Familial Mediterranean Fever: Effects of Genotype and Ethnicity on Inflammatory Attacks and Amyloidosis

Aviva Mimouni, MD*; Nurit Magal, PhD*; Nava Stoffman, MD*; Tamy Shohat, MD*; Ara Minasian, MD‡; Michael Krasnov, MD*; Gabrielle J. Halpern, MRCPsych*; Jerome I. Rotter, MD§; Nathan Fischel-Ghodsian, MD§; Yehuda L. Danon, MDʈ; and Mordechai Shohat, MD*

ABSTRACT. Objective. The gene causing familial factors other than genotype, such as environment or genes Mediterranean fever (FMF)—an autosomal recessive dis- other than MEFV, play a role in the determination of the ease characterized by recurrent short episodes of fever severity of the inflammatory attacks in FMF. Pediatrics associated most commonly with peritonitis, pleuritis, 2000;105(5). URL: http://www.pediatrics.org/cgi/content/ and arthritis—has recently been found and several mu- full/105/5/e70; amyloidosis, specific mutation, phenotype-ge- tations identified. The most severe complication of the notype correlation, ethnicity. disease is amyloidosis, which can lead to renal failure. The aim of this study was to investigate the role of genetic versus nongenetic factors on the phenotype as ABBREVIATIONS. FMF, familial Mediterranean fever; MEFV, well as on the development of amyloidosis in FMF in a Mediterranean fever (the FMF gene); PCR, polymerase chain re- large and heterogeneous group of patients. action; CI, confidence interval. Methodology. We studied 382 patients from 4 ethnic origins living in different environments: North African amilial Mediterranean fever (FMF) is an auto- Jews, other Jews, Turks, Armenians living in the United somal recessive disease affecting primarily non- States, and Armenians from Yerevan, Armenia. Informa- tion regarding amyloidosis was available for 371 pa- Ashkenazi Jews, Armenians, Turks, and Ar- F1 tients. We examined the association between the muta- abs. The carrier rate in these populations is very tion M694V and the development of amyloidosis, and we high, with estimates based on family studies as high also compared the clinical characteristics of the inflam- as 1:5 to 1:7 among some non-Ashkenazi Jewish pop- matory attacks in patients from different ethnic origins, ulations,2 and 1:7 among Armenians in California.3 while controlling for the type of mutation. The disease is characterized by recurrent short epi- Results. A significant association was found between sodes of inflammation and serositis including fever, amyloidosis and the most common mutation in exon 10 peritonitis, pleuritis, synovitis,1,3,4 and, rarely, peri- of the FMF gene (MEFV), M694V (for M694V homozy- carditis.5 The clinical symptoms can vary in different -Amyloid .(2.71–1.16 ؍ CI %95 ;1.77 ؍ gotes, relative risk osis was present in 44 of 171 homozygous FMF patients patients, sometimes even in the same family. Amy- (25.7%), in 22 of 143 compound heterozygous FMF pa- loidosis, similar to that seen in other chronic inflam- tients (15.4%), and in 7 of 57 patients carrying other matory diseases such as rheumatoid arthritis, is the mutations (12.3%). In homozygotes for M694V who had most severe complication of FMF and leads to renal not been treated with colchicine before 20 years of age, failure. the risk of amyloidosis developing before this age was There is ethnic variability in the prevalence of 61.0%. In our series, there were no cases of amyloidosis in amyloidosis, which occurs in 60% of the Turks, in 16 patients carrying the common mutation E148Q. We 27% of the non-Ashkenazi Jews, and in 1% to 2% of found that the type and severity of the FMF inflamma- 6 tory symptoms were associated with both the genotype the Armenians in the United States. In untreated and the country of residence of the patient. Jewish patients of North African origin, the fre- Conclusions. In the light of the high frequency of amy- quency of amyloidosis increases progressively with loidosis in homozygotes for the mutation M694V, colchi- age, occurring in up to 75% of those over 43 years.7 cine treatment should be given to this group irrespective of Colchicine has been shown to be effective in prevent- the severity of the inflammatory attacks to prevent the ing the attacks of FMF as well as the development of development of amyloidosis. Our findings also suggest that amyloidosis.8–10 Some individuals develop amyloid- osis without having recurrent inflammatory epi- 11 From the *Department of Medical