CRISPR/Cas9–Mediated Mutation of Aa-Crystallin Gene Induces Congenital Cataracts in Rabbits

Special Issue CRISPR/Cas9–Mediated Mutation of aA-Crystallin Gene Induces Congenital Cataracts in Rabbits

Lin Yuan,1 Haobin Yao,1 Yuxin Xu,1 Mao Chen,1 Jichao Deng,1 Yuning Song,1 Tingting Sui,1 Yong Wang,1 Yongye Huang,1,2 Zhanjun Li,1 and Liangxue Lai1,3

1Jilin Provincial Key Laboratory of Animal Embryo Engineering, Institute of Zoonosis, College of Animal Science, Jilin University, Changchun, China 2College of Life Science and Health, Northeastern University, Shenyang, China 3CAS Key Laboratory of Regenerative Biology, South China Institute for Stem Cell Biology and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China

Correspondence: Zhanjun Li, Jilin PURPOSE. The present study aimed to investigate the role of the aA-crystallin gene in inducing Provincial Key Laboratory of Animal congenital cataracts in rabbits and to construct a novel animal model for characterization and Embryo Engineering, 5333#, Xi’an pathologic analysis of congenital cataracts for future research. Road, Changchun 130062, China; [email protected]. METHODS. We generated aA-crystallin gene knockout rabbits with congenital cataracts by Liangxue Lai, Jilin Provincial Key coinjection of Cas9 mRNA and sgRNA into zygotes. Cataract phenotypes were investigated in Laboratory of Animal Embryo Engi- a repeated study of 19 F0-generation and 11 F1-generation rabbits with aA-crystallin gene neering, 5333#, Xi’an Road, Chang- mutations. Heritability was analyzed by PCR, sequencing, slim lamp, hematoxylin eosin chun 130062, China; staining, immunohistochemistry, and Western blot. [email protected]. RESULTS. We found aA-crystallin gene mutations in all 19 F0-generation pups (100%) with indel LY, HY, and YX contributed equally to mutations in the aA-crystallin gene ranging from 3 to 52 bp. Off-target assay revealed that the work presented here and should therefore be regarded as equivalent none of the potential off-target sites exhibited mutations, demonstrating that off-target authors. mutagenesis was not induced by cytoplasmic microinjection of in vitro–transcribed Cas9 mRNA. Slim lamp assay revealed that 15 of 19 live pups (78.9%) exhibited typical phenotypes, Submitted: December 13, 2016 including congenital cataracts, microphthalmia, obscurity, and early atrophy of the lens, and Accepted: March 9, 2017 failed differentiation of lens fibers. Histologic hematoxylin and eosin staining showed that aA- Citation: Yuan L, Yao H, Xu Y, et al. crystallin gene knockout rabbits exhibited smaller lenses. Production of the aA-crystallin CRISPR/Cas9–mediated mutation of protein was determined to be dramatically reduced in aA-crystallin gene knockout rabbits. We aA-crystallin gene induces congenital induced aA-crystallin gene mutations and phenotypes in F1-generation rabbits. cataracts in rabbits. Invest Ophthal- mol Vis Sci. 2017;58:BIO34–BIO41. CONCLUSIONS. Our data suggest that CRISPR/Cas9–mediated mutation of the aA-crystallin gene in DOI:10.1167/iovs.16-21287 rabbits recapitulates phenotypes of congenital cataracts, microphthalmia, obscurity, and early atrophy of the lens, and failed differentiation of lens fibers. These findings suggest the possibility of a new animal model of congenital cataracts, which should be used to further investigate the association between mutations in aA-crystallin gene and congenital cataracts in humans. Keywords: rabbits, aA-crystallin, congenital cataracts, CRISPR/Cas9, animal model

