US009 187749B2

(12) United States Patent (10) Patent No.: US 9,187,749 B2 Bhattacharjee et al. (45) Date of Patent: Nov. 17, 2015

(54) METHODS FOR MODULATING FACTOR 12 6,794,499 B2 9/2004 Wengel et al. EXPRESSION 29-33 3: Wengeet al. W - - enge 7,399,845 B2 7/2008 Seth et al. (75) Inventors: Gourab Bhattacharjee, San Diego, CA 7.427.672 B2 9/2008 Imanishi et al. (US); Alexey Revenko, San Diego, CA 7,547,684 B2 6/2009 Seth et al. (US); Robert A. MacLeod, San Diego, 7,696,345 B2 4/2010 Allerson et al. CA (US) 2001/005.3519 A1 12/2001 Fodor et al. 2003/0228597 A1 12/2003 COWSert et al. 2004/0171570 A1 9, 2004 A11 tal. (73) Assignee: s rhymaceutical, Inc., Carlsbad, 2005/O130923 A1 6, 2005 SN al 2007/0031844 A1 2/2007 Khvorova et al. 2007/0192882 A1* 8, 2007 Dewald ...... 800, 14 (*) Notice: Subject to any disclaimer, the term of this 2008/0039618 A1 2/2008 Allerson et al. patent is extended or adjusted under 35 3.93.9 A. 1939. Ny's al. U.S.C. 154(b) by 38 days. 2009 OO64350 A1 3, 2009 Dewaldwayze et al. 2010.01374.14 A1 6, 2010 Freier et al. (21) Appl. No.: 14/124,621 2010/03241 14 A1 12/2010 Dewald 2011/0067.124 A1 3/2011 Dewald ...... 800, 13 (22) PCT Filed: Jun. 8, 2012 2012/0309035 A1 12/2012 Lindahl et al...... 435/13 2013/0331434 A1* 12/2013 Monia et al...... 514.f44 A (86). PCT No.: PCT/US2012/041747 S371 (c)(1) FOREIGN PATENT DOCUMENTS C s (2), (4) Date: Feb. 28, 2014 WO WO99,14226 3, 1999 WO WOO3,OO46O2 1, 2003 (87) PCT Pub. No.: WO2012/170947 W. W. 39.95. 1339. PCT Pub. Date: Dec. 13, 2012 WO WO 2007 134181 11, 2007 WO WO 2008.101157 8, 2008 (65) Prior Publication Data WO WO 2008,150729 12/2008 WO WO 2008,1544O1 12/2008 US 2014/02283OO A1 Aug. 14, 2014 WO WO 2009 OO6478 1, 2009 WO WO 2009/115478 9, 2009 WO WO 2010/094732 8, 2010 Related U.S. Application Data (Continued) (60) Provisional application No. 61/495,943, filed on Jun. 10, 2011, provisional application No. 61/496,456, OTHER PUBLICATIONS filed on Jun. 13, 2011. DonaldOa. Kylee C tPh aaCCCatical DesignS. 1995 1233-254.* (51) Int. Cl. Merriam-Webster online retrieved on Mar. 5, 2015 definition for CI2N IS/II (2006.01) prophylactically. Retrieved from: Google, pp. 1-3.* CI2N IS/II3 (2010.01) Cugno et al. Trends Mol. Med. 15:69-78, 2009.* A6 IK 4.8/00 (2006.01) Adcock et al., “A laboratory approach to the evaluation of hereditary A6 IK3I/7088 (2006.01) hypercoagulability” Am. J. Clin. Pathol. (1997) 108(4):434-449. A6 IK 45/06 (2006.01) (Continued) (52) U.S. Cl. CPC ...... CI2N 15/1137 (2013.01); A61 K3I/7088 (2013.01); A61K 45/06 (2013.01); A61 K Primary Examiner — Brian Whiteman 48/005 (2013.01); C12N 15/113 (2013.01); CI2N 2310/11 (2013.01); C12N 23.10/315 . 4) tigny Agent, or Firm — Knobbe, Martens, Olson & (2013.01); C12N 23.10/3231 (2013.01); C12N Ca 23.10/3341 (2013.01); C12N 23.10/341 O A O (2013.01) (57) ABSTRACT (58) Field of Classification Search CPC ...... C12N 2310/11; C12N 23.10/31; C12N Disclosed herein are methods for decreasing Factor 12 and 2310/32: C12N 231 O/33 treating or preventing inflammatory conditions in an indi See application file for complete search history. vidual in need thereof. Examples of disease conditions that (56) References Cited can be ameliorated with the administration of antisense com pounds targeted to Factor 12 include hereditary angioedema U.S. PATENT DOCUMENTS (HAE). Methods for inhibiting Factor 12 can also be used as a prophylactic treatment to prevent individuals at risk for 5,801,154 A 9, 1998 Baracchini et al. developing an inflammatory condition, such as, hereditary 6,268,490 B1 7/2001 Imanishi et al. 6,525, 191 B1 2/2003 Ramasamy angioedema. 6,582,908 B2 6, 2003 Fodor et al. 6,670,461 B1 12/2003 Wengel et al. 6,770,748 B2 8/2004 Imanishi et al. 22 Claims, 2 Drawing Sheets US 9,187,749 B2 Page 2

(56) References Cited Foster et al., “Inhibition of the activation of Hageman factor (factor XII) by extracts of Schistosoma mansoni.” J. Lab. Clin. Med. (1992) 120(5): 735-9. FOREIGN PATENT DOCUMENTS Freier et al., “The ups and downs of nucleic acid duplex stability: WO WO 2010/11 1702 9, 2010 structure-stability studies on chemically-modified DNA:RNA WO WO 2012/0647.58 5, 2012 duplexes” Nucleic Acids Research (1997) 25(22):4429-4443. WO WO 2012/170947 12/2012 Frieden et al., “Expanding the design horizon of antisense oligonucleotides with alpha-L-LNA'Nucleic Acids Research (2003) OTHER PUBLICATIONS 31(21):6365-6372. Gautschi et al., “Activity of a Novel bcl-2/bcl-XL-Bispecific Albaek et al., “Analogues of a Locked Nucleic Acid with Three Antisense Oligonucleotide Against Tumors of Diverse Histologic Carbon 2',4'-Linkages: Synthesis by Ring-Closing Metathesis and Origins' J. Natl. Cancer Inst. (2001) 93(6):463-471. Influence of Nucleic Acid Duplex Stability” J. Org. Chem. (2006) Gigliet al., “Interaction of plasmakallikrein with the C1 inhibitor.” J. 71:7731-774O. Immunol. (1970) 104:574-581. Altmann et al., “Second-generation antisense oligonucleoties: struc Han et al., “Increased vascular permeability in C1 inhibitor-deficient ture-activity relationships and the design of improved signal mice mediated by the bradykinin type 2 receptor.” J. Clin. Invest. transduction inhibitors' Biochem. Soc. Trans. (1996) 24: 630-637. (2002) 109: 1057-1063. Altmann et al., “Second Generation of Antisense Oligonucleotides: Hazegh-Azam et al., “The Corn Inhibitor of Activated Hageman From Nuclease Resistance to Biological Efficacy in Animals” Factor: Purification and Properties of Two Recombinant Forms of the Chimia (1996) 50: 168-176. Protein’ Protein Expr. Purif. (1998) 13(2): 143-149. Altmann et al., “Second Generation AntiSense Oligonucleotides— Hojima et al., “Pumpkin seed inhibitor of human factor XIIa (acti Inhibition of PKC-a and c-RAF Kinase Expression by Chimeric vated Hageman factor) and bovine trypsin' Biochemistry (1982) Oligonucleotides Incorporating 5'-Substituted Carbocyclic 21(16): 3741-3746. Nucleosides and 2'-O-Ethylene Glycol Substituted Ribonucleosides' Isawa et al., “Identification and characterization of plasmakallikrein Nucleosides Nucleotides (1997) 16(7-9): 917-926. kinin System inhibitors from Salivary glands of the blood-sucking Altschul et al., “Basic Local Alignment Search Tool” J. Mol. Biol. insect Triatoma infestans.” FEBS J. (2007) 274(16): 4271-4286. (1990) 215: 403-410. Kaplanet al., “Pathways for bradykinin formation and inflammatory Aulak et al., "Chymotrypsin inhibitory activity of normal C1-inhibi disease.” J. Allergy Clin. Immunol. (2002) 109(2): 195-209. tor and a P1 Arg to His mutant: evidence for the presence of overlap Kato et al., “Identification and characterization of the plasma kal ping reactive centers.” Protein Sci. (1993)2(5): 727-732. likrein-kinin system inhibitor, haemaphysalin, from hard tick, Bertina et al., “Mutation in blood coagulation factor V associated Haemaphysalis longicornis' Thromb. Haemost. (2005) 93: 359-67. with resistance to activated protein C.” Nature (1994)369(6475):64 Kleinschnitz et al., “Targeting coagulation factor XII provides pro 67. tection from pathological thrombosis in cerebral ischemia without Bjorket al., “Mechanism of the anticoagulantaction of heparin.” Mol interfering with hemostasis' J. Exper. Med. (2006) 203:513-518. Cell Biochem. (1982) 48(3):161-182. Koshkin et al., “LNA (Locked Nucleic Acids): Synthesis of the Bouillet et al. “Disease expression in women with hereditary Adenine, Cytosine, Guanine, 5-Methylcytosine, Thymine and Uracil angioedema' Am. J. Obstet. Gynecol. (2008) 199: 484.e1-484.e4. Biocyclonucleoside Monomers, Oligomerisation, and Unprec Braasch et al., “Locked nucleic acid (LNA): fine-tuning the recogni edented Nucleic Acid Recognition’ Tetrahedron (1998). 54:3607 tion of DNA and RNA” Chem. Biol. (2001) 8:1-7. 3630. Branch et al., “A good antisense molecule is hard to find.” TIBS Kumar et al., “The First Analogues of LNA (Locked Nucleic Acids): (1998) 23:45-50. Phosphorothioate-LNA and 2'-Thio-LNA' Bioorg. Med. Chem. Lett. Chan et al., “The inhibition of activated factor XII (hageman factor) (1998) 8:2219-2222. by antithrombin III: The effect of other plasma proteinase inhibitors' Leumann, “DNA Analogues: From Supramolecular Principles to Biochem. Biophys. Res. Comm. (1977) 74(1): 150-158. Biological Properties' Bioorganic & Medicinal Chemistry (2002) Cichon et al., “Increased activity of coagulation factor XII (Hageman 10:841-854. factor) causes hereditary angioedema type III Am. J. Hum. Genet. Mackenzie et al., “Plasma prekallikrein levels are positively associ (2006) 79: 1098-1104. ated with circulating lipid levels and the metabolic syndrome in Citarella et al., “The Second Exon-Encoded Factor XII Region Is children.” Appl. Physiol. Nutr. Metab. (2010) 35: 518-525. Involved in the Interaction of Factor XII With Factor XI and DoesNot Mahdiet al., “Factor XII interacts with the multiprotein assembly of Contribute to the Binding Site for Negatively Charged Surfaces” urokinase plasminogen activator receptor, gC1qR, and cytokeratin 1 Blood (1998) 92: 41.98-4206. on endothelial cell membranes' Blood (2002)99(10): 3585-3596. Citarella et al., “Identification of aputative binding site for negatively Maher et al., “Comparative hybrid arrest by tandem antisense charged surfaces in the fibronectin type II domain of human factor oligodeoxyribonucleotides O oligodeoxyribonucleoside XII—an immunochemical and homology modeling approach.” methylphosphonates in a cell-free system” Nuc. Acid. Res. (1988) Thromb. Haemost. (2000) 84(6): 1057-1065. 16:3341-3358. Crooke et al., “Basic Principles of Antisense Therapeutics' Antisense Martin, "Ein neuer Zugang Zu 2'-O-Alkylribonucleosiden and Research and Application (1998) Chapter 1:1-50. Eigenschaften eren Oligonucleotide' Helv. Chim. Acta (1995) 78: Drake et al., “Selective cellular expression of tissue factor in human 486-504. tissues. Implications for disorders of hemostasis and thrombosis.” New England Biolabs 1998/99 Catalog (cover page and pp. 121 and Am J Pathol (1989) 134(5):1087-1097. 284). Elayadi et al., “Applications of PNA and LNA oligomers to chemo Nielsen, "Corn trypsin inhibitor decreases tissue-type plasminogen therapy” Curr. Opinion Invest. Drugs (2001) 2:558-561. activator-mediated fibrinolysis of human plasma.” Blood Coagul. Esnouf et al., “A monoclonal antibody raised against human beta Fibronolysis. (2009) 20(3): 191-196. factor XIIa which also recognizes alpha-factor XIIa but not factor XII Nishikawa et al., “Effect of neurotropin(R) on the activation of the or complexes of factor XIIa with C1 esterase inhibitor.” Thromb. plasma kallikrein-kinin system” Biochem. Pharmacol. (1992) 43(6): Haemost. (2000) 83(6): 874-881. 1361-1369. Farsetti et al., “Orphan receptor hepatocyte nuclear factor-4 antago Niwano et al., “Inhibitory action of amyloid precursorprotein against nizes estrogen receptor alpha-mediated induction of human coagul human Hageman factor (factor XII).” J. Lab. Clin. Med. (1995) lation factor XII gene.” Endocrinology (1998) 139(11): 4581-4589. 125(2): 251-256. Foster et al., “Inhibition of the activation of Hageman factor (factor Orum et al., “Locked nucleic acids: A promising molecular family for XII) and of platelet aggregation by extracts of Brugia malayi gene-function analysis and antisense drug development' Curr. Opin microfilariae.” J. Lab. Clin. Med. (1991) 117(5): 344-352. ion Mol. Ther. (2001) 3(3):239-243. US 9,187,749 B2 Page 3

(56) References Cited Singh et al., “Synthesis of 2'-Amino-LNA: A Novel Conformation ally Restricted High-Affinity Oligonucleotide Analogue with a OTHER PUBLICATIONS Handle” J. Org. Chem. (1998) 63:1.0035-10039. Srivastava et al., “Five- and Six-Membered Conformationally Rajapakse et al., “A novel anticoagulant purified from fish protein Locked 2',4'-Carbocyclic ribo-Thymidines: Synthesis, Structure, and hydrolysate inhibits factor XIIa and platelet aggregation.” Life Sci. Biochemical Studies' J. Am. Che. Soc. (2007) 129:8362-8379. (2005) 76(22): 2607-2619. Tanabe et al., “Isolation and Characterization of Streptoverticillium Ratnoff et al., “Inhibition of the activation of hageman factor (factor Anticoagulant (SAC), a Novel Protein Inhibitor of Blood Coagula XII) by eosinophils and eosinophilic constituents' Am. J. Hematol. tion Produced by Streptoverticillium cinnamoneum subsp. Cin (1993)42(1): 138-145. namoneum” J. Biochem. (1994) 115(4): 743-751. Reynolds et al., “Rational siRNA design for RNA interference” Wahlestedt et al., “Potent and nontoxic antisense oligonucleoties Nature Biotechnology (2004) 22(3):326-330. containing locked nucleic acids” PNAS (2000) 97(10):5633-5638. Ryder et al., “The effect of chemical modification of basic amino acid Woolf et al., “Specificity of antisense oligonucleotides in vivo” residues on the activation and amidolytic activity of Hageman factor PNAS (1992) 89:7305-73.09. (factor XII).” J. Lab. Clin. Med. (1993) 122(6): 697-702. Zhangeal., “PowerBLAST: A New Network BLAST Application for Sampaio et al., “Plant serine proteinase inhibitors. Structure and Interactive or Automate Sequence Analysis and Annoation'. Genome biochemical applications on plasma kallikrein and related enzymes.” Res. (1997) 7: 649-656. Immunopharmacology (1996) 32(1-3): 62-66. Zhou et al., “Fine Tuning of Electrostatics around the Internucleoside Sanghvi et al., “Heterocyclic Base Modifications in Nucleic Acids Phosphate through Incorporation of Modified 2',4'-Carbocylic-LNAS and Their Applications in Antisense Oligonucleotides' Antisense and-ENAS Leads to Significant Modulation of Antisense Properties” Research and Applications (1993) pp. 273-288. J. Org. Chem. (2009) 74: 118-134. Schousboe et al., “Synchronized inhibition of the phospholipid medi Zuraw, “Hereditary Angioedema” N. Engl.J.Med. (2008)359: 1027 ated autoactivation of factor XII in plasma by beta 2-glycoprotein I 36. and anti-beta 2-glycoprotein I.” Thromb. Haemost (1995) 73(5): International Search Report for application PCT/US 1 1/598.04 dated 798-804. May 14, 2012. Schwartz et al., “Tissue factor pathway inhibitor endocytosis.” International Search Report for application PCT/US2012/041747 Trends Cardiovasc Med. (1997) 7(7):234-239. dated Dec. 10, 2012. Scott et al., “Alpha-1-antitrypsin-Pittsburgh. A potent inhibitor of Yau et al., “Selective depletion of factor XI or factor XII with human plasma factor XIa, kallikrein, and factor XIIf” J. Clin. Invest. antisense oligonucleotides attenuates catheter thrombosis in rabbits'. (1986) 77(2): 631-634. Blood, vol. 123, No. 13, pp. 2102-2107, Mar. 27, 2014. Singh et al., “LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition” Chem. Commun. (1998) 4:455-456. * cited by examiner U.S. Patent Nov. 17, 2015 Sheet 1 of 2 US 9,187,749 B2

(9 dinoud) IXy :

(Zdnous) yu ILO-IXy . . . (g dino) uuLoo i (zdnous) sad (tdnous) sad U.S. Patent Nov. 17, 2015 Sheet 2 of 2 US 9,187,749 B2

