VPS29 Exerts Opposing Effects on Endocytic Viral Entry 2 3 4 Daniel Poston1,2, Yiska Weisblum1, Alvaro Hobbs1, Paul D

bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 VPS29 exerts opposing effects on endocytic viral entry 2 3 4 Daniel Poston1,2*, Yiska Weisblum1*, Alvaro Hobbs1, Paul D. Bieniasz1,3 5 6 7 1. Laboratory of Retrovirology, The Rockefeller University, 1230 York Avenue, New York NY 8 10065 9 2. Weill Cornell/Rockefeller/Sloan-Kettering Tri-Institutional MD-PhD Program, 1300 York 10 Avenue, New York NY 10021 11 3. Howard Hughes Medical Institute, The Rockefeller University, 1230 York Avenue, New 12 York NY 10065 13 14 15 *These authors contributed equally 16 17 18 Correspondence to: Paul D. Bieniasz, Laboratory of Retrovirology, The Rockefeller University, 19 31 1230 York Avenue, New York NY 10065 E.Mail [email protected] 20 21 22 23 SUMMARY 24 Emerging zoonotic viral pathogens threaten global health and there is an urgent need to discover 25 host and viral determinants influencing infection. We performed a loss-of-function genome-wide 26 CRISPR screen in a human lung cell line using HCoV-OC43, a human betacoronavirus. One 27 candidate gene, VPS29, was required for infection by HCoV-OC43, SARS-CoV-2, other 28 endemic and pandemic threat coronaviruses as well as ebolavirus. However, VPS29 deficiency 29 had no effect on certain other viruses that enter cells via endosomes and had an opposing, 30 enhancing effect on influenza A virus infection. VPS29 deficiency caused changes endosome 31 morphology, and acidity and attenuated the activity of endosomal proteases. These changes in 32 endosome properties caused incoming coronavirus, but not influenza virus particles, to become 33 entrapped therein. Overall, these data show how host regulation of endosome characteristics can 34 influence viral susceptibility and identify a host pathway that could serve as a pharmaceutical 35 target for intervention in zoonotic viral diseases. 36 37 KEYWORDS: 38 SARS-CoV-2, COVID-19, coronavirus, influenza virus, ebolavirus, genome-wide CRISPR 39 screen, respiratory viruses, VPS29, viral entry, trafficking, zoonosis 40 41 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

42 INTRODUCTION 43 44 Because viruses rely on host cellular proteins to replicate, an attractive strategy for the next- 45 generation of antiviral therapies is targeted inhibition of human proteins—termed “dependency 46 factors”—that are required for viral replication. Of particular interest are human proteins 47 required by diverse viral lineages, encompassing not only known human pathogens but animal 48 viruses that are of concern for future spillover into human populations. One universal aspect of 49 the viral lifecycle that could be targeted pharmacologically is viral entry. All enveloped viruses 50 require fusion between viral and host cellular membranes for infection (White and Whittaker, 51 2016). Some enveloped viruses preferentially fuse at the plasma membrane, while others enter 52 cells via endocytosis and fuse in compartments of the endolysosomal system (Grove and Marsh, 53 2011). Viruses that fuse at the plasma membrane sometimes depend on the expression of cell 54 surface proteases to activate viral fusion proteins, while viruses that enter through endosomes 55 can be highly dependent on endosomal characteristics such as the presence of certain endosomal 56 proteases and/or endosomal pH (Laporte and Naesens, 2017; Marsh and Helenius, 2006). 57 58 The specific route of entry can dictate which dependency factors are required for productive 59 infection. For example, the hemagglutinin (HA) of most influenza A virus (IAV) strains must be 60 cleaved by trypsin-like proteases, which primes it for receptor binding and subsequent fusion 61 (Böttcher-Friebertshäuser et al., 2014). Like IAV, the spike protein of coronaviruses must also be 62 processed by proteases in order to enter target cells. However, unlike HA, the spike protein often 63 has two distinct cleavage sites, termed S1/S2 and S2’, that are cleaved during different stages of 64 the virus replication cycle, including biosynthesis (by the Golgi resident furin-like proteases) and 65 during entry (by cell surface TMPRSS2 protease or endosomal cathepsins) (Millet and 66 Whittaker, 2015). Cleavage regulates the liberation of the fusion peptide to enable fusion of the 67 viral envelope with the cellular membranes, allowing infection to proceed. Similarly, the 68 envelope protein of filoviruses, GP, requires two distinct cleavage steps. First, Furin mediated 69 cleavage during exocytosis yields two subunits, GP1 and GP2, which remain linked by disulfide 70 bonds to form the heterodimers that compose the trimeric envelope complex. Following 71 endocytosis, GP1 is further cleaved by endosomal proteases, mainly cathepsins, in a process that 72 removes the cap and the mucin-like domain to enable binding of GP1 to its endosomal receptor, 73 Niemann-Pick C1 (NPC1)(Volchkov and Klenk, 2018). 74 75 In this century alone, four emerging zoonotic respiratory pathogens—SARS-Coronavirus (CoV), 76 MERS-CoV, H1N1 influenza A virus (IAV), and SARS-CoV-2—have caused significant 77 morbidity and mortality. Of these, SARS-CoV, MERS-CoV, and SARS-CoV-2 are all 78 enveloped, positive-stranded RNA viruses in the genus betacoronavirus (Coronaviridae Study 79 Group of the International Committee on Taxonomy of Viruses, 2020). Four other coronaviruses 80 are known to infect humans; Human CoV (HCoV)-OC43 and HCoV-HKU1 are members of the 81 betacoronavirus genus (Killerby et al., 2018), while HCoV-229E and HCoV-NL63 are members 82 of the alphacoronavirus genus. Each generally causes only mild illness. To identify coronavirus 83 dependency factors, we performed a genome-wide loss-of-function CRISPR screen using HCoV- 84 OC43 in a human lung cell line, and focused on candidate hits that are required by diverse 85 Coronaviridae. We identified one such factor, VPS29, that is broadly required by both human 86 and animal CoVs. VPS29 is a component of both retromer (VPS26/VPS29/VPS35) and retriever 87 (DSCR3/VPS29/C16orf62), two distinct but related complexes that, together with the bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

88 CCDC22/CCDC93/COMMD (CCC) complex, mediate endosome-to-plasma-membrane and 89 endosome-to-TGN recycling of transmembrane cargo (Baños-Mateos et al., 2019; McNally et 90 al., 2017; Phillips-Krawczak et al., 2015; Singla et al., 2019). We show that loss of VPS29 91 impairs CoV infection, and also causes failure of ebolavirus infection. In stark contrast, we show 92 that VPS29 deficiency facilitates IAV infection. We further show that VPS29 deficiency causes 93 profound changes in endosomal properties, including alteration of morphology, acidity and 94 proteolytic activity that differentially impact the egress of viruses from endosomes. 95 96 RESULTS 97 A genome wide screen reveals HCoV-OC43 dependency factors 98 To identify host proteins required for HCoV-OC43 infection, we performed a genome-wide 99 CRISPR screen in the A549 lung adenocarcinoma cell line. Briefly, A549 cells were transduced 100 with the Brunello sgRNA library (Doench et al., 2016; Sanson et al., 2018) at a low MOI (0.3) 101 and high coverage (500X) to generate a population of cells each harboring a single sgRNA. After 102 selection to remove untransduced cells, A549-Brunello cells were infected with HCoV-OC43 at 103 an MOI of 0.1 and incubated for 1 week to allow viral-induced cell death to occur (Figure 1A). 104 Enrichment of sgRNA sequences in the surviving cells—i.e. those putatively lacking a 105 dependency factor—was assessed using MAGeCK (Li et al., 2014). 106 107 We identified 34 candidate dependency factors, defined as genes scoring higher than the highest 108 scored non-targeting control (Figure 1B). As a positive control, we identified CASD1, the 109 enzyme responsible for the generation 9-O-acetylated sialic acids, which serve as the receptor for 110 HCoV-OC43 (Schwegmann-Wessels and Herrler, 2006). Consistent with several other genome 111 wide screens for viral dependency factors, we identified multiple genes (SLC35B2, XYLT2, and 112 B4GALT7) involved in heparan sulfate biosynthesis, implying that heparan sulfate is an 113 attachment factor for HCoV-OC43 (Gao et al., 2019; Luteijn et al., 2019; Milewska et al., 2014; 114 Park et al., 2017; Schneider et al., 2020). 115 116 To further classify gene hits (Figure 1C), we performed a functional enrichment analysis using 117 string-db followed by annotation with UniProt keywords (Szklarczyk et al., 2019; UniProt 118 Consortium, 2019). Many of the hits were associated with intracellular transport or endosome 119 activity including VPS29, the CCDC22/CCDC93/COMMD3 (CCC) complex, and the 120 WDR81/91 complex, suggesting a requirement for these functions in HCoV-OC43 infection. 121 Additionally, we identified PIK3C3, which generates phosphatidylinositol 3-phosphate (PI(3)P), 122 a phospholipid required for the recruitment of retromer to endosomes (Burda et al., 2002). Some 123 of the genes identified by our screen were also recently reported in CRISPR screens utilizing 124 SARS-CoV-2, implying that they are broadly required for coronavirus infection (Daniloski et al., 125 2020; Zhu et al., 2021). 126 127 Requirement for candidate host factors is both cell type and virus dependent 128 We next investigated whether the VPS29/CCC complex and the WDR81/91 were required for 129 infection by a diverse panel of respiratory viruses, including coronaviruses. In addition to HCoV- 130 OC43, we tested additional seasonal HCoVs (HCoV-NL63 and HCoV-229E), rVSV/SARS- 131 CoV-2, a chimeric vesicular stomatitis virus encoding the SARS-CoV-2 Spike protein, as well as 132 other pathogenic respiratory viruses: IAV, adenovirus, and respiratory syncytial virus (RSV). 133 We used CRISPR/Cas9 to generate individual cell lines lacking each gene of interest and bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

134 confirmed knock-out (KO), both by sequencing target loci and by western blot analyses (Figure 135 S1A). Importantly, KO of these genes did not affect cellular viability or proliferation. Because 136 viral dependency factors identified via CRISPR screening might be required in a cell-type 137 specific manner, we evaluated the requirement of these genes for infection in multiple cell lines 138 expressing ACE2 (the receptor for both SARS-CoV-2 and HCoV-NL63): A549-ACE2, HT1080- 139 ACE2, and 293T-ACE2. 140 141 Given their function in endosomal trafficking, we hypothesized that these hits would most likely 142 affect viral entry. We therefore performed single-cycle infection assays and quantified infected 143 cells via flow cytometry. There was strong requirement for VPS29/CCC complex as well as 144 WDR81/91 in A549 cells for all CoVs tested (Figure 2A-D). However, the was no requirement 145 these factors in for IAV, adenovirus, or RSV infection of A549 cells (Figure 2E-G). In all other 146 cell lines tested, there was a strong requirement for VPS29 for all coronaviruses but no 147 dependency on VPS29 or the other candidate proteins was found for adenovirus and RSV 148 (Figure 2H-T). Since these viruses all rely on endocytic pathways for viral entry (Krzyzaniak et 149 al., 2013; Lakadamyali et al., 2004; Meier and Greber, 2004), these data indicate that 150 VPS29/CCC and WDR81/91 are specifically required for coronavirus infection, rather than 151 broadly impairing endocytic function. The magnitude of the effect of CCC complex and 152 WDR81/91 knockout on CoV infection was different in different cell lines. For example, KO of 153 the CCC complex or WDR81/91 had a blunted effect on CoV infection in HT1080-ACE2 cells 154 (Figure 2H-K). Moreover, in 293T-ACE2 cells, KO of the CCC complex inhibited HCoV-OC43 155 but not HCoV-NL63 or rVSV/SARS-CoV-2 infection, while WDR81/91 knockout impaired 156 infection for all three viruses (Figure 2O-Q). 157 158 We found that VSV infection was unaffected by VPS29 KO (Figure 2U). Because the sole 159 difference between rVSV/SARS-CoV-2 and VSV itself is that rVSV/SARS-CoV-2 enters cells 160 using the SARS-CoV-2 spike protein in lieu of VSV-G, these data suggest that it is the entry 161 pathway that imposes the requirement for VPS29. Given the strong requirement for VPS29 by all 162 tested HCoVs, in all cell lines tested, we sought to further confirm the relevance of VPS29 to 163 HCoV infection. To do so, we used CRISPR/Cas9 to KO VPS29 in normal human bronchial 164 epithelial (NHBE) primary lung cells. Loss of VPS29 strongly inhibited HCoV-OC43 infection 165 in NHBE cells (Figure 2V), suggesting that VPS29 is important for HCoV infection of 166 physiologically relevant cells. 167 168 In contrast to effects on coronavirus infection, we observed precisely the opposite effect of 169 VPS29 or CCC complex deficiency on IAV infection in HT1080-ACE2 and 293T-ACE2 cells. 170 That is, KO of VPS29 or CCC complex components enhanced IAV infection (Figure 2M,S) 171 while WDR81/91 KO had no effect. To confirm the phenotype observed using the IAV strain 172 A/WSN/33, we analyzed two separate strains of 2009 pandemic H1N1 IAV; 173 A/Netherlands/602/2009 (H1N1)pdm09 (H1N12009 Netherlands) and A/California/04/2009 174 (H1N1)pdm09 (H1N12009 California). We found that the ability of VPS29 KO to enhance IAV entry 175 was conserved in the pandemic IAV strains (Figure 2W,X). That the same set of endocytic 176 factors could promote infection of coronaviruses while antagonizing IAV infection indicates 177 endosome-based viral entry pathways are influenced by specific sets of host proteins that can 178 facilitate or restrict viral entry. 179 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