ongenital cataracts are characterized by increased opacity eyes, rabbits may represent a more optimal animal model for C and decreased transparency in the lens, and they are the eye disease studies. leading cause of blindness in newborn babies.1 Previous studies The present study aimed to provide further insight into the have reported that nearly a third of congenital cataracts are relationship between CRYAA mutations and congenital cata- caused by mutations in the crystalline family genes, aA- racts and to create a new animal model for recapitulating crystallin gene (CRYAA) and aB-crystallin gene (CRYAB), which congenital cataracts for in vivo drug screening and assessment have been shown to be associated with autosomal dominant or of the safety of artiﬁcial lenses. We generated CRYAA knockout (KO) rabbits via coinjection of Cas9 mRNA and sgRNA into recessive congenital cataracts.2–4 The gene CRYAA is expressed 5 pronuclear-stage zygotes. We also evaluated the mutational at a high level in the lens, and is involved in maintaining its efﬁciency of the CRISPR/Cas9 system, the resulting congenital 6 structure and transparency. In clinical practice, mutations in cataract phenotypes in the KO rabbits, and the heritability of the human CRYAA have been found to be associated with the CRYAA KO mutations in this animal model. congenital anterior polar cataracts.5,7,8 Mouse models are widely used to recapitulate human diseases, owing to certain physiologic characteristics and METHODS relatively low costs.9 However, mouse models cannot accurate- ly replicate the physiologic and pathologic characteristics of all Ethical Statement human diseases due to differences in physiology and gene We purchased 6-month-old New Zealand rabbits from the expression between mouse and human.10 Instead, based on the Laboratory Animal Centre of Jilin University (Changchun, similar sizes and physiologic structures of human and rabbit China). All experiments about rabbits were carried out under

This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. Downloaded from iovs.arvojournals.org on 09/26/2021 Effects of CRYAA on Inducing Congenital Cataracts IOVS j Special Issue j Vol. 58 j No. 6 j BIO35

FIGURE 1. CRISPR/Cas9–mediated gene targeting of CRYAA in zygotes. E1-E10 represent various blastocysts used in this study. (A) Schematic diagram of sgRNA targeting the rabbit CRYAA loci. The yellow rectangle represents the protein-coding region of CRYAA.Theblue rectangle represents the untranslated regions of CRYAA. Two sgRNA sequences, sgRNA1 and sgRNA2, are highlighted in red, and the protospacer adjacent motif (PAM) sequences are presented in green. Primers F and R were used for mutation detection in blastocysts and pups. ATG, start codon; TGA, termination codon. (B) CRYAA mutation detection in blastocysts by T-cloning and Sanger sequencing. The wild-type sequence is shown at the top. Sequences of sgRNAs are highlighted in red, insertions are highlighted in blue, and deletions are designated by dashes.(C) T7E1 cleavage assay for mutation detection in blastocysts. M, DL2000. Bands of PCR products: WT (368 bp), an additional band of a smaller size was cleaved band in mutants (322 bp). Bands of T7E1: WT band (368 bp), mutant band (322 bp), and T7E1 cleaved band (268 bp). (D) Cytoplasmic injection of zygotes using CRISPR/Cas9 system.

the supervision of and in accordance with the guidelines on PCR primers for CRYAA as follows: F, 50 AACAGCCAGTCAG animal care of the Animal Care Center and Use Committee of CCTTAAC 30, and R, 50 ACCTGTCTCTCGTTGTGTTTG 30.At Jilin University. All experimental protocols were approved by least 30 positive plasmid clones were sequenced by Comate the Ethics Committee of Jilin University, and adhered to the Bioscience Company Limited (Changchun, China) through ARVO Statement for the Use of Animals in Opthalmic and Sanger sequencing and analyzed using commercial software Vision Science. (DNAman; Lynnon Corp., San Ramon, CA, USA, and Basic Local Alignment Search Tool; National Center for Biotechnology Vector Construction and In Vitro Transcription Information, Bethesda, MD, USA). We performed the T7E1 assay as described previously by Vector construction and in vitro transcription were carried out Shen et al.14 Digested samples were analyzed by 12% as described previously by Song et al.11 Two complementary polyacrylamide TAE gel. DNA oligonucleotides were annealed at 958C for 5 minutes to generate double-strand DNA, which was then cloned into a BbsI- Off-Target Analysis digested pUC57-simple vector expressing Cas9 (Addgene ID 51307). In vitro transcription was performed using commercial To test whether off-target mutations occurred in the CRYAA KO kits (mMessagem Machine SP6 and MAXI script T7; Ambion, rabbits, seven potential off-target sites (POTS) with top ranking Austin, TX, USA). Transcripts were then puriﬁed with an RNA extraction kit (RNeasy Mini Kit; Qiagen, Hilden, Germany). TABLE 1. Summary of Mutation Efﬁciency and Embryo Cleavage Rate After Injection With the CRISPR/Cas9 System