XIWAWUH XIWAWUH p?Aeap US 9, 187,749 B2 1. 2 METHODS FOR MODULATING FACTOR 12 cades are activated in order to propagate the inflammatory EXPRESSION response (e.g., complement system in response to infection, fibrinolysis and coagulation systems in response to necrosis CROSS REFERENCED TO RELATED due to a burn or trauma, kinin system to Sustain inflammation) APPLICATIONS 5 (Robbins Pathologic Basis of Disease, Philadelphia, W.B Saunders Company). This application is a U.S. National Phase filing under 35 Inflammation can be acute or chronic. Acute inflammation U.S.C. S371 claiming priority to International Serial No. has a fairly rapid onset, quickly becomes severe, and quickly PCT/US2012/041747 filed Jun. 8, 2012, which claims prior and distinctly clears after a few days to a few weeks. Chronic ity to U.S. Provisional Application No. 61/495,943, filed Jun. 10 inflammation can begin rapidly or slowly and tends to persist 10, 2011 and U.S. Provisional Application No. 61/496,456, for weeks, months, or years with a vague and indefinite ter filed Jun. 13, 2011, each of which is incorporated herein by mination. Chronic inflammation can result when an injury or reference in its entirety. stimulus, or products resulting from its presence, persists at the site of injury or stimulation and the body’s immune SEQUENCE LISTING 15 response is not sufficient to overcome its effects. Inflammatory responses, although generally helpful to the The present application is being filed along with a body to clear an injury or stimulus, can sometimes cause Sequence Listing in electronic format. The Sequence Listing injury to the body. In some cases, a body's immune response is provided as a file entitled BIOLO154USASEQ.txt, created inappropriately triggers an inflammatory response where Nov. 8, 2013, which is 122 Kb in size. The information in the 20 there is no known injury or stimulus to the body. In these electronic format of the sequence listing is incorporated cases, categorized as autoimmune diseases, the body attacks herein by reference in its entirety. its own tissues causing injury to its own tissues. Hereditary angioedema FIELD Hereditary angioedema (HAE) is a rare inflammatory dis 25 ease characterized by recurrent episodes of Swelling around Provided are methods for reducing expression of Factor 12 the head and extremities (Zuraw, B. L. N. Engl. J. Med. 359: mRNA and protein in an animal. Such methods are useful to 1027-36, 2008). Angioedema attacks occur with unpredict treat, prevent, or ameliorate inflammatory conditions, includ able frequency and are typically focused on the skin, and ing hereditary angioedema (HAE). gastric, oropharyngeal, and laryngeal mucosas. Asphyxiation 30 due to laryngeal Swelling can result in mortality. HAE is BACKGROUND caused by deficiency or malfunction of the serine protease inhibitor C1-INH (Kaplan, A. P. et al. J. Allergy Clin. Immu Inflammation nol. 109: 195-209, 2002). C1-INH is the primary inhibitor of Inflammation is a complex biological process of the body coagulation factors 12 and 11 (Factor 11) of the intrinsic in response to an injury or abnormal stimulation caused by a 35 coagulation pathway as well as plasma kallikrein (Gigli, I. et physical, chemical, or biological stimulus. Inflammation is a al. J. Immunol. 104:574-581, 1970). C1-INH mediated inhi protective process by which the body attempts to remove the bition of plasma kallikrein and Factor 12 results in inactiva injury or stimulus and begins to heal affected tissue in the tion of the kallikrein pathway and decreased levels of brady body. kinin (BK). C1-INH deficiency or dysfunction results in The inflammatory response to injury or stimulus is charac- 40 overproduction of BK, which is the mechanism by which terized by clinical signs of increased redness (rubor), tem HAE attacks are believed to occur. Type III HAE has been perature (calor), Swelling (tumor), pain (dolor) and/or loss of linked with mutations in the Factor 12 gene, which encodes function (functio laesa) in a tissue. Increased redness and coagulation protein Factor 12 (Cichon, S. et al. Am. J. Hum. temperature is caused by vasodilation leading to increased Genet. 79: 1098-1104, 2006). blood supply at core body temperature to the inflamed tissue 45 The kinin-kallikrein pathway consists of several proteins site. Swelling is caused by vascular permeability and accu that play a role in inflammation, blood pressure control, mulation of protein and fluid at the inflamed tissue site. Pain coagulation, and pain. Plasma prekallikrein is the precursor is due to the release of chemicals (e.g. bradykinin) at the of plasma kallikrein, which in turn liberates kinins from kini inflamed tissue site that stimulate nerve endings. Loss of nogens and also generates plasmin from plasminogen. function may be due to several causes. 50 Plasma prekallikrein is converted to plasma kallikrein by Inflammation is now recognized as a type of non-specific Factor 12a by the cleavage of an internal Arg-Ile peptide immune response to an injury or stimulus. The inflammatory bond. Plasma prekallikrein, in turn, is the product of the response has a cellular component and an exudative compo KLKB1 gene (MacKenzie, J. A. et al. Appl. Physiol. Nutr. nent. In the cellular component, resident macrophages at the Metab. 35: 518-525, 2010. Plasma kallikrein works in asso site of injury or stimulus initiate the inflammatory response 55 ciation with Factors 11 and 12. by releasing inflammatory mediators such as TNFalpha, There is currently no animal model which directly repli IFNalpha IL-1, IL-6, IL12, IL-18 and others. Leukocytes are cates HAE. However, the increased vascular permeability then recruited to move into the inflamed tissue area and per associated with HAE has been replicated in rodent models form various functions such as release of additional cellular with agents such as the angiotensin converting enzyme (ACE) mediators, phagocytosis, release of enzymatic granules, and 60 inhibitor captopril, as well as the C1-INH knockout mouse other functions. The exudative component involves the pas (Han, E. D. et al. J. Clin. Invest. 109: 1057-1063, 2002). sage of plasma fluid containing proteins from blood vessels to the inflamed tissue site. Inflammatory mediators such as SUMMARY bradykinin, nitric oxide, and histamine cause blood vessels to become dilated, slow the blood flow in the vessels, and 65 Provided herein are methods for modulating expression of increase the blood vessel permeability, allowing the move Factor 12 mRNA and protein. In certain embodiments, Factor ment of fluid and protein into the tissue. Biochemical cas 12 specific inhibitors modulate expression of Factor 12 US 9, 187,749 B2 3 4 mRNA and protein. In certain embodiments, Factor 12 spe comprising one unit and elements and components that com cific inhibitors are nucleic acids, proteins, or Small molecules. prise more than one subunit, unless specifically stated other In certain embodiments, modulation can occur in a cell or wise. tissue. In certain embodiments, the cell or tissue is in an The section headings used herein are for organizational animal. In certain embodiments, the animal is a human. In 5 purposes only and are not to be construed as limiting the certain embodiments, Factor 12 mRNA levels are reduced. In Subject matter described. All documents, or portions of docu certain embodiments, Factor 12 protein levels are reduced. In ments, cited in this disclosure, including, but not limited to, certain embodiments, Factor 12 mRNA and protein levels are patents, patent applications, published patent applications, reduced. Such reduction can occur in a time-dependent man articles, books, treatises, and GENBANK Accession Num ner or in a dose-dependent manner. 10 Also provided are methods useful for preventing, treating, bers and associated sequence information obtainable through and ameliorating diseases, disorders, and conditions. In cer databases such as National Center for Biotechnology Infor tain embodiments, such diseases, disorders, and conditions mation (NCBI) and other data referred to throughout in the are inflammatory conditions. In certain embodiments, the disclosure herein are hereby expressly incorporated by refer inflammatory condition may be an acute or chronic inflam 15 ence for the portions of the document discussed herein, as matory condition. In certain embodiments, such inflamma well as in their entirety. tory conditions may include hereditary angioedema (HAE), Definitions edema, angioedema, Swelling, angioedema of the lids, ocular Unless specific definitions are provided, the nomenclature edema, macular edema, and cerebral edema. utilized in connection with, and the procedures and tech Such diseases, disorders, and conditions can have one or niques of analytical chemistry, synthetic organic chemistry, more risk factors, causes, or outcomes in common. Certain and medicinal and pharmaceutical chemistry described risk factors and causes for development of an inflammatory herein are those well known and commonly used in the art. condition include genetic predisposition to an inflammatory Standard techniques may be used for chemical synthesis, and condition and environmental factors. In certain embodi chemical analysis. ments, a defect in an individual’s genetic code for comple 25 Unless otherwise indicated, the following terms have the ment 1 esterase inhibitor (i.e., C1-INH, a protein that helps to following meanings: regulate the immune system) is responsible for inflammatory “2'-O-methoxyethyl” (also 2'-MOE and 2'-O(CH) conditions, such as, hereditary angioedema (HAE). In certain OCH) refers to an O-methoxy-ethyl modification of the 2 embodiments, genetic mutations lead to a deficiency in position of a furanosyl ring. A 2'-O-methoxyethyl modified C1-INH (i.e., type I HAE) or an inability of existing C1-INH 30 Sugar is a modified Sugar. to function properly (i.e., type II HAE). In certain embodi “2'-MOE nucleoside' (also 2'-O-methoxyethyl nucleo ments, genetic mutations in Factor 12 gene lead to hyperfunc side) means a nucleoside comprising a 2-MOE modified tionalization of Factor 12, which leads to hereditary Sugar moiety. angioedema (i.e., type III HAE). In certain embodiments, acquired angioedema may be the result of using angiotensin 35 “5-methylcytosine” means a cytosine modified with a converting enzyme inhibitors (i.e., ACE inhibitors) or angio methyl group attached to the 5' position. A 5-methylcytosine tensin II receptor blockers (i.e., ARBs). In certain embodi is a modified nucleobase. ments, an allergic reaction may lead to angioedema. Certain About’ means within +7% of a value. For example, if it is outcomes associated with development of an inflammatory stated, “the compounds affected at least about 70% inhibition condition include edema/swelling in various body parts 40 of Factor 12, it is implied that the Factor 12 levels are including the extremities (i.e., hands, feet, arms, legs), the inhibited within a range of 63% and 77%. intestines (abdomen), the face, the genitals, the larynx (i.e., 'Active pharmaceutical agent’ means the Substance or Sub Voice box); vascular permeability; vascular leakage; general stances in a pharmaceutical composition that provide a thera ized inflammation; abdominal pain; bloating; Vomiting; diar peutic benefit when administered to an individual. For rhea; itchy skin; respiratory (asthmatic) reactions; rhinitis; 45 example, in certain embodiments an antisense oligonucle anaphylaxis; bronchoconstriction; hypotension; coma; and otide targeted to Factor 12 is an active pharmaceutical agent. death. 'Active target region' or “target region' means a region to In certain embodiments, methods of treatment include which one or more active antisense compounds is targeted. administering a Factor 12 specific inhibitor to an individual in 'Active antisense compounds' means antisense compounds need thereof. In certain embodiments, the Factor 12 specific 50 that reduce target nucleic acid levels or protein levels. inhibitor is a nucleic acid. In certain embodiments, the “Administered concomitantly” refers to the co-administra nucleic acid is an antisense compound. In certain embodi tion of two agents in any manner in which the pharmacologi ments, the antisense compound is a modified oligonucleotide. cal effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents DETAILED DESCRIPTION 55 be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. It is to be understood that both the foregoing general The effects of both agents need not manifest themselves at the description and the following detailed description are exem same time. The effects need only be overlapping for a period plary and explanatory only and are not restrictive of the inven of time and need not be coextensive. tion, as claimed. Herein, the use of the singular includes the 60 Administering” means providing a pharmaceutical agent plural unless specifically stated otherwise. As used herein, the to an individual, and includes, but is not limited to adminis use of “or” means “and/or unless stated otherwise. Addition tering by a medical professional and self-administering. ally, as used herein, the use of “and” means “and/or unless Amelioration” or “ameliorate' or “ameliorating refers to stated otherwise. Furthermore, the use of the term “includ a lessening of at least one indicator, sign, or symptom of an ing as well as other forms, such as “includes” and 65 associated disease, disorder, or condition. The severity of “included, is not limiting. Also, terms such as “element” or indicators may be determined by subjective or objective mea “component' encompass both elements and components sures, which are known to those skilled in the art. US 9, 187,749 B2 5 6 Animal' refers to a human or non-human animal, includ nucleic acid encoding a coagulation factor. For example, in ing, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and certain embodiments, a coagulation factor nucleic acid non-human primates, including, but not limited to, monkeys includes, without limitation, a DNA sequence encoding a and chimpanzees. coagulation factor (including genomic DNA comprising Antibody” refers to a molecule characterized by reacting introns and exons), an RNA sequence transcribed from DNA specifically with an antigen in Some way, where the antibody encoding a coagulation factor, and an mRNA sequence and the antigen are each defined in terms of the other. Anti encoding a coagulation factor. “Coagulation factor mRNA body may refer to a complete antibody molecule or any frag means an mRNA encoding a coagulation factor protein. ment or region thereof. Such as the heavy chain, the light “Complementarity’ means the capacity for pairing chain, Fab region, and Fc region. 10 between nucleobases of a first nucleic acid and a second Antisense activity” means any detectable or measurable nucleic acid. activity attributable to the hybridization of an antisense com “Contiguous nucleobases' means nucleobases immedi pound to its target nucleic acid. In certain embodiments, ately adjacent to each other. antisense activity is a decrease in the amount or expression of “Diluent’ means an ingredient in a composition that lacks a target nucleic acid or protein encoded by Such target nucleic 15 pharmacological activity, but is pharmaceutically necessary acid. or desirable. For example, the diluent in an injected compo Antisense compound' means an oligomeric compound sition may be a liquid, e.g. saline solution. that is capable of undergoing hybridization to a target nucleic “Dose” means a specified quantity of a pharmaceutical acid through hydrogen bonding. Examples of antisense com agent provided in a single administration, or in a specified pounds include single-stranded and double-stranded com time period. In certain embodiments, a dose may be admin pounds, such as, antisense oligonucleotides, siRNAS, shR istered in one, two, or more boluses, tablets, or injections. For NAs, snoRNAs, miRNAs, and satellite repeats. example, in certain embodiments where Subcutaneous Antisense inhibition” means reduction of target nucleic administration is desired, the desired dose requires a Volume acid levels or target protein levels in the presence of an anti not easily accommodated by a single injection, therefore, two sense compound complementary to a target nucleic acid com 25 or more injections may be used to achieve the desired dose. In pared to target nucleic acid levels or target protein levels in the certain embodiments, the pharmaceutical agent is adminis absence of the antisense compound. tered by infusion over an extended period of time or continu Antisense oligonucleotide' means a single-stranded oli ously. Doses may be stated as the amount of pharmaceutical gonucleotide having a nucleobase sequence that permits agent per hour, day, week, or month. hybridization to a corresponding region or segment of a target 30 “Effective amount’ means the amount of active pharma nucleic acid. ceutical agent Sufficient to effectuate a desired physiological "Bicyclic sugar” means a furanosyl ring modified by the outcome in an individual in need of the agent. The effective bridging of two atoms. A bicyclic Sugar is a modified Sugar. amount may vary among individuals depending on the health “Bicyclic nucleoside' (also BNA) means a nucleoside hav and physical condition of the individual to be treated, the ing a Sugar moiety comprising a bridge connecting two car 35 taxonomic group of the individuals to be treated, the formu bon atoms of the Sugar ring, thereby forming a bicyclic ring lation of the composition, assessment of the individuals system. In certain embodiments, the bridge connects the medical condition, and other relevant factors. 4-carbon and the 2-carbon of the Sugar ring. “Factor 12 nucleic acid or “Factor XII nucleic acid or “F "Cap structure' or “terminal cap moiety' means chemical 12 nucleic acid or “FXII nucleic acid or “F12 nucleic acid modifications, which have been incorporated at either termi 40 means any nucleic acid encoding Factor 12. For example, in nus of an antisense compound. certain embodiments, a Factor 12 nucleic acid includes a “cEt' or “constrained ethyl means a bicyclic nucleoside DNA sequence encoding Factor 12, an RNA sequence tran having a Sugar moiety comprising a bridge connecting the scribed from DNA encoding Factor 12 (including genomic 4-carbon and the 2-carbon, wherein the bridge has the for DNA comprising introns and exons), and an mRNA sequence mula: 4'-CH(CH) O-2'. 45 encoding Factor 12. "Factor 12 mRNA' means an mRNA “Constrained ethyl nucleoside' (also clet nucleoside) encoding a Factor 12 protein. means a nucleoside comprising a bicyclic Sugar moiety com “Factor 12 specific inhibitor” refers to any agent capable of prising a 4'-CH(CH)—O-2' bridge. specifically inhibiting the expression of Factor 12 mRNA “Chemically distinct region” refers to a region of an anti and/or Factor 12 protein at the molecular level. For example, sense compound that is in Some way chemically different than 50 Factor 12 specific inhibitors include nucleic acids (including another region of the same antisense compound. For example, antisense compounds), peptides, antibodies, Small mol a region having 2'-O-methoxyethyl nucleotides is chemically ecules, and other agents capable of inhibiting the expression distinct from a region having nucleotides without 2'-O-meth of Factor 12 mRNA and/or Factor 12 protein. In certain oxyethyl modifications. embodiments, by specifically modulating Factor 12 mRNA "Chimericantisense compound' means an antisense com 55 expression and/or Factor 12 protein expression, Factor 12 pound that has at least two chemically distinct regions. specific inhibitors may affect other components of the coagul "Co-administration' means administration of two or more lation cascade including downstream components. Similarly, pharmaceutical agents to an individual. The two or more in certain embodiments, Factor 12 specific inhibitors may pharmaceutical agents may be in a single pharmaceutical affect other molecular processes in an animal. composition, or may be in separate pharmaceutical composi 60 “Fully complementary' or “100% complementary' means tions. Each of the two or more pharmaceutical agents may be each nucleobase of a first nucleic acid has a complementary administered through the same or different routes of admin nucleobase in a second nucleic acid. In certain embodiments, istration. Co-administration encompasses parallel or sequen a first nucleic acid is an antisense compound and a target tial administration. nucleic acid is a second nucleic acid. “Coagulation factor” means any of factors I, II, III, IV. V. 65 "Gapmer means a chimeric antisense compound in which VII, VIII, IX, X, XI, XII, XIII, or TAFI in the blood coagul an internal region having a plurality of nucleosides that Sup lation cascade. "Coagulation factor nucleic acid means any port RNase H cleavage is positioned between external regions US 9, 187,749 B2 7 8 having one or more nucleosides, wherein the nucleosides “unmodified nucleobase' means the purine bases adenine (A) comprising the internal region are chemically distinct from and guanine (G), and the pyrimidine bases thymine (T), the nucleoside or nucleosides comprising the external cytosine (C), and uracil (U). regions. The internal region may be referred to as a 'gap' and “Modified nucleotide' means a nucleotide having, inde the external regions may be referred to as the “wings.” pendently, a modified Sugar moiety, modified internucleoside "Gap-widened' means a chimeric antisense compound linkage, or modified nucleobase. A “modified nucleoside' having a gap segment of 12 or more contiguous 2'-deoxyri means a nucleoside having, independently, a modified Sugar bonucleosides positioned between and immediately adjacent moiety or modified nucleobase. to 5' and 3' wing segments having from one to six nucleosides. “Modified oligonucleotide' means an oligonucleotide “Hybridization” means the annealing of complementary 10 comprising a modified internucleoside linkage, a modified nucleic acid molecules. In certain embodiments, complemen Sugar, or a modified nucleobase. tary nucleic acid molecules include an antisense compound “Modified sugar refers to a substitution or change from a and a target nucleic acid. natural Sugar. “Identifying an animal at risk for developing an inflamma 15 “Motif' means the pattern of chemically distinct regions in tory condition” means identifying an animal having been an antisense compound. diagnosed with an inflammatory condition or identifying an “Naturally occurring internucleoside linkage” means a 3' animal predisposed to develop an inflammatory condition. to 5' phosphodiester linkage. Individuals predisposed to develop an inflammatory condi “Natural sugar moiety” means a sugar found in DNA (2-H) tion include those having one or more risk factors for inflam or RNA (2'-OH). matory conditions, including, having a personal or family “Nucleic acid refers to molecules composed of mono history of one or more inflammatory conditions. Such iden meric nucleotides. A nucleic acid includes ribonucleic acids tification may be accomplished by any method including (RNA), deoxyribonucleic acids (DNA), single-stranded evaluating an individual’s medical history and standard clini nucleic acids, double-stranded nucleic acids, Small interfer cal tests or assessments. 25 ing ribonucleic acids (siRNA), and microRNAs (miRNA). “Identifying an animal at risk for experiencing an attack of “Nucleobase' means a heterocyclic moiety capable of pair hereditary angioedema' means identifying an animal having ing with a base of another nucleic acid. been diagnosed with hereditary angioedema or identifying an "Nucleobase sequence” means the order of contiguous animal predisposed to develop hereditary angioedema. Indi nucleobases independent of any Sugar, linkage, or nucleobase viduals predisposed to develop hereditary angioedema 30 modification. "Nucleoside' means a nucleobase linked to a Sugar. include those having one or more risk factors for hereditary Nucleoside mimetic' includes those structures used to angioedema, including, having a personal or family history of replace the Sugar or the Sugar and the base and not necessarily hereditary angioedema. Such identification may be accom the linkage at one or more positions of an oligomeric com plished by any method including evaluating an individuals 35 pound Such as for example nucleoside mimetics having mor medical history and standard clinical tests or assessments. pholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicy “Immediately adjacent’ means there are no intervening clo, or tricyclo Sugar mimetics, e.g., nonfuranose Sugar units. elements between the immediately adjacent elements. Nucleotide mimetic includes those structures used to replace “Individual” means a human or non-human animal the nucleoside and the linkage at one or more positions of an selected for treatment or therapy. 40 oligomeric compound Such as for example peptide nucleic “Inflammatory condition' or "inflammatory disease” or acids or morpholinos (morpholinos linked by —N(H)—C “inflammatory disorder” or “inflammatory condition” means (=O)—O— or other non-phosphodiester linkage). Sugar a disease, disorder or condition related to an inflammatory Surrogate overlaps with the slightly broader term nucleoside response to injury or stimulus characterized by clinical signs mimetic but is intended to indicate replacement of the Sugar of increased redness (rubor), temperature (calor), Swelling 45 unit (furanose ring) only. The tetrahydropyranyl rings pro (tumor), pain (dolor) and/or loss of function (functiolaesa) in vided hereinare illustrative of an example of a Sugar Surrogate a tissue. Examples of Such diseases, disorders, and conditions wherein the furanose Sugar group has been replaced with a include hereditary angioedema (HAE). tetrahydropyranyl ring system. “Inhibiting Factor 12” means reducing expression of Fac "Nucleotide' means a nucleoside having a phosphate tor 12 mRNA and/or protein levels in the presence of a Factor 50 group covalently linked to the Sugar portion of the nucleoside. 12 specific inhibitor, including a Factor 12 antisense oligo “Oligomeric compound' or "oligomer means a polymer nucleotide, as compared to expression of Factor 12 mRNA oflinked monomeric subunits which is capable of hybridizing and/or protein levels in the absence of a Factor 12 specific to at least a region of a nucleic acid molecule. inhibitor, such as a Factor 12 antisense oligonucleotide. “Oligonucleotide' means a polymer of linked nucleosides “Internucleoside linkage” refers to the chemical bond 55 each of which can be modified or unmodified, independent between nucleosides. one from another. "Linked nucleosides' means adjacent nucleosides which “Parenteral administration” means administration through are bonded together. injection or infusion. Parenteral administration includes Sub “Mismatch' or “non-complementary nucleobase' refers to cutaneous administration, intravenous administration, intra the case when a nucleobase of a first nucleic acid is not 60 muscular administration, intraarterial administration, intrap capable of pairing with the corresponding nucleobase of a eritoneal administration, or intracranial administration, e.g., second or target nucleic acid. intrathecal or intracerebroventricular administration. “Modified internucleoside linkage” refers to a substitution “Peptide' means a molecule formed by linking at least two or any change from a naturally occurring internucleoside amino acids by amide bonds. Peptide refers to polypeptides bond (i.e., a phosphodiester internucleoside bond). 