180 VPS29-associated proteins facilitate CoV infection and hinder IAV infection 181 Because of the opposing effects of VPS29 on HCoV and IAV infection, we elected to examine 182 this protein in more detail—specifically in HT1080 cells, where VPS29 KO strongly suppressed 183 CoV infection and facilitated IAV infection. VPS29 can participate in multiple different protein 184 complexes with distinct roles in normal cell biology (Baños-Mateos et al., 2019). Thus, in order 185 to clarify which VPS29 interacting proteins, if any, are important for facilitating CoV infection 186 and inhibiting IAV infection, we performed a focused siRNA screen targeting VPS29 interacting 187 proteins and assessed impact of knockdown (KD) on HCoV and IAV infection. 188 Knockdown of VPS26A, VPS29, VPS35, or RAB7A each impaired HCoV-OC43, HCoV-NL63, 189 HCoV-229E, and rVSV/SARS-CoV-2 infection (Figure 3A-D). These data strongly suggest that 190 the participation of VPS29 in the Retromer complex (VPS26A/VPS29/VPS35), which is 191 recruited to endosomes via Rab7A, is the means by which it facilitates CoV infection (Rojas et 192 al., 2008). Interestingly, KD of DSCR3 and C16orf62, which play analogous roles to VPS26 and 193 VPS35 and form the Retriever complex (McNally et al., 2017), inhibited HCoV-OC43 infection 194 but not HCoV-NL63, HCoV-229E, or rVSV/SARS-CoV-2 infection. 195 196 IAV infection was enhanced by KD of an overlapping set of VPS29 associated proteins, 197 specifically CCDC22, VPS35, VPS29, RAB7A, WASH1, and RAB21 (Figure 3E). WASH1 is a 198 member of the WASH complex, which facilitates formation of actin patches on endosomes, 199 interacts with and is critical for some protein-sorting functions of retromer (Seaman et al., 2013). 200 RAB21 is a known effector of the WASH complex (Del Olmo et al., 2019). These data thus 201 suggest that the enhancement of IAV infection in VPS29 KO cells is due to the absence of an 202 intact Retromer/WASH complex. While KO or KD of VPS29 facilitates IAV infection, KD of 203 some VPS29-interacting proteins impaired IAV infection. For example, KD of SNX6 impaired 204 IAV infection > 5-fold. However, KD of SNX6 did not affect HCoV infection, indicating that the 205 inhibition of IAV infection is not simply due to global impairment of endosomal function due to 206 SNX6 KD. 207 208 The ability of VPS29 to facilitate CoV infection and inhibit IAV infection depends on 209 interaction with retromer components and regulators 210 In an orthogonal approach to investigate the role of the Retromer complex in facilitating CoV 211 infection and hindering IAV infection, we generated HT1080 VPS29 KO single cell clones 212 (SCCs) and reconstituted with wildtype (WT) and mutant forms of VPS29. One VPS29 mutant 213 (I91D) does not interact with the Retromer component VPS35, while the other (L152E) does not 214 interact with TBC1D5, a RAB7A GTPase-activating protein that is critical for endosomal 215 recycling of known retromer cargoes (Collins et al., 2005; Harbour et al., 2010; Jia et al., 2016). 216 In agreement with our previous data, CoV infection was inhibited and IAV infection was 217 enhanced in the VPS29 KO SCC (Figure 3F-J). Normal HT1080 cell susceptibility was 218 substantially restored upon reconstitution with a construct expressing a WT, sgRNA-resistant 219 VPS29 (Figure S1 B,C). However, reconstitution with a construct expressing VPS29I91D or 220 VPS29L152E did not reverse the effects of VPS29 KO on HCoV or IAV infection (Figure 3F-J). 221 Overall, these data confirm that loss of the Retromer complex function is the major means by 222 which VPS29 KO affects CoV and IAV infection. 223 224 VPS29 deficiency results in enlarged, deacidified endosomes bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

225 To elucidate the impact of VPS29 on viral infection we next investigated the impact of VPS29 226 KO on normal endosomal function. We labeled endosomes in living cells using a construct 227 containing two FYVE domains fused to mScarlet (2XFYVE-mSCAR), which binds to PI(3)P 228 that is enriched on endosome membranes (Gillooly et al., 2000). Thereafter we treated cells with 229 Dextran labeled with pH-sensitive (pHrodo Green or pHrodo Red) or pH-insensitive (Alexa 230 Fluor (AF)-488) fluorophores to visualize endocytic cargo uptake, as well as the pH status of 231 these endosomes. 232 233 Unlike parental HT1080 cells, VPS29 KO cells displayed a prominent subset of enlarged PI(3)P- 234 positive endosomes. These enlarged endosomes were deacidified, as evident from decreased 235 pHrodo Green Dextran signal compared to endosomes in unmanipulated cells, or other smaller 236 endosomes in VPS29 KO cells (Figure 4A,B and S2). Importantly, there was a return to normal 237 endosome phenotype after reconstitution with wildtype VPS29, confirming that this effect is due 238 to VPS29 KO (Figure 4C and S2). The appearance of enlarged, deacidified vesicles was 239 maintained in VPS29 KO cells reconstituted with VPS29I91D or VPS29L152E (Figure 4D,E and 240 S2), suggesting that this phenotype is due to retromer disfunction. Quantification of the pH- 241 sensitive Dextran signal from these images revealed a 3.7-fold decrease in fluorescence intensity 242 in VPS29 KO cells (Figure 4F) that is rescued upon reconstitution with WT VPS29, but not with 243 VPS29I91D or VPS29L152E. Importantly, the enlarged endosomes in VPS29 KO cells exhibited 244 equivalent fluorescent intensity to endosomes in normal cells when cells were incubated with 245 pH-insensitive AF-488 Dextran, indicating that while they were deacidified, they were not 246 impaired in cargo loading (Figure 5A, B and S3). 247 248 VPS29 KO results in entrapment of rVSV/SARS-CoV-2 in endosomes 249 Given the above findings, we hypothesized that CoV infection is impaired in VPS29 KO cells 250 due to impediment in spike dependent egress from endosomes. To test this idea, we generated 251 rVSV/SARS-CoV-2NG-P, a replication-competent chimeric VSV expressing SARS-CoV-2 Spike 252 protein in lieu of VSV-G, and containing the VSV structural protein P fused to mNeonGreen 253 (NG-P), thus enabling the direct observation of entering viral particles (Schott et al., 2005). 254 255 At 60 minutes post infection of parental HT1080 cells few NG-P punctae were evident within 256 2xFYVE-mSCAR labeled endosomes, suggesting successful egress of most rVSV/SARS-CoV- 257 2NG-P particles (Figure 6A and S4A) and minimal accumulation therein. However, in VPS29 KO 258 cells, enlarged endosomes contained many rVSV/SARS-CoV-2NG-P punctae at 60 min after 259 infection. Likewise, when cells were infected in the presence of labeled Dextran and imaged 60 260 minutes post infection, we observed a similar phenotype with rVSV/SARS-CoV-2 particles 261 accumulated in enlarged, Dextran-containing vesicles in VPS29 KO cells (Figure 6B and S4B). 262 Overall, these data indicate that the major inhibitory effect of VPS29 KO on CoV infection is the 263 result of failed egress from endosomes. 264 265 Similar experiments in which incoming IAV virions were detected by immunofluorescence 60 266 min after (Figure 6C and S5) revealed that IAV particles did not accumulate in the enlarged 267 2xFYVE-mSCAR labeled endosomes in VPS29 KO cells. Thus, the effect of VPS29 KO on 268 rVSV/SARS-CoV-2 was indeed specific. In fact, there was significantly greater association 269 between incoming IAV and 2xFYVE-labeled endosomes in parental HT1080 cells as compared bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

270 to VPS29 KO cells (Figure 6C and S5), mirroring the opposing effects of VPS KO on HCoV and 271 IAV infection. 272 273 We hypothesized that such effect might be due to VPS29-dependent trafficking of antiviral 274 proteins with activity against IAV to endosomes, such as IFITM3. We observed that IFITM3 275 knockdown enhanced IAV infection of parental HT1080 cells (Figure S6A), in agreement with 276 previous reports (Feeley et al., 2011). However, IFITM3 knockdown augmented IAV infection 277 in VPS29 KO cells (Figure S6A), suggesting that the enhancement of IAV infection in VPS29 278 KO cells was not the result of loss of IFITM3 activity. Concordantly, IFITM3 localized to 279 2xFYVE-labeled endosomes in both WT and VPS29 KO cells, and there was no clear difference 280 in localization (Figure S6B). Overall. these finding suggest that enhanced IAV infection in 281 VPS29 KO cells is due to increased egress from endosomes but is not due to altered localization 282 and/or impaired activity of IFITM3. 283 284 Impairment of CoV and ebolavirus infection in VPS29 KO cells due to loss of endosomal 285 cathepsin activity 286 The aforementioned findings indicate that the reduced susceptibility to HCoV infection in 287 VPS29 KO cells is spike-specific and is the consequence of failed egress from endosomes. We 288 hypothesized that this effect could be due to impaired spike processing by endosomal proteases 289 during entry. We used HIV-1-based pseudotyped viruses to test the susceptibility of various CoV 290 spikes to VPS29 KO and cathepsin inhibition using the drug E64d. As rVSV/SARS-CoV-2 bears 291 a point mutation, R683G, which ablates the polybasic furin cleavage site, we tested pseudotypes 292 bearing WT or R683G mutant spike proteins, as well as spike proteins from SARS-CoV and 293 SARS-like CoV from bats and pangolins, which also do not contain polybasic cleavage sites 294 (Coutard et al., 2020). 295 296 Pseudotypes bearing both the WT and R683G mutant SARS-CoV-2 spike proteins were sensitive 297 to VPS29 KO and cathepsin inhibition. However, cathepsin inhibition did not further decrease 298 infection of VPS29 KO cells (Figure 7A). The SARS-CoV-2R683G (Figure7B), SARS-CoV 299 (Figure7C), and the SARS-like bat (Figure 7D) and pangolin viruses (Figure 7E,F) that lack furin 300 cleavage sites were more impacted by VPS29 KO and cathepsin inhibition than WT SARS-CoV- 301 2. Indeed, in several instances, VPS29 KO and/or cathepsin inhibition resulted in undetectable 302 infection by SARS-CoV-2R683G, SARS-CoV, and the SARS-like bat/pangolin CoVs. Similarly, 303 infectivity assays utilizing rVSV/SARS-CoV-2 also revealed a dose-dependent inhibition of 304 infectivity upon cathepsin inhibition in parental HT1080, but no impairment of infection upon 305 cathepsin inhibition in VPS29 KO cells (Figure 7G). 306 307 That there was no further effect of cathepsin inhibition on CoV infection in VPS29 KO cells 308 suggests that the effect of these two manipulations converge on a common pathway in promoting 309 egress from endosomes. We thus hypothesized that VPS29 KO impedes CoV infection by 310 impairing proper processing of spike by cathepsins. If this were indeed the case, then VPS29 KO 311 should impair infection mediated by ebolavirus (EBOV) glycoprotein (GP), which is known to 312 require processing by endosomal cathepsins (Schornberg et al., 2006). To test this, we performed 313 infectivity assays in WT and VPS29 KO cells using a recombinant VSV expressing EBOV GP in 314 lieu of VSV-G (rVSV/EBOV-GP) (Mulherkar et al., 2011). Indeed, we observed a strong 315 inhibition of rVSV/EBOV-GP with both cathepsin inhibition and loss of VPS29 (Figure 7H). bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