Genetics, FMRC and Beilinson Campus, sodes (FMF type 2), and therefore, identification of Rabin Medical Center and Sackler School of Medicine, Tel Aviv University, an amyloidosis-associated mutation will allow for Tel Aviv, Israel; ‡Emergency Medical Scientific Center, Yerevan, Armenia; directing prophylactic colchicine therapy to pr- §Medical Genetics Birth Defects Center, Cedars-Sinai Medical Center, and esymptomatic individuals who can greatly benefit University of California, Los Angeles, California; and ʈDepartment of Im- munology, FMRC and Beilinson Campus, Rabin Medical Center and Sack- from it. ler School of Medicine, Tel Aviv University, Tel Aviv, Israel. Linkage between the gene responsible for FMF Received for publication Jun 29, 1999; accepted Dec 21, 1999. (MEFV) and the short arm of chromosome 16 was Address correspondence to Mordechai Shohat, MD, Department of Medical first shown in 1992,12 and locus homogeneity was Genetics, Rabin Medical Center, Beilinson Campus, Petah Tikva, 49100, 13 Israel. E-mail: [email protected] demonstrated for all ethnic groups studied. Re- 14,15 PEDIATRICS (ISSN 0031 4005). Copyright © 2000 by the American Acad- cently, the gene causing FMF has been cloned, emy of Pediatrics. and 4 common missense mutations identified in exon http://www.pediatrics.org/cgi/content/full/105/5/Downloaded from www.aappublications.org/newse70 by guestPEDIATRICS on September 29, Vol. 2021 105 No. 5 May 2000 1of7 10. More recently, additional mutations have been tic criteria and who had no family history of FMF that could found in exons 2, 3, 5, and 10.16–19 The protein en- suggest a carrier state by descent. We believe that when more FMF 14 15 mutations are discovered, these patients will be found to have 1 of coded by the gene, named pyrin or marenostrin, is these as yet undiscovered mutations. a member of a family of nuclear factors homologous The diagnosis of FMF in siblings when the proband was found to the Ro52 autoantigen. to have 2 FMF mutations was based on the presence of these same Previous phenotype/genotype correlation studies 2 mutations in the sibling, and when the proband had only 1 have shown conflicting results regarding the corre- known mutation, it was based on the demonstration of the sharing of 2 alleles with the proband, by studying polymorphic markers lation between the severity of FMF and the mutation adjacent to the MEFV gene (D16S3070, D16S3370, D16S2617, and M694V.20–22 Two of these studies20,21 found that ho- D16S3275).12 Asymptomatic individuals who were found to carry mozygosity for the mutation M694V was signifi- mutations in both alleles were considered affected. cantly associated with a more severe form of the disease, but they were both based on a population Phenotype Parameters where it was not possible to differentiate between the The phenotype variables that were determined in all the af- effect of the mutation and the effect of the environ- fected individuals were age of onset of the inflammatory attacks, ment. The same studies have also reported con- organs involved during the attacks (resulting in peritonitis, pleu- ritis, arthritis, or the presence of fever only), number of attacks flicting and inconclusive results with regard to the before the commencement of colchicine treatment, age of diagno- association between homozygosity for M694V and sis, and the presence and age of onset of amyloidosis. Age of amyloidosis21–24; however, they dealt with popula- commencement of colchicine treatment was also noted. tions with insufficient variability of mutations or For several patients, information on some of the parameters of phenotype variables was missing. The number of attacks per year where most of the affected individuals had been was considered missing when treatment with colchicine was ini- 21,24 treated. tiated less than a year after the onset of the FMF symptoms (99 of A previous study by us22 based on 138 affected 382), and the age of onset was considered missing when there was individuals showed no significant phenotype-geno- a problem with recall, usually in older patients (70 of 382). We type correlation with regard to the inflammatory excluded these patients when these parameters were analyzed. attacks, but did demonstrate a correlation between amyloidosis and the mutation M694V. Twenty out of Subjects With Amyloidosis the 138 affected individuals developed amyloidosis, Information regarding amyloidosis was available in 371 pa- tients. Amyloidosis was diagnosed in 73 of 371 patients and was but because of the small numbers involved, espe- the presenting symptom in 7 (FMF type 2). Of these 73 patients, 10 cially of those with amyloidosis, we could not make were North African Jews, 2 were other Jews (both of Iraqi origin), recommendations regarding treatment. 