65 and proteins. “Modified nucleobase' refers to any nucleobase other than "Pharmaceutical composition' means a mixture of sub adenine, cytosine, guanine, thymidine, or uracil. An stances Suitable for administering to an individual. For US 9, 187,749 B2 10 example, a pharmaceutical composition may comprise one or “Unmodified nucleotide' means a nucleotide composed of more active pharmaceutical agents and a sterile aqueous Solu naturally occurring nucleobases, Sugar moieties, and inter tion. nucleoside linkages. In certain embodiments, an unmodified “Pharmaceutically acceptable derivative' encompasses nucleotide is an RNA nucleotide (i.e. 3-D-ribonucleosides) or pharmaceutically acceptable salts, conjugates, prodrugs or a DNA nucleotide (i.e. B-D-deoxyribonucleoside). isomers of the compounds described herein. Certain Embodiments "Pharmaceutically acceptable salts' means physiologi Certain embodiments provide methods for decreasing Fac cally and pharmaceutically acceptable salts of antisense com tor 12 mRNA and protein expression. pounds, i.e., salts that retain the desired biological activity of Certain embodiments provide methods for the treatment, the parent oligonucleotide and do not impart undesired toxi 10 cological effects thereto. prevention, or amelioration of diseases, disorders, and con “Phosphorothioate linkage” means a linkage between ditions associated with Factor 12 in an individual in need nucleosides where the phosphodiester bond is modified by thereof. Also contemplated are methods for the preparation of replacing one of the non-bridging oxygenatoms with a Sulfur a medicament for the treatment, prevention, or amelioration atom. A phosphorothioate linkage (Pi—S) is a modified inter 15 of a disease, disorder, or condition associated with Factor 12. nucleoside linkage. Factor 12 associated diseases, disorders, and conditions “Portion” means a defined number of contiguous (i.e., include inflammatory conditions. In certain embodiments, linked) nucleobases of a nucleic acid. In certain embodi the inflammatory condition may be an acute or chronic ments, a portion is a defined number of contiguous nucleo inflammatory condition. In certain embodiments, such bases of a target nucleic acid. In certain embodiments, a inflammatory conditions may include hereditary angioedema portion is a defined number of contiguous nucleobases of an (HAE), edema, angioedema, Swelling, angioedema of the antisense compound. lids, ocular edema, macular edema, and cerebral edema. “Prevent' or “preventing refers to delaying or forestalling Certain embodiments provide for the use of a Factor 12 the onset or development of a disease, disorder, or condition specific inhibitor for treating, preventing, or ameliorating a for a period of time from minutes to indefinitely. Prevent also 25 Factor 12 associated disease. In certain embodiments, Factor means reducing risk of developing a disease, disorder, or 12 specific inhibitors are nucleic acids (including antisense condition. compounds), peptides, antibodies, Small molecules, and “Prodrug' means a therapeutic agent that is prepared in an other agents capable of inhibiting the expression of Factor 12 inactive form that is converted to an active form within the mRNA and/or Factor 12 protein. body or cells thereof by the action of endogenous enzymes or 30 In certain embodiments of the present invention, Factor 12 other chemicals or conditions. specific inhibitors are peptides or proteins, such as, but not "Side effects” means physiological responses attributable limited to, yellowfin sole anticoagulant protein (YAP) as to a treatment other than the desired effects. In certain described in Life Sci. 2005. 76: 2607-19; corn inhibitor of embodiments, side effects include injection site reactions, activated Hageman factor (CHFI) as described in Protein liver function test abnormalities, renal function abnormali 35 Expr: Purif. 1998. 13: 143-9; corn trypsin inhibitor as ties, liver toxicity, renal toxicity, central nervous system described in Blood Coagul. Fibronolysis. 2009. 20:191-6: abnormalities, myopathies, and malaise. For example, triafestin-1 and triafestin-2 as described in FEBS J. 2007. increased aminotransferase levels in serum may indicate liver 274: 4271-86: YHK9 and vitronectin as described in Blood. toxicity or liver function abnormality. For example, increased 2002. 99: 3585-96; torresea cearensis trypsin inhibitor as bilirubin may indicate liver toxicity or liver function abnor 40 described in Immunopharmacology. 1996. 32: 62-6; amyloid mality. precursor protein as described in J. Lab. Clin. Med. 1995. "Single-stranded oligonucleotide' means an oligonucle 125: 251-6; streptoverticillium anticoagulant I as described in otide which is not hybridized to a complementary strand. J. Biochem. 1994. 115: 743-51; C1-inhibitor as described in “Specifically hybridizable” refers to an antisense com Protein Sci. 1993. 2: 727-32; antithrombin III as described in pound having a Sufficient degree of complementarity between 45 Biochem. Biophys. Res. Comm. 1977. 74: 150-8; and alpha an antisense oligonucleotide and a target nucleic acid to 1-antitrypsin-Pittsburgh as described in J. Clin. Invest. 1986. induce a desired effect, while exhibiting minimal or no effects 77:631-4. on non-target nucleic acids under conditions in which specific In certain embodiments of the present invention, Factor 12 binding is desired, i.e., under physiological conditions in the specific inhibitors are antibodies, such as, but not limited to, case of in Vivo assays and therapeutic treatments. 50 KOK5 antibody as described in Thromb. Haemost. 2000. 84: "Targeting or “targeted' means the process of design and 1057-65; mAb 2/215 as described in Thromb. Haemost. 2000. selection of an antisense compound that will specifically 83: 874-81: B7C9 as described in Blood. 1998.92:4198-206; hybridize to a target nucleic acid and induce a desired effect. beta 2-glycoprotein I and anti-beta 2-glycoprotein I as “Target nucleic acid.” “target RNA.” and “target RNA tran described in Thromb. Haemost. 1995. 73: 798-804; and mAb script' all refer to a nucleic acid capable of being targeted by 55 2/215 and mAb 201f9 as described in USPPN 2009/0304685. antisense compounds. In certain embodiments of the present invention, Factor 12 "Target segment’ means the sequence of nucleotides of a specific inhibitors are Small molecules, such as, but not lim target nucleic acid to which an antisense compound is tar ited to, neurotropin as described in Biochem. Pharmacol. geted. “5” target site' refers to the 5'-most nucleotide of a 1992. 43: 1361-9; haemaphysalin as described in Thromb. target segment. "3" target site' refers to the 3'-most nucleotide 60 Haemost. 93: 359-67; transcription factor hepatocyte nuclear of a target segment. factor-4 as described in Endocrinology. 1998. 139: 4581-9: “Therapeutically effective amount’ means an amount of a phenylglyoxal hydrate as described in J. Lab. Clin. Med. pharmaceutical agent that provides atherapeutic benefit to an 1993. 122: 697-702; eosinophilic extracts as described in Am. individual. J. Hematol. 1993. 42: 138-45; schistosome extracts as “Treat' or “treating refers to administering a pharmaceu 65 described in J. Lab. Clin. Med. 1992. 120: 735-9; extracts of tical composition to effect an alteration or improvement of a Brugia malayimicrofilariae as described in J. Lab. Clin. Med. disease, disorder, or condition. 1991. 117: 344-52; H-D-Pro-Phe-Arg-chloromethylketone US 9, 187,749 B2 11 12 as described in USPPN US 2010/01 19512; and Curcurbita (iii) a 3' wing segment consisting of linked nucleosides, maxima iso inhibitor as described in Biochemistry. 1982. 21: wherein the gap segment is positioned immediately adjacent 3741-3746. to and between the 5' wing segment and the 3' wing segment Certain embodiments provide for methods of treating, pre and wherein each nucleoside of each wing segment com venting, or ameliorating an inflammatory condition in an prises a modified Sugar. In some such embodiments, each animal, comprising administering to the animala therapeuti cytosine in the modified oligonucleotide is a 5-methylcy cally effective amount of a Factor 12 specific inhibitor, tosine. wherein the inflammatory condition is ameliorated in the In certain embodiments, the modified oligonucleotide of animal. the compound comprises: In certain embodiments, the animal is a human. 10 (i) a gap segment consisting often linked deoxynucleosides; In certain embodiments, the inflammatory condition is (ii) a 5' wing segment consisting of five linked nucleosides; hereditary angioedema (HAE). (iii) a 3' wing segment consisting of five linked nucleosides, In certain embodiments, the Factor 12 specific inhibitor is wherein the gap segment is positioned immediately adjacent an antisense compound. In certain embodiments, the anti to and between the 5' wing segment and the 3' wing segment, sense compound is a modified oligonucleotide. 15 wherein each nucleoside of each wing segment comprises a In certain embodiments, the Factor 12 specific inhibitor is 2'-O-methoxyethyl Sugar, and wherein each internucleoside a nucleic acid. In certain embodiments, the nucleic acid is a linkage is a phosphorothioate linkage. In some Such embodi modified oligonucleotide. ments, each cytosine in the modified oligonucleotide is a In certain embodiments, the Factor 12 specific inhibitor is 5-methylcytosine. a modified oligonucleotide. Certain embodiments provide the use of Factor 12 specific In certain embodiments, the modified oligonucleotide con inhibitors as described herein in the manufacture of a medi sists of 12 to 30 linked nucleosides. cament for treating, ameliorating, or preventing an inflamma In certain embodiments, the modified oligonucleotide is a tory condition Such as hereditary angioedema. single-stranded oligonucleotide. Certain embodiments provide the use of a Factor 12 spe In certain embodiments, the modified oligonucleotide con 25 cific inhibitor as described herein in the manufacture of a sists of 15, 16, 17, 18, 19, or 20 linked nucleosides. medicament for treating, preventing, or ameliorating an In certain embodiments, the modified oligonucleotide has inflammatory condition as described herein in a patient who a nucleobase sequence that is 80%, 85%, 90%,95%, or 100% is Subsequently administered an additional agent or therapy complementary to a human Factor 12 nucleic acid. as described herein. In certain embodiments, the modified oligonucleotide 30 Certain embodiments provide a kit for treating, preventing, comprises at least one modified internucleoside linkage. In or ameliorating an inflammatory condition as described certain embodiments, each modified internucleoside linkage herein wherein the kit comprises: is a phosphorothioate internucleoside linkage. (i) a Factor 12 specific inhibitor as described herein; and In certain embodiments, at least one nucleoside of the alternatively modified oligonucleotide comprises a modified Sugar. In cer 35 (ii) an additional agent or therapy as described herein. tain embodiments, the modified Sugar is a bicyclic Sugar. In A kit may further include instructions for using the kit to certain embodiments, the bicyclic Sugar comprises a 4'-CH treat, prevent, or ameliorate an inflammatory condition as (CH)—O-2' bridge. described herein by combination therapy as described herein. In certain embodiments, the modified Sugar comprises a In certain embodiments, provided is a compound compris 2'-O-methoxyethyl group. 40 ing a modified oligonucleotide. In certain embodiments, the In certain embodiments, at least one nucleoside of the compound comprises a modified oligonucleotide consisting modified oligonucleotide comprises a modified nucleobase. of 12 to 30 linked nucleosides. In certain embodiments, the modified nucleobase is a 5'-me In certain embodiments, the modified oligonucleotide tar thylcytosine. gets a Factor 12 nucleic acid. In certain embodiments, the In certain embodiments, at least one nucleoside of the 45 Factor 12 nucleic acid may be selected from, but is not limited modified oligonucleotide comprises at least one tetrahydro to, one or more of GENBANKAccession No. NM 000505.3 pyran modified nucleoside wherein a tetrahydropyran ring (incorporated herein as SEQID NO: 1), GENBANKAcces replaces the furanose ring. In certain embodiments, each of sion No. CR601747.1 (incorporated herein as SEQ ID NO: the at least one tetrahydropyran modified nucleoside has the 2), GENBANK Accession No. CR616520.1 (incorporated Structure: 50 herein as SEQ ID NO: 3), GENBANK Accession No. CN298799.1 (incorporated herein as SEQID NO: 4), GEN BANK Accession No. BG248482.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. AW237759.1 (incorporated herein as SEQID NO: 6), GENBANKAcces 55 sion No. BF5291.77.1 (incorporated hereinas SEQID NO:7), the complement of GENBANK Accession No. NT 023133.13 truncated from nucleobase 21637001 to OY 21650000 (incorporated herein as SEQ ID NO: 8), GEN i BANK Accession No. CA456551.1 (incorporated herein as 60 SEQ ID NO: 9), GENBANK Accession No. BC057921.1 (incorporated herein as SEQID NO: 10), GENBANKAcces wherein Bx is an optionally protected heterocyclic base sion No. NM 021489.2 (incorporated hereinas SEQID NO: moiety. 11), GENBANK Accession No. AA277143.1 (incorporated In certain embodiments, the modified oligonucleotide of herein as SEQ ID NO: 12), GENBANK Accession No. the compound comprises: 65 BI554497.1 (incorporated herein as SEQ ID NO: 13), the (i) a gap segment consisting of linked deoxynucleosides; complement of GENBANK Accession No. NT 039589.7 (ii) a 5' wing segment consisting of linked nucleosides; truncated from nucleobase 1059000 to nucleobase 1071000 US 9, 187,749 B2 13 14 (incorporated herein as SEQID NO: 14), GENBANKAcces wherein the modified oligonucleotide is at least 90% comple sion No. NM 00101.4006.1 (incorporated herein as SEQID mentary to a Facter 12 nucleic acid. NO: 15), the complement of GENBANK Accession No. In certain embodiments, expression of Factor 12 mRNA is NW 047487.1 truncated from nucleobase 9759001 to reduced. 9773000 (incorporated herein as SEQ ID NO: 16), the In certain embodiments, expression of Factor 12 protein is complement of GENEBANK Accession No. reduced. NW 001121001.1 truncated from nucleobase 21 2000 to In certain embodiments, the inflammatory condition is an 223000 (incorporated herein as SEQ ID NO: 17), GEN acute inflammatory condition. BANKAccession No. 3378 064 A (incorporated herein as In certain embodiments, the acute inflammatory condition 10 is hereditary angioedma. SEQ ID NO: 18), GENBANK Accession No. 3436 025 A In certain embodiments, the prophylactic administering of (incorporated herein as SEQ ID NO: 19), and GENBANK a modified oligonucleotide prevents edema. Accession No. AB179224.1 (incorporated herein as SEQID In certain embodiments, the prophylactic administering of NO: 20). a modified oligonucleotide prevents vascular permeability. In certain embodiments, the compound may comprise a 15 In certain embodiments, the prophylactic administering of modified oligonucleotide comprising a nucleobase sequence a modified oligonucleotide prevents vascular leakage. at least 80%, at least 85%, at least 90%, at least 95%, at least In certain embodiments, the prophylactic administering of 96%, at least 97%, at least 98%, or at least 99% complemen a modified oligonucleotide prevents inflammation. tary to an equal length portion of SEQID NO: 1, SEQID NO: Certain embodiments provide a method comprising pro 2, SEQIDNO:3, SEQIDNO:4, SEQID NO:5, SEQID NO: phylactically treating an inflammatory condition in an animal 6, SEQID NO:7, SEQID NO:8, SEQID NO:9, SEQIDNO: by administering to the animal a therapeutically effective 10, SEQID NO: 11, SEQID NO: 12, SEQID NO: 13, SEQ amount of a modified oligonucleotide consisting of 12 to 30 IDNO: 14, SEQID NO:15, SEQIDNO:16, SEQID NO:17, linked nucleosides, wherein the modified oligonucleotide is SEQID NO: 18, SEQID NO: 19, or SEQID NO. 20. at least 90% complementary to a Factor 12 nucleic acid. In certain embodiments, the compound may comprise a 25 In certain embodiments, the inflammatory condition is an modified oligonucleotide comprising a nucleobase sequence acute inflammatory condition. at least 80%, at least 85%, at least 90%, at least 95%, at least In certain embodiments, the acute inflammatory condition 96%, at least 97%, at least 98%, or at least 99% complemen is hereditary angioedma. tary to an equal length portion of a human sequence. In certain Certain embodiments provide a method comprising inhib embodiments, the compound may comprise a modified oli 30 iting edmea in an animal by administering to the animal a gonucleotide comprising a nucleobase sequence at least 80%, therapeutically effective amount of a modified oligonucle at least 85%, at least 90%, at least 95%, at least 96%, at least otide consisting of 12 to 30 linked nucleosides, wherein the 97%, at least 98%, or at least 99% complementary to an equal modified oligonucleotide is at least 90% complementary to a lengthportion of SEQID NO: 1, SEQID NO: 2, SEQID NO: Factor 12 nucleic acid. 3, SEQIDNO:4, SEQIDNO:5, SEQID NO: 6, SEQID NO: 35 Certain embodiments provide a method comprising inhib 7, or SEQID NO: 8. iting vascular permeability in an animal by administering to In certain embodiments, the compound may comprise a the animal a therapeutically effective amount of a modified modified oligonucleotide comprising a nucleobase sequence oligonucleotide consisting of 12 to 30 linked nucleosides, 100% complementary to an equal length portion of SEQID wherein the modified oligonucleotide is at least 90% comple NO: 1, SEQID NO: 2, SEQID NO:3, SEQID NO: 4, SEQ 40 mentary to a Factor 12 nucleic acid. ID NO:5, SEQID NO: 6, SEQID NO:7, or SEQID NO:8. Certain embodiments provide a method comprising inhib In certain embodiments, the compound may comprise a iting vascular leakage in an animal by administering to the modified oligonucleotide comprising a nucleobase sequence animal a therapeutically effective amount of a modified oli 100% complementary to an equal length portion of a human gonucleotide consisting of 12 to 30 linked nucleosides, sequence. In certain embodiments, the compound may com 45 wherein the modified oligonucleotide is at least 90% comple prise a modified oligonucleotide comprising a nucleobase mentary to a Factor 12 nucleic acid. sequence 100% complementary to an equal length portion of Certain embodiments provide a method comprising inhib SEQID NO: 1, SEQID NO: 2, SEQID NO:3, SEQID NO: iting inflammation in an animal by administering to the ani 4, SEQID NO: 5, SEQID NO: 6, SEQID NO: 7, or SEQID mal a therapeutically effective amount of a modified oligo NO: 8. 50 nucleotide consisting of 12 to 30 linked nucleosides, wherein In certain embodiments, the nucleobase sequence of the the modified oligonucleotide is at least 90% complementary modified oligonucleotide is 100% complementary to a to a Factor 12 nucleic acid. nucleobase sequence of SEQID NO: 1, SEQID NO: 2, SEQ In certain embodiments, the animal is a human. IDNO:3, SEQIDNO:4, SEQIDNO:5, SEQIDNO: 6, SEQ In certain embodiments, the Factor 12 nucleic acid is a ID NO: 7, or SEQ ID NO:8. 55 human Factor 12 nucleic acid. Certain embodiments provide a method comprising, (1) In certain embodiments, the human Factor 12 nucleic acid identifying an animal at risk for experiencing an attack of is SEQIDNO: 1, SEQID NO:2, SEQID NO:3, SEQID NO: hereditary angioedema; and (2) prophylactically administer 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or the ing to the at risk animal atherapeutically effective amount of complement of SEQID NO: 8. a modified oligonucleotide consisting of 12 to 30 linked 60 In certain embodiments, the modified oligonucleotide is nucleosides, wherein the modified oligonucleotide is at least 100% complementary to a human Factor 12 nucleic acid. 90% complementary to a Facter 12 nucleic acid. In certain embodiments, the modified oligonucleotide is a Certain embodiments provide a method comprising, (1) single-stranded oligonucleotide. identifying an animal at risk for developing an inflammatory In certain embodiments, wherein the modified oligonucle condition; and (2) prophylactically administering to the at 65 otide comprises at least one modified internucleoside linkage. risk animal a therapeutically effective amount of a modified In certain embodiments, the modified internucleoside link oligonucleotide consisting of 12 to 30 linked nucleosides, age is a phosphorothioate internucleoside linkage. US 9, 187,749 B2 15 16 In certain embodiments, the modified oligonucleotide In certain embodiments, the inflammatory condition is comprises at least one nucleoside having a modified Sugar. associated with high levels of bradykinin. In certain embodiments, the modified Sugar is a bicyclic Antisense Compounds Sugar. Oligomeric compounds include, but are not limited to, In certain embodiments, the bicyclic Sugar comprises a oligonucleotides, oligonucleosides, oligonucleotide analogs, 4'-CH(CH) O-2' bridge. oligonucleotide mimetics, antisense compounds, antisense In certain embodiments, the modified oligonucleotide oligonucleotides, and siRNAs. An oligomeric compound comprises at least one tetrahydropyran modified nucleoside may be “antisense to a target nucleic acid, meaning that is wherein a tetrahydropyran ring replaces the furanose ring. capable of undergoing hybridization to a target nucleic acid In certain embodiments, each of the at least one tetrahy 10 through hydrogen bonding. dropyran modified nucleoside has the structure: In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3’ direc tion, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain Such 15 embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. OY In certain embodiments, an antisense compound targeted i to a Factor 12 nucleic acid is 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits. In other embodiments, the antisense com wherein Bx is an optionally protected heterocyclic base pound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or linked moiety. Subunits. In certain Such embodiments, the antisense com In certain embodiments, the modified Sugar comprises a 25 pounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2'-O-methoxyethyl group. 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33,34, 35,36, 37,38, In certain embodiments, at least one nucleoside comprises 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55, a modified nucleobase. 56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71,72, In certain embodiments, the modified nucleobase is a 73, 74, 75, 76, 77, 78,79, or 80 linked subunits in length, or a 5-methylcytosine. 30 range defined by any two of the above values. In some In certain embodiments, the modified oligonucleotide is embodiments the antisense compound is an antisense oligo co-administered with any of the group selected from a serine nucleotide, and the linked subunits are nucleosides. protease inhibitor C1-INH recombinant protein, kallikrein In certain embodiments antisense oligonucleotides tar antisense oligonucleotide, CINRYZE, BERINERT, KALBI geted to a Factor 12 nucleic acid may be shortened or trun TOR, Icatibant, Ecallantide, attenuated androgens, anabolic 35 cated. For example, a single Subunit may be deleted from the steroids, and antifibrinolytic agents (e.g., epsilon-aminocap 5' end (5' truncation), or alternatively from the 3' end (3' roic acid and tranexamic acid). truncation). A shortened or truncated antisense compound Certain embodiments provide, a modified oligonucleotide targeted to a Factor 12 nucleic acid may have two subunits consisting of 12 to 30 linked nucleosides fully complemen deleted from the 5' end, or alternatively may have two sub tary to SEQID NO: 1, SEQID NO: 2, SEQID NO:3, SEQID 40 units deleted from the 3' end, of the antisense compound. NO: 4, SEQID NO: 5, SEQID NO: 6, SEQID NO: 7, or the Alternatively, the deleted nucleosides may be dispersed complement of SEQID NO: 8 for use in the treatment of an throughout the antisense compound, for example, in an anti inflammatory condition. sense compound having one nucleoside deleted from the 5' In certain embodiments, the inflammatory condition is end and one nucleoside deleted from the 3' end. hereditary angioedema. 45 When a single additional Subunit is present in a lengthened Certain embodiments provide use of a modified oligo antisense compound, the additional Subunit may be located at nucleotide as described herein in the manufacture of a medi the 5' or 3' end of the antisense compound. When two or more cament for treating an inflammatory condition. additional subunits are present, the added subunits may be In certain embodiments, the administering is parenteral adjacent to each other, for example, in an antisense compound administration. In certain embodiments, the parenteral 50 having two subunits added to the 5' end (5' addition), or administration is any of subcutaneous or intravenous admin alternatively to the 3' end (3' addition), of the antisense com istration. pound. Alternatively, the added subunits may be dispersed Certain embodiments provide a method comprising, throughout the antisense compound, for example, in an anti increasing or stabilizing HMWK in an animal in need thereof sense compound having one subunit added to the 5' end and by administering to the animal a therapeutically effective 55 one subunit added to the 3' end. amount of a modified oligonucleotide consisting of 12 to 30 It is possible to increase or decrease the length of an anti linked nucleosides, wherein the modified oligonucleotide is sense compound. Such as an antisense oligonucleotide, and/or at least 90% complementary to a Factor 12 nucleic acid. introduce mismatch bases without eliminating activity. For Certain embodiments provide a method of treating an example, in Woolfetal. (Proc. Natl. Acad. Sci. USA89:7305 inflammatory condition in an animal in need thereof by 60 7309, 1992), a series of antisense oligonucleotides 13-25 increasing or stabilizing HMWK in the animal by adminis nucleobases in length were tested for their ability to induce tering to the animal a therapeutically effective amount of a cleavage of a target RNA in an oocyte injection model. Anti modified oligonucleotide consisting of 12 to 30 linked sense oligonucleotides 25 nucleobases in length with 8 or 11 nucleosides, wherein the modified oligonucleotide is at least mismatch bases near the ends of the antisense oligonucle 90% complementary to a Factor 12 nucleic acid. 65 otides were able to direct specific cleavage of the target In certain embodiments, the inflammatory condition is mRNA, albeit to a lesser extent than the antisense oligonucle associated with low levels of HMWK. otides that contained no mismatches. Similarly, target spe US 9, 187,749 B2 17 18 cific cleavage was achieved using 13 nucleobase antisense 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, oligonucleotides, including those with 1 or 3 mismatches. gapmers of the present invention include, but are not limited Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2001) demonstrated the ability of an oligonucleotide having 2-16-2, 1-18-1,3-10-3, 2-10-2, 1-10-1,2-8-2, 5-8-5, or 6-8-6. 