316 This result suggests that the susceptibility of VPS29 KO is mediated by impaired cathepsin 317 activity. 318 319 Consistent with the above conclusion, when parental HT1080 cells were treated with the 320 cathepsin inhibitor E64d, infected with rVSV/SARS-CoV-2 NG-P and examined microscopically, 321 we observed a phenotype similar to that seen in VPS29 KO cells (see Figure 6A). Specifically, 322 substantially more rVSV/SARS-CoV-2NG-P punctae were evident within endosomes, and the 323 endosomes appear enlarged with similar appearance and morphology to those observed in 324 VPS29 KO cells (Figure 7I and S7). To directly test whether VPS29 KO results in impaired 325 endosomal cathepsin activity, we measured endosomal cathepsin activity in WT and VPS29 KO 326 HT1080 cells using a substrate that generates a fluorescent signal upon cleavage by cathepsin L. 327 Indeed, in WT cells, we observed a strong red fluorescence signal in vesicular structures, 328 indicating high levels of cathepsin activity. However, in VPS29 KO cells the red fluorescence 329 signal was nearly absent, indicative of impaired cathepsin activity in VPS29 KO cells (Figure 330 7J). To determine if the loss of cathepsin L activity was the result of failed trafficking of 331 cathepsins to the endolysosomal system, we performed immunofluorescence studies utilizing 332 tagged cathepsin L in cells with endosomes labeled with 2xFYVE-mSCAR. There was no 333 change in cathepsin L localization to 2xFYVE-mSCAR-positive endosomes in VPS29 KO cells 334 (Figure 7K). These data suggest that the loss of cathepsin activity in VPS29 KO cells is not a 335 result of impaired trafficking of cathepsin itself to endosomes, but rather change endosomal 336 conditions in VPS29 KO cells, such as increased pH, reduces cathepsin activity therein. 337 338 DISCUSSION 339 While the advent of robust, high-throughput screening modalities has generated a wealth of 340 information regarding host-viral interactions, the underlying mechanism of action for many host 341 proteins implicated by these screens remain incompletely understood. Here, utilizing HCoV- 342 OC43 as a model HCoV, we employed a genome-wide loss-of-function CRISPR screen to 343 identify and characterize factors required for efficient CoV infection. In particular, we show that 344 the retromer subunit protein VPS29 is required for productive infection by diverse CoVs in a 345 variety of cell types. Other genome-wide screens using SARS-CoV-2 have also suggested a role 346 for VPS29 and the CCC as well as RAB7A, which recruits retromer to endosomes (Daniloski et 347 al., 2020; Hoffmann et al., 2021; Wang et al., 2021; Zhu et al., 2021) in HCoV infection 348 349 While previous studies have hypothesized that the mechanism whereby VPS29/CCC complex 350 facilitates SARS-CoV-2 infection is by maintaining cell surface expression of viral receptors 351 (Daniloski et al., 2020; Zhu et al., 2021), our findings indicate a different role. Indeed, infection 352 by HCoVs that use three distinct receptors was inhibited by VPS29/CCC KO, while there was no 353 VPS29/CCC requirement for infection by IAV, adenovirus, or RSV—which should otherwise 354 also be dependent on cell-surface expression of their respective receptors. Indeed, HCoV- 355 OC43’s purported receptor (9-O-acetylated sialic acid) is nearly identical to IAV’s receptor 356 (sialic acid). Yet, while HCoV-OC43 infection is highly dependent on VPS29/CCC, IAV 357 infection is either unaffected by these factors (in A549 cells) or hindered by them (in HT1080 358 and 293T cells). 359 360 A possible mechanism that might account for the enhancing effect VPS29 deficiency on IAV 361 infection could be retromer-dependent trafficking of endosomal cargo that antagonizes IAV bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

362 infection. While this notion is consistent with our finding that showing incoming IAV 363 accumulated in endosomes to a greater extent in normal than in VPS29 KO cells, the proteins 364 that might be responsible for mediating this effect are unknown. Other possibilities, include 365 direct influence of retromer on IAV containing endosomes, In this regard, retromer dependent 366 movement of human papilloma virus (HPV) to the TGN has been reported to involve direct 367 interaction between retromer and the HPV L2 protein (Popa et al., 2015). While loss of 368 retromer/WASH complex facilitated IAV infection in HT1080 cells, loss of other retromer- 369 interacting proteins, such as SNX6 and Rab38, impaired IAV infection. Thus, distinct effector 370 functions of VPS29 may have different infection enhancing and inhibiting properties, with the 371 overall effect depending on viral and/or cell-type specific characteristics. Differences in 372 expression and/or activity of various VPS29 effector proteins may explain why VPS29 KO 373 facilitates IAV infection in HT1080 and 293T cells, but not in A549 cells. 374 375 However, VPS29 KO impaired CoV infection in all cells tested, including primary lung cells. 376 Nevertheless, we did observe some differences. Specifically, loss of both retromer and retriever 377 impaired HCoV-OC43 infection, while loss of retriever did not impair HCoV-NL63 or HCoV- 378 229E or rVSV/SARS-CoV-2 infection. These findings suggest that there may be multiple roles 379 for VPS29 in HCoV infection, with some CoVs requiring the effector functions of distinct 380 VPS29-containing complexes. The precise requirement for distinct VPS29 functions could vary 381 with cell type, for example there was a decreased requirement for the CCC complex in HT1080 382 and 293T cells. Our finding that SARS-CoV-2R683G , SARS-CoV, and bat/pangolin CoVs were 383 all heavily impacted by both VPS29 KO and cathepsin inhibition suggests that these viruses are 384 especially sensitive to endocytic function, in line with recent work demonstrating that mutation 385 of the SARS-CoV-2 polybasic cleavage site drives virions to enter via the endocytic route 386 (Winstone et al., 2021). 387 388 Based on our findings, it appears that a key feature of VPS29/retromer KO cells, is elevation of 389 the pH of endolysosomal compartments. This change should impair activation of cathepsins 390 (Jerala et al., 1998), thus impeding endosomal CoV spike as well as EBOV GP processing and 391 egress from endosomes to initiate productive infection, consistent with our observations of 392 incoming virions. In agreement with this model, others have shown VPS35 deficiency results 393 reduced endosomal cathepsin activity (Cui et al., 2019). Here, however, we show that this 394 reduced endosomal activity is likely due to perturbed endolysosomal pH rather than impaired 395 trafficking of cathepsin zymogen in VPS29 KO cells. We also speculate that the perturbations in 396 endosomal pH that accompany VPS29 deficiency underlies increased cellular susceptibility to 397 IAV infection, perhaps by reducing virion exposure to destructive lysosomal proteases, or 398 increasing the duration of exposure to optimal conditions for HA-mediated membrane fusion. 399 400 Importantly, our findings suggest that the exploration of cathepsin inhibitors, or other endosomal 401 perturbing agents is a promising target for novel drugs against CoVs, which remain a potentially 402 serious emergent public health threat. 403 404 ACKNOWLEDGMENTS 405 We thank members of the Bieniasz Laboratory for helpful comments and discussion. This work 406 was supported by grants from National Institute of Allergy and Infectious Diseases, R01AI 407 50111 and R37AI640003 to (PDB), by a Medical Scientist Training Program grant from the bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

408 National Institute of General Medical Sciences T32GM007739 to the Weill 409 Cornell/Rockefeller/Sloan Kettering Tri-Institutional MD-PhD Program and by the National 410 Institute of Allergy and Infectious Diseases F30AI157898 (to DP). 411 412 413 AUTHOR CONTRIBUTIONS 414 YW, DP, and PDB conceived the study. YW, DP, and AH performed experiments and analyzed 415 the data. DP, YW, and PDB wrote the manuscript. 416 417 DECLARATION OF INTERESTS 418 The authors declare no competing interests. 419 420 421 422 423 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Fig 1 - A CRISPR screen reveals genes influencing HCoV-OC43 susceptibility

424 425 Figure 1: A CRISPR screen reveals genes influencing HCoV-OC43 susceptibility 426 (A) Schematic of screening setup (B) Screen results, where the x-axis corresponds to each 427 unique gene in the library (labeled randomly from 1 to 19,114) and the y-axis denotes the -log10 428 MAGeCK gene score. All genes scoring higher than the best-scoring non-targeting control 429 pseudogene are labeled in blue. The screen was performed in three independent replicates (C) 430 string-db analysis and UniProt annotation of gene hits. Sphere colors correspond to UniProt 431 keywords and connecting lines indicate strength of evidence underlying gene-gene interactions 432 (pink: experimentally-determined interaction; blue: annotated interaction in curated databases; 433 gray: evidence of co-expression; yellow: text-mining). 434 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Fig 2 – Requirement for identified host proteins is cell type and virus dependent

HCoV-OC43 HCoV-NL63 HCoV-229E rVSV/SARS2 Adenovirus Influenza RSV

A B C D E F G 30 30 15 40 60 40 60

30 30 20 20 10 40 40 ACE2

- 20 20

% Infected 10 10 5 20 20 10 10 A549

0 0 0 0 0 0 0

EV EV EV EV EV EV EV

VPS29 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 WDR81WDR91 CCDC22CCDC93 CCDC22CCDC93 CCDC22CCDC93 CCDC22CCDC93 CCDC22CCDC93 CCDC22CCDC93 CCDC22CCDC93COMMD3 COMMD3 COMMD3 COMMD3 COMMD3 COMMD3 COMMD3

H I J K L M N 30 60 30 40 80 15 40 30 60 20 40 20

ACE2 10 - 20 40 20

% Infected 10 20 10 5 10 20 HT1080

0 0 0 0 0 0 0

EV EV EV EV EV EV EV

VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3

O P Q R S T 20 60 60 50 30 30 40 15 40 40 20 30 20 ACE2

- 10 20

% Infected 20 20 10 5 10 293T 10

0 0 0 0 0 0

EV EV EV EV EV EV

VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 VPS29WDR81WDR91 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 CCDC22CCDC93COMMD3 U V W X

VSV-G HCoV-OC43 H1N1A/California/2009 H1N1A/Netherlands/2009 100 50 80 80

80 40 60 60 ACE2 ACE2 60 30 - - 40 40

40 NHBE 20 % Infected % Infected % Infected

HT1080 20 HT1080 20 20 10

0 0 0 0

EV EV EV EV 435 VPS29 VPS29 VPS29 VPS29 436 Figure 2: Requirement for identified host proteins is cell type and virus dependent 437 (A-X) Cells were infected with the indicated viruses at an MOI of 0.3. At 24 hours post 438 infection, cells were stained, and the percent infected cells was determined by flow cytometry. 439 (A-G): A549-ACE2, (H-N, U, W-X): HT1080-ACE2, (O-T): 293T-ACE2, (V): NHBE. X-axis 440 indicates gene knockout, EV: empty vector. Mean (bar graph) of three replicates (dots). Error 441 bars indicate SD. Data shown is a representative of at least two independent experiments. 442 100 rVSV/SARS2