3 were Armenians living in the United States, 47 were Armenians The aims of this study were to investigate in a from Yerevan, and 11 were Turks. large and heterogeneous group of patients the as- Amyloidosis in the Armenians from Yerevan was diagnosed by rectal biopsy in 3 patients and by the presence of persistent pro- sociation between amyloidosis and the common teinuria (Ͼ300 mg/dL) in 44 FMF patients—all whom were on mutations in MEFV, to compare the genotype to dialysis at the time of the study. In the other ethnic groups, the phenotype in FMF patients before their com- amyloidosis was diagnosed by rectal and/or renal biopsy. In all mencing colchicine treatment, and to correlate the these cases, amyloidosis was diagnosed in previously untreated or effect of ethnicity and environment (ie, country of inadequately treated patients. residence) on the FMF attacks to determine clinical guidelines for molecular studies and treatment Patient Genotype Groups with colchicine. Affected individuals were assigned according to the FMF mu- tation to 1 of the following groups: group 1, homozygotes for the mutation M694V; group 2, compound heterozygotes for M694V METHODS and another mutation but not E148Q; group 3, homozygotes or compound heterozygotes for any 2 mutations other than M694V Subjects and E148Q; and group 4, patients with mutation E148Q. We included in this study all 382 patients (314 probands and 68 siblings) diagnosed by us as having FMF. They were from 5 Mutation Analysis distinct groups living in 4 countries: 1) 131 North African Jews (from Morocco, Algeria, Tunisia, and Libya) living in Israel; 2) 51 Mutation analysis was performed by genomic sequencing. Israeli Jewish patients of other ethnic origins (Ashkenazi, mixed Eleven mutations in exon 10 were tested—these were M680V, Ashkenazi/other, and other); 3) 49 Turkish patients living in M680I, T681I, ‚I692, M694I, M694V, ‚M694, K695R, V726A, Turkey; 4) 29 Armenian patients living in California; and 5) 122 A744S, and R761H. We tested for these by polymerase chain Armenian patients living in Yerevan, Armenia. reaction (PCR) amplification using the forward oligonucleotide The patients were ascertained in FMF clinics in the various 10F1; 5Ј-ccagaagaactaccctgtccc-3Ј and the reverse oligonucleo- countries (University of California, Los Angeles FMF clinic in tide 10R1; 5Ј-cagagcagctggcgaatgtat-3Ј. The PCR amplification California; Rabin Medical Center in Israel; the Gata Medical Cen- was performed under the following conditions: 95°C for 10 ter in Ankara, Turkey; and the Emergency Medical Scientific Cen- minutes followed by 30 cycles of 95°C for 15 seconds, 55°C for ter in Yerevan, Armenia). For uniformity all the patients under- 30 seconds and 72°C for 30 seconds, and final extension at 72°C went clinical evaluation by the Israeli researchers (M.S., T.S., and for 10 minutes. PCR products were purified with the High Pure M.K.) who examined the patients, reviewed the history, clinical PCR Product Purification kit (Boehringer, Mannheim, Ger- symptoms and course of the disease of each patient, and com- many) and sequenced directly, using specific primers and pleted the family history and pedigree. Thermo Sequenase kit (Amersham, Buckinghamshire, En- gland). Mutation E148Q in exon 2 was analyzed by restriction of PCR Criteria for Diagnosis of FMF products from genomic DNA. The region harboring mutation The diagnosis of FMF in this study was based on the following E148Q was amplified using the forward oligonucleotide: 5Ј- criteria: 1) probands and/or sibs with 2 FMF-causing mutations in gcctgaagactccagaccaccccg –3Ј and the reverse oligonucleotide the MEFV gene (homozygotes or compound heterozygotes); and 5Ј–aggccctccgaggccttctctc –3Ј. The amplified products were di- 2) probands found to carry only 1 known mutation but who gested for 3 hours with 3 international units of BstN1. We did not demonstrated characteristic FMF symptoms that met the diagnos- test for mutations E167D, T267I, F479L, P369S, and R408Q.