Embryo Collection, Microinjection, and Transfer Blastocysts 2-Cell, Morula, Blastocyst, With CRYAA The protocol for microinjection of pronuclear-stage zygotes Zygotes, n n (%) n (%) n (%) Mutation, n (%) has been described previously by Song11 and Yuan et al.12 A mixture of Cas9 mRNA (200 ng/lL) and CRYAA-sgRNA (50 ng/ Noninjection lL) was coinjected into the cytoplasms of pronuclear-stage 30 29 (96.7) 28 (93.3) 26 (86.7) 0 (0) zygotes. These zygotes were then immediately transferred into the oviducts of surrogate rabbits. CRISPR injection 30 28 (93.3) 27 (90) 26 (86.7) 26 (100) Mutation Detection by PCR and T7E1 Assay 30 29 (96.7) 29 (96.7) 27 (90) 27 (100) 30 29 (96.7) 28 (93.3) 27 (90) 27 (100) The protocol for mutation detection has been described Total 13 previously by Lv et al. Genomic (g)DNA was extracted from 90 86 (95.5) 84 (93.3) 80 (88.9) 80 (100) microinjected blastocysts and CRYAA KO rabbits. We listed

Downloaded from iovs.arvojournals.org on 09/26/2021 Effects of CRYAA on Inducing Congenital Cataracts IOVS j Special Issue j Vol. 58 j No. 6 j BIO36

TABLE 2. Summary of the Generation of CRYAA KO Rabbit Via CRISPR/Cas9 System

Recipients gRNA/Cas9, ng/lL Embryos, n Pups Obtained, n Pups With Mutation, n (%) Pups With Cataract, n (%)

1 40/180 45 10 10 (100) 8 (80.0) 2 40/180 40 9 9 (100) 7 (77.8)

scores for each sgRNA were predicted using an online design (DAB) (AR1022; Boster Biological Technology, Wuhan, China) tool (http://crispr.mit.edu, in the public domain). Products of for IHC staining, and sections were imaged with a fluorescence POTS PCR were amplified and assessed by Sanger sequencing microscope (Eclipse TS100; Nikon Corp., Tokyo, Japan). and T7E1 assay14. Western Blotting Slit Lamp Examination Western blot analysis of CRYAA was conducted as previously The primary diagnosis of congenital cataracts was determined described by Lv et al.13 Briefly, primary antibodies for CRYAA by slit lamp biomicroscopy. At 13 days of age, the rabbits were (1:10,000 ab5595) and b-actin (1:1000 60008-1-lg; Proteintech dilated and examined. In a normal lens, the reflection of the slit Group) were incubated at 48C overnight. b-actin was used as an lamp from the surface of the cornea is transparency in all panels, internal control. HRP-conjugated secondary antibodies (1:600, while lenses with congenital cataracts’ result in a dense opacity. A0280) were used for enhanced chemiluminometry (ECL) detection. The membrane was exposed on an Azure Biosystems (C600) imaging system (Azure Biosystems, Dublin, CA, United Hematoxylin and Eosin (HE) Staining and States), according to the manufacturer’s instructions. Immunohistochemistry (IHC) We performed HE and immunofluorescence staining as ESULTS previously described by Xia et al.15 The eyes of CRYAA KO R and WT rabbits were fixed in 4% paraformaldehyde for 48 Mutation of CRYAA in Zygotes Using CRISPR/Cas9 hours at 4 C before being dehydrated, embedded in paraffin 8 System medium, and slide-sectioned. Primary anti-CRYAA antibody (1:1000, ab5595; Abcam plc, Cambridge, UK) and secondary To induce KO mutations in CRYAA in rabbits, two sgRNAs anti-rabbit polyclonal antibodies (1:600, A0280; Beyotime targeting exon 2 of CRYAA were designed using an online tool Institute of Biotechnology, Shanghai, China) were used in this (http://crispr.mit.edu, in the public domain; Fig. 1A). To study. We used 3,3N-diaminobenzidine tertrahydrochloride examine the mutational efficiency of the CRISPR/Cas9 system