100% complementarity to the bcl-2 mRNA and having 3 5 In certain embodiments, the antisense compound has a mismatches to the bcl-XL mRNA to reduce the expression of “wingmer motif, having a wing-gap or gap-wing configura both bcl-2 and bcl-XL in vitro and in vivo. Furthermore, this tion, i.e. an X-Y or Y-Z configuration as described above for oligonucleotide demonstrated potent anti-tumor activity in the gapmer configuration. Thus, wingmer configurations of V1VO. the present invention include, but are not limited to, for Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) 10 example 5-10, 8–4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, tested a series of tandem 14 nucleobase antisense oligonucle 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8. otides, and a 28 and 42 nucleobase antisense oligonucleotides In certain embodiments, antisense compounds targeted to a comprised of the sequence of two or three of the tandem Factor 12 nucleic acid possess a 5-10-5 gapmer motif. antisense oligonucleotides, respectively, for their ability to In certain embodiments, antisense compounds targeted to a arrest translation of human DHFR in a rabbit reticulocyte 15 Factor 12 nucleic acid possess a 3-14-3 gapmer motif. assay. Each of the three 14 nucleobase antisense oligonucle In certain embodiments, antisense compounds targeted to a otides alone was able to inhibit translation, albeit at a more Factor 12 nucleic acid possess a 2-13-5 gapmer motif. modest level than the 28 or 42 nucleobase antisense oligo In certain embodiments, antisense compounds targeted to a nucleotides. Factor 12 nucleic acid possess a 5-8-5 gapmer motif. Antisense Compound Motifs In certain embodiments, antisense compounds targeted to a In certain embodiments, antisense compounds targeted to a Factor 12 nucleic acid possess a 6-8-6 gapmer motif. Factor 12 nucleic acid have chemically modified subunits In certain embodiments, an antisense compound targeted arranged in patterns, or motifs, to confer to the antisense to a Factor 12 nucleic acid has a gap-widened motif. compounds properties such as enhanced inhibitory activity, In certain embodiments, a gap-widened antisense oligo increased binding affinity for a target nucleic acid, or resis 25 nucleotide targeted to a Factor 12 nucleic acid has a gap tance to degradation by in vivo nucleases. segment of fourteen 2'-deoxyribonucleotides positioned Chimeric antisense compounds typically contain at least immediately adjacent to and between wing segments of three one region modified so as to confer increased resistance to chemically modified nucleosides. In certain embodiments, nuclease degradation, increased cellular uptake, increased the chemical modification comprises a 2'-Sugar modification. binding affinity for the target nucleic acid, and/or increased 30 In another embodiment, the chemical modification comprises inhibitory activity. A second region of a chimeric antisense a 2-MOE sugar modification. compound may optionally serve as a substrate for the cellular In certain embodiments, a gap-widened antisense oligo endonuclease RNase H, which cleaves the RNA strand of an nucleotide targeted to a Factor 12 nucleic acid has a gap RNA:DNA duplex. segment of thirteen 2'-deoxyribonucleotides positioned Antisense compounds having a gapmer motif are consid 35 immediately adjacent to and between a 5' wing segment of ered chimeric antisense compounds. In a gapmer an internal two chemically modified nucleosides and a 3' wing segment region having a plurality of nucleotides that Supports RNaseH of five chemically modified nucleosides. In certain embodi cleavage is positioned between external regions having a ments, the chemical modification comprises a 2'-Sugar modi plurality of nucleotides that are chemically distinct from the fication. In another embodiment, the chemical modification nucleosides of the internal region. In the case of an antisense 40 comprises a 2-MOE sugar modification. oligonucleotide having a gapmer motif, the gap segment gen Target Nucleic Acids, Target Regions and Nucleotide erally serves as the Substrate for endonuclease cleavage, Sequences while the wing segments comprise modified nucleosides. In Nucleotide sequences that encode Factor 12 include, with certain embodiments, the regions of a gapmer are differenti out limitation, the following: GENBANK Accession No. ated by the types of Sugar moieties comprising each distinct 45 NM 000505.3 (incorporated herein as SEQ ID NO: 1), region. The types of Sugar moieties that are used to differen GENBANK Accession No. CR601747.1 (incorporated tiate the regions of a gapmer may in Some embodiments herein as SEQ ID NO: 2), GENBANK Accession No. include B-D-ribonucleosides, B-D-deoxyribonucleosides, CR616520.1 (incorporated herein as SEQID NO:3), GEN 2-modified nucleosides (such 2'-modified nucleosides may BANK Accession No. CN298799.1 (incorporated herein as include 2'-MOE, and 2'-O CH, among others), and bicy 50 SEQ ID NO: 4), GENBANK Accession No. BG248482.1 clic Sugar modified nucleosides (such bicyclic Sugar modified (incorporated herein as SEQID NO. 5), GENBANKAcces nucleosides may include those having a 4'-(CH2)n-O-2 sion No. AW237759.1 (incorporated herein as SEQID NO: bridge, where n=1 or n=2). Preferably, each distinct region 6), GENBANK Accession No. BF5291.77.1 (incorporated comprises uniform Sugar moieties. The wing-gap-wing motif herein as SEQ ID NO: 7), the complement of GENBANK is frequently described as “X-Y-Z’, where “X” represents the 55 Accession No. NT 023133.13 truncated from nucleobase length of the 5' wing region, “Y” represents the length of the 21637001 to 21650000 (incorporated herein as SEQID NO: gap region, and “Z” represents the length of the 3' wing 8), GENBANK Accession No. CA456551.1 (incorporated region. As used herein, a gapmer described as "X-Y-Z’ has a herein as SEQ ID NO: 9), GENBANK Accession No. configuration Such that the gap segment is positioned imme BC057921.1 (incorporated hereinas SEQID NO: 10), GEN diately adjacent to each of the 5' wing segment and the 3' wing 60 BANK Accession No. NM 021489.2 (incorporated herein segment. Thus, no intervening nucleotides exist between the as SEQID NO: 11), GENBANKAccession No. AA277143.1 5' wing segment and gap segment, or the gap segment and the (incorporated herein as SEQID NO: 12), GENBANKAcces 3' wing segment. Any of the antisense compounds described sion No. BI554497.1 (incorporated herein as SEQ ID NO: herein can have agapmer motif. In some embodiments, Xand 13), the complement of GENBANK Accession No. Zare the same, in other embodiments they are different. In a 65 NT 039589.7 truncated from nucleobase 1059000 to preferred embodiment, Y is between 8 and 15 nucleotides. X, nucleobase 1071000 (incorporated herein as SEQ ID NO: Y or Z can be any of 1,2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14. 14), GENBANK Accession No. NM 001014006.1 (incor US 9, 187,749 B2 19 20 porated herein as SEQID NO: 15), the complement of GEN hybridize in a non-specific manner to sequences other than a BANK Accession No. NW 047487.1 truncated from selected target nucleic acid (i.e., non-target or off-target nucleobase 9759001 to 9773000 (incorporated hereinas SEQ sequences). ID NO: 16), the complement of GENBANK Accession No. There may be variation in activity (e.g., as defined by NW 001121001.1 truncated from nucleobase 21 2000 to percent reduction of target nucleic acid levels) of the anti 223000 (incorporated herein as SEQ ID NO: 17), GEN sense compounds within an active target region. In certain BANKAccession No. 3378 064 A (incorporated herein as embodiments, reductions in Factor 12 mRNA levels are SEQ ID NO: 18), GENBANK Accession No. 3436 025 A indicative of inhibition of Factor 12 expression. Reductions in (incorporated herein as SEQ ID NO: 19), and GENBANK levels of a Factor 12 protein are also indicative of inhibition of Accession No. AB179224.1 (incorporated herein as SEQID 10 target mRNA expression. Further, phenotypic changes are NO: 20). indicative of inhibition of Factor 12 expression. For example, It is understood that the sequence set forth in each SEQID reduced or prevented inflammation can be indicative of inhi NO in the Examples contained herein is independent of any bition of Factor 12 expression. In another example, reduced modification to a Sugar moiety, an internucleoside linkage, or or prevented edema/swelling can be indicative of inhibition of a nucleobase. As such, antisense compounds defined by a 15 Factor 12 expression. In another example, prolonged clotting SEQID NO may comprise, independently, one or more modi times (aPTT) can be indicative of inhibition of Factor 12. In fications to a Sugar moiety, an internucleoside linkage, or a another example, reduced or prevented vascular permeability nucleobase. Antisense compounds described by Isis Number can be indicative of inhibition of Factor 12 expression. In (Isis No) indicate a combination of nucleobase sequence and another example, reduced or prevented vascular leakage can motif. be indicative of inhibition of Factor 12 expression. In certain In certain embodiments, a target region is a structurally embodiments, vascular permeability is measured by quanifi defined region of the target nucleic acid. For example, a target cation of a dye, such as Evans Blue. region may encompass a 3'UTR, a 5' UTR, an exon, an intron, Hybridization an exon/intronjunction, a coding region, a translation initia In some embodiments, hybridization occurs between an tion region, translation termination region, or other defined 25 antisense compound disclosed herein and a Factor 12 nucleic nucleic acid region. The structurally defined regions for Fac acid. The most common mechanism of hybridization involves tor 12 can be obtained by accession number from sequence hydrogen bonding (e.g., Watson-Crick, Hoogsteen or databases such as NCBI and such information is incorporated reversed Hoogsteen hydrogen bonding) between comple herein by reference. In certain embodiments, a target region mentary nucleobases of the nucleic acid molecules. may encompass the sequence from a 5' target site of one target 30 Hybridization can occur under varying conditions. Strin segment within the target region to a 3" target site of another gent conditions are sequence-dependent and are determined target segment within the same target region. by the nature and composition of the nucleic acid molecules Targeting includes determination of at least one target seg to be hybridized. ment to which an antisense compound hybridizes, such that a Methods of determining whether a sequence is specifically desired effect occurs. In certain embodiments, the desired 35 hybridizable to a target nucleic acid are well known in the art. effect is a reduction in mRNA target nucleic acid levels. In In certain embodiments, the antisense compounds provided certain embodiments, the desired effect is reduction of levels herein are specifically hybridizable with a Factor 12 nucleic of protein encoded by the target nucleic acid or a phenotypic acid. change associated with the target nucleic acid. Complementarily A target region may contain one or more target segments. 40 An antisense compound and a target nucleic acid are Multiple target segments within a target region may be over complementary to each other when a sufficient number of lapping. Alternatively, they may be non-overlapping. In cer nucleobases of the antisense compound can hydrogen bond tain embodiments, target segments within a target region are with the corresponding nucleobases of the target nucleic acid, separated by no more than about 300 nucleotides. In certain Such that a desired effect will occur (e.g., antisense inhibition embodiments, target segments within a target region are sepa 45 of a target nucleic acid. Such as a Factor 12 nucleic acid). rated by a number of nucleotides that is, is about, is no more Non-complementary nucleobases between an antisense than, is no more than about, 250, 200, 150, 100,90, 80, 70, 60, compound and a Factor 12 nucleic acid may be tolerated 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or provided that the antisense compound remains able to spe is a range defined by any two of the preceeding values. In cifically hybridize to a target nucleic acid. Moreover, an anti certain embodiments, target segments within a target region 50 sense compound may hybridize over one or more segments of are separated by no more than, or no more than about, 5 a Factor 12 nucleic acid Such that intervening or adjacent nucleotides on the target nucleic acid. In certain embodi segments are not involved in the hybridization event (e.g., a ments, target segments are contiguous. Contemplated are tar loop structure, mismatch or hairpin structure). get regions defined by a range having a starting nucleic acid In certain embodiments, the antisense compounds pro that is any of the 5' target sites or 3' target sites listed herein. 55 vided herein, or a specified portion thereof, are, or are at least, Suitable target segments may be found within a 5' UTR, a 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, coding region, a 3' UTR, an intron, an exon, or an exon/intron 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% comple junction. Target segments containing a start codon or a stop mentary to a Factor 12 nucleic acid, a target region, target codon are also Suitable target segments. A Suitable target segment, or specified portion thereof. Percent complementa segment may specifically exclude a certain structurally 60 rity of an antisense compound with a target nucleic acid can defined region Such as the start codon or stop codon. be determined using routine methods. The determination of Suitable target segments may include For example, an antisense compound in which 18 of 20 a comparison of the sequence of a target nucleic acid to other nucleobases of the antisense compound are complementary sequences throughout the genome. For example, the BLAST to a target region, and would therefore specifically hybridize, algorithm may be used to identify regions of similarity 65 would represent 90 percent complementarity. In this amongst different nucleic acids. This comparison can prevent example, the remaining noncomplementary nucleobases may the selection of antisense compound sequences that may be clustered or interspersed with complementary nucleobases US 9, 187,749 B2 21 22 and need not be contiguous to each other or to complementary base(s) relative to a target nucleic acid, Such as a Factor 12 nucleobases. As such, an antisense compound which is 18 nucleic acid, or specified portion thereof. nucleobases in length having 4 (four) noncomplementary The antisense compounds provided herein also include nucleobases which are flanked by two regions of complete those which are complementary to a portion of a target complementarity with the target nucleic acid would have nucleic acid. As used herein, "portion” refers to a defined 77.8% overall complementarity with the target nucleic acid number of contiguous (i.e. linked) nucleobases within a and would thus fall within the scope of the present invention. region or segment of a target nucleic acid. A "portion' can Percent complementarity of an antisense compound with a also refer to a defined number of contiguous nucleobases of region of a target nucleic acid can be determined routinely an antisense compound. In certain embodiments, the anti using BLAST programs (basic local alignment search tools) 10 and PowerBLAST programs known in the art (Altschulet al., sense compounds, are complementary to at least an 8 nucleo J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, base portion of a target segment. In certain embodiments, the Genome Res., 1997, 7, 649 656). Percent homology, antisense compounds are complementary to at least a 12 sequence identity or complementarity, can be determined by, nucleobase portion of a target segment. In certain embodi for example, the Gap program (Wisconsin Sequence Analysis 15 ments, the antisense compounds are complementary to at Package, Version 8 for Unix, Genetics Computer Group, Uni least a 15 nucleobase portion of a target segment. Also con versity Research Park, Madison Wis.), using default settings, templated are antisense compounds that are complementary which uses the algorithm of Smith and Waterman (Adv. Appl. to at leasta 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more Math., 1981, 2, 482 489). nucleobase portion of a target segment, or a range defined by In certain embodiments, the antisense compounds pro any two of these values. vided herein, or specified portions thereof, are fully comple Identity mentary (i.e., 100% complementary) to a target nucleic acid, The antisense compounds provided herein may also have a or specified portion thereof. For example, an antisense com defined percent identity to a particular nucleotide sequence, pound may be fully complementary to a Factor 12 nucleic SEQ ID NO, or compound represented by a specific Isis acid, or a target region, or a target segment or target sequence 25 number, orportion thereof. As used herein, an antisense com thereof. As used herein, “fully complementary' means each pound is identical to the sequence disclosed herein if it has the nucleobase of an antisense compound is capable of precise same nucleobase pairing ability. For example, a RNA which base pairing with the corresponding nucleobases of a target contains uracil in place of thymidine in a disclosed DNA nucleic acid. For example, a 20 nucleobase antisense com sequence would be considered identical to the DNA sequence pound is fully complementary to a target sequence that is 400 30 since both uracil and thymidine pair with adenine. Shortened nucleobases long, so long as there is a corresponding 20 and lengthened versions of the antisense compounds nucleobase portion of the target nucleic acid that is fully described herein as well as compounds having non-identical complementary to the antisense compound. Fully comple bases relative to the antisense compounds provided herein mentary can also be used in reference to a specified portion of also are contemplated. The non-identical bases may be adja the first and for the second nucleic acid. For example, a 20 35 cent to each other or dispersed throughout the antisense com nucleobase portion of a 30 nucleobase antisense compound pound. Percent identity of an antisense compound is calcu can be “fully complementary’ to a target sequence that is 400 lated according to the number of bases that have identical nucleobases long. The 20 nucleobase portion of the 30 base pairing relative to the sequence to which it is being nucleobase oligonucleotide is fully complementary to the compared. target sequence if the target sequence has a corresponding 20 40 In certain embodiments, the antisense compounds, or por nucleobase portion wherein each nucleobase is complemen tions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, tary to the 20 nucleobase portion of the antisense compound. 96%, 97%, 98%, 99% or 100% identical to one or more of the At the same time, the entire 30 nucleobase antisense com antisense compounds or SEQID NOS, or a portion thereof, pound may or may not be fully complementary to the target disclosed herein. sequence, depending on whether the remaining 10 nucleo 45 In certain embodiments, a portion of the antisense com bases of the antisense compound are also complementary to pound is compared to an equal length portion of the target the target sequence. nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, The location of a non-complementary nucleobase may be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase at the 5' end or 3' end of the antisense compound. Alterna portion is compared to an equal length portion of the target tively, the non-complementary nucleobase or nucleobases 50 nucleic acid. may be at an internal position of the antisense compound. In certain embodiments, a portion of the antisense oligo When two or more non-complementary nucleobases are nucleotide is compared to an equal length portion of the target present, they may be contiguous (i.e., linked) or non-contigu nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, ous. In one embodiment, a non-complementary nucleobase is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase located in the wing segment of a gapmer antisense oligo 55 portion is compared to an equal length portion of the target nucleotide. nucleic acid. In certain embodiments, antisense compounds that are, or Modifications are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in A nucleoside is a base-Sugar combination. The nucleobase length comprise no more than 4, no more than 3, no more than (also known as base) portion of the nucleoside is normally a 2, or no more than 1 non-complementary nucleobase(s) rela 60 heterocyclic base moiety. Nucleotides are nucleosides that tive to a target nucleic acid, such as a Factor 12 nucleic acid, further include a phosphate group covalently linked to the or specified portion thereof. Sugar portion of the nucleoside. For those nucleosides that In certain embodiments, antisense compounds that are, or include a pentofuranosyl Sugar, the phosphate group can be are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, linked to the 2',3' or 5’ hydroxyl moiety of the sugar. Oligo 26, 27, 28, 29, or 30 nucleobases in length comprise no more 65 nucleotides are formed through the covalent linkage of adja than 6, no more than 5, no more than 4, no more than 3, no cent nucleosides to one another, to form a linear polymeric more than 2, or no more than 1 non-complementary nucleo oligonucleotide. Within the oligonucleotide structure, the US 9, 187,749 B2 23 24 phosphate groups are commonly referred to as forming the Examples of nucleosides having modified Sugar moieties internucleoside linkages of the oligonucleotide. include without limitation nucleosides comprising 5'-vinyl, Modifications to antisense compounds encompass Substi 5'-methyl (R or S), 4-S, 2-F, 2'-OCH, 2'-OCHCH tutions or changes to internucleoside linkages, Sugar moi 2'-OCH2CHF and 2'-O(CH)OCH substituent groups. The eties, or nucleobases. Modified antisense compounds are substituent at the 2' position can also be selected from allyl, often preferred over native forms because of desirable prop amino, azido, thio, O-allyl, O C-C alkyl, OCF, OCHF, erties such as, for example, enhanced cellular uptake, O(CH2)SCH, O(CH), O N(R)(R), O—CH2—C enhanced affinity for nucleic acid target, increased stability in (=O) N(R)(R), and O CH, C(=O) N(R)— the presence of nucleases, or increased inhibitory activity. (CH2) N(R)(R), where each R. R. and R, is, indepen Chemically modified nucleosides may also be employed to 10 dently, H or substituted or unsubstituted C-C alkyl. increase the binding affinity of a shortened or truncated anti As used herein, “bicyclic nucleosides’ refer to modified sense oligonucleotide for its target nucleic acid. Conse nucleosides comprising a bicyclic Sugar moiety. Examples of quently, comparable results can often be obtained with bicyclic nucleosides include without limitation nucleosides shorter antisense compounds that have such chemically 15 comprising a bridge between the 4' and the 2' ribosyl ring modified nucleosides. atoms. In certain embodiments, antisense compounds pro Modified Internucleoside Linkages vided herein include one or more bicyclic nucleosides com The naturally occurring internucleoside linkage of RNA prising a 4 to 2' bridge. Examples of such 4" to 2 bridged and DNA is a 3' to 5' phosphodiester linkage. Antisense bicyclic nucleosides, include but are not limited to one of the compounds having one or more modified, i.e. non-naturally formulae: 4'-(CH)—O-2 (LNA); 4'-(CH)—S-2; 4'- occurring, internucleoside linkages are often selected over (CH), O-2 (ENA); 4'-CH(CH) O-2' and 4'-CH antisense compounds having naturally occurring internucleo (CHOCH)—O-2 (and analogs thereof see U.S. Pat. No. side linkages because of desirable properties such as, for 7,399,845, issued on Jul. 15, 2008): 4'-C(CH)(CH) O-2' example, enhanced cellular uptake, enhanced affinity for tar (and analogs thereof see published International Application get nucleic acids, and increased Stability in the presence of 25 WO/2009/006478, published Jan. 8, 2009): 4'-CH N nucleases. (OCH)-2' (and analogs thereof see published International Oligonucleotides having modified internucleoside link Application WO/2008/150729, published Dec. 11, 2008): ages include internucleoside linkages that retain a phospho 4'-CH O N(CH)-2' (see published U.S. Patent Applica rus atom as well as internucleoside linkages that do not have tion US2004-0171570, published Sep. 2, 2004); 4'-CH N a phosphorus atom. Representative phosphorus containing 30 (R)-O-2', wherein R is H. C-C alkyl, or a protecting internucleoside linkages include, but are not limited to, phos group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); phodiesters, phosphotriesters, methylphosphonates, phos 4'-CH C(H)(CH)-2' (see Chattopadhyaya et al., J. Org. phoramidate, and phosphorothioates. Methods of preparation Chem., 2009, 74, 118-134); and 4'-CH C (=CH-)-2' of phosphorous-containing and non-phosphorous-containing (and analogs thereof see published International Application linkages are well known. 35 WO 2008/154401, published on Dec. 8, 2008). In certain embodiments, antisense compounds targeted to a Further reports related to bicyclic nucleosides can also be Factor 12 nucleic acid comprise one or more modified inter found in published literature (see for example: Singh et al., nucleoside linkages. In certain embodiments, the modified Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahe internucleoside linkages are phosphorothioate linkages. In dron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. certain embodiments, each internucleoside linkage of an anti 40 Acad. Sci. U.S.A., 2000,97,5633-5638; Kumaret al., Bioorg. sense compound is a phosphorothioate internucleoside link Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. age. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Modified Sugar Moieties Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr: Antisense compounds can optionally contain one or more Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., nucleosides wherein the Sugar group has been modified. Such 45 Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Sugar modified nucleosides may impart enhanced nuclease Then, 2001, 3, 239-243: U.S. Pat. Nos. 6,268,490; 6,525, 191; stability, increased binding affinity, or some other beneficial 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; biological property to the antisense compounds. In certain 7,399,845; 7,547,684; and 7,696.345; U.S. Patent Publication embodiments, nucleosides comprise chemically modified No. US2008-0039618: US2009-0012281; U.S. Patent Ser. ribofuranose ring moieties. Examples of chemically modified 50 Nos. 60/989,574: 61/026,995: 61/026,998: 61/056,564: ribofuranose rings include without limitation, addition of 61/086,231: 61/097,787; and 61/099,844; Published PCT Substitutent groups (including 5' and 2' Substituent groups, International applications WO 1994/014226; WO 2004/ bridging of non-geminal ring atoms to form bicyclic nucleic 106356; WO 2005/021570, WO 2007/134181; WO 2008/ acids (BNA), replacement of the ribosyl ring oxygen atom 150729; WO 2008/154401; and WO 2009/006478. Each of with S. N(R), or C(R)(R) (R, R and R are each indepen 55 the foregoing bicyclic nucleosides can be prepared having dently H, C-C alkyl or a protecting group) and combina one or more stereochemical Sugar configurations including tions thereof. Examples of chemically modified Sugars for example C-L-ribofuranose and B-D-ribofuranose (see include 2'-F-5'-methyl substituted nucleoside (see PCT Inter PCT international application PCT/DK98/00393, published national Application WO 2008/101157 Published on Aug. 21, on Mar. 25, 1999 as WO 99/14226). 2008 for other disclosed 5',2'-bis substituted nucleosides) or 60 In certain embodiments, bicyclic sugar moieties of BNA replacement of the ribosyl ring oxygen atom with S with nucleosides include, but are not limited to, compounds having further substitution at the 2'-position (see published U.S. at least one bridge between the 4' and the 2' position of the Patent Application US2005-0130923, published on Jun. 16, pentofuranosyl Sugar moiety wherein Such bridges indepen 2005) or alternatively 5'-substitution of a BNA (see PCT dently comprises 1 or from 2 to 4 linked groups independently International Application WO 2007/134181 Published on 65 selected from —C(R)(R) , —C(R)=C(R)—, Nov. 22, 2007 wherein LNA is substituted with for example a —C(R)=N , —C(=O)— —C(=NR)— —C(=S)—, 5'-methyl or a 5'-vinyl group). O— —Si(R) , —S(=O), , and —N(R)—; US 9, 187,749 B2 25 26 wherein: -continued X is 0, 1, or 2: (C) n is 1, 2, 3, or 4, each R, and R is, independently, H, a protecting group, hydroxyl, C-C alkyl, Substituted C-C alkyl, C-C alk enyl, Substituted C-C alkenyl, C-C alkynyl. Substituted C-C alkynyl, Cs-Co aryl, Substituted Cs-Co aryl, hetero cycle radical, substituted heterocycle radical, heteroaryl, sub stituted heteroaryl, Cs-C, alicyclic radical, substituted C-C, 10 alicyclic radical, halogen, OJ, NJ.J., S.J., N, COOJ, acyl (D) (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)-J), or sulfoxyl (S(=O)-J); and each J and J is, independently, H. C-C alkyl, Substi 15 tuted C-C alkyl, C-C alkenyl, Substituted C-C alk enyl, C-C alkynyl, Substituted C-C alkynyl, Cs-Caryl, Substituted Cs-Co aryl, acyl (C(=O)—H). Substituted acyl, a heterocycle radical, a Substituted heterocycle radical, C-C aminoalkyl, Substituted C-C aminoalkyl or a pro tecting group. (E) In certain embodiments, the bridge of a bicyclic Sugar moiety is —C(RR), , —C(R)(R), O—, C(RR)—N(R)—O— or —C(RR)—O N(R)—. In certain embodiments, the bridge is 4'-CH-2',4'-(CH)-2',4'- 25 (CH)-2',4'-(CH), O-2',4'-CH O N(R)-2' and 4'-CH N(R)—O-2'- wherein each Ris, independently, H, a protecting group or C-C alkyl. In certain embodiments, bicyclic nucleosides are further 30 (F) defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the C-L configuration or in the B-D configuration. Previously, C-L- O Bx methyleneoxy (4'-CH, O-2) BNA’s have been incorpo rated into antisense oligonucleotides that showed antisense 35 activity (Frieden et al., Nucleic Acids Research, 2003, 21, HC NC 6365-6372). In certain embodiments, bicyclic nucleosides include, but (G) are not limited to, (A) C-L-methyleneoxy (4'-CH2—O-2) 40 BNA, (B) B-D-methyleneoxy (4'-CH-O-2) BNA, (C) eth yleneoxy (4'-(CH), O-2) BNA, (D) aminooxy (4'-CH O Bx O N(R)-2') BNA, (E) oxyamino (4'-CH N(R)-O-2) BNA, and (F) methyl(methyleneoxy) (4'-CH(CH)—O-2) BNA, (G) methylene-thio (4'-CH-S-2) BNA, (H) methyl 45 ene-amino (4'-CH N(R)-2') BNA, (I) methyl carbocyclic NS (4'-CH-CH(CH)-2') BNA, and (J) propylene carbocyclic (4'-(CH)-2') BNA as depicted below. (H) 50 (A) O O Bx