10 % infected 1

0.1

WT I91D L152E

VPS29 WTVPS29 + EV KO + EV

VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29

100 100 rVSV/SARS2 HCoV-OC43

10 10 % infected % infected 1 1

bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license0.1 to display the preprint0.1 in perpetuity. It is made

WT WT available under aCC-BY 4.0 International license. I91D I91D L152E L152E

VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV

VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 Fig 3– Effect of VPS29 KO on HCoV and Influenza infection is primarilyVPS29 KO + VPS29 VPS29 KO + VPS29

driven by loss of Retromer/WASH complex100 function 100 100 rVSV/SARS2 HCoV-OC43 HCoV-NL63

10 10 10 1000 1000 A rVSV/SARS2 B HCoV-OC43

100 100 % infected % infected % infected 1 1 1 10 10

1 1

0.1 0.1 0.1 0.1 0.1

Fold inhibition relative to siCTL Fold inhibition relative to siCTL WT WT WT I91D I91D I91D L152E L152E L152E SNX6 SWIP SNX5SNX3SNX2 SNX1 SNX3 SWIP SNX2 SNX5SNX6 SNX1 VPS35RAB7AVPS29 SNX27 VAMP7 RAB38RAB32 RAB7B RAB21DSCR3 RACK1 SNX17 RAB7AVPS35 VPS29 DSCR3 RAB32VAMP7 SNX27RAB7B RACK1 SNX17 RAB21 RAB38 VPS26A ANKFY1 TBC1D5RAB40C VPS26B WASH1 WASH1 VPS26A VPS26B RAB40C TBC1D5 ANKFY1 CCDC93 C16orf62COMMD3CCDC22CCDC53 MICALL1 COMMD3 C16orf62 CCDC22 CCDC93 CCDC53MICALL1 Strumpellin ANKRD27 Strumpellin ANKRD27 VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV 10 1000 HCoV-NL63 HCoV-229E C VPS29 KO + VPS29D VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29100 VPS29 KO + VPS29

1 10 100 100 rVSV/SARS2 100 HCoV-OC43 100 HCoV-NL63 HCoV-229E 1

0.1 0.1 Fold inhibition relative to siCTL 10 10 Fold inhibition relative to siCTL 10 10 SWIPSNX5 SNX3 SNX2SNX6 SNX1 SNX6 SWIPSNX3 SNX2 SNX1SNX5 VPS35RAB7AVPS29 VAMP7DSCR3 RACK1 RAB21SNX27 SNX17RAB32 RAB7B RAB38 VPS35VPS29RAB7A VAMP7 DSCR3 RAB32RACK1 RAB21RAB38SNX17 SNX27 RAB7B VPS26A VPS26B WASH1RAB40CTBC1D5 ANKFY1 VPS26ATBC1D5 WASH1 ANKFY1 RAB40C VPS26B COMMD3 CCDC93 C16orf62 CCDC22 MICALL1 CCDC53 CCDC22CCDC93 MICALL1 COMMD3 CCDC53C16orf62 ANKRD27 Strumpellin ANKRD27 Strumpellin 10 % infected % infected % infected Influenza % infected E 1 1 1 1

1 0.1 0.1 0.1 0.1

WT WT WT WT I91D I91D I91D I91D L152E L152E L152E L152E 0.1 Fold rescue relative to siCTL

SNX5 VPS29SNX2 WTVPS29 + EV KO + EV SNX1 SNX3 SWIPVPS29 WTVPS29SNX6 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS35VPS29RAB7A RAB21 SNX27SNX17 DSCR3 RAB32 RACK1RAB7B VAMP7 RAB38 WASH1 ANKFY1 VPS26A RAB40C TBC1D5 VPS26B CCDC22 C16orf62CCDC93CCDC53 COMMD3 MICALL1 ANKRD27Strumpellin VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29

100 100 100 100 100 F rVSV/SARS2 G HCoV-OC43 H HCoV-NL63 I HCoV-229E J Influenza

10 10 10 10

10 % infected % infected % infected % infected % infected 1 1 1 1

0.1 0.1 0.1 0.1 1

WT WT WT WT WT I91D I91D I91D I91D I91D L152E L152E L152E L152E L152E

VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV

VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29

443 100 100 100 100 444 Figure 3:HCoV-OC43 Effect of VPS29 KOHCoV-NL63 on HCoV and HCoV-229EIAV infection is primarilyInfluenza driven by loss of

445 Retromer/WASH10 complex10 function 10

446 (A-E) HT1080 cells were transfected with a focused siRNA library10 targeting VPS29-interacting % infected % infected % infected % infected 447 proteins.1 Two days after 1transfection, cells were1 infected with (A) rVSV/SARS-CoV-2, (B) 448 HCoV-OC43, (C) HCoV-NL63, (D) HCoV-229E and (E) IAV at an MOI of 0.3. At 24 hours 0.1 0.1 0.1 1

449 post infection, cells were stained,WT and the percent infected cells was determined by flow WT WT WT I91D I91D I91D I91D 450 cytometry. PlottedL152E are levels of inhibitionL152E (for HCoVsL152E and rVSV/SARS-L152ECoV-2) or increase (for VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV

VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 451 IAV) in VPS29siRNA KO + VPS29 KD cells, relativeVPS29 KO + VPS29 to siRNA non-targeting control. Fold change values were VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 452 calculated by comparing levels of infection in KD cells to the average of 4 separate pools of non- 453 targeting100 HCoV-NL63siRNA controls100. SolidHCoV-229E black line 100marksInfluenza fold change of 1. The dashed lines mark the

454 highest10 and lowest fold changes10 of non-targeting siRNA controls from the average. (F-J) WT and

455 VPS29 mutants were reconstituted in VPS2910 KO cells. Cells were infected with (F) % infected % infected % infected 456 rVSV/SARS1 -CoV-2, (G)1 HCoV-OC43, (H) HCoV-NL63, (I) HCoV-229E, or (J) IAV. At 24 457 hours post infection, cells were stained, and the percent infected cells was determined by flow 0.1 0.1 1 458 cytometry. Mean (bar graph) of three replicates (dots). Error bars indicate SD. Data shown is a WT WT WT I91D I91D I91D 459 representative ofL152E two independent L152Eexperiments. L152E VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV

460 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29

100 HCoV-229E 100 Influenza

10 % infected % infected 1

0.1 1

WT WT I91D I91D L152E L152E

VPS29 WTVPS29 + EV KO + EV VPS29 WTVPS29 + EV KO + EV

VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29

100 Influenza

10 % infected

WT I91D L152E

VPS29 WTVPS29 + EV KO + EV

VPS29 KO + VPS29 VPS29 KO + VPS29 VPS29 KO + VPS29 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Fig 4– VPS29-KO results in enlarged, deacidified PI(3)P-rich vesicles

2xFYVE-mScar pHrodo Green Dextran Overlay

A VPS29 WT + EV + VPS29WT

B VPS29 KO + EV + VPS29 KO

C VPS29 KO + WT VPS29 WT + VPS29 KO

D I91D VPS29 KO + VPS29 + VPS29 KO

E L152E VPS29 KO + VPS29 + VPS29 KO

F pHrodo Green Dextran Signal ns ns ns 1000000 ✱✱✱✱ ✱✱✱✱

100000

10000

1000 MFI per area 100

WT I91D L152E

VPS29 WT + EV VPS29 KO + EV

VPS29 KO + VPS29 VPS29 KO + VPS29VPS29 KO + VPS29 461 462 Figure 4: VPS29-KO results in enlarged, deacidified PI(3)P-rich vesicles 463 Representative images of HT1080 cells transduced with a construct expressing 2xFYVE- 464 mSCAR after incubation with pHrodo Green Dextran for 60 minutes. (A): VPS29 WT + EV 465 expression cassette. (B): VPS29 KO HT1080 + EV expression cassette. (C): VPS29 KO HT1080 466 reconstituted with WT VPS29. (D): VPS29 KO HT1080 reconstituted with VPS29I91D. (E): 467 VPS29 KO HT1080 reconstituted with VPS29L152E. EV: empty vector. (F): Quantification of 468 Mean Fluorescence Intensity (MFI) of pHrodo Green Dextran signal inside of 2x-FYVE labeled 469 endosomes from n=4 independent images (images in A-E, as well as the additional representative 470 images depicted in Supplemental Figure S2). Error bars indicate SD. Statistical test: Student’s T 471 test. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 5– The enlarged, deacidified vesicles in VPS29-KO cells are not impaired for cargo loading 472 Dextran AF-488 pHrodo Red Dextran A Overlay B (Non-pH dependent) (pH dependent)

AF-488 Dextran Signal

✱✱✱ WT 1000000

100000

10000

1000 MFI per area 100

10 WT VPS29 KO VPS29KO

473 474 Figure 5: Enlarged, deacidified vesicles in VPS29-KO cells are not impaired for cargo 475 loading 476 (A): Representative images of HT1080 cells incubated with Dextran AF-488 (non-pH 477 dependent) and pHrodo Red Dextran (pH dependent) for 60 minutes. (B): Quantification of 478 Mean Fluorescence Intensity (MFI) of AF-488 Dextran Signal inside vesicles in WT and VPS29 479 KO cells from n=3 independent images (images in A, as well as the additional representative 480 images in Supplemental Figure S3). Error bars indicate SD. Statistical test: Student’s T test. 481 482 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Fig 6–VPS29 KO results in rVSV/SARS-CoV-2 specifically remaining trapped in vesicles

A rVSV/SARS-CoV-2 2xFYVE-mScar Overlay

60 ✱ WT

20 VPS29KO

% rVSV/SARS-CoV-2 in endosomes % rVSV/SARS-CoV-2 0 WT VPS29 KO

B rVSV/SARS-CoV-2 Dextran Red Overlay

100 ✱✱

80 WT

20 VPS29KO

% rVSV/SARS-CoV-2 in endosomes % rVSV/SARS-CoV-2 0 WT VPS29 KO

C IAV 2xFYVE-mScar Overlay

40000 ✱✱✱ WT 30000

20000

10000 IAV signal in endosomes IAV VPS29KO 0 WT VPS29 KO 483 484 Figure 6: VPS29 KO results in rVSV/SARS-CoV-2 specifically remaining trapped in 485 endosomes 486 (A): Representative images of rVSV/SARS-CoV-2NG-P infection in WT and VPS29 KO HT1080 487 cells. 2xFYVE-mSCAR labeled cells were infected with rVSV/SARS-CoV-2NG-P for 60 minutes. 488 Quantification indicates the percent of rVSV/SARS-CoV-2NG-P punctae inside of 2x-FYVE 489 labeled endosomes from n=4 independent images (images in A, as well as the additional 490 representative images in Supplemental Figure S4A). (B): Representative images of WT and 491 VPS29 KO HT1080 cells incubated for 60 minutes with Dextran Red 10,000 MW and 492 rVSV/SARS-CoV-2NG-P. Quantification indicates the percent of rVSV/SARS-CoV-2NG-P punctae 493 inside of Dextran Red labeled endosomes from n=4 independent images (images in B, as well as 494 the additional representative images in Supplemental Figure S4B). (C): Representative images of 495 IAV infection in WT and VPS29 KO HT1080 cells labeled with 2xFYVE-mSCAR. Cells were 496 infected with IAV for 60 minutes then fixed and stained for IAV NP. Quantification indicates the 497 IAV signal (MFI) inside of 2x-FYVE labeled endosomes from n=4 independent images (images 498 in C, as well as the additional representative images in Supplemental Figure S5). 499 Error bars indicate SD. Statistical test: Student’s T test. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Fig 7 – Impairment of CoV infection by VPS29 KO is influenced by presence of 500 polybasic cleavage site and correlates with cathepsin inhibition A B C D 7 7 7 107 10 SARS-CoV-2 WT 10 SARS-CoV-2R683G 10 SARS-CoV WIV16

