALDH2 as revealed by restriction enzyme and SSCP analysis. Hum pedigrees. Alcohol Clin Exp Res. 1998;11:97A. Genet. 1999;104:177-187.

(REPRINTED) ARCH GEN PSYCHIATRY/ VOL 62, JAN 2005 WWW.ARCHGENPSYCHIATRY.COM 55