55

(B) (I)

60 O Bx

NC 65 CH US 9, 187,749 B2 27 28 -continued NJ.J. S.J., N, OC(=X).J., and NJC(=X)NJJ wherein (J) each J. J. and J is, independently, H. C-C alkyl, or Substi tuted C-C alkyl and X is O or NJ. In certain embodiments, bicyclic nucleosides are provided having Formula III:

III 10 Ta O wherein Bx is the base moiety and R is independently H, a protecting group or C-C alkyl. O Bx Z. In certain embodiments, bicyclic nucleosides are provided 15 having Formula I:

O N O T O Bx

wherein: Bx is a heterocyclic base moiety; O Q o1 25 T, and T, are each, independently H, a hydroxyl protecting Ti, group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a Support wherein: medium; Bx is a heterocyclic base moiety; 30 Z, is C-C alkyl, C-C alkenyl, C-C alkynyl, Substi -Q-Q-Q- is —CH2—N(R)—CH2—, C(=O) N tuted C-C alkyl, Substituted C-C alkenyl, Substituted (R)—CH2—, —CH2—O N(R) , CH N(R) C-C alkynyl or substituted acyl (CGEO)—). O— or N(R)—O CH: In certain embodiments, bicyclic nucleosides are provided R is C-C alkyl or an amino protecting group; and having Formula IV: T, and T, are each, independently H, a hydroxyl protecting 35 group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a Support IV medium. a 9b, In certain embodiments, bicyclic nucleosides are provided 40 T-O O Bx T having Formula II: Cc O1

Ci II O Bx 45 OR

wherein:

50 Bx is a heterocyclic base moiety; T, and T, are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a wherein: phosphorus moiety or a covalent attachment to a Support Bx is a heterocyclic base moiety; 55 medium; T, and T, are each, independently H, a hydroxyl protecting R is C-C alkyl, Substituted C-C alkyl, C-C alkenyl, group, a conjugate group, a reactive phosphorus group, a Substituted C-C alkenyl, C-C alkynyl or substituted C-C, phosphorus moiety or a covalent attachment to a Support alkynyl: medium; Z, is C-C alkyl, C-C alkenyl, C-C alkynyl. Substi 60 each q, q, q and q is, independently, H., halogen, C-C, tuted C-C alkyl, Substituted C-C alkenyl, Substituted alkyl, Substituted C-C alkyl, C-C alkenyl, Substituted C-C alkynyl, acyl, Substituted acyl, Substituted amide, thiol C-C alkenyl, C-C alkynyl or Substituted C-C alkynyl, or substituted thio. C-C alkoxyl. Substituted C-C alkoxyl, acyl, Substituted acyl, C-C aminoalkyl or Substituted C-C aminoalkyl; In one embodiment, each of the Substituted groups is, inde 65 pendently, mono or poly Substituted with Substituent groups In certain embodiments, bicyclic nucleosides are provided independently selected from halogen, oxo, hydroxyl, OJ, having Formula V: US 9, 187,749 B2 29 30 each q, q, q and q, is, independently, H, halogen, C-C2 V alkyl, Substituted C-C alkyl, C-C alkenyl, Substituted a 9b, C-C alkenyl, C-C alkynyl, Substituted C-C alkynyl, T-O O Bx C-C alkoxyl, substituted C-C2 alkoxyl, OJ, S.J., SOJ O-T SOJ.J., NJ.J., N, CN, C(=O)CJ, C(=O)NJ.J., C(=O).J. Ce O C(=O)NJ.J., N(H)C(=NH)NJ.J., N(H)C(=O)NJ.J. or N(H)C(=S)NJ.J.; and q, and q, or q, and q together are =C(q)(q), wherein q v OR and q are each, independently, H., halogen, C-C alkyl or 10 Substituted C-C alkyl. One carbocyclic bicyclic nucleoside having a 4'-(CH2)-2' wherein: bridge and the alkenyl analog bridge 4'-CH=CH-CH-2 Bx is a heterocyclic base moiety; have been described (Freier et al., Nucleic Acids Research, T, and T, are each, independently H, a hydroxyl protecting 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., group, a conjugate group, a reactive phosphorus group, a 15 2006, 71, 7731-7740). The synthesis and preparation of car phosphorus moiety or a covalent attachment to a Support bocyclic bicyclic nucleosides along with their oligomeriza medium; tion and biochemical studies have also been described q, q, q and q are each, independently, hydrogen, halo (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), 8362 gen, C-C alkyl, Substituted C-C alkyl, C-C alkenyl, 8379). As used herein, “4'-2' bicyclic nucleoside' or “4 to 2' Substituted C-C alkenyl, C-C alkynyl, substituted bicyclic nucleoside' refers to a bicyclic nucleoside compris C-C alkynyl, C-C alkoxy, Substituted C-C alkoxy, ing a furanose ring comprising a bridge connecting two car OJ, S.J., SOJ SOJJ, NJ.J., N, CN, C(=O)CJ, C(=O) bon atoms of the furanose ring connects the 2 carbon atom NJ.J., C(=O).J. O. C(=O)NJ.J., N(H)C(=NH)NJ.J., and the 4' carbon atom of the Sugar ring. N(H)C(=O)NJ.J. or N(H)C(=S)NJ.J.; 25 As used herein, "monocylic nucleosides' refer to nucleo or q and q together are =C(q)(q): sides comprising modified Sugar moieties that are not bicyclic q and q are each, independently, H, halogen, C-C2 alkyl Sugar moieties. In certain embodiments, the Sugar moiety, or or Substituted C-C alkyl. Sugar moiety analogue, of a nucleoside may be modified or The synthesis and preparation of the methyleneoxy (4'- Substituted at any position. CH-O-2) BNA monomers adenine, cytosine, guanine, 30 As used herein, ''2'-modified Sugar means a furanosyl 5-methyl-cytosine, thymine and uracil, along with their oli Sugar modified at the 2' position. In certain embodiments, gomerization, and nucleic acid recognition properties have such modifications include substituents selected from: a been described (Koshkin et al., Tetrahedron, 1998, 54,3607 halide, including, but not limited to substituted and unsubsti 3630). BNAS and preparation thereof are also described in tuted alkoxy, substituted and unsubstituted thioalkyl, substi WO 98/39352 and WO 99/14226. 35 tuted and unsubstituted amino alkyl, Substituted and unsub Analogs of methyleneoxy (4'-CH2—O-2) BNA and stituted alkyl, substituted and unsubstituted allyl, and 2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. substituted and unsubstituted alkynyl. In certain embodi Med. Chem. Lett., 1998, 8,2219-2222). Preparation of locked ments, 2 modifications are selected from Substituents includ nucleoside analogs comprising oligodeoxyribonucleotide ing, but not limited to: O(CH), OCH, O(CH), NH, duplexes as Substrates for nucleic acid polymerases has also 40 O(CH), CH, O(CH),F, O(CH)ONH, OCHC(=O)N been described (Wengel et al., WO 99/14226). Furthermore, (H)CH, and O(CH), ONI(CH2)CH, where n and mare synthesis of 2'-amino-BNA, a novel comformationally from 1 to about 10. Other 2'-substituent groups can also be restricted high-affinity oligonucleotide analog has been selected from: C-C alkyl, Substituted alkyl, alkenyl, alky described in the art (Singh et al., J. Org. Chem., 1998, 63, nyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCHOCN, 10035-10039). In addition, 2-amino- and 2'-methylamino 45 Cl, Br, CN, F, CF, OCF, SOCH, SOCHONO., NO, N, BNA’s have been prepared and the thermal stability of their NH, heterocycloalkyl, heterocycloalkaryl, aminoalky duplexes with complementary RNA and DNA strands has lamino, polyalkylamino, Substituted silyl, an RNA cleaving been previously reported. group, a reportergroup, an intercalator, a group for improving In certain embodiments, bicyclic nucleosides are provided pharmacokinetic properties, or a group for improving the 50 pharmacodynamic properties of an antisense compound, and having Formula VI: other Substituents having similar properties. In certain embodiments, modified nucleosides comprise a 2-MOE side