6 WT 106 106 106 10 VPS29 KO RLU RLU RLU RLU 105 105 105 105

104 104 104 104 0 1 5 10 0 1 5 10 0 1 5 10 0 1 5 10 µM E64D µM E64D µM E64D µM E64D E F G H

107 Pangolin-CoV/Gx 107 Pangolin-CoV/Gd 100 rVSV/SARS-CoV-2 100 rVSV/EBOV GP

106 106 10 10 RLU RLU 5 5 1 1

10 10 % Infected % Infected

104 104 0.1 0.1 0 1 5 10 0 1 5 10 0 1 5 10 0 1 5 10 µM E64D µM E64D µM E64D µM E64D I rVSV/SARS-CoV-2 2xFYVE-mScar Overlay WT +10µM E64d

J Cathepsin L Activity (Magic Red) WT VPS29KO

K CTSL 2xFYVE-mScar Overlay WT VPS29KO

501 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

502 Figure 7: Impairment of CoV infection by VPS29 KO is influenced by presence of 503 polybasic cleavage site and correlates with cathepsin inhibition 504 (A-F): WT and VPS29 KO HT1080 cells were treated with the indicated concentrations of E64d 505 for 30 minutes before infection with HIV-1 based nano-luciferase reporter viruses pseudotyped 506 with Spike protein of (A): WT SARS-CoV-2, (B): SARS-CoV-2R683G, (C): SARS-CoV, (D): 507 WIV16: ,(E): Pangolin-CoV/Gx, (F): Pangolin-CoV/Gd. At 48hpi cells were harvested and nano- 508 luciferase activity was measured. Limit of detection of the HIV-1-based pseudoassay = 104 RLU. 509 (G-H): WT and VPS29 KO HT1080 cells were treated with the indicated concentrations of E64d 510 for 30 minutes before infection with (G): rVSV/SARS-CoV-2 or (H): rVSV/EBOV-GP. At 16 511 hours post infection, and infected cells enumerated by determined by flow cytometry. Limit of 512 detection of the flow cytometry assay = 0.1 % infection. Mean (bar graph) of three replicates 513 (dots). Error bars indicate SD. Data shown is a representative of at least two independent 514 experiments. (I): Representative images of rVSV/SARS-CoV-2NG-P infection in E64d treated WT 515 HT1080. 2xFYVE-mSCAR labeled cells were treated with E64d for 30 minutes, then infected 516 with rVSV/SARS-CoV-2NG-P for 60 minutes. (J): Representative images of WT and VPS29 KO 517 HT1080 cells following 60-minute incubation with Magic Red Cathepsin L Activity Kit. (K): 518 Representative images of WT and VPS29 KO HT1080 cells stably expressing V5-tagged CTSL 519 and labeled with 2xFYVE-mSCAR. 520 521 522 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

523 RESOURCE AVAILABILITY 524 Lead contact 525 Further information and requests for resources and reagents should be directed to and will be 526 fulfilled by the lead contact, Paul Bieniasz ([email protected]) 527 528 Material Availability 529 Newly generated materials associated with this study are available from the Lead Contact with a 530 completed Materials Transfer Agreement. 531 532 Data and code availability 533 Sequencing data will be made available upon manuscript acceptance. 534 535 EXPERIMENTAL MODELS AND SUBJECT DETAILS 536 Cell culture 537 HEK-293T (H. Sapiens; sex: female), A549 (H. Sapiens; sex: male), HT1080 (H. Sapiens; sex: 538 male), MDCK (Canis familiaris) and Vero cells (Cercopithecus aethiops) were obtained from 539 ATCC, and Huh7.5 cells (generously provided by Charles M. Rice) were maintained at 37°C and 540 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% fetal 541 bovine serum. NHBE cells (H. Sapiens) were obtained from ATCC (Cat# ATCC PCS-300-010) 542 and maintained at 37°C and 5% CO2 in Airway Epithelial Cell Basal Medium (ATCC PCS-300- 543 030) supplemented with Bronchial Epithelial Cell Growth Kit (ATCC PCS-300-040). All cells 544 have been assessed for Mycoplasma contamination. 545 546 Production of viral stocks 547 HCoV-OC43 (strain: ATCC VR-759) and HCoV-229E (strain: ATCC VR-740) were obtained 548 from Zeptometrix Corporation, and HCoV-NL63 (strain: Amsterdam I) was obtained from the 549 Biodefense and Emerging Infections Research Resources Repository. Viral stocks were 550 generated by propagation on Huh7.5 cells. The IAV strains A/WSN/33 (H1N1), 551 A/Netherlands/602/2009 (H1N1)pdm09 (H1N12009 Netherlands), A/California/04/2009 552 (H1N1)pdm09 (H1N12009 California) were propagated in MDCK cells. RSV strain A2-line19F 553 expressing the red fluorescent protein monomeric Katushka 2 (mKate2;(Hotard et al., 2012)) was 554 propagated in Vero cells. Adenovirus 5 was purchased from ATCC (VR-1516) and propagated in 555 A549 cells. VSVIND(eGFP) was propagated on 293T cells (Whelan et al., 2000). The replication- 556 competent chimeric recombinant vesicular stomatitis virus encoding SARS-CoV-2 S and green 557 fluorescent protein (eGFP), rVSV/SARS-2/GFP2E1, has been described previously (Schmidt et 558 al., 2020) and was propagated on 293T-ACE2 cells. rVSV/EBOV-GP was propagated on Vero 559 cells as previously described (Mulherkar et al., 2011). 560 561 METHOD DETAILS 562 CRISPR-Cas9 screening 563 The human genome-wide Brunello Library (Doench et al., 2016) in lentiCRISPRv2 was obtained 564 from Addgene (cat# 73179) and amplified according to depositor’s instructions. Resulting 565 plasmid DNA was validated via NGS sequencing to confirm appropriate coverage and 566 representation (the resulting library contained 0.0% undetected guides and a skew ratio of the top 567 10% represented guides to the bottom 10% represented guides was 3.94, well below the 568 recommended cutoff of 10 for an “ideal” library (Joung et al., 2017)). To generate lentiviral bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

569 preparations of the Brunello library, 293T cells (6 x 106 cells per 10 cm dish) were transfected 570 with 6µg lentiCRISPRv2-Brunello, 6µg NL-gagpol, and 1.2 µg VSV-G using PEI. 48 hours post 571 transfection, supernatants were pooled and concentrated using Amicon Ultra Centrifugal Filters. 572 Concentrated lentiviral preps were stored at -80°C and titrated on A549 cells based on 573 puromycin resistance. Briefly, 10-fold serial dilutions (from 10-1 to 10-6) were used to transduce 574 40,000 A549 cells in a 24 well plate format. 48 hours post transduction, cells were trypsinized 575 and moved up to 6 well plates in the presence of 1.25 µg/mL puromycin. 9 days post 576 transduction, cells were fixed, stained with Crystal Violet, and stained foci were counted to 577 measure the number of cells surviving selection (i.e. those that were transduced with 578 lentiCRISPRv2 harboring a puromycin resistance cassette). To perform the screen, 1.3 x 108 579 A549 cells were transduced with lentiCRISPRv2-Brunello at an MOI of 0.3 in order to generate 580 a population of single KO cells at high (>500X) coverage. Two days post transduction, cells 581 were placed in selection with 1.25 µg/mL puromycin and passaged for 7 days, until there were 582 no untransduced cells remaining. Thereafter, in triplicates with 8x106 cells per flask, A549- 583 Brunello cells were infected or not with HCoV-OC43 at an MOI of 0.1, and passaged for 7 days 584 until >95% infection-induced cell death occurred. Cellular gDNA was isolated using Zymogen 585 Quick-DNA Midiprep Plus Kit (Zymo Research), and sequencing libraries prepared via 586 amplication of sgRNA loci utilizing F primers containing P5 and Read 1 Sequencing Primer and 587 a R primer containing P7, a barcode, and the multiplexing Index Read Sequencing Primer, as 588 described in Joung et al, 2017. Resulting libraries were gel purified, pooled, and sequenced on 589 the Illumina HiSeq at Genewiz using 80 cycles of Read 1 (Forward) and 8 Cycles of Index 1 590 using standard Illumina sequencing primers. 591 592 Pathway Analysis of screen hits 593 All 34 candidate genes were searched using the STRING database (https://string-db.org) for 594 functional enrichment of protein-protein interactions using default settings, except the minimum 595 required interaction score was changed from medium confidence (0.400) to high confidence 596 (0.700). Subsequently, genes were annotated with UniProt keywords (https://uniprot.org) 597 598 Validation of CRISPR hits 599 Individual sgRNAs targeting hits of interest were cloned into lentiCRISPRv2 via linearization 600 with BsmBI followed by ligation of annealed oligos with compatible sticky ends using primers: 601 VPS29 F: caccgGGACATCAAGTTATTCCATG: VPS29 R: 602 aaacCATGGAATAACTTGATGTCCc; CCDC22 F: caccgCCGCAGGGTTGATCACACGC; 603 CCDC22 R: aaacGCGTGTGATCAACCCTGCGGc; CCDC93 F: 604 caccgTAGAATCCAAAGCTGATCCA; CCDC93 R: aaacTGGATCAGCTTTGGATTCTAc; 605 COMMD3 F: caccgCTTGAAACATATCGACCCAG; COMMD3 R: 606 aaacCTGGGTCGATATGTTTCAAGc. As a control, unmodified (“empty vector”) 607 lentiCRISPRv2, which does not harbor an sgRNA cassette, was used. Lentiviral preparations 608 were obtained by transfecting 1x106 293Ts with 1µg lentiCRISPRv2, 1µg NL-gagpol, and .2µg 609 VSV-G using PEI. 2 days post transfection, supernatants were collected, filtered, and used to 610 transduce 5x104 A549-ACE2, HT1080-ACE2, 293T-ACE2, or NHBE cells. 2 days post 611 transduction, cells were trypsinized, placed in selection with 1.25µg/mL puromycin, and 612 passaged until there were no remaining viable untransduced cells. CRISPR KO was verified by 613 Sanger Sequencing and Western Blot. 614 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