FIGURE 2. Generation of CRYAA KO rabbits by CRISPR/Cas9 system. (A) T-cloning and Sanger sequencing of 19 pups (F0-1 to F0-19); F0-1 to F0-19 represent the founder pups (F0). Sequences of sgRNAs are highlighted in red, insertions are shown in blue, and deletions are designated by dashes. (B) T7E1 cleavage assay for CRYAA mutation detection in F0-1 to F0-19 pups. M, DL2000. F0-1 to F0-19 represent various F0 pups used in this study. Bands of PCR products: WT (368 bp), an additional band of a smaller size was cleaved band in mutants (322 bp). Bands of T7E1: WT band (368 bp), mutant band (322 bp), and T7E1 cleaved band (268 bp).

Downloaded from iovs.arvojournals.org on 09/26/2021 Effects of CRYAA on Inducing Congenital Cataracts IOVS j Special Issue j Vol. 58 j No. 6 j BIO37

FIGURE 3. Determination of off-target effects in F0 CRYAA KO rabbits. Chromatogram sequence analysis of 14 POTS for (A) sgRNA1 and (B) sgRNA2 in F0 CRYAA KO rabbits showing no double peaks in any sequencing diagrams. Blue area represents sequencing of the POTS. T7E1 cleavage analysis of POTS for (C) sgRNA1 and (D) sgRNA2. M, DL2000; 1–7, seven POTS. (E) Comparison of intended CRISPR DSB sites and POTS showing the number of sequence mismatches. CRYAA-S1, CRYAA-sgRNA1; CRYAA-S2, CRYAA-sgRNA2. Double-strand break sites are highlighted in green, and PAM sequences in blue. Sequence mismatches are highlighted in red.

Downloaded from iovs.arvojournals.org on 09/26/2021 Effects of CRYAA on Inducing Congenital Cataracts IOVS j Special Issue j Vol. 58 j No. 6 j BIO38

FIGURE 4. Phenotypes of congenital cataracts in F0 CRYAA KO rabbits. (A) Gross eye appearance of 13-day-old CRYAA KO rabbit exhibiting a cataract phenotype. Lens of a WT rabbit with a clear lens. Lens of F0-9 (heterozygous mutant) rabbit with a nuclear cataract. F0-9 (right eye), the right eye of F0-9 rabbit; F0-9 (left eye), the left eye of F0-9 rabbit. (B) CRYAA protein expression was analyzed by Western blotting. Equal amounts of protein were loaded, and b-actin was used as a reference control. Data were obtained from at least three independent experiments. The data are presented as mean 6 SD. *P < 0.05. **P < 0.01. ***P < 0.001, Student’s t-test. (C) Hematoxylin and eosin staining of the lenses from WT and heterozygous CRYAA KO rabbits. (a, e) Whole lenses. Scale bar: 200 lm. (b, f) Equatorial regions. Scale bar:50lm. (c, g) Lens nuclei. Scale bar:50 lm. Primary ﬁbers migrate to the OFZ in the nuclei of CRYAA KO rabbit lenses. (d, h) Anterior lens capsules. Scale bar:50lm. Black dotted lines indicate differences between WT and CRYAA KO rabbits.