VI chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2-MOE substitution have been described as having 55 improved binding affinity compared to unmodified nucleo sides and to other modified nucleosides, such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in 60 vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Alt mann et al., Chimia, 1996, 50, 168-176: Altmann et al., Bio wherein: chem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Bx is a heterocyclic base moiety; Nucleosides Nucleotides, 1997, 16,917-926). T, and T, are each, independently H, a hydroxyl protecting As used herein, a “modified tetrahydropyran nucleoside' group, a conjugate group, a reactive phosphorus group, a 65 or “modified THP nucleoside” means a nucleoside having a phosphorus moiety or a covalent attachment to a Support six-membered tetrahydropyran “sugar substituted in for the medium; pentofuranosyl residue in normal nucleosides (a Sugar Surro US 9, 187,749 B2 31 32 gate). Modified THP nucleosides include, but are not limited As used herein, "oligonucleotide' refers to a compound to, what is referred to in the art as hexitol nucleic acid (HNA), comprising a plurality of linked nucleosides. In certain anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see embodiments, one or more of the plurality of nucleosides is Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoro modified. In certain embodiments, an oligonucleotide com HNA (F-HNA) or those compounds having Formula VII: 5 prises one or more ribonucleosides (RNA) and/or deoxyribo nucleosides (DNA). Many other bicyclo and tricyclo Sugar Surrogate ring sys VII tems are also known in the art that can be used to modify Cl 92 nucleosides for incorporation into antisense compounds (see T-O O C 10 3 for example review article: Leumann, Bioorg. Med. Chem., C7 C4 2002, 10, 841-854). C6 Bx Such ring systems can undergo various additional Substitu O tions to enhance activity. T1. C5 15 Methods for the preparations of modified sugars are well R. R. known to those skilled in the art. In nucleotides having modified Sugar moieties, the nucleo wherein independently for each of said at least one tetrahy base moieties (natural, modified or a combination thereof) are dropyran nucleoside analog of Formula VII: maintained for hybridization with an appropriate nucleic acid Bx is a heterocyclic base moiety; target. T, and T, are each, independently, an internucleoside link In certain embodiments, antisense compounds comprise ing group linking the tetrahydropyran nucleoside analog to one or more nucleosides having modified Sugar moieties. In the antisense compound or one ofT and T, is an internucleo certain embodiments, the modified sugar moiety is 2'-MOE. side linking group linking the tetrahydropyran nucleoside In certain embodiments, the 2'-MOE modified nucleosides analog to the antisense compound and the other of T, and T. 25 are arranged in a gapmer motif. In certain embodiments, the is H, a hydroxyl protecting group, a linked conjugate group or modified Sugar moiety is a bicyclic nucleoside having a (4'- a 5' or 3'-terminal group; CH(CH)—O-2) bridging group. In certain embodiments, q1, q2, qs, qaqs, q and q, are eachindependently, H.C-C, the (4'-CH(CH)—O-2) modified nucleosides are arranged alkyl, Substituted C-C alkyl, C-C alkenyl, Substituted throughout the wings of a gapmer motif. C-C alkenyl, C-C alkynyl or substituted C-C alkynyl: 30 Compositions and Methods for Formulating Pharmaceutical and each of R and R is selected from hydrogen, hydroxyl, Compositions halogen, substituted or unsubstituted alkoxy, NJ.J., S.J., N. OC(=X).J., OC(=X)NJJ, NJC(=X)NJJ, and CN, Antisense oligonucleotides may be admixed with pharma wherein X is O.S or NJ and each J. J. and J is, indepen ceutically acceptable active or inert Substances for the prepa dently, H or C-C alkyl. 35 ration of pharmaceutical compositions or formulations. Com In certain embodiments, the modified THP nucleosides of positions and methods for the formulation of pharmaceutical Formula VII are provided wherein q1, q2, q, q, qs, q and q.7 compositions are dependent upon a number of criteria, are each H. In certain embodiments, at least one of q1, q2, q. including, but not limited to, route of administration, extent of q, ds, q and q, is other than H. In certain embodiments, at disease, or dose to be administered. least one of q1, q2, q, q1, qs, q and q, is methyl. In certain 40 An antisense compound targeted to a Factor 12 nucleic acid embodiments, THP nucleosides of Formula VII are provided can be utilized in pharmaceutical compositions by combining wherein one of R and R is fluoro. In certain embodiments, the antisense compound with a suitable pharmaceutically R is fluoro and R is H; R is methoxy and R is H, and R is acceptable diluent or carrier. A pharmaceutically acceptable H and R is methoxyethoxy. diluent includes phosphate-buffered saline (PBS). PBS is a As used herein, '2'-modified’ or "2"-substituted” refers to 45 diluent suitable for use in compositions to be delivered a nucleoside comprising a Sugar comprising a Substituent at parenterally. Accordingly, in one embodiment, employed in the 2' position other than H or OH. 2'-modified nucleosides, the methods described herein is a pharmaceutical composi include, but are not limited to, bicyclic nucleosides wherein tion comprising an antisense compound targeted to a Factor the bridge connecting two carbon atoms of the Sugar ring 12 nucleic acid and a pharmaceutically acceptable diluent. In connects the 2" carbon and another carbon of the Sugar ring; 50 certain embodiments, the pharmaceutically acceptable dilu and nucleosides with non-bridging 2" Substituents, such as ent is PBS. In certain embodiments, the antisense compound allyl, amino, azido, thio, O-allyl, O—C-Co alkyl, —OCF, is an antisense oligonucleotide. O—(CH), O CH, 2'-O(CH2)SCH, O—(CH)— Pharmaceutical compositions comprising antisense com O N(R)(R), or O CH, C(=O) N(R)(R), where pounds encompass any pharmaceutically acceptable salts, each R, and R, is, independently, Hor Substituted or unsub 55 esters, or salts of Such esters, or any other oligonucleotide stituted C-C alkyl. 2'-modified nucleosides may further which, upon administration to an animal, including a human, comprise other modifications, for example at other positions is capable of providing (directly or indirectly) the biologi of the Sugar and/or at the nucleobase. cally active metabolite or residue thereof. Accordingly, for As used herein, “2'-F refers to a nucleoside comprising a example, the disclosure is also drawn to pharmaceutically Sugar comprising a fluoro group at the 2' position. 60 acceptable salts of antisense compounds, prodrugs, pharma As used herein, “2'-OMe” or “2'-OCH or “2'-O-methyl ceutically acceptable salts of Such prodrugs, and other each refers to a nucleoside comprising a Sugar comprising an bioeduivalents. Suitable pharmaceutically acceptable salts —OCH group at the 2' position of the Sugar ring. include, but are not limited to, Sodium and potassium salts. As used herein, “MOE or “2'-MOE or “2'- A prodrug can include the incorporation of additional OCHCHOCH or “2'-O-methoxyethyl each refers to a 65 nucleosides at one or both ends of an antisense compound nucleoside comprising a Sugar comprising a which are cleaved by endogenous nucleases within the body, —OCH2CH2OCH group at the 2' position of the Sugar ring. to form the active antisense compound. US 9, 187,749 B2 33 34 Conjugated Antisense Compounds treatments are performed in multiple replicates, the data are Antisense compounds may be covalently linked to one or presented as the average of the replicate treatments. more moieties or conjugates which enhance the activity, cel The concentration of antisense oligonucleotide used varies lular distribution or cellular uptake of the resulting antisense from cell line to cell line. Methods to determine the optimal oligonucleotides. Typical conjugate groups include choles antisense oligonucleotide concentration for a particular cell terol moieties and lipid moieties. Additional conjugate line are well known in the art. Antisense oligonucleotides are groups include carbohydrates, phospholipids, biotin, phena typically used at concentrations ranging from 1 nM to 300 nM Zine, folate, phenanthridine, anthraquinone, acridine, fluores when transfected with LIPOFECTAMINE. Antisense oligo ceins, rhodamines, coumarins, and dyes. nucleotides are used at higher concentrations ranging from 10 625 to 20,000 nM when transfected using electroporation. Antisense compounds can also be modified to have one or RNA Isolation more stabilizing groups that are generally attached to one or RNA analysis can be performed on total cellular RNA or both termini of antisense compounds to enhance properties poly(A)-- mRNA. Methods of RNA isolation are well known Such as, for example, nuclease stability. Included in Stabiliz in the art. RNA is prepared using methods well known in the ing groups are cap structures. These terminal modifications 15 art, for example, using the TRIZOL Reagent (Invitrogen, protect the antisense compound having terminal nucleic acid Carlsbad, Calif.) according to the manufacturer's recom from exonuclease degradation, and can help in delivery and/ mended protocols. or localization within a cell. The cap can be present at the Analysis of Inhibition of Target Levels or Expression 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be Inhibition of levels or expression of a Factor 12 nucleic present on both termini. Cap structures are well known in the acid can be assayed in a variety of ways known in the art. For art and include, for example, inverted deoxy abasic caps. example, target nucleic acid levels can be quantitated by, e.g., Further 3' and 5'-stabilizing groups that can be used to cap one Northern blot analysis, competitive polymerase chain reac or both ends of an antisense compound to impart nuclease tion (PCR), or quantitative real-time PCR. RNA analysis can stability include those disclosed in WO 03/004602 published be performed on total cellular RNA or poly(A)-- mRNA. on Jan. 16, 2003. 25 Methods of RNA isolation are well known in theart. Northern Cell Culture and Antisense Compounds Treatment blot analysis is also routine in the art. Quantitative real-time The effects of antisense compounds on the level, activity or PCR can be conveniently accomplished using the commer expression of Factor 12 nucleic acids can be tested in vitro in cially available ABI PRISM 7600, 7700, or 7900 Sequence a variety of cell types. Cell types used for Such analyses are Detection System, available from PE-Applied Biosystems, available from commercial vendors (e.g. AmericanType Cul 30 Foster City, Calif. and used according to manufacturers ture Collection, Manassus, Va.; Zen-Bio, Inc., Research Tri instructions. angle Park, N.C.: Clonetics Corporation, Walkersville, Md.) Quantitative Real-Time PCRAnalysis of Target RNA Levels and are cultured according to the vendors instructions using Quantitation of target RNA levels may be accomplished by commercially available reagents (e.g. Invitrogen Life Tech quantitative real-time PCR using the ABIPRISM7600, 7700, nologies, Carlsbad, Calif.). Illustrative cell types include, but 35 or 7900 Sequence Detection System (PE-Applied Biosys are not limited to, HepG2 cells, Hep3B cells, and primary tems, FosterCity, Calif.) according to manufacturers instruc hepatocytes. tions. Methods of quantitative real-time PCR are well known In Vitro Testing of Antisense Oligonucleotides in the art. Described herein are methods for treatment of cells with Prior to real-time PCR, the isolated RNA is subjected to a antisense oligonucleotides, which can be modified appropri 40 reverse transcriptase (RT) reaction, which produces comple ately for treatment with other antisense compounds. mentary DNA (cDNA) that is then used as the substrate for In general, cells are treated with antisense oligonucleotides the real-time PCR amplification. The RT and real-time PCR when the cells reach approximately 60-80% confluency in reactions are performed sequentially in the same sample well. culture. RT and real-time PCR reagents are obtained from Invitrogen One reagent commonly used to introduce antisense oligo 45 (Carlsbad, Calif.). RT real-time-PCR reactions are carried out nucleotides into cultured cells includes the cationic lipid by methods well known to those skilled in the art. transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Gene (or RNA) target quantities obtained by real time PCR Calif.). Antisense oligonucleotides are mixed with LIPO are normalized using either the expression level of a gene FECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, Calif.) to whose expression is constant, Such as cyclophilin A, or by achieve the desired final concentration of antisense oligo 50 quantifying total RNA using RIBOGREEN (Invitrogen, Inc. nucleotide and a LIPOFECTIN concentration that typically Carlsbad, Calif.). Cyclophilin A expression is quantified by ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide. real time PCR, by being run simultaneously with the target, Another reagent used to introduce antisense oligonucle multiplexing, or separately. Total RNA is quantified using otides into cultured cells includes LIPOFECTAMINE (Invit RIBOGREEN RNA quantification reagent (Invetrogen, Inc. rogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed 55 Eugene, Oreg.). Methods of RNA quantification by with LIPOFECTAMINE in OPTI-MEM 1 reduced Serum RIBOGREEN are taught in Jones, L. J., et al. (Analytical medium (Invitrogen, Carlsbad, Calif.) to achieve the desired Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 concentration of antisense oligonucleotide and a LIPO instrument (PE Applied Biosystems) is used to measure FECTAMINE concentration that typically ranges 2 to 12 RIBOGREEN fluorescence. ug/mL per 100 nM antisense oligonucleotide. 60 Probes and primers are designed to hybridize to a Factor 12 Another technique used to introduce antisense oligonucle nucleic acid. Methods for designing real-time PCR probes otides into cultured cells includes electroporation. and primers are well known in the art, and may include the use Cells are treated with antisense oligonucleotides by routine of software such as PRIMER EXPRESS Software (Applied methods. Cells are typically harvested 16-24 hours after anti Biosystems, Foster City, Calif.). sense oligonucleotide treatment, at which time RNA or pro 65 Analysis of Protein Levels tein levels of target nucleic acids are measured by methods Antisense inhibition of Factor 12 nucleic acids can be known in the art and described herein. In general, when assessed by measuring Factor 12 protein levels. Protein levels US 9, 187,749 B2 35 36 of Factor 12 can be evaluated or quantitated in a variety of individual’s response to administration of the antisense com ways well known in the art, Such as immunoprecipitation, pound. An individuals response to administration of the anti Western blot analysis (immunoblotting), enzyme-linked sense compound is used by a physician to determine the immunosorbent assay (ELISA), quantitative protein assays, amount and duration of therapeutic intervention. protein activity assays (for example, caspase activity assays), In certain embodiments, administration of an antisense immunohistochemistry, immunocytochemistry or fluores compound targeted to a Factor 12 nucleic acid results in cence-activated cell sorting (FACS). Antibodies directed to a reduction of Factor 12 expression by at least 15, 20, 25, 30, target can be identified and obtained from a variety of sources, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85,90, 95 or 99%, or a such as the MSRS catalog of antibodies (Aerie Corporation, range defined by any two of these values. In certain embodi Birmingham, Mich.), or can be prepared via conventional 10 ments, administration of an antisense compound targeted to a monoclonal or polyclonal antibody generation methods well Factor 12 nucleic acid results in a change in a measure of known in the art. Antibodies useful for the detection of inflammation, Swelling, hypertension, and/or vascular per mouse, rat, monkey, and human Factor 12 are commercially meability. In certain embodiments, administration of a Factor available. 12 antisense compound increases the measure by at least 15, In Vivo Testing of Antisense Compounds 15 20, 25, 30, 35, 40, 45, 50,55, 60, 65,70, 75, 80, 85,90, 95 or Antisense compounds, for example, antisense oligonucle 99%, or a range defined by any two of these values. In some otides, are tested in animals to assess their ability to inhibit embodiments, administration of a Factor 12 antisense com expression of Factor 12 and produce phenotypic changes, pound decreases the measure by at least 15, 20, 25, 30, 35, 40, Such as, reduced inflammation, edema/swelling, vascular per 45, 50, 55, 60, 65, 70, 75, 80, 85,90, 95 or 99%, or a range meability, and vascular leakage. In certain embodiments, defined by any two of these values. inflammation is measured by measuring the increase or In certain embodiments, pharmaceutical compositions decrease of edema, temperature, pain, color of tissue, and comprising an antisense compound targeted to Factor 12 are abdominal function in the animal. Testing may be performed used for the preparation of a medicament for treating a patient in normal animals, or in experimental disease models. For Suffering or Susceptible to an inflammatory condition includ administration to animals, antisense oligonucleotides are for 25 ing hereditary angioedema (HAE). mulated in a pharmaceutically acceptable diluent. Such as Certain Combination Therapies phosphate-buffered saline. Administration includes In certain embodiments, one or more pharmaceutical com parenteral routes of administration, Such as intraperitoneal, positions of the present invention are co-administered with intravenous, and Subcutaneous. Calculation of antisense oli one or more other pharmaceutical agents. In certain embodi gonucleotide dosage and dosing frequency is within the abili 30 ments, such one or more other pharmaceutical agents are ties of those skilled in the art, and depends upon factors such designed to treat the same disease, disorder, or condition as as route of administration and animal body weight. Following the one or more pharmaceutical compositions of the present a period of treatment with antisense oligonucleotides, RNA is invention. In certain embodiments, such one or more other isolated from liver tissue and changes in Factor 12 nucleic pharmaceutical agents are designed to treat a different dis acid expression are measured. 35 ease, disorder, or condition as the one or more pharmaceutical Certain Indications compositions of the present invention. In certain embodi In certain embodiments, the invention provides methods of ments, such one or more other pharmaceutical agents are treating an individual comprising administering one or more designed to treat an undesired side effect of one or more pharmaceutical compositions of the present invention. In cer pharmaceutical compositions of the present invention. In cer tain embodiments, the individual has an inflammatory condi 40 tain embodiments, one or more pharmaceutical compositions tion. In certain embodiments, the individual is at risk for of the present invention are co-administered with another developing an inflammatory condition, including, but not pharmaceutical agent to treat an undesired effect of that other limited to, hereditary angioedema (HAE), edema, pharmaceutical agent. In certain embodiments, one or more angioedema, Swelling, angioedema of the lids, ocular edema, pharmaceutical compositions of the present invention are macular edema, and cerebral edema. This includes individu 45 co-administered with another pharmaceutical agent to pro als with an acquired problem, disease, or disorder that leads to duce a combinational effect. In certain embodiments, one or a risk of inflammation, for example, genetic predisposition to more pharmaceutical compositions of the present invention an inflammatory condition, environmental factors, and expo are co-administered with another pharmaceutical agent to Sure to certain medications, including, for example, ACE produce a synergistic effect. inhibitors and ARBs. In certain embodiments, the individual 50 In certain embodiments, one or more pharmaceutical com has been identified as in need of anti-inflammation therapy. positions of the present invention and one or more other Examples of such individuals include, but are not limited to pharmaceutical agents are administered at the same time. In those having a mutation in the genetic code for complement 1 certain embodiments, one or more pharmaceutical composi esterase inhibitor (i.e., C1-INH) or Factor 12. In certain tions of the present invention and one or more other pharma embodiments, an abnormal code can lead to a deficiency in 55 ceutical agents are administered at different times. In certain C1-INH (i.e., type I HAE), an inability of existing C1-INH to embodiments, one or more pharmaceutical compositions of function properly (type II HAE), or hyperfunctional Factor 12 the present invention and one or more other pharmaceutical (i.e., type III HAE). In certain embodiments the invention agents are prepared together in a single formulation. In cer provides methods for prophylactically reducing Factor 12 tain embodiments, one or more pharmaceutical compositions expression in an individual. Certain embodiments include 60 of the present invention and one or more other pharmaceutical treating an individual in need thereof by administering to an agents are prepared separately. individual atherapeutically effective amount of an antisense In certain embodiments, pharmaceutical agents that may compound targeted to a Factor 12 nucleic acid. be co-administered with a pharmaceutical composition of the In one embodiment, administration of a therapeutically present invention include anticoagulant orantiplateletagents. effective amount of an antisense compound targeted to a 65 In certain embodiments, pharmaceutical agents that may be Factor 12 nucleic acid is accompanied by monitoring of Fac co-administered with a pharmaceutical composition of the tor 12 levels in the serum of an individual, to determine an present invention include serine protease inhibitor C1-INH US 9, 187,749 B2 37 38 recombinant protein, kallikrein antisense oligonucleotide, reverse sequence CTGGCAATGTTTCCCAGTGA, desig CINRYZE, BERINERT, KALBITOR, Icatibant, Ecallantide, nated herein as SEQ ID NO: 23; probe sequence attenuated androgens, anabolic steroids, and antifibrinolytic CCCAATGGGCCACACTGTCTCTGC, designated herein agents (e.g., epsilon-aminocaproic acid and tranexamic acid). as SEQ ID NO: 24). Factor 12 mRNA levels were adjusted In certain embodiments, pharmaceutical agents that may according to total RNA content, as measured by be co-administered with a Factor 12 specific inhibitor of the RIBOGREEN. present invention include, but are not limited to, an additional ISIS 410944 (SEQ ID NO: 36), which was one of the Factor 12 inhibitor. In certain embodiments, the co-admin antisense oligonucleotides tested in the assay, was designed Stered pharmaceutical agent is administered prior to admin as a 5-10-5 MOE gapmer, and is 20 nucleosides in length, istration of a pharmaceutical composition of the present 10 wherein the central gap segment is comprised often 2'-deoxy invention. In certain embodiments, the co-administered phar nucleosides and is flanked on both sides (in the 5' and 3 maceutical agent is administered following administration of a pharmaceutical composition of the present invention. In directions) by wings comprising 5 nucleosides each. Each certain embodiments the co-administered pharmaceutical nucleoside in the 5' wing segment and each nucleoside in the agent is administered at the same time as a pharmaceutical 15 3' wing segment has a 2-MOE modification. The internucleo composition of the present invention. In certain embodiments side linkages throughout the gapmer are phosphorothioate the dose of a co-administered pharmaceutical agent is the (P=S) linkages. All cytosine residues throughout the gapmer same as the dose that would be administered if the co-admin are 5-methylcytosines. ISIS 410944 is targeted to nucleo istered pharmaceutical agent was administered alone. In cer bases 980 to 999 of mouse Factor 12 mRNA (GENBANK tain embodiments the dose of a co-administered pharmaceu Accession No. NM 021489.2), incorporated herein as SEQ tical agent is lower than the dose that would be administered ID NO: 11. ISIS 410944 inhibited murine Factor 12 mRNA if the co-administered pharmaceutical agent was adminis by 68%. tered alone. In certain embodiments the dose of a co-admin C57BL/6J-Tyrc-2J mice were treated with 2.5 mg/kg, 5 istered pharmaceutical agent is greater than the dose that mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, or 80 mg/kg (corre would be administered if the co-administered pharmaceutical 25 sponding to 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 mg/kg, 80 agent was administered alone. mg/kg, or 160 mg/kg per week) of ISIS 410944 administered In certain embodiments, the co-administration of a second subcutaneously twice a week for 3 weeks. Factor 12 mRNA compound enhances the anti-inflammatory effect of a first and protein expression was reduced in a dose dependent compound, Such that co-administration of the compounds manner. Factor 12 mRNA was reduced by greater than 90% results in an anti-inflammatory effect that is greater than the 30 inhibition at a dose of 160 mg/kg per week. effect of administering the first compound alone. In other embodiments, the co-administration results in anti-inflam Example 2 matory effects that are additive of the effects of the com pounds when administered alone. In certain embodiments, In Vivo Effect of Antisense Inhibition of Murine the co-administration results in anti-inflammatory effects that 35 Factor 12 in an Angioedema Mouse Model are supra-additive of the effects of the compounds when administered alone. In certain embodiments, the first com Hereditary angioedema (HAE) is characterized by local pound is an antisense compound. In certain embodiments, the second compound is an antisense compound. Swelling and increase in vascular permeability in Subcutane 40 ous tissues (Morgan, B. P. N. Engl. J. Med. 363: 581-83, EXAMPLES 2010). It is caused by a deficiency of the C1 inhibitor, a protein of the complement system. Two mouse models were Non-Limiting Disclosure and Incorporation by used in this study, including, an established mouse model of Reference C1-INH deficiency and a captopril-induced edema model, 45 both of which cause vascular permeability, a hallmark of While certain compounds, compositions, and methods HAE. Reversal of vascular permeability is accompanied by described herein have been described with specificity in increased plasma levels of high molecular weight kininogen accordance with certain embodiments, the following (HMWK). examples serve only to illustrate the compounds described In the first model, angioedema was induced by treatment herein and are not intended to limit the same. Each of the 50 with Captopril, a known antihypertensive agent, which references recited in the present application is incorporated increases vascular permeability in mice and replicates the herein by reference in its entirety. pathology of hereditary angioedema. In the second model, angioedema was induced by treat Example 1 ment with ISIS 461756, an antisense oligonucleotide which 55 targets murine C1 inhibitor mRNA, which increases vascular Antisense Inhibition of Murine Factor 12 mRNA permeability in mice and replicates the pathology of heredi tary angioedema. ISIS 461756 (SEQID NO:37: AAAGTG Antisense oligonucleotides targeted to a murine Factor 12 GTTGATACCCTGGG) is a 5-10-5 MOE gapmer targeting nucleic acid were tested for their effects on Factor 12 mRNA nucleosides 1730-1749 of NM 009776.3 (SEQID NO: 21). in vitro. Cultured mouse primary hepatocytes at a density of 60 The effect of HOE-140 and ISIS 410944, an antisense 10,000 cells per well were transfected using Cytofectin oligonucleotide inhibitor of Factor 12, were evaluated in the reagent with 100 nM antisense oligonucleotide. After a treat Captopril and ISIS 461756-induced mouse models of vascu ment period of approximately 24 hours, RNA was isolated lar permeability. Some of the murine groups were treated with from the cells and mouse Factor 12 mRNA levels were mea HOE-140, a selective antagonist of the bradykinin B2 recep sured by quantitative real-time PCR using the murine primer 65 tor, which blocks vasodilation and vascular permeability probe set RTS2959 (forward sequence CAAAGGAGGGA (Cruden and Newby, Expert Opin. Pharmacol. 9: 2383-90, CATGTATCAACAC, designated herein as SEQID NO: 22: 2008). Other mice were treated with ISIS 410944, which US 9, 187,749 B2 39 40 inhibits Factor 12 mRNA expression. The effect of treatment mice were treated with 50 mg/kg of the antisense oligonucle with HOE-140 was compared with the effect of treatment otide targeting C1 inhibitor, ISIS 461756, administered sub with ISIS 410944. cutaneously twice a week for 2 weeks. At the end of the Treatment treatment period, the mice were intraperitoneally adminis The various treatment groups for this assay are presented in 5 tered 20 ug of captopril. Group 7 served as the experimental Table 1. group for examining the effect of Factor 12 ASO on captopril Group 1 consisted of 4 C57BL/6J-Tyrc-2J mice treated and ISIS 461756-induced vascular permeability. with PBS administered subcutaneously twice a week for 4 All the groups were then injected with 30 mg/kg of Evans weeks. No other treatment was administered to Group 1. Blue solution into the tail vein. The mice were sacrificed 30 which served as a control group to measure the basal level of 10 min after the Evans Blue Solution administration and colons, vascular permeability. feet, ears, and intestines were harvested. Blood samples were Group 2 consisted of 8 C57BL/6J-Tyrc-2J mice treated taken through cardiac puncture. with PBS administered subcutaneously twice a week for 4 weeks. At the end of the treatment, the mice were intraperi TABLE 1 toneally administered 20 ug of captopril. Group 2 served as a 15 PBS control group for captopril-induced vascular permeabil Treatment groups ity. Group No. Treatment Captopril ISIS 461756 HOE-140 Group 3 consisted of 8 C57BL/6J-Tyrc-2J mice treated with PBS administered subcutaneously twice a week for 4 1. (N = 4) PBS No No No 2. (N = 8) PBS Yes No No weeks. On day 14, the mice were treated with 50 mg/kg of the 20 3. (N = 8) PBS Yes Yes No antisense oligonucleotide targeting C1 inhibitor, ISIS 4. (N = 8) PBS Yes Yes Yes 461756, administered subcutaneously twice a week for 2 5. (N = 8) ISIS 141923 Yes Yes No weeks. At the end of the treatment period, the mice were 6. (N = 8) ISIS 410944 Yes No No intraperitoneally administered 20 ug of captopril. Group 3 7. (N = 8) ISIS 410944 Yes Yes No served as a PBS control group for captopril and ISIS 461756- 25 induced vascular permeability. Evans Blue Dye Quantification Group 4 consisted of 8 C57BL/6J-Tyrc-2J mice treated The harvested tissues from the feet, colon, ears, and intes with PBS administered subcutaneously twice a week for 4 tines were placed separately informamide solution overnight weeks. On day 14, the mice were treated with 50 mg/kg of the to leach out the Evans Blue dye. The formamide solution antisense oligonucleotide targeting C1 inhibitor, ISIS 30 containing ear and feet tissue was heated to 55° C. and left 461756, administered subcutaneously twice a week for 2 overnight. The color intensity of the dye-infused formamide weeks. At the end of the treatment period, the mice were Solution was then measured at ODoo, and is presented in intraperitoneally administered 20 Jug of captopril. The mice Table 2. Mice displaying any manifestation of angioedema were then also intraperitoneally administered 30 ug of HOE take up more dye and, therefore, demonstrate high OD values. 140. Group 4 served as a positive control for inhibition of 35 As shown in Table 2, mice treated with ISIS 410944 and a vascular permeability with HOE-140. vascular permeability inducing agent (Groups 6 and 7) have Group 5 consisted of 8 C57BL/6J-Tyrc-2J mice treated reduced vascular permeability as compared to those mice with 40 mg/kg of control oligonucleotide ISIS 141923, a treated with a vascular permeability agent and no anti-vascu 5-10-5MOE gapmer with no known murine target, (CCTTC lar permeability agent (Groups 2 and 3). CCTGAAGGTTCCTCC: SEQ ID NO: 38) administered 40 As presented in Table 2, treatment with ISIS 410944 pre subcutaneously twice a week for 4 weeks. On day 14, the vents vascular permeability in mice treated with captopril mice were treated with 50 mg/kg of the antisense oligonucle (Group 6) and in mice treated with captopril and ISIS 461756 otide targeting C1 inhibitor, ISIS 461756, administered sub (Group 7) compared to the respective PBS control groups cutaneously twice a week for 2 weeks. At the end of the (Groups 2 and 3). Measures of vascular permeability in mice treatment period, the mice were intraperitoneally adminis- 45 of Groups 6 and 7 were also reduced in comparison to the tered 201g of captopril. Group 5 served as a control group for mice treated with the control oligonucleotide, ISIS 141923 captopril and ISIS 461756-induced vascular permeability. (Group 5), where vascular permeability was induced with Group 6 consisted of 8 C57BL/6J-Tyrc-2J mice and was captopril and ISIS 461756. Measures of vascular permeabil treated with 40 mg/kg of oligonucleotide ISIS 410944, a ity in the colon and feet tissues of both the treatment groups 5-10-5 MOE gamper targeting murine Factor 12, adminis- 50 (Groups 6 and 7) were also reduced compared to basal levels, tered subcutaneously twice a week for 4 weeks. At the end of as observed in mice treated with only PBS (Group 1). the treatment period, the mice were intraperitoneally admin Reduced vascular permeability in mice treated with ISIS istered 20 g of captopril. Group 6 served as the experimental 410944 was comparable to that seen in mice treated with the group for examining the effect of Factor 12 ASO on captopril bradykinin 2 receptor antagonist, HOE 140, which served as a induced vascular permeability. 55 positive control in this assay. Group 7 consisted of 8 C57BL/6J-Tyrc-2J mice treated Therefore, antisense inhibition of Factor 12 mRNA may be with 40 mg/kg of oligonucleotide ISIS 410944 administered beneficial for the treatment and prevention of vascular per subcutaneously twice a week for 4 weeks. On day 14, the meability, which is symptomatic of HAE. TABLE 2 ODann, of Evans Blue dye to measure vascular permeability Group ISIS HOE No. Treatment Captopril 461756 140 Colons Intestines Feet Ears 1 PBS No No No O.26 O16 O. 11 O.O2 2 PBS Yes No No O49 O.29 O.12 O.O7 US 9, 187,749 B2