615 Infectivity Assays 616 A total of 1x104 cells per well were seeded on a 96-well plate in triplicate. The next day, cells 617 were infected with each virus at an MOI of ~0.3. For HCoV-OC43, HCoV-NL63, and HCoV- 618 229E, infected plates were incubated at 34ºC for 24 hours. For IAV, RSV, and adenovirus, 619 infected plates were incubated at 37ºC for 24 hours. For rVSV/SARS-CoV-2, infected plates 620 were incubated at 37ºC for 16 hours. Cells were then fixed in 4% PFA. For rVSV/SARS-CoV-2 621 and RSV, which encode eGFP and mKate2 reporter genes respectively, number of infected cells 622 were measured directly by flow cytometry. Otherwise, cells were immunostained for viral 623 antigens. Briefly, cells were blocked with 5.0% fetal bovine serum in PBS and permeabilized 624 with 0.5% Saponin before a 30 minutes incubation with: HCoV-OC43: Anti-Coronavirus Group 625 Antigen Antibody, nucleoprotein of OC-43 (1:1000, Sigma MAB9013); HCoV-NL63: Anti 626 coronavirus NL63 (1:1000, Eurofins M.30.HCo.B2D4); HCoV-229: Anti coronavirus 229E 627 (1:1000, Eurofins M.30.HCo.B1E7); IAV: Influenza A NP Antibody, FITC (1:50, Invitrogen 628 MA1-7322); Adenovirus: Adenovirus Hexon Antibody, FITC (1:50, Invitrogen MA1-7329). For 629 unconjugated primary antibodies (HCoV-OC43, HCoV-NL63, and HCoV-229E), a secondary 630 antibody conjugate AF-488 Goat anti-Mouse IgG (H+L) (1:1000, Thermo) was used before 631 infected cells were enumerated via flow cytometry. 632 633 siRNA screening of VPS29 interactors 634 A list of well-known VPS29 interactors (Baños-Maetos, 2019 (Figure 1)) was selected and used 635 to construct a targeted siRNA library constructed of a pool of four different gene specific siRNA 636 sequences (ON TARGETplus SMARTpool siRNA, Dharmacon). siRNAs were reverse- 3 637 transfected with 5x10 HT1080-ACE2 using RNAiMAX (Thermo Scientific) according to the 638 manufacturer’s protocol. Two- or three-days post transfection, cells were infected at an MOI of 639 ~0.3 and processed as above. 640 641 Plasmid Construction 642 The lentiviral expression vector CSIN was derived from CSIB (Kane et al., 2013) by exchanging 643 the Blasticidin resistance cassette with Neomycin. Briefly, primers Neo_CSIB_F: 644 AAAAACACGATGATAATATGGCCACAACCAATTGAACAAGATGGATTGCACGCAGG 645 TTCT and Neo_CSIB_R: 646 AGCTTGATATCAAGCTTGCATGCCTGCAGGTCAGAAGAACTCGTCAAGAAGGCGAT 647 AGAA were used to amplify the Neomycin resistance cassette and assemble into CSIB 648 linearized with and BstXI and SbfI using NEBuilder HiFi DNA Assembly (NEB). The 2xFYVE- 649 mSCAR endosome labeling construct was constructed by adding 2 FYVE domains to the N- 650 terminus of mScarlett. FYVE domains were PCR amplified from the Hrs protein using primers 651 FYVE_1_F: 652 ACAGACTGAGTCGCCCGGGGGGGATCCGGCCGAGAGGGCCGCCACCGAGAGCGAT 653 GCCATGTTTGC, FYVE_1_R: 654 GGCAGCAAACATGGCATCGCTCTCGGATCCTCCTCCTCCCTCCGCTTTCCTGTTCAGC 655 TG, FYVE_2_F: 656 CAGCTGAACAGGAAAGCGGAGGGAGGAGGAGGATCCGAGAGCGATGCCATGTTTG 657 CTGCC, FYVE_2_R: 658 TCACTGCCTCGCCCTTGCTCACCATGGATCCTCCTCCTCCCTCCGCTTTCCTGTTCAG 659 CT. mScarlett was PCR amplified using primers mSCAR_F: 660 AGCTGAACAGGAAAGCGGAGGGAGGAGGAGGATCCATGGTGAGCAAGGGCGAGGC bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

661 AGTGA and mSCAR_R: 662 GGGGGAGGGAGAGGGGCGGATCAGGCCAGAGAGGCCCTACTTGTACAGCTCGTCCA 663 TGCC. The resulting fragments were assembled into CSIB linearized with SfiI using NEBuilder 664 HiFi DNA Assembly (NEB). 665 To generate rVSV/SARS-CoV-2NG-P, The spike CDS was reverse transcribed and PCR amplified 666 from rVSV/SARS-2/GFP2E1 using primers: P-NG-2E1-S-MluI_F: 667 MLUAGAGATCGATCTGTTTCCTTGACACGCGTATGTTTGTGTTCCTGGTGCTGCTGCC 668 A and P-NG-2E1-S-NotI_R: 669 AACATGAAGAATCTGTTGTGCAGGGCGGCCGCCTTACAACAGGAGCCACAGGAA. 670 The resulting fragment was ligated into VSV NG-P (Jia et al., 2020) plasmid linearized with 671 MluI and NotI using T4 ligase (NEB). 672 673 Reconstitution experiments 674 A VPS29 coding sequence containing silent mutations in the sgRNA targeting sequence was 675 purchased from IDT and cloned into CSIN using NEBuilder HiFi DNA Assembly (NEB). The 676 VPS29I91D and VPS29L152E derivates were obtained via PCR mutagenesis using primers I91D F: 677 GGTCACCAAGTAGATCCTTGGGGA, I91D R: TCCCCAAGGATCTACTTGGTGACC, 678 L152E F: CCATCATTTGTGGAGATGGATATCCAGGC, L152E R: 679 GCCTGGATATCCATCTCCACAAATGATGG. Resulting constructs, including an empty 680 vector CSIN used as a control, were used to transduce single cell clones obtained from bulk EV 681 or VPS29 KO HT1080-ACE2 via limiting dilution. Infectivity assays on the resulting cell lines 682 were performed as above. 683 684 HIV/Nanoluc CoV Pseudotype Assays 685 To generate HIV/Nanoluc CoV pseudotyped particles, 5x106 293T cells were plated in 10mL 686 growth medium in a 10-cm dish. The next day, 7.5 µg pHIV-1NL4-3 ∆Env-NanoLuc and 2.5 µg 687 indicated CoV spike plasmid were transfected using PEI. Media was changed after 8 hours of 688 incubation. After 48 hours post transfection, supernatant was harvested, passed through a 0.22- 689 µm polyvinylidene fluoride syringe filter (Millipore; SLGVR33RS), aliquoted, and stored at - 690 80ºC. To perform nanoluc assays with the resulting HIV/Nanoluc CoV pseudotyped particles, a 691 total of 1x104 HT1080-ACE2 WT or VPS29 KO cells per well were plated in triplicate in a 96- 692 well plate. The next day, ~1x103 infectious units of HIV/Nanoluc CoV pseudotyped particles 693 were added to cells and incubated at 37ºC for 48 hours. Thereafter, cells were harvested for 694 Nanoluc luciferase assays using the Nano-Glo® Luciferase Assay System (Promega, Cat# 695 N1150). 696 697 pHrodo Dextran Endocytosis assay 698 Cells were plated in a Nunc Lab-Tek II Chamber Slide (Thermo) at 5x103 cells per well. The 699 next day, cells were transduced with 2xFYVE-mSCAR to label endosomes. 48 hours post 700 transduction, cells were treated with pHrodo Green Dextran 10,000 MW (Thermo, cat# P35368) 701 at a concentration of 100 µg/mL for 60 minutes. Alternatively, unlabeled cells were treated with 702 an equal ratio of pHrodo Red Dextran 10,000 MW (Thermo, cat# P10361) and AF-488 Dextran 703 10,000 MW (Thermo, cat# D22910). Thereafter, cells were washed 3X in PBS and placed in 704 Live Cell Imaging Solution (Thermo Cat# A14291DJ). For 2x-FYVE labeled cells, images were 705 acquired on a DeltaVision OMX SR imaging system using a 60X Widefield oil immersion 706 objective (Olympus) with an exposure time of 50ms, 5.0% Transmission for the AF-488 channel, bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

707 an exposure time of 50ms, 10% Transmission for the A568 channel, and an exposure time of 708 150ms, 10% Transmission for the DAPI channel. For co-Dextran-treated cells, images were 709 acquired on a DeltaVision OMX SR imaging system using a 60X Widefield oil immersion 710 objective (Olympus) with an exposure time of 25ms, 10.0% Transmission for the AF-488 711 channel, an exposure time of 50ms, 10% Transmission for the A568 channel, and an exposure 712 time of 200ms, 10% Transmission for the DAPI channel. 713 714 Microscopy of rVSV/SARS-CoV-2 infected cells 715 Cells were plated in a Nunc Lab-Tek II Chamber Slide (Thermo) at 5x103 cells per well. The 716 next day, cells were transduced with 2xFYVE-mSCAR to label endosomes. For rVSV/SARS- 717 CoV-2NG-P , 48 hours post transduction cells were treated with 5µM E64d (Sigma Aldrich 718 E8640-250UG) for 30 minutes, followed by inoculation with rVSV/SARS-CoV-2NG-P at an MOI 719 of 2. 60 minutes post infection, cells were washed 3x with PBS and fixed in 4% PFA. 720 Alternatively, unlabeled cells were treated with pHrodo Red Dextran and infected with 721 rVSV/SARS-CoV-2NG-P for 60 minutes. 60 minutes post infection, cells were washed 3X with 722 PBS and imaged in Live Cell Imaging Solution. For cells with 2x-FYVE labeled endosomes, 723 images were acquired on a DeltaVision OMX SR imaging system using a 60X Widefield oil 724 immersion objective (Olympus) with an exposure time of 50ms, 10% Transmission for the AF- 725 488 channel, an exposure time of 100ms, 10% Transmission for the A568 channel, and an 726 exposure time of 150ms, 10% Transmission for the DAPI channel. For cells with Dextran Red 727 labeled endosomes, images were acquired on a DeltaVision OMX SR imaging system using a 728 60X Widefield oil immersion objective (Olympus) with an exposure time of 50ms, 10% 729 Transmission for the AF-488 channel, an exposure time of 50ms, 10% Transmission for the 730 A568 channel, and an exposure time of 200ms, 10% Transmission for the DAPI channel. 731 732 Influenza virus immunofluorescence 733 Cells were plated in a Nunc Lab-Tek II Chamber Slide (Thermo) at 5x103 cells per well. The 734 next day, cells were transduced with a construct expressing 2xFYVE-mSCAR to label 735 endosomes. 48 hours post transduction, cells were infected with IAV at an MOI of ~10. 60 736 minutes post infection, cells were washed with PBS, fixed in 4% PFA, permeabilized with 0.1% 737 triton, blocked with FBS and stained for Influenza Virus Nucleoprotein (1:200, abcam cat# 738 ab128193) and antibody conjugate AF-488 Goat anti-Mouse IgG (H+L) (Thermo, 1:1000). 739 Images were acquired on a DeltaVision OMX SR imaging system using a 60X Widefield oil 740 immersion objective (Olympus) with an exposure time of 50ms, 5.0% Transmission for the AF- 741 488 channel, an exposure time of 100ms, 10% Transmission for the A568 channel, and an 742 exposure time of 100ms, 10% Transmission for the DAPI channel. 743 744 Quantification of fluorescence microscopy 745 For each cell, Regions Of Interest (ROIs) corresponding to labeled endosomes were defined 746 using the freehand selection tool in Fiji. Quantification of mean fluorescence intensity inside 747 each ROI was determined using the Measure command. For punctae quantification, the number 748 of punctae inside each ROI was counted and summed to give the total number of punctae inside 749 ROIs for each cell. Additionally, the total number of punctae outside of ROIs in each cell was 750 measured. The reported % of virus in endosomes corresponds to: 751 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

# �� 752 × 100 # �� + # �� 753 754 Cathepsin L activity assay 755 Cells were plated 2x104 cells per well in a Nunc Lab-Tek II Chamber Slide (Thermo). The next 756 day, intracellular cathepsin L activity was detected using the Magic Red Cathepsin L Assay Kit 757 (Biorad cat# ICT941). Briefly, cells were incubated in 1X Magic Red and Hoechst 33342 Stain 758 for 30 minutes, then washed 3X with PBS before being placed in Live Cell Imaging Solution 759 (Thermo Cat# A14291DJ). Images were acquired on a DeltaVision OMX SR imaging system 760 using a 60X Widefield oil immersion objective (Olympus) using an exposure time of 50ms, 10% 761 Transmission for the A568 nm channel and an exposure time of 100ms, 10% Transmission for 762 the DAPI channel. 763 764 Cathepsin L localization staining 765 The coding sequence of CTSL was tagged with a 3’V5 and cloned into CSIN using NEBuilder 766 HiFi DNA Assembly (NEB) with primers CTSL_3’_V5_F: 767 ACAGACTGAGTCGCCCGGGGGGGATCCGGCCGAGAGGGCCGCCACCATGAATCCTA 768 CACTCATCCTTGC and CTSL_3’_V5_R: 769 GGGGGAGGGAGAGGGGCGGATCAGGCCAGAGAGGCCTCACGTAGAATCGAGACCG 770 AGGAGAGGGTTAGGGATAGGCTTACCCACAGTGGGGTAGCTGGCT. Cells stably 771 expressing this 3’V5-tagged CTSL were plated in a Nunc Lab-Tek II Chamber Slide (Thermo) at 772 5x103 cells per well. The next day, cells were transduced with a construct expressing 2xFYVE- 773 mSCAR to label endosomes. 48 hours post transduction, cells were fixed in 4% PFA, 774 permeabilized with 0.1% triton, blocked with FBS and stained for V5 (invitrogen cat# 46-0705, 775 1:1000) and antibody conjugate AF- 488 Goat anti-Mouse IgG (H+L) (Thermo, 1:1000). Images 776 were acquired on a DeltaVision OMX SR imaging system using a 60X Widefield oil immersion 777 objective (Olympus) with an exposure time of 50ms, 5.0% Transmission for the AF-488 channel, 778 an exposure time of 100ms, 10% Transmission for the A568 channel, and an exposure time of 779 100ms, 10% Transmission for the DAPI channel. 780 781 QUANTIFICATION AND STATISTICAL ANALYSIS 782 Raw FASTQ files were aligned to the Brunello library and scored using the MAGeCK statistical 783 package. All flow cytometry data were analyzed using FlowJo software, version 10.6.1. All 784 graphs were generated using GraphPad Prism, version 8. Error bars correspond to the standard 785 deviation. All images were generated by maximum intensity projection using Fiji (https://fiji.sc/). 786 787 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