in zygotes, a mixture of in vitro–transcribed Cas9 mRNA and The results revealed that none of the POTS exhibited mutations, the two sgRNAs were coinjected into the cytoplasms of rabbit demonstrating that off-target mutagenesis was reduced by zygotes. Then, the injected zygotes were cultured until the cytoplasmic microinjection of in vitro–transcribed Cas9 mRNA. blastocyst stage, and CRYAA mutations were detected in all tested blastocysts (100%; Table 1). This result was confirmed Phenotype Assessment of CRYAA KO Rabbits by T-vector and T7E1 assay (Figs. 1B, 1C). These results suggest that mutations in CRYAA were induced by cytoplasmic Next, we investigated whether the CRYAA mutations caused microinjection of Cas9 mRNA and two sgRNAs in zygotes. phenotypes including cataracts. Slit lamp observation revealed that 15 of 19 live pups (78.9%) exhibited congenital cataracts Generation of CRYAA KO Rabbits and microphthalmia (Table 2). Opacity was observed in the nuclear regions of the lenses of CRYAA KO rabbits, while wild- In order to generate KO rabbits, 85 injected zygotes CRYAA type (WT) litter mates exhibited transparent lenses (Fig. 4A). In were transferred to two surrogate rabbits. After full-term addition, CRYAA KO rabbits exhibited significantly reduced gestation, the two recipient mothers successfully gave birth to 19 live pups (Table 2). Genomic DNA samples from F0- levels of CRYAA protein (Fig. 4B). generation pups were extracted and used to detect of CRYAA Histologic HE staining showed that CRYAA KO rabbits mutations. As shown in Fig. 2A, CRYAA mutations were found exhibited smaller lenses (Fig. 4C, a versus e), as well as more in all 19 pups (100%). Indel mutations in CRYAA ranged from 3 severe vacuole-like degeneration in the equatorial regions (Fig. to 52 bp and were confirmed by T7E1 assay (Figs. 2A, 2B). 4C, b versus f) and anterior capsules (Fig. 4C, d versus h) of To test whether off-target mutations occurred in these their lenses compared with those of WT rabbits. In addition, CRYAA KO rabbits, PCR products from seven POTS were primary fibers were disordered and had migrated to the sequenced and assessed with T7E1 assay (Figs. 3A–D). The organelle-free zone (OFZ) in the nuclei of CRYAA KO rabbit number of sequence mismatches between each POTS and the lenses, while those of WT rabbits were well ordered (Fig. 4C, c CRISPR double-strand break (DSB) sites is listed in Figure 3E. versus g). These findings indicate that phenotypes associated

Downloaded from iovs.arvojournals.org on 09/26/2021 Effects of CRYAA on Inducing Congenital Cataracts IOVS j Special Issue j Vol. 58 j No. 6 j BIO39

FIGURE 5. Heritability of the CRYAA KO in rabbits. T-cloning and Sanger sequencing analyses of F1 CRYAA KO rabbits (F1-1 to F1-11). F1-1 to F1-11 pups are the offspring of F0 rabbits. Sequences of sgRNAs are highlighted in red, insertions are shown in blue, and deletions are indicated by dashes.(B) T7E1 cleavage assay for CRYAA mutation detection in F1 pups. M, DL2000; F1-1 to F1-11 represent various F1 pups used in our study. Bands of PCR products: WT (368 bp), an additional band of a smaller size was cleaved band in mutants (322 bp). Bands of T7E1: WT band (368 bp), mutant band (322 bp), and T7E1 cleaved band (268 bp). (C) Gross eye appearance of 13-day-old CRYAA KO rabbits with cataract phenotypes. Lens opacities were concentrated in the nuclear region in of F1-8 mutant rabbit. F1-8 (right eye), the right eye of F1-8 rabbit; F1-8 (left eye), the left eye of F1-8 rabbit. (D) Photographs of a rabbit lens with a cataract in a 13-day-old F1 CRYAA KO mutant. Lens of F1-2 rabbit has been severely atrophied. The opacity of lens rabbit indicates that CRYAA KO is the causative mutation in F1-3; F1-2, F1-3 indicate F1 mutants. Scale bar: 1 mm.