TABLE 2-continued ODann, of Evans Blue dye to measure vascular permeability Group ISIS HOE No. Treatment Captopril 461756 140 Colons Intestines Feet Ears 3 PBS Yes Yes No O49 O.34 O.11 O.12 4 PBS Yes Yes Yes O.14 O.18 O.O7 O.09 5 ISIS 141923 Yes Yes No 0.44 O.29 O.14 O.08 6 ISIS 410944 Yes No No O.18 O.25 O.O5 O.14 7 ISIS 410944 Yes Yes No O.20 O.28 O.O6 OO6

Quantification of High Molecular Weight Kininogen Group 6 consisted of 8 mice and was treated with 40 mg/kg (HMWK) of ISIS 410944 administered subcutaneously twice a week Western blot quantification of HMWK from blood samples 15 for 4 weeks. At the end of the treatment period, the mice were are presented in FIG. 1. intraperitoneally administered 20 g of captopril. Group 6 As shown in FIG. 1, samples from Groups 1 and 2 have low served as an experimental treatment group for examining the levels of HMWK as compared to Groups 6 and 7 indicating effect of ISIS 410944 on captopril-induced vascular perme that vascular permeability is reversed in Groups 6 and 7. Also ability. as shown in FIG. 1, samples from Groups 1 and 2 have All the groups were then injected with 30 mg/kg of Evans increased HMWK cleavage product as compared to Groups 6 Blue solution. The mice were sacrificed 30 min after the and 7. Thus, lack of HMWK is caused by kallikrein cleavage Evans Blue Solution administration and colons, feet, ears, and of HMWK into cleavage products (including bradykinin and intestines were harvested. HKa). 25 TABLE 3 Example 3 Treatment groups In Vivo Effect of Antisense Inhibition of Murine Group No. Treatment Captopril HOE-140 Factor 12 on Basal Permeability and 30 1. (N = 8) PBS No No Captopril-Induced Permeability in Mice 2. (N = 8) PBS Yes No 3. (N = 8) PBS No Yes Basal permeability is the level of vascular permeability 4. (N = 8) PBS Yes Yes 5. (N = 8) ISIS 410944 No No occurring in the tissues of naive, untreated mice. The effect of 6. (N = 8) ISIS 410944 Yes No ISIS 410944 in the prevention of vascular permeability, either 35 basal or captopril-induced, was evaluated. Treatment Evans Blue Dye Quantification The various treatment groups for this assay are presented in The harvested tissues from the feet, colon, ears, and intes Table 3. tine were placed separately in formamide solution overnight Group 1 consisted of 8 mice and was treated with PBS 40 to leach out the Evans Blue dye. The formamide solution administered subcutaneously twice a week for 4 weeks. No containing ears and feet tissue was heated to 55° C. and left other treatment was administered to Group 1 which served as overnight. The color intensity of the dye-infused formamide a control group to measure the basal levels of vascular per Solution was then measured at ODoo, and is presented in meability. Table 4. Mice displaying any manifestation of angioedema Group 2 consisted of 8 mice and was treated with PBS 45 take up more dye and, therefore, demonstrate high OD values. administered subcutaneously twice a week for 4 weeks. At the As presented in Table 4, mice treated with ISIS 410944 end of the treatment period, the mice were intraperitoneally demonstrated reduced basal vascular permeability compared administered 20 ug of captopril. Group 2 served as the nega to the PBS control (Group 5 Vs Group 1). The reduction in tive control group for captopril-induced vascular permeabil basal vascular permeability by treatment with ISIS 410944 ity. 50 was comparable to that caused by treatment with HOE 140 Group 3 consisted of 8 mice and was treated with PBS (Group 3, which served as the positive control). Mice treated administered subcutaneously twice a week for 4 weeks. At the with ISIS 410944 also demonstrated reduced captopril-in end of the treatment period, the mice were intraperitoneally duced vascular permeability in most tissues compared to the administered 30 ug of HOE-140. Group 3 served as a positive PBS control (Group 6 vs. Group 2). The reduction in capto control for inhibition of basal vascular permeability. 55 pril-induced vascular permeability by treatment with ISIS Group 4 consisted of 8 mice and was treated with PBS 410944 was comparable to that caused by treatment with administered subcutaneously twice a week for 4 weeks. At the HOE140 (Group 4, which served as the positive control). end of the treatment period, the mice were intraperitoneally administered 20 g of captopril. The mice were also intrap TABLE 4 eritoneally administered 30 ug of HOE-140. Group 4 served 60 as a positive control for inhibition of captopril-induced vas ODann, of Evans Blue dye to measure vascular permeability cular permeability. Group HOE Group 5 consisted of 8 mice and was treated with 40 mg/kg No. Treatment Captopril 140 Colon Feet Intestine Ears of ISIS 410944 administered subcutaneously twice a week 1 PBS No No O.27 O.O8 O.23 O.O6 for 4 weeks. Group 5 served as an experimental treatment 65 2 PBS Yes No O.61 O.O8 O.24 O.O1 group for examining the effect of ISIS 410944 on basal vas 3 PBS No Yes O.18 OO6 O.21 O.O3 cular permeability. US 9, 187,749 B2 43 44 TABLE 4-continued Quantification of Vascular Permeability The harvested tissues were placed in formamide solution ODann. Of Evans Blue dye to measure vascular permeability overnight to leach out the Evans Blue dye. The formamide Group HOE solution containing feet tissue was heated to 55° C. and left No. Treatment Captopril 140 Colon Feet Intestine Ears overnight. The color intensity of the dye-infused formamide 4 PBS Yes Yes O.29 O.O3 O.14 O Solution was then measured at ODoo, and is presented in 5 ISIS 410944 No No O.19 OO6 O.22 O.04 Table 6. Mice displaying any manifestation of angioedema 6 ISIS 410944 Yes No O29 O.04 O.13 O.OOS take up more dye and, therefore, demonstrate high OD values. 10 As presented in Table 6, mice treated with higher doses of Example 4 ISIS 410944 (Groups 4 and5) had reduced levels of captopril Dose-Dependent Effect of Antisense Inhibition of induced vascular permeability compared to the correspond Murine Factor 12 on Vascular Permeability in an ing PBS control group (Group 2). The reduction in vascular Angioedema Mouse Model permeability in mice of these treatment groups (Groups 4 and 15 5) were comparable to the levels of basal vascular permeabil The effect of varying doses on ISIS 410944 on captopril ity (as shown in Group 1) as well as in mice treated with induced vascular permeability was evaluated. HOE140 (Group 3). Treatment The various treatment groups for this assay are presented in TABLE 6 Table 5. Group 1 consisted of 4 mice and was treated with PBS ODaoo, of Evans Blue dye to measure vascular permeability administered subcutaneously twice a week for 3 weeks. No Group Dose HOE other treatment was administered to Group 1 which served as No. Treatment (mg/kg) Captopril 140 Colon Feet Intestine a control group to measure the basal levels of vascular per meability. 25 1 PBS No No O.23 O.15 0.11 2 PBS Yes No O45 0.19 O16 Group 2 consisted of 8 mice and was treated with PBS 3 PBS Yes Yes O.24 O.O9 O.10 administered subcutaneously twice a week for 3 weeks. At the 4 ISIS 410944 160 Yes No O.2O O.1O O.13 end of the treatment period, the mice were intraperitoneally S ISIS 410944 8O Yes No O.22 O.12 0.14 administered 201g of captopril. Group 2 served as the control 6 ISIS 410944 40 Yes No O.39 O.19 O16 7 ISIS 410944 2O Yes No O45 018 0.19 30 group for captopril-induced vascular permeability. 8 ISIS 410944 10 Yes No O.58 0.14 O2O Group 3 consisted of 4 mice and was treated with PBS 9 ISIS 410944 5 Yes No O48 0.19 O16 administered subcutaneously twice a week for 3 weeks. At the end of the treatment period, the mice were intraperitoneally administered 20 g of captopril. The mice were also intrap Quantification of Vascular Leakage eritoneally administered 30 ug of HOE-140. Group 3 served 35 The blood drawn through cardiac puncture was immedi as a positive control for inhibition of captopril-induced vas ately mixed with 3 times the volume of ice-cold ethanol. The cular permeability. solution was centrifuged at 15,000 g for 20 minutes at 4°C. to Groups 4,5,6,7,8, and 9 consisted of 8 mice each and were remove cell debris and precipitated plasma proteins. The treated with 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 ethanol extracts were further purified by ultra-filtration mg/kg, or 80 mg/kg (corresponding to 5 mg/kg, 10 mg/kg, 20 40 through a 10 kDa MWCO filter. The color intensity of the mg/kg, 40 mg/kg, 80 mg/kg, or 160 mg/kg per week), respec ethanol extracted plasma solution was then measured at tively, of ISIS 410944 administered subcutaneously twice a ODo. The results are presented in Table 7 as percentage week for 3 weeks. At the end of the treatment period, the mice increase or decrease of the OD values of the Group 1 PBS of all the groups were intraperitoneally administered 20 g of control. Mice displaying any manifestation of angioedema captopril. Groups 4-9 served as the experimental treatment 45 take up more dye and, therefore, demonstrate high OD values. groups for examining the effect of varying doses of ISIS Mice treated with 160 mg/kg/week and 80 mg/kg/week of 410944 on captopril-induced vascular permeability. ISIS 410944 (Groups 4 and 5) demonstrated less vascular All the groups were then injected with 30 mg/kg of Evans leakage compared to the PBS negative control treated with Blue solution in the tail vein. The mice were sacrificed 30 min captopril (Group 2). The results from Groups 4 and 5 were after the Evans Blue solution administration and colons, feet, 50 comparable to the positive control treated with HOE 140 ears, and intestines were harvested. Blood samples were (Group 3). taken through cardiac puncture. TABLE 7 TABLE 5 55 Percentage of ODo of Evans Blue dye compared to Treatment groups the PBS basal control to measure vascular leakage Group No. Treatment Dose (mg/kg/wik) Captopril HOE-140 Dose Group No. Treatment (mg/kg) Captopril HOE-140 Plasma 1. (N = 4) PBS No No 2. (N = 8) PBS Yes No 2 PBS Yes No -37 3. (N = 4) PBS Yes Yes 3 PBS Yes Yes 70 4. (N = 8) ISIS 410944 160 Yes No 4 ISIS 410944 160 Yes No 36 5. (N = 8) ISIS 410944 8O Yes No 5 ISIS 410944 8O Yes No 42 6. (N = 8) ISIS 410944 40 Yes No 6 ISIS 410944 40 Yes No -20 7. (N = 8) ISIS 410944 2O Yes No 7 ISIS 410944 2O Yes No -11 8. (N = 8) ISIS 410944 10 Yes No 8 ISIS 410944 10 Yes No -19 9. (N = 8) ISIS 410944 5 Yes No 65 9 ISIS 410944 5 Yes No -1 US 9, 187,749 B2 45 46 Example 5 TABLE 9 ODann, of Evans Blue dye to measure vascular permeability Dose-Dependent Effect of Antisense Inhibition of Group Dose (mg/ HOE Murine Factor 12 on Basal Permeability in Mice 5 No. Treatment kg/week) 140 Colon Feet Ears Intestines 1 PBS No O.31 O.12 O.OO7 O16 The effect of varying doses on ISIS 410944 on basal vas 2 PBS Yes O.27 O.O6 O.OS O.11 cular permeability was evaluated. 3 ISIS 410944 160 No O.25 O.O7 O.O11 O.14 Treatment 4 ISIS 410944 8O No O.24 OO6 0.009 O.11 10 S ISIS 410944 40 No O.27 OO6 O.OO6 O.13 The various treatment groups for this assay are presented in 6 ISIS 410944 2O No O.27 O.O7 O.OO4 O.15 7 ISIS 410944 10 No O.28 OO6 O.OOS O.14 Table 8. 8 ISIS 410944 5 No O.33 O.O8 0.008 O.15 Group 1 consisted of 8 mice and was treated with PBS administered subcutaneously twice a week for 3 weeks. No 15 Quantification of Vascular Leakage other treatment was administered to Group 1 which served as The blood drawn through cardiac puncture was immedi a control group to measure the basal levels of vascular per ately mixed with 3 times the volume of ice-cold ethanol. The meability. solution was centrifuged at 15,000 g for 20 minutes at 4°C. to Group 2 consisted of 4 mice and was treated with PBS remove cell debris and precipitated plasma proteins. The administered subcutaneously twice a week for 3 weeks. At the ethanol extracts were further purified by ultra-filtration end of the treatment period, the mice were intraperitoneally through a 10 kDa MWCO filter. The color intensity of the administered 30 ug of HOE-140. Group 2 served as a positive ethanol extracted plasma solution was then measured at control for inhibition of basal vascular permeability. ODo. The results are presented in Table 10 as percentage Groups 3,4,5,6,7, and 8 consisted of 8 mice each and were increase or decrease of the OD values of the Group 1 PBS treated with 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 25 control. It was expected that treatment groups may display mg/kg, or 80 mg/kg (corresponding to 5 mg/kg, 10 mg/kg, 20 higher OD values due to reduced vascular leakage. All the mg/kg, 40 mg/kg, 80 mg/kg, or 160 mg/kg per week), respec mice in the ISIS oligonucleotide-treated groups demonstrated tively, of ISIS 410944 administered subcutaneously twice a significantly reduced vascular leakage compared to the PBS negative control. week for 3 weeks. Groups 4-9 served as the experimental 30 treatment groups for examining the effect of varying does of ISIS 410944 on basal vascular permeability. TABLE 10 All the groups were then injected with 30 mg/kg of Evans Percentage of ODoo of Evans Blue dye compared to Blue solution in the tail vein. The mice were sacrificed 30 min the PBS basal control to measure vascular leakage 35 after the Evans Blue solution administration and colons, feet, Group No. Treatment Dose (mg/kg/week) HOE-140 Plasma ears, and intestines were harvested. Blood samples were 3 ISIS 410944 160 No 92 taken through cardiac puncture. 4 ISIS 410944 8O No 79 5 ISIS 410944 40 No 84 TABLE 8 6 ISIS 410944 2O No 68 40 7 ISIS 410944 10 No 44 Treatment groups Group No. Treatment Dose (mg/kg/week) HOE-140 Quantification of High Molecular Weight Kininogen 1. (N = 8) PBS No (HMWK) 2. (N = 4) PBS Yes 45 Western blot quantification of HMWK from blood samples 3. (N = 8) ISIS 410944 160 No are presented in FIG. 2 and Tables 11 and 12. As shown in 4. (N = 8) ISIS 410944 8O No Table 11, Groups treated with 410944 have higher levels of 5. (N = 8) ISIS 410944 40 No 6. (N = 8) ISIS 410944 2O No HMWK as compared to PBS control, increasing in a dose 7. (N = 8) ISIS 410944 10 No dependent manner. Treatment with Factor 12 antisense oligo 8. (N = 8) ISIS 410944 5 No nucleotide results in stabilization of HMWK. Thus, vascular 50 permeability is reduced in ISIS 410944-treated groups in a dose-dependent manner. As shown in Table 12, Groups Quantification of Vascular Permeability treated with 410944 have lower HMWK cleavage product as The harvested tissues from the feet, colon, and ears were compared to PBS control, decreasing in a dose-dependent placed informamide solution overnight to leach out the Evans 55 manner. Thus, reduced HMWK is caused by kallikrein cleav Blue dye. The formamide solution containing feet and ear age of HMWK into cleavage products (including bradykinin tissue was heated to 55° C. and left overnight. The color and HKa). Data are presented in Intensity Units as measured intensity of the dye-infused formamide solution was then by densitometer. measured at ODoo, and is presented in Table 9. Higher OD values are associated with higher levels of permeability. 60 TABLE 11 As presented in Table 9, mice treated with ISIS 410944 at Quantification of HMWK by densitometer all doses (Groups 3-8) demonstrated reduced basal vascular permeability compared to the PBS control (Group 1). The Group No Treatment Dose (mg/kg/week) Intensity Units reduction in basal vascular permeability of the ISIS oligo 1 PBS 2362 nucleotide-treated groups was comparable to the same dem 65 3 ISIS 410944 160 577753 onstrated in the positive control group treated with HOE 140 4 ISIS 410944 8O 426446 (Group 2). US 9, 187,749 B2 47 48 TABLE 11-continued Groups 4, 5, 6, 7, and 8 consisted of 8 mice each and were treated with 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, or 40 Quantification of HMWK by densitometer mg/kg (corresponding to 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 Group No Treatment Dose (mg/kg/week) Intensity Units mg/kg, or 80 mg/kg per week), respectively, of ISIS 410944 5 and ISIS 482584 each administered subcutaneously twice a 5 ISIS 410944 40 298.551 week for 3 weeks. At the end of the treatment period, the mice 6 ISIS 410944 2O 114112 of all the groups were intraperitoneally administered 20 g of 7 ISIS 410944 10 3O893 captopril. Groups 4-8 served as the experimental treatment groups for examining the effect of ISIS 410944 and ISIS 10 482584 on captopril-induced vascular permeability. TABLE 12 All the groups were then injected with 30 mg/kg of Evans Blue solution in the tail vein. The mice were sacrificed 30 min Quantification of HMWK cleavage product by densitometer after the Evans Blue solution administration and colons, feet, Group No Treatment Dose (mg/kg/week) Intensity Units ears, and intestines were harvested. 15 1 PBS 26038 TABLE 13 3 ISIS 410944 160 1859 4 ISIS 410944 8O 8001 Treatment groups 5 ISIS 410944 40 14710 6 ISIS 410944 2O 20553 Group No. Treatment Dose (mg/kg/wik) Captopril HOE-140 7 ISIS 410944 10 29037 1. (N = 4) PBS No No 2. (N = 8) PBS Yes No 3. (N = 4) PBS Yes Yes Example 6 4. (N = 8) ISIS 410944 + 8O Yes No ISIS 48.2584 5. (N = 8) ISIS 410944 + 40 Yes No Combination Therapy of Antisense Oligonucleotides 25 ISIS 48.2584 Targeting Factor 12 and Kallikrein on 6. (N = 8) ISIS 410944 + 2O Yes No Captopril-Induced Vascular Permeability in Mice ISIS 48.2584 7. (N = 8) ISIS 410944 + 10 Yes No Mice were treated with varying doses of ISIS 482584, a ISIS 48.2584 5-10-5 MOE gapmer targeting kallikrein (KLKB1) 8. (N = 8) ISIS 410944 + 5 Yes No (GGCATATTGGTTTTTGGAAT, SEQID NO:39) and ISIS 30 ISIS 48.2584 410944 in a captopril-induced vascular permeability model. Treatment Quantification of Vascular Permeability The various treatment groups for this assay are presented in The harvested tissues from the feet, colon, and ears were Table 13. placed informamide solution overnight to leach out the Evans Group 1 consisted of 4 mice and was treated with PBS 35 Blue dye. The formamide solution containing feet and ear administered subcutaneously twice a week for 3 weeks. No tissue was heated to 55° C. and left overnight. The color other treatment was administered to Group 1 which served as intensity of the dye-infused formamide solution was then a control group to measure the basal levels of vascular per measured at ODoo, and is presented in Table 14. Mice meability. displaying any manifestation of angioedema take up more Group 2 consisted of 8 mice and was treated with PBS 40 dye and, therefore, demonstrate high OD values. As presented administered subcutaneously twice a week for 3 weeks. At the in Table 14, most of the tissues of mice treated with a com end of the treatment period, the mice were intraperitoneally bination of ISIS 410944 and ISIS 482584 at all doses (Groups administered 201g of captopril. Group 2 served as the control 3-8) demonstrated reduced vascular permeability compared group for captopril-induced vascular permeability. to the PBS control (Group 1). The reduction in vascular Group 3 consisted of 4 mice and was treated with PBS 45 permeability of the ISIS oligonucleotide-treated groups was administered subcutaneously twice a week for 3 weeks. At the comparable to the same demonstrated in the basal PBS con end of the treatment period, the mice were intraperitoneally trol (Group 1), as well as the positive control group treated administered 20 g of captopril. The mice were also intrap with HOE 140 (Group 2). Combination of Factor 12 and eritoneally administered 30 ug of HOE-140. Group 3 served KLKB1 antisense oligonucleotides results in Synergistic as a positive control for inhibition of captopril-induced vas 50 decrease in permeability. As expected, a corresponding Syn cular permeability. ergistic decrease in vascular leakage was also observed. TABLE 1.4 OD600, of Evans Blue dye to measure vascular permeability Group Dose No. Treatment (mg/kg/wik) Captopril HOE-140 Colon Feet Intestines Ears

1 PBS No No O.24 O.11 O.13 O.O1 2 PBS Yes No O.38 0.15 O.11 O.OS 3 PBS Yes Yes O.23 OO6 O.15 O.04 4 ISIS 410944 - ISIS 8O Yes No O.19 O.O7 O.11 O.04 482S84 5 ISIS 410944 - ISIS 40 Yes No O.19 O.O7 O.12 O.O3 482S84 6 ISIS 410944 - ISIS 2O Yes No O.22 O.O8 O.12 O.04 US 9, 1 87,749 B2 49 50 TABLE 14-continued ODann. Of Evans Blue dye to measure vascular permeability Group Dose No. Treatment (mg/kg/wik) Captopril HOE-140 Colon Feet Intestines Ears 7 ISIS 410944 - ISIS 10 Yes No O.38 O.13 O.13 O.OS 482S84 8 ISIS 410944 - ISIS 5 Yes No O.S3 O.12 O.13 O.O3 482S84