788 Bibliography 789 790 Baños-Mateos, S., Rojas, A.L., and Hierro, A. (2019). VPS29, a tweak tool of endosomal 791 recycling. Curr. Opin. Cell Biol. 59, 81–87. 792 Böttcher-Friebertshäuser, E., Garten, W., Matrosovich, M., and Klenk, H.D. (2014). The 793 hemagglutinin: a determinant of pathogenicity. Curr. Top. Microbiol. Immunol. 385, 3–34. 794 Burda, P., Padilla, S.M., Sarkar, S., and Emr, S.D. (2002). Retromer function in endosome-to- 795 Golgi retrograde transport is regulated by the yeast Vps34 PtdIns 3-kinase. J. Cell Sci. 115, 796 3889–3900. 797 Collins, B.M., Skinner, C.F., Watson, P.J., Seaman, M.N.J., and Owen, D.J. (2005). Vps29 has a 798 phosphoesterase fold that acts as a protein interaction scaffold for retromer assembly. Nat. Struct. 799 Mol. Biol. 12, 594–602. 800 Coronaviridae Study Group of the International Committee on Taxonomy of Viruses (2020). The 801 species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and 802 naming it SARS-CoV-2. Nat. Microbiol. 5, 536–544. 803 Coutard, B., Valle, C., de Lamballerie, X., Canard, B., Seidah, N.G., and Decroly, E. (2020). The 804 spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent 805 in CoV of the same clade. Antiviral Res. 176, 104742. 806 Cui, Y., Carosi, J.M., Yang, Z., Ariotti, N., Kerr, M.C., Parton, R.G., Sargeant, T.J., and 807 Teasdale, R.D. (2019). Retromer has a selective function in cargo sorting via endosome transport 808 carriers. J. Cell Biol. 218, 615–631. 809 Daniloski, Z., Jordan, T.X., Wessels, H.H., Hoagland, D.A., Kasela, S., Legut, M., Maniatis, S., 810 Mimitou, E.P., Lu, L., Geller, E., et al. (2020). Identification of Required Host Factors for 811 SARS-CoV-2 Infection in Human Cells. Cell. 812 Del Olmo, T., Lauzier, A., Normandin, C., Larcher, R., Lecours, M., Jean, D., Lessard, L., 813 Steinberg, F., Boisvert, F.-M., and Jean, S. (2019). APEX2-mediated RAB proximity labeling 814 identifies a role for RAB21 in clathrin-independent cargo sorting. EMBO Rep. 20. 815 Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan, K.F., Smith, I., 816 Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized sgRNA design to maximize activity 817 and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 34, 184–191. 818 Feeley, E.M., Sims, J.S., John, S.P., Chin, C.R., Pertel, T., Chen, L.-M., Gaiha, G.D., Ryan, B.J., 819 Donis, R.O., Elledge, S.J., et al. (2011). IFITM3 inhibits influenza A virus infection by 820 preventing cytosolic entry. PLoS Pathog. 7, e1002337. 821 Gao, H., Lin, Y., He, J., Zhou, S., Liang, M., Huang, C., Li, X., Liu, C., and Zhang, P. (2019). 822 Role of heparan sulfate in the Zika virus entry, replication, and cell death. Virology 529, 91–100. 823 Gillooly, D.J., Morrow, I.C., Lindsay, M., Gould, R., Bryant, N.J., Gaullier, J.M., Parton, R.G., 824 and Stenmark, H. (2000). Localization of phosphatidylinositol 3-phosphate in yeast and 825 mammalian cells. EMBO J. 19, 4577–4588. 826 Grove, J., and Marsh, M. (2011). The cell biology of receptor-mediated virus entry. J. Cell Biol. 827 195, 1071–1082. 828 Harbour, M.E., Breusegem, S.Y.A., Antrobus, R., Freeman, C., Reid, E., and Seaman, M.N.J. 829 (2010). The cargo-selective retromer complex is a recruiting hub for protein complexes that 830 regulate endosomal tubule dynamics. J. Cell Sci. 123, 3703–3717. 831 Hoffmann, H.-H., Sánchez-Rivera, F.J., Schneider, W.M., Luna, J.M., Soto-Feliciano, Y.M., 832 Ashbrook, A.W., Le Pen, J., Leal, A.A., Ricardo-Lax, I., Michailidis, E., et al. (2021). Functional 833 interrogation of a SARS-CoV-2 host protein interactome identifies unique and shared bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

834 coronavirus host factors. Cell Host Microbe 29, 267–280.e5. 835 Hotard, A.L., Shaikh, F.Y., Lee, S., Yan, D., Teng, M.N., Plemper, R.K., Crowe, J.E., and 836 Moore, M.L. (2012). A stabilized respiratory syncytial virus reverse genetics system amenable to 837 recombination-mediated mutagenesis. Virology 434, 129–136. 838 Jerala, R., Zerovnik, E., Kidric, J., and Turk, V. (1998). pH-induced conformational transitions 839 of the propeptide of human cathepsin L. A role for a molten globule state in zymogen activation. 840 J. Biol. Chem. 273, 11498–11504. 841 Jia, D., Zhang, J.-S., Li, F., Wang, J., Deng, Z., White, M.A., Osborne, D.G., Phillips-Krawczak, 842 C., Gomez, T.S., Li, H., et al. (2016). Structural and mechanistic insights into regulation of the 843 retromer coat by TBC1d5. Nat. Commun. 7, 13305. 844 Jia, M., Liberatore, R.A., Guo, Y., Chan, K.-W., Pan, R., Lu, H., Waltari, E., Mittler, E., 845 Chandran, K., Finzi, A., et al. (2020). VSV-Displayed HIV-1 Envelope Identifies Broadly 846 Neutralizing Antibodies Class-Switched to IgG and IgA. Cell Host Microbe 27, 963–975.e5. 847 Joung, J., Konermann, S., Gootenberg, J.S., Abudayyeh, O.O., Platt, R.J., Brigham, M.D., 848 Sanjana, N.E., and Zhang, F. (2017). Genome-scale CRISPR-Cas9 knockout and transcriptional 849 activation screening. Nat. Protoc. 12, 828–863. 850 Kane, M., Yadav, S.S., Bitzegeio, J., Kutluay, S.B., Zang, T., Wilson, S.J., Schoggins, J.W., 851 Rice, C.M., Yamashita, M., Hatziioannou, T., et al. (2013). MX2 is an interferon-induced 852 inhibitor of HIV-1 infection. Nature 502, 563–566. 853 Killerby, M.E., Biggs, H.M., Haynes, A., Dahl, R.M., Mustaquim, D., Gerber, S.I., and Watson, 854 J.T. (2018). Human coronavirus circulation in the United States 2014-2017. J. Clin. Virol. 101, 855 52–56. 856 Krzyzaniak, M.A., Zumstein, M.T., Gerez, J.A., Picotti, P., and Helenius, A. (2013). Host cell 857 entry of respiratory syncytial virus involves macropinocytosis followed by proteolytic activation 858 of the F protein. PLoS Pathog. 9, e1003309. 859 Lakadamyali, M., Rust, M.J., and Zhuang, X. (2004). Endocytosis of influenza viruses. Microbes 860 Infect. 6, 929–936. 861 Laporte, M., and Naesens, L. (2017). Airway proteases: an emerging drug target for influenza 862 and other respiratory virus infections. Curr Opin Virol 24, 16–24. 863 Li, W., Xu, H., Xiao, T., Cong, L., Love, M.I., Zhang, F., Irizarry, R.A., Liu, J.S., Brown, M., 864 and Liu, X.S. (2014). MAGeCK enables robust identification of essential genes from genome- 865 scale CRISPR/Cas9 knockout screens. Genome Biol. 15, 554. 866 Luteijn, R.D., van Diemen, F., Blomen, V.A., Boer, I.G.J., Manikam Sadasivam, S., van 867 Kuppevelt, T.H., Drexler, I., Brummelkamp, T.R., Lebbink, R.J., and Wiertz, E.J. (2019). A 868 Genome-Wide Haploid Genetic Screen Identifies Heparan Sulfate-Associated Genes and the 869 Macropinocytosis Modulator TMED10 as Factors Supporting Vaccinia Virus Infection. J. Virol. 870 93. 871 Marsh, M., and Helenius, A. (2006). Virus entry: open sesame. Cell 124, 729–740. 872 McNally, K.E., Faulkner, R., Steinberg, F., Gallon, M., Ghai, R., Pim, D., Langton, P., Pearson, 873 N., Danson, C.M., Nägele, H., et al. (2017). Retriever is a multiprotein complex for retromer- 874 independent endosomal cargo recycling. Nat. Cell Biol. 19, 1214–1225. 875 Meier, O., and Greber, U.F. (2004). Adenovirus endocytosis. J Gene Med 6 Suppl 1, S152-63. 876 Milewska, A., Zarebski, M., Nowak, P., Stozek, K., Potempa, J., and Pyrc, K. (2014). Human 877 coronavirus NL63 utilizes heparan sulfate proteoglycans for attachment to target cells. J. Virol. 878 88, 13221–13230. 879 Millet, J.K., and Whittaker, G.R. (2015). Host cell proteases: Critical determinants of bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