with congenital cataracts and disrupted organization of the Histologic analysis conﬁrmed that smaller lenses (Fig. 6A, a lens were exhibited in CRYAA KO rabbits. versus e), as well as anterior capsules (Fig. 6A, d versus h) and more severe vacuole-like degeneration in the equatorial regions Heritability of CRYAA Mutations and Phenotype (Fig. 6A, b versus f ) of lenses were observed in F1 CRYAA KO Assessment of F1 Rabbits rabbits. In addition, nuclei were deeply stained pink (Fig. 6A, d versus h) in the anterior capsules, suggesting that lens In order to determine the heritability of the cataract organization was disrupted in the CRYAA KO rabbits. Further- phenotypes, two female founders exhibiting cataract pheno- more, a dramatic reduction in the production of CRYAA protein types (F0-8 and F0-12) were mated with two male founders (F0- was observed via IHC (Fig. 6B) and Western blotting (Fig. 6C) in 4 and F0-6). We genotyped F1 CRYAA KO rabbits by PCR and T- CRYAA KO rabbits compared with that in WT rabbits. Thus, our cloning. The results revealed that mutations in CRYAA were data indicate a strong genotype phenotype correlation between detected in 10 of the 11 F1 rabbit pups (Figs. 5A, 5B). We CRYAA mutations and congenital cataracts. further examined whether these CRYAA mutations led to the observed cataract phenotypes in the F1 generation. As shown in Figures 5C and 5D, F1-8 and F1-3 rabbits presented DISCUSSION concentrated opacities in the nuclear regions of the lenses (cataract phenotypes). Microphthalmia, smaller lenses, and Previous studies have demonstrated that CRYAA plays key roles early lens atrophy were also found in F1-3 CRYAA KO rabbits. in suppressing stress-induced protein aggregation and main-

Downloaded from iovs.arvojournals.org on 09/26/2021 Effects of CRYAA on Inducing Congenital Cataracts IOVS j Special Issue j Vol. 58 j No. 6 j BIO40

FIGURE 6. Phenotype assessment of F1 CRYAA KO rabbits. (A) Hematoxylin and eosin staining of the lenses from WT and heterozygous CRYAA KO rabbits. (a, e) Whole lenses from WT and heterozygous rabbits. Scale bar: 200 lm. (b, f) Equatorial regions. Scale bar:50lm. (c, g) Lens nuclei. Scale bar: 200 lm. (d, h) Anterior lens capsules. Scale bar:50lm. Black dotted lines indicate differences between WT and CRYAA mutant KO rabbits. Atrophy lens, severe vacuole-like degeneration in the equatorial regions, and ﬁbers in nucleus that lose their normal arrangement are CRYAA KO causative mutation. (B) Immunohistochemical assay of WT and heterozygous F1 CRYAA KO rabbits. 20*, scale bar: 100 lm; 40*, scale bar:50 lm. (C) Expression of CRYAA and b-actin in F1 generation rabbits. Expression of CRYAA in CRYAA KO rabbits is reduced compared to that in WT rabbits. We used b-actin as a reference control. Data were obtained from at least three independent experiments. The data are presented as mean 6 SD. *P < 0.05. **P < 0.01. ***P < 0.001, Student’s t-test.