Example 7 TABLE 1.5 Combination Therapy of Antisense Oligonucleotides Treatment groups Targeting Factor 12 and KLKB1 on Basal Vascular Group No. Treatment Dose (mg/kg/wk) HOE-140 Permeability in Mice 1. (N = 8) PBS No 2. (N = 4) PBS Yes Mice were treated with varying doses of ISIS 482584, an 3. (N = 8) ISIS 410944 + 8O No antisense oligonucleotide targeting kallikrein (KLKB1) and ISIS 482S84 4. (N = 8) ISIS 410944 + 40 No ISIS 410944 in a basal vascular permeability model. ISIS 482S84 Treatment 5. (N = 8) ISIS 410944 + 2O No The various treatment groups for this assay are presented in ISIS 482S84 Table 15. 6. (N = 8) ISIS 410944 + 10 No ISIS 482S84 Group 1 consisted of 8 mice and was treated with PBS 25 7. (N = 8) ISIS 410944 + 5 No administered subcutaneously twice a week for 3 weeks. No ISIS 482S84 other treatment was administered to Group 1 which served as a control group to measure the basal levels of vascular per Quantification of Vascular Permeability meability. The harvested tissues from the feet, colon, and ears were Group 2 consisted of 4 mice and was treated with PBS 30 placed informamide solution overnight to leach out the Evans administered subcutaneously twice a week for 3 weeks. At the Blue dye. The formamide solution containing feet and ear end of the treatment period, the mice were intraperitoneally tissue was heated to 55° C. and left overnight. The color administered 30 ug of HOE-140. Group 2 served as a positive intensity of the dye-infused formamide solution was then control for inhibition of basal vascular permeability. measured at ODoo, and is presented in Table 16. Higher Groups 3, 4, 5, 6, and 7 consisted of 8 mice each and were 35 OD values are associated with higher levels of permeability. treated with 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, or 40 As presented in Table 16, most of the tissues of mice treated mg/kg (corresponding to 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 with a combination of ISIS 410944 and ISIS 482584 at all mg/kg, or 80 mg/kg per week), respectively, of ISIS 410944 doses (Groups 2-7) demonstrated reduced vascular perme and ISIS 482584 each administered subcutaneously twice a ability compared to the PBS control (Group 1). The reduction week for 3 weeks. Groups 3-7 served as the experimental 40 in vascular permeability of the ISIS oligonucleotide-treated treatment groups for examining the effect of ISIS 410944 and groups was comparable to the same demonstrated in positive ISIS 482584 on basal vascular permeability. control group treated with HOE 140 (Group 2). Treatment All the groups were then injected with 30 mg/kg of Evans with a combination of Factor 12 and KLKB1 antisense oli Blue solution in the tail vein. The mice were sacrificed 30 min gonucleotides resulted in a synergistic decrease in permeabil after the Evans Blue solution administration and colons, feet, 45 ity. As expected, a corresponding synergistic decrease invas ears, and intestines were harvested. cular leakage was also observed. TABLE 16

ODoo of Evans Blue dye to measure vascular permeability

Group Dose HOE No. Treatment (mg/kg/wk) 140 Colon Feet Intestines Ears

1 PBS No O.19 O.O8 O.10 O.OO)4 2 PBS Yes O.14 0.04 O.08 O.OO8 3 ISIS 410944 - 8O No O.14 0.04 O.09 O.O1 ISIS 48.2584 ISIS 410944 - 40 No O.15 O.OS O.10 O.OO6 ISIS 48.2584 ISIS 410944 - 2O No O.15 O.04 O.10 O.OO7 ISIS 48.2584 ISIS 410944 - 10 No O.15 O.O6 O.10 O.OO)4 ISIS 48.2584 ISIS 410944 - 5 No O.14 O.OS O.13 O.OO2 ISIS 48.2584 US 9, 187,749 B2 51 52 Example 8 Example 9

Inhibition of Factor 12 Protein Activation by ISIS In Vivo Effect of Antisense Inhibition of Murine 48.2584 Factor 12 in a C1-INHAntisense Oligonucleotide-Induced Angioedema Model The effect of antisense inhibition of kallikrein (KLKB1) mRNA on Factor 12 protein activation was evaluated. Vascular permeability induced by ISIS 461756, an anti Treatment sense oligonucleotide which targets murine C1 inhibitor 10 mRNA, increases vascular permeability in mice and repli The various treatment groups for this assay are presented in cates the pathology of hereditary angioedema. The effect of Table 17. ISIS 410944 on this model was evaluated. Group 1 consisted of 8 mice and was treated with PBS Treatment administered subcutaneously twice a week for 3 weeks. No other treatment was administered to Group 1 which served as 15 One group of 8 mice was treated with 40 mg/kg ISIS a control group to measure Factor 12 activation. 410944 administered subcutaneously twice a week for 3 weeks (weekly dose of 80 mg/kg). A second group of 8 mice Groups 2, 3, 4, 5, and 6 consisted of 8 mice each and were was treated with 40 mg/kg of the control oligonucleotide, treated with 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, or 40 ISIS 141923, administered subcutaneously twice a week for 3 mg/kg (corresponding to 5 mg/kg, 10 mg/kg, 20 mg/kg, 40 weeks (weekly dose of 80 mg/kg). A third group of 8 mice mg/kg, or 80 mg/kg per week), respectively of ISIS 482584 was treated with PBS administered subcutaneously twice a administered subcutaneously twice a week for 3 weeks. week for 3 weeks. On day 14, all the groups were treated with Groups 2-6 served as the treatment groups for measuring the 12.5 mg/kg ISIS 461756 administered subcutaneously twice effect of ISIS 482584 on Factor 12 activation. a week for 3 weeks (weekly dose of 25 mg/kg). A control At the end of the treatment period, plasma was harvested 25 group of mice was treated with PBS administered subcutane from the mice for the Spectrozyme(R) Factor 12a based ami ously twice a week for 3 weeks but was not administered ISIS dolytic assay for Factor 12 in plasma. 461756.

TABLE 17 At the end of the treatment period, all the groups were 30 injected with 30 mg/kg of Evans Blue solution into the tail Treatment groups vein. The mice were sacrificed 30 min after the Evans Blue solution administration and colons, feet, ears, and intestines Group No. Treatment Dose (mg/kgwk) were harvested. The liver was also harvested for RNA analy 1. (N = 8) PBS S1S. 2. (N = 8) ISIS 482S84 8O 35 3. (N = 8) ISIS 482S84 40 RNA Analysis 4. (N = 8) ISIS 482S84 2O 5. (N = 8) ISIS 482S84 10 RNA was isolated from the liver for RT-PCR analysis of 6. (N = 8) ISIS 482S84 5 C1-INH and Factor 12 mRNAs. The primer probe set for C1-INH is RTS3218 (forward sequence GAGTCCCCCA 40 GAGCCTACAGT, designated herein as SEQ ID NO: 25: Assay for Factor 12 Activation in Plasma reverse sequence TGTCATTTGTTATTGTGATGGCTACA, Plasma (5 LL) was added to 85 uL of PBS with 1 ug/ml designated hereinas SEQID NO: 26; probe sequence CTGC dextran sulfate (500 kDa) in a 96 well polypropelene micro CCTCTACCTGGCCAACAACCA, designated herein as SEQ ID NO: 27). The primer probe set for Factor 12 is plate and the solution was incubated for 5 minutes at room 45 temperature. Spectrozyme(R) FXIIa (10 uL of a 2 mM solu RTS2959 (forward sequence CAAAGGAGGGACATGTAT tion) and 0.2 mMKALLISTOPTM solution was added and the CAACAC, designated herein as SEQ ID NO: 28; reverse absorbance kinetic was measured at 405 nm. Factor 12 acti sequence CTGGCAATGTTTCCCAGTGA, designated Vation was measured in the linear phase of absorbance accu herein as SEQID NO:29; probe sequence CCCAATGGGC mulation. The results are presented in Table 18 as a percent 50 CACACTGTCTCTGC, designated herein as SEQ ID NO: age of Factor 12 activation measured in the PBS control 30). The results are presented in Table 19 as percent inhibition sample. As observed in Table 18, inhibition of kallikrein compared to the PBS control not treated with ISIS 461756. (KLKB1) by ISIS 482584 results in decreased activation of The data indicates that ISIS 461756 significantly reduced Factor 12 by its substrate, implying that PKK is required for C1-INH mRNA expression and that treatment with ISIS proper factor 12 activation. 55 410944 significantly reduced Factor 12 expression.

TABLE 18 TABLE 19 Percentage Factor 12 activation compared to the PBS control Percent inhibition of mRNA expression in mice treated 60 with ISIS 461756 compared to the untreated PBS control Dose (mg/kg/wk) % F12 activation Treatment C1-INH mRNA Factor 12 mRNA 8O 14 40 24 PBS 76 O 2O 47 10 63 ISIS 141923 79 O 5 82 65 ISIS 410944 77 95 US 9, 187,749 B2 53 54 Quantification of Vascular Permeability TABLE 20 The harvested tissues from the feet, colon, and intestine were placed in formamide Solution overnight to leach out the Percent change in vascular permeability in mice treated Evans Blue dye. The formamide solution containing feet with ISIS 461756 compared to the untreated PBS control tissue was heated to 55° C. and left overnight. The color 5 intensity of the dye-infused formamide solution was then Treatment Colon Feet Intestines measured at ODoo. The data is presented in Table 20 as PBS 13 70 27 percent increase or reduction compared to the PBS control ISIS 141923 2 8O 14 not treated with ISIS 461756. The data indicates that treat ISIS 410944 -24 -1 -10 ment with ISIS 410944 prevented vascular permeability 10 induced by ISIS 461756.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 43

<21 Os SEQ ID NO 1 &211s LENGTH: 2O60 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (50) ... (1897)

<4 OOs SEQUENCE: 1

Ctattgatct ggacticctgg at aggcagct ggaccalacgg acggatgcc atg agg gct 58 Met Arg Ala 1.

Ctg Ctg Ctic ctgggg tt C ctg. Ctg gtg agc titg gag to a aca citt tcg 106 Luell Lieu Lleu Lieu. Gly Phe Lieu. Lieu Val Ser Lieu. Glu Ser Thir Lell Ser

att cca Cct togg gaa gCC ccc aag gag cat aag tac aaa. gct gaa gag 154 Ile Pro Pro Trp Glu Ala Pro Lys Glu. His Llys Tyr Lys Ala Glu Glu 2O 25 3O 35

CaC aca gtc gtt ct c act gtc. acc ggg gag cc c tec cac t to c cc tto His Thr Val Val Lieu. Thr Val Thr Gly Glu Pro Cys His Phe Pro Phe 4 O 45 SO

cag tac cac cqg cag citg tac cac aaa tdt acc cac aag ggc cgg C Ca 250 Glin Tyr His Arg Gln Leu Tyr His Lys Cys Thr His Lys Gly Arg Pro 55 6 O 65

ggc cct cag ccc tigg togt gct acc acc ccc aac titt gat cag gac Cag 298 Gly Pro Gln Pro Trp Cys Ala Thr Thr Pro Asin Phe Asp Glin Asp Glin 70 7s 8O

cga tgg gga tac tet ttg gag ccc aag aaa gtg aaa gac CaC tgc agc 346 Arg Trp Gly Tyr Cys Lieu. Glu Pro Llys Llys Wall Lys Asp His Cys Ser 85 9 O 95

a.a.a. cac agc cc c tec cag aaa gga ggg acc tdt gtgaac atg C Ca agc 394 Lys His Ser Pro Cys Gln Lys Gly Gly Thr Cys Val Asn Met Pro Ser 1OO 105 11 O 115

ggc c cc cac tdt ct c tdt coa caa cac ctic act gga aac CaC tgc Cag 442 Gly Pro His Cys Lieu. Cys Pro Gln His Lieu. Thr Gly Asn His Cys Glin 12 O 125 13 O

a.a.a. gag aag tigc titt gag cct cag citt citc cqg ttt titc CaC aag aat 490 Glu Lys Cys Phe Glu Pro Gln Leu Lleu. Arg Phe Phe His Lys Asn 135 14 O 145

gag ata tig tat aga act gag caa goa gct gtg gCC aga tgc Cag 538 Glu Ile Trp Tyr Arg Thr Glu Glin Ala Ala Val Ala Arg Glin 150 155 16 O

aag ggt Cct gat gcc cac to cag C9g Ctg gcc agc cag gcc tgc 586 Gly Pro Asp Ala His Cys Glin Arg Lieu Ala Ser Glin Ala Cys 1.65 17O 17s

acc aac Ccg to ct c cat ggg ggt cqc to ct a gag gtg gag ggc CaC 634 Thir Asn Pro Cys Lieu. His Gly Gly Arg Cys Lieu. Glu Val Glu Gly His 18O 185 19 O 195

US 9, 187,749 B2 131 132 - Continued

Cat gga agg cala aat tgt gtc CC a ttic cc c Cala tgc ggc cag ct C cc 587 His Gly Arg Glin Asn Cys Wall Pro Phe Pro Glin Cys Gly Glin Lieu. Arg 8O 85 9 O 95 gcc agg atg gC9 Cag gaa citc. aat a.a.a. gtg citt tga aaatgctgaa 633 Ala Arg Met Ala Glin Glu Lell Asn Lys Wall Luell 1 OO 105 aaaaaaaaaa aaaaa. 648

SEQ ID NO 21 LENGTH: 1837 TYPE: DNA ORGANISM: Mus musculus FEATURE: NAME/KEY: CDS LOCATION: (92) ... (1606)

<4 OOs, SEQUENCE: 21 actgattctic togcgactgtc. togcticagt ct gtc.ctgaagc tigcct agtga ccaagaactt 6 O ggaccaggac gcagctgaca togctg.ccca g atg gcc toc agg ctg acc cca 112 Met Ala Ser Arg Lieu. Thr Pro

Ctg acc citc. Ctg Ctg Ctg Ctg Ctg gct 999 gat aga gcc ttic to a gat 16 O Lell Thir Luell Luell Lell Lell Lell Luell Ala Gly Asp Arg Ala Phe Ser Asp 1O 15 2O c cc gala gct acc agc CaC agc acc cag gat CCa Ctg gag gct Cala gcg Pro Glu Ala Thir Ser His Ser Thir Glin Asp Pro Lell Glu Ala Glin Ala 25 3 O 35 a.a.a. agc aga gag agc tto cott gala aga gat gac t cc tgg agt cc c CC a 256 Lys Ser Arg Glu Ser Phe Pro Glu Arg Asp Asp Ser Trp Ser Pro Pro 4 O 45 SO 55 gag cott aca gta Ctg c cc tot acc tgg CC a aca a CC agt gta gcc at C Glu Pro Thir Wall Lell Pro Ser Thir Trp Pro Thir Thir Ser Wall Ala Ile 6 O 65 70 a Ca at a aca aat gac a CC atg ggt a.a.a. gta gcc aac gag to c ttic agc 352 Thir Ile Thir Asn Asp Thir Met Gly Lys Wall Ala Asn Glu Ser Phe Ser 7s 8O 85

Cag CaC agc cag C Ca gct gct cag Cta cc c aca gat tot CC a gga cag 4 OO Glin His Ser Glin Pro Ala Ala Glin Luell Pro Thir Asp Ser Pro Gly Glin 90 95 1OO c cc cott Ctg aat tot t cc agc cag cc c to c act gcc toa gat citt cc c 4 48 Pro Pro Luell Asn Ser Ser Ser Glin Pro Ser Thir Ala Ser Asp Luell Pro 105 11O 115 a CC cag gct act act gaa c cc ttic tgc cc.g gag cc.g citt gct cag tgc 496 Thir Glin Ala Thir Thir Glu Pro Phe Cys Pro Glu Pro Lell Ala Glin Cys 12O 125 13 O 135 tot gat to a gac aga gac t cc to a gag gca aag citc. toa gag gct ttg 544 Ser Asp Ser Asp Arg Asp Ser Ser Glu Ala Lys Lell Ser Glu Ala Luell 14 O 145 15 O a Ca gat ttic tot gtg aag citc. tac CaC gcc titc toa gct acc aag atg 592 Thir Asp Phe Ser Wall Lys Lell Tyr His Ala Phe Ser Ala Thir Lys Met 155 16 O 1.65 gct aag acc aac atg gcc titt to c CC a ttic agc att gcc agc citc. citc. 64 O Ala Thir Asn Met Ala Phe Ser Pro Phe Ser Ile Ala Ser Luell Luell 17 O 17s 18O a Ca cag gtt citt citt 999 gct gga gac agc acc aag agc aac ttg gag 688 Thir Glin Wall Luell Lell Gly Ala Gly Asp Ser Thir Lys Ser Asn Luell Glu 185 190 195 agc at C citt to c tac c cc aag gat titt gcc tgt gtc CaC Cala gca Cta 736 Ser Ile Luell Ser Tyr Pro Asp Phe Ala Cys Wall His Glin Ala Luell 2 OO 2O5 210 215

US 9, 187,749 B2 135 136 - Continued caaact ctac aaataaaact togcagacatt ttcttct citc actaaaaaaa aaaaaaaaaa 1836 a. 1837

<210s, SEQ ID NO 22 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 22

Calaaggaggg acatgitat ca acac 24

<210s, SEQ ID NO 23 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 23 Ctggcaatgt titcc.ca.gtga

<210s, SEQ ID NO 24 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Probe

< 4 OO SEQUENCE: 24 cc caatgggc cacactgtct ctdc 24

<210s, SEQ ID NO 25 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 25 gagt cc ccca gag cct acag t 21

<210s, SEQ ID NO 26 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 26 tgtcatttgt tattgttgatg gctaca 26

<210s, SEQ ID NO 27 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Probe

<4 OOs, SEQUENCE: 27 ctg.cccticta cct ggccaac aacca 25

<210s, SEQ ID NO 28 &211s LENGTH: 24 US 9, 187,749 B2 137 138 - Continued

TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 28

Calaaggaggg acatgitat ca acac 24

SEQ ID NO 29 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 29 Ctggcaatgt titcc.ca.gtga

SEQ ID NO 3 O LENGTH: 24 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Probe

SEQUENCE: 3 O cc caatgggc cacactgtct ctdc 24

SEQ ID NO 31 SEQUENCE: 31

OOO

SEQ ID NO 32

SEQUENCE: 32

OOO

SEQ ID NO 33

SEQUENCE: 33

OOO

SEQ ID NO 34

SEQUENCE: 34

OOO

SEO ID NO 35

SEQUENCE: 35

OOO

SEQ ID NO 36

SEQUENCE: 36

OOO

SEO ID NO 37

SEQUENCE: 37 US 9, 187,749 B2 139 140 - Continued

OOO

<210s, SEQ ID NO 38

<4 OOs, SEQUENCE: 38

OOO

<210s, SEQ ID NO 39

<4 OOs, SEQUENCE: 39

OOO

<210s, SEQ ID NO 4 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 4 O gCatgggaca gagatggtgc

<210s, SEQ ID NO 41 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 41 aaagtggttg at accctggg

<210s, SEQ ID NO 42 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 42 cct tcc ct ga aggttcct co

<210s, SEQ ID NO 43 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 43 ggcatattgg tttittggaat

What is claimed is: 2. The method of claim 1, wherein the prophylactic admin istering of the compound comprising a modified oligonucle 1. A method comprising, 60 prophylactically treating hereditary angioedema (HAE) in otide prevents or ameliorates edema. an animal identified as having HAE by administering to 3. The method of claim 1, wherein the prophylactic admin the animal a therapeutically effective amount of a com istering of the compound comprising a modified oligonucle pound comprising a modified oligonucleotide consist otide prevents or ameliorates vascular permeability. ing of 12 to 30 linked nucleosides, wherein the modified 65 4. The method of claim 1, wherein the prophylactic admin oligonucleotide is at least 90% complementary to a Fac istering of the compound comprising a modified oligonucle tor 12 nucleic acid. otide prevents or ameliorates vascular leakage. US 9, 187,749 B2 141 142 5. The method of claim 1, wherein the prophylactic admin 15. The method of claim 14, wherein the bicyclic sugar istering of the compound comprising a modified oligonucle comprises a 4'-CH(CH)—O-2' bridge. otide prevents or ameliorates inflammation. 16. The method of claim 13, wherein the modified sugar 6. The method of claim 1, wherein the animal is a human. comprises a 2'-O-methoxyethyl group. 7. The method of claim 1, wherein the Factor 12 nucleic acid is a human Factor 12 nucleic acid. 17. The method of claim8, wherein at least one nucleoside 8. The method of claim 7, wherein the human Factor 12 comprises a modified nucleobase. nucleic acid is SEQID NO: 1, SEQID NO: 2, SEQID NO:3, 18. The method of claim 17, wherein the modified nucleo SEQID NO:4, SEQID NO:5, SEQID NO: 6, SEQID NO: base is a 5-methylcytosine. 7, or the complement of SEQID NO: 8. 19. The method of claim 8, comprising co-administering 9. The method of claim8, wherein the modified oligonucle 10 the compound comprising a modified oligonucleotide and otide is 100% complementary to a human Factor 12 nucleic any of the group selected from a serine protease inhibitor acid. C1-INH recombinant protein, CINRYZE, BERINERT, 10. The method of claim 9, wherein the modified oligo KALBITOR, Icatibant, Ecallantide, attenuated androgens, nucleotide is a single-stranded oligonucleotide. 15 anabolic steroids, antifibrinolytic agents, epsilon-aminocap 11. The method of claim 10, wherein the modified oligo roic acid, tranexamic acid. nucleotide comprises at least one modified internucleoside 20. The method of claim 8, wherein the administering is linkage. parenteral administration. 12. The method of claim 11, wherein the modified inter nucleoside linkage is a phosphorothioate internucleoside 21. The method of claim 20, wherein the parenteral admin linkage. istration is any of Subcutaneous or intravenous administra 13. The method of claim 8, comprising at least one nucleo tion. side having a modified Sugar. 22. The method of claim 8, wherein the compound com 14. The method of claim 13, wherein the modified sugar is prises a conjugate. a bicyclic Sugar.