880 coronavirus tropism and pathogenesis. Virus Res. 202, 120–134. 881 Mulherkar, N., Raaben, M., de la Torre, J.C., Whelan, S.P., and Chandran, K. (2011). The Ebola 882 virus glycoprotein mediates entry via a non-classical dynamin-dependent macropinocytic 883 pathway. Virology 419, 72–83. 884 Park, R.J., Wang, T., Koundakjian, D., Hultquist, J.F., Lamothe-Molina, P., Monel, B., 885 Schumann, K., Yu, H., Krupzcak, K.M., Garcia-Beltran, W., et al. (2017). A genome-wide 886 CRISPR screen identifies a restricted set of HIV host dependency factors. Nat. Genet. 49, 193– 887 203. 888 Phillips-Krawczak, C.A., Singla, A., Starokadomskyy, P., Deng, Z., Osborne, D.G., Li, H., Dick, 889 C.J., Gomez, T.S., Koenecke, M., Zhang, J.-S., et al. (2015). COMMD1 is linked to the WASH 890 complex and regulates endosomal trafficking of the copper transporter ATP7A. Mol. Biol. Cell 891 26, 91–103. 892 Popa, A., Zhang, W., Harrison, M.S., Goodner, K., Kazakov, T., Goodwin, E.C., Lipovsky, A., 893 Burd, C.G., and DiMaio, D. (2015). Direct binding of retromer to human papillomavirus type 16 894 minor capsid protein L2 mediates endosome exit during viral infection. PLoS Pathog. 11, 895 e1004699. 896 Rojas, R., van Vlijmen, T., Mardones, G.A., Prabhu, Y., Rojas, A.L., Mohammed, S., Heck, 897 A.J.R., Raposo, G., van der Sluijs, P., and Bonifacino, J.S. (2008). Regulation of retromer 898 recruitment to endosomes by sequential action of Rab5 and Rab7. J. Cell Biol. 183, 513–526. 899 Sanson, K.R., Hanna, R.E., Hegde, M., Donovan, K.F., Strand, C., Sullender, M.E., Vaimberg, 900 E.W., Goodale, A., Root, D.E., Piccioni, F., et al. (2018). Optimized libraries for CRISPR-Cas9 901 genetic screens with multiple modalities. Nat. Commun. 9, 5416. 902 Schmidt, F., Weisblum, Y., Muecksch, F., Hoffmann, H.-H., Michailidis, E., Lorenzi, J.C.C., 903 Mendoza, P., Rutkowska, M., Bednarski, E., Gaebler, C., et al. (2020). Measuring SARS-CoV-2 904 neutralizing antibody activity using pseudotyped and chimeric viruses. J. Exp. Med. 217. 905 Schneider, W.M., Luna, J.M., Hoffmann, H.-H., Sánchez-Rivera, F.J., Leal, A.A., Ashbrook, 906 A.W., Le Pen, J., Ricardo-Lax, I., Michailidis, E., Peace, A., et al. (2020). Genome-scale 907 identification of SARS-CoV-2 and pan-coronavirus host factor networks. Cell. 908 Schornberg, K., Matsuyama, S., Kabsch, K., Delos, S., Bouton, A., and White, J. (2006). Role of 909 endosomal cathepsins in entry mediated by the Ebola virus glycoprotein. J. Virol. 80, 4174– 910 4178. 911 Schott, D.H., Cureton, D.K., Whelan, S.P., and Hunter, C.P. (2005). An antiviral role for the 912 RNA interference machinery in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 102, 18420– 913 18424. 914 Schwegmann-Wessels, C., and Herrler, G. (2006). Sialic acids as receptor determinants for 915 coronaviruses. Glycoconj. J. 23, 51–58. 916 Seaman, M.N.J., Gautreau, A., and Billadeau, D.D. (2013). Retromer-mediated endosomal 917 protein sorting: all WASHed up! Trends Cell Biol. 23, 522–528. 918 Singla, A., Fedoseienko, A., Giridharan, S.S.P., Overlee, B.L., Lopez, A., Jia, D., Song, J., Huff- 919 Hardy, K., Weisman, L., Burstein, E., et al. (2019). Endosomal PI(3)P regulation by the 920 COMMD/CCDC22/CCDC93 (CCC) complex controls membrane protein recycling. Nat. 921 Commun. 10, 4271. 922 Szklarczyk, D., Gable, A.L., Lyon, D., Junge, A., Wyder, S., Huerta-Cepas, J., Simonovic, M., 923 Doncheva, N.T., Morris, J.H., Bork, P., et al. (2019). STRING v11: protein-protein association 924 networks with increased coverage, supporting functional discovery in genome-wide experimental 925 datasets. Nucleic Acids Res. 47, D607–D613. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

926 UniProt Consortium (2019). UniProt: a worldwide hub of protein knowledge. Nucleic Acids Res. 927 47, D506–D515. 928 Volchkov, V., and Klenk, H.D. (2018). Proteolytic processing of filovirus glycoproteins. In 929 Activation of Viruses by Host Proteases, E. Böttcher-Friebertshäuser, W. Garten, and H.D. 930 Klenk, eds. (Cham: Springer International Publishing), pp. 99–108. 931 Wang, R., Simoneau, C.R., Kulsuptrakul, J., Bouhaddou, M., Travisano, K.A., Hayashi, J.M., 932 Carlson-Stevermer, J., Zengel, J.R., Richards, C.M., Fozouni, P., et al. (2021). Genetic Screens 933 Identify Host Factors for SARS-CoV-2 and Common Cold Coronaviruses. Cell 184, 106– 934 119.e14. 935 Whelan, S.P., Barr, J.N., and Wertz, G.W. (2000). Identification of a minimal size requirement 936 for termination of vesicular stomatitis virus mRNA: implications for the mechanism of 937 transcription. J. Virol. 74, 8268–8276. 938 White, J.M., and Whittaker, G.R. (2016). Fusion of enveloped viruses in endosomes. Traffic 17, 939 593–614. 940 Winstone, H., Lista, M.J., Reid, A.C., Bouton, C., Pickering, S., Galao, R.P., Kerridge, C., 941 Doores, K.J., Swanson, C., and Neil, S. (2021). The polybasic cleavage site in the SARS-CoV-2 942 spike modulates viral sensitivity to Type I interferon and IFITM2. J. Virol. 943 Zhu, Y., Feng, F., Hu, G., Wang, Y., Yu, Y., Zhu, Y., Xu, W., Cai, X., Sun, Z., Han, W., et al. 944 (2021). A genome-wide CRISPR screen identifies host factors that regulate SARS-CoV-2 entry. 945 Nat. Commun. 12, 961. 946 947 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

948 949 SUPPLEMENTAL INFORMATION 950 951 Supplemental figures S1-S7 952 953 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Supplemental Figure S1 – Validation of CRISPR KO and VPS29 Reconstiution

A A549 HT1080 293T B WT KO SCC1 SCC4 WT KO WT KO WT KO VPS29 construct: EV EV WT I91D L152E VPS29 VPS29 GAPDH

GAPDH CCDC22

GAPDH C 120

100

CCDC93 80

60 GAPDH 40 Relative to WT EV Relative to WT COMMD3 20 Normalized VPS29 Expression 0 GAPDH

WT + EVKO + KOEV + WT KO + I91D KO + L152E VPS29 Construct 954 955 Supplemental Figure S1: Validation of CRISPR KO and VPS29 Reconstitution 956 (A): Western Blot confirmation of VPS29, CCDC22, CCDC93, and COMMD3 KO. (B): 957 Western Blot confirmation of VPS29 SSC KO and reconstitution. Antibodies: VPS29 958 (ab236796), CCDC22 (protein tech 16636-1-AP), CCDC93 (protein tech 20861-1-AP), 959 COMMD3 (protein tech 26240-1-AP). (C): Quantification of the level of VPS29 expression 960 normalized to GAPDH. 961 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Supplemental Figure S2 – Additional representative images demonstrating VPS29- KO results in enlarged, deacidified PI(3)P-rich vesicles

VPS29 KO + VPS29 KO + VPS29 KO + VPS29 WT + EV VPS29 KO + EV WT VPS29 VPS29I91D VPS29L152E mScar - 2xFYVE Green pHrodo Overlay mScar - 2xFYVE Green pHrodo Overlay mScar - 2xFYVE Green pHrodo Overlay 962 963 Supplemental Figure S2: Additional representative images demonstrating VPS29 KO 964 results in enlarged, deacidified PI(3)P-rich vesicles 965 Additional representative images from Figure 4. HT1080 cells transduced with 2xFYVE- 966 mSCAR after incubation with pHrodo Green Dextran for 60 minutes bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Supplemental Figure S3 –Additional representative images showing the enlarged, deacidified vesicles in VPS29-KO cells are not 967 impaired for cargo loading Dextran AF-488 pHrodo Red Dextran Overlay (Non-pH dependent) (pH dependent) WT VPS29KO

968 969 Supplemental Figure S3: Additional representative images showing the enlarged, 970 deacidified vesicles in VPS29-KO cells are not impaired for cargo loading 971 Additional representative images from Figure 5. WT and VPS29 KO HT1080 cells incubated for 972 60 minutes with an equal molar ratio of pHrodo Dextran Red 10,000 MW and Dextran AF-488 973 10,000 MW. 974 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Supplemental figure S4: Additional representative images demonstrating VPS29 KO results in rVSV/SARS-CoV-2 remaining trapped in vesicles

A WT VPS29 KO

rVSV/SARS-Cov-2 2xFYVE-mScar Overlay rVSV/SARS-Cov-2 2xFYVE-mScar Overlay

B WT VPS29 KO

rVSV/SARS-Cov-2 Dextran Red Overlay rVSV/SARS-Cov-2 Dextran Red Overlay

975 976 Supplemental Figure S4: Additional representative images demonstrating VPS29 KO 977 results in rVSV/SARS-CoV-2 remaining trapped in vesicles 978 (A): Additional representative images from Figure 6A. rVSV/SARS-CoV-2NG-P infection in WT 979 and VPS29 KO HT1080 cells. Cells were infected with rVSV/SARS-CoV-2NG-P for 60 minutes. 980 (B): Additional representative images from Figure 6B. WT and VPS29 KO HT1080 cells 981 incubated for 60 minutes with Dextran Red 10,000 MW and rVSV/SARS-CoV-2NG-P. 982 bioRxivSupplemental preprint doi: https://doi.org/10.1101/2021.08.06.455441 Figure S5: – Additional representative; this version posted images August 8,demonstrating 2021. The copyright that holder for this preprint (whichInfluenza was not certified virus by peeris more review) associatedis the author/funder, with who PI(3)P has granted-rich bioRxiv endosomal a license to membranes display the preprint in inWT perpetuity. It is made HT1080s than in VPS29 KO HT1080s.available under aCC-BY 4.0 International license.

WT VPS29 IAV 2xFYVE-mScar Overlay IAV 2xFYVE-mScar Overlay

983 984 Supplemental Figure S5: Additional representative images demonstrating that IAV is more 985 associated with PI(3)P-rich endosomal membranes in WT HT1080 cells than in VPS29 KO 986 HT1080 cells. 987 Additional representative images from Figure 6C: IAV infection in WT and VPS29 KO HT1080 988 cells labeled with 2xFYVE-mSCAR. Cells were infected with IAV for 60 minutes then fixed and 989 stained for IAV NP. 990 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Supplemental Fig 6–The enhancement of Influenza infection by VPS29 KO is not mediated by loss of IFITM3 activity

A Influenza

20 siCTL % Infected 10 siIFITM3

0 WT HT1080 VPS29 KO

B IFITM3 2xFYVE-mScar Overlay WT VPS29KO

991 992 Supplemental Figure S6: The enhancement of Influenza infection by VPS29 KO is not 993 mediated by loss of IFITM3 activity 994 (A): WT and VPS29 KO HT1080 cells were transfected with a pool of four control siRNAs 995 (siCTL) or a pool of four siRNAs targeting IFITM3 (siIFITM3). Three days post transfection, 996 cells were infected with IAV. At 24 hours post infection, cells were stained, and the percent 997 infected cells was determined by flow cytometry. (B): Representative images of WT and VPS29 998 KO HT1080 cells stably expressing V5-tagged IFITM3 and labeled with 2xFYVE-mSCAR. 999 1000 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.06.455441; this version posted August 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Supplemental figure S7: Additional representative images demonstrating Cathepsin Inhibition result in rVSV/SARS2 remaining trapped in vesicles

WT + 10µM E64D

rVSV/SARS-Cov-2 2xFYVE-mScar Overlay

1001 1002 Supplemental Figure S7: Additional representative images demonstrating cathepsin 1003 inhibition with E64d phenocopies VPS29 KO. 1004 Additional representative images from Figure 7I: 2xFYVE-mSCAR labeled cells were treated 1005 with E64d for 30 minutes, then infected with rVSV/SARS-CoV-2NG-P for 60 minutes. 1006 1007 1008

VPS29 Exerts Opposing Effects on Endocytic Viral Entry 2 3 4 Daniel Poston1,2*, Yiska Weisblum1*, Alvaro Hobbs1, Paul D

VPS29 Exerts Opposing Effects on Endocytic Viral Entry 2 3 4 Daniel Poston1,2, Yiska Weisblum1, Alvaro Hobbs1, Paul D