taining the membrane structures of lens epithelial and fiber Previous studies reported that mutations in gap junction cells.16,17 This has been confirmed in CRYAA KO mice, which protein alpha 8 (GJA8) in various species recapitulate develop small lenses with opacities initially confined to the congenital cataracts.12,23,24 The mechanism leading to cata- nucleus but progressing to total cataracts.18 In our study, racts in our previous study12 seems to involve the abnormal congenital microphthalmia, as well as degradation of the distribution and expression of membrane protein GJA8, membrane structures in lens fibers were found in CRYAA KO which functions in the formation of connexin and maintains rabbits. In addition, failed maturation of epithelial cells was the gap junction channel structure.23,25 As for CRYAA observed in the OFZ of CRYAA KO rabbits. The OFZ is involved mutations, the mechanism underlying the induction of in the synthesis and packaging of free-organelles (nucleus, congenital cataracts is the abnormal aggregation of insoluble endoplasmic reticulum, Golgi apparatus, etc.) in the cyto- aA-crystallin protein in the lens.26 Although phenotypes such plasms of terminally differentiated lens fiber cells, and it also as cataracts, lens opacity, microphthalmia, and small lens size functions in maintaining the transparency of the lens.19,20 were observed in both GJA8 and CRYAA KO rabbits, primary Therefore, we speculate that the breakdown of nuclei in the fibers were found to migrate to the OFZ in the nuclei of secondary lens fiber cells was due to incomplete organelle CRYAA KO rabbit lenses, while smaller gap junctions were degradation in the OFZ, which has been demonstrated in observed in the cortical fibers of KO rabbits. Based on previous studies.21,22 GJA8 Although cataract phenotypes and microphthalmia have these differences, the novel CRYAA KO rabbits produced in been observed in mice and humans with CRYAA mutations,7,18 this study provide a broader understanding of how CRYAA the mechanisms underlying microphthalmia in these cases functions as a chaperone, structural, and regulatory protein in have not been investigated. Of note, dramatically smaller lenses lens transparency. that experience early atrophy were observed in CRYAA KO In summary, the CRISPR/Cas9–mediated mutation of CRYAA rabbits in this study. It has been shown that CRYAA not only in rabbits recapitulates phenotypes of congenital cataracts, acts as a chaperone but also functions to prevent lens cells microphthalmia, early atrophy of the lens, and failed differen- from apoptosis both in vitro and in vivo.6 Therefore, we tiation of lens fibers. These cataract phenotypes can be suspect that CRYAA mutations may induce apoptosis in lens induced by abnormal aggregation of lens proteins and the epithelial cells, resulting in microphthalmia and early atrophy failure of OFZ formation in the lenses of CRYAA KO rabbits. of lenses in CRYAA KO rabbits. This novel and stable animal model can be used in the future to

Downloaded from iovs.arvojournals.org on 09/26/2021 Effects of CRYAA on Inducing Congenital Cataracts IOVS j Special Issue j Vol. 58 j No. 6 j BIO41

study the role of crystallin and to conduct drug screening for 12. Yuan L, Sui T, Chen M, et al. CRISPR/Cas9-mediated GJA8 cataract prevention in clinical practice. knockout in rabbits recapitulates human congenital cataracts. Sci Rep. 2016;6:22024. Acknowledgments 13. Lv Q, Yuan L, Deng J, et al. Efficient generation of myostatin gene mutated rabbit by CRISPR/Cas9. Sci Rep. 2016;6:25029. The authors thank Peiyan Hu, Xue Chen, and Tingting Yu at the 14. Shen B, Zhang J, Wu H, et al. Generation of gene-modified Embryo Engineering Center for technical assistance. mice via Cas9/RNA-mediated gene targeting. Cell Res. 2013; Supported by the National Natural Science Foundation of China 23:720–723. (Grant No. 31201080 and 31272394). 15. Xia C, Liu H, Cheung D, et al. Diverse gap junctions modulate Disclosure: L. Yuan, None; H. Yao, None; Y. Xu, None; M. Chen, distinct mechanisms for fiber cell formation during lens None; J. Deng, None; Y. Song, None; T. Sui, None; Y. Wang, development and cataractogenesis. Development. 2006;133: None; Y. Huang, None; Z. Li, None; L. Lai, None 2033–2040. 16. Cobb BA, Petrash JM. Structural and functional changes in the alpha A-crystallin R116C mutant in hereditary cataracts. References Biochemistry. 2000;39:15791–15798. 1. Lambert SR, Drack AV. Infantile cataracts. Surv Ophthalmol. 17. Cobb BA, Petrash JM. alpha-Crystallin chaperone-like activity 1996;40:427–458. and membrane binding in age-related cataracts. Biochemistry. 2002;41;483–490. 2. Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien EW, Weleber RG. Autosomal dominant congenital cataract associ- 18. Brady JP, Garland D, Duglas-Tabor Y, Robison WG Jr, Groome ated with a missense mutation in the human alphacrystallin A, Wawrousek EF. Targeted disruption of the mouse alpha A- gene CRYAA. Hum Mol Genet. 1998;7:471–474. crystallin gene induces cataract and cytoplasmic inclusion bodies containing the small heat shock protein alpha B- 3. Mackay DS, Andley UP, Shiels A. Cell death triggered by a crystallin. Proc Natl Acad Sci U S A. 1997;94:884–889. novel mutation in the alphaA-crystallin gene underlies autosomal dominant cataract linked to chromosome 21q. 19. Wride MA. Cellular and molecular features of lens differentiation: a review of recent advances. . 1996;61: Eur J Hum Genet. 2003;11:784–793. Differentiation 77–93. 4. Jiaox X, Khan SY, Irum B, et al. Missense mutations in CRYAB 20. Bassnett S, Mataic D. Chromatin degradation in differentiating are liable for recessive congenital cataracts. PLoS One. 2015; fiber cells of the eye lens. . 1997;137:37–49. 10:e0137973. J Cell Biol 21. Hamai Y, Fukui HN, Kuwabara T. Morphology of hereditary 5. Graw J. Mouse models of cataract. J Genet. 2009;88:469–486. mouse cataract. Exp Eye Res. 1974;18:537–546. 6. Andley UP. Crystallins in the eye: function and pathology. 22. Pendergrass W, Penn P, Possin D, Wolf N. Accumulation of . 2007;26:78–98. Prog Retin Eye Res DNA, nuclear and mitochondrial debris, and ROS at sites of 7. Su D, Guo Y, Li Q, Guan L, Zhu S, Ma X. A novel mutation in age-related cortical cataract in mice. Invest Ophthalmol Vis CRYAA is associated with autosomal dominant suture Sci. 2005;46:4661–4670. cataracts in a Chinese family. Mol Vis. 2012;18:3057–3063. 23. Devi RR, Vijayalakshmi P. Novel mutations in GJA8 associated 8. Zhang L, Zhang Y, Liu P, Cao W, Tang X, Su S. Congenital with autosomal dominant congenital cataract and microcor- anterior polar cataract associated with a missense mutation in nea. Mol Vis. 2006;12:190–195. the human alpha crystallin gene CRYAA. Mol Vis. 2011;17: 24. Rong P, Wang X, Niesman I, et al. Disruption of Gja8 (alpha8 2693–2697. connexin) in mice leads to microphthalmia associated with 9. Li XJ, Li W. Beyond mice: genetically modifying larger animals retardation of lens growth and lens fiber maturation. to model human diseases. J Genet Genomics. 2012;39:237– Development. 2002;129:167–174. 238. 25. Arora A, Minogue PJ, Liu X, et al. A novel GJA8 mutation is 10. Seok J, Warren HS, Cuenca AG, et al. Genomic responses in associated with autosomal dominant lamellar pulverulent mouse models poorly mimic human inflammatory diseases. cataract: further evidence for gap junction dysfunction in Proc Natl Acad Sci U S A. 2013;110:3507–3512. human cataract. JMedGenet. 2006;43:e2. 11. Song Y, Yuan L, Wang Y, et al. Efficient dual sgRNA-directed 26. Bloemendal H, de Jong W, Jaenicke R, Lubsen NH, Slingsby C, large gene deletion in rabbit with CRISPR/Cas9 system. Cell Tardieu A. Ageing and vision: structure, stability and function Mol Life Sci. 2016;73:2959–2968. of lens crystallins. Prog Biophys Mol Bio. 2004;86:407–485.

Downloaded from iovs.arvojournals.org on 09/26/2021