2of7 GENOTYPE/PHENOTYPEDownloaded from CORRELATION www.aappublications.org/news IN FAMILIAL by guest MEDITERRANEAN on September 29, 2021 FEVER Statistical Analysis Amyloidosis We compared the presence of amyloidosis among the 4 differ- Table 2 shows the association among the 4 geno- ent genotype groups and the clinical characteristics of the patients type groups and amyloidosis according to ethnic with and without amyloidosis within each group. All computations were performed using SAS statistical soft- group. A statistically significant association was ware (SAS, Cary, NC). Statistical analysis was performed using found between the genotype M694V/M694V and Student’s t test for 2-group comparisons of continuous variables amyloidosis (relative risk ϭ 1.77; P ϭ .008; 95% CI ϭ and analysis of variance for comparisons of multiple groups. The 1.16–2.71). Amyloidosis was diagnosed in 44 (25.7%) ␹2 test was used to test for the significance of the association of 171 homozygotes, and in only 7 (12.3%) of 57 between the clinical characteristics of FMF and the various muta- tions and ethnic origins. Fisher’s exact test was performed to test patients who carried a mutation other than M694V. for significance of the association when the sample size was small None of the 16 patients with mutation E148Q had (expected counts in each cell Ͻ5). Fisher’s exact test and the Monte amyloidosis. The association of amyloidosis with the Carlo test were used to test for the significance of the association M694V mutation was confirmed when analysis was between amyloidosis and the different genotypes. The effects of performed separately on the group of Turkish pa- ethnicity and genotype on the characteristics of the FMF attacks Ͻ Ͻ (fever, abdominal pains, pleuritis, and arthritis) were studied by tients (P .004), other Jews (P .03), and Armenian multiple regression analysis and odds ratio and 95% confidence patients from Yerevan (P Ͻ .009) and from the intervals (CIs) were computed. The effects of ethnicity and geno- United States (P Ͻ .01; Table 2). type on the number of attacks, age of onset, and age at diagnosis Because FMF amyloidosis can be prevented by of FMF were tested by a multiple linear regression model. Because the inflammatory type of attack may change with age, colchicine treatment, we tested whether the associa- it is possible that those groups with an earlier age of onset, tion between the mutation M694V and amyloidosis diagnosis, and treatment may have a different pattern of symp- held in patients who had never received colchicine toms. Therefore, we also tested for these variables, while control- and developed amyloidosis before 20 years of age. ling for the number of years since commencement of colchicine treatment. The prevalence of amyloidosis developing before the This study was approved by the human subjects committees at 20 years of age in untreated homozygotes according the Rabin Medical Center, Beilinson Campus, Petah Tikva, Israel, to the mutation groups is shown in Table 3. Al- and Cedars-Sinai Medical Center, Los Angeles, California, and though 25 (61.0%) of 41 patients who were homozy- informed consent was obtained from each participant. gous for the mutation M694V developed amyloid- osis, the frequency of this complication in compound RESULTS heterozygotes for M694V/other was 4.7% (2 of 43), For the analysis of the frequency of the mutations and in individuals carrying the genotypes E148Q/ Ͻ among the different ethnic groups we excluded the other and other/other it was 21.0% (4 of 19; P .001; siblings. Table 1 depicts the distribution of the MEFV Table 3). Amyloidosis was not diagnosed in any mutation groups among the 314 probands according patients carrying the E148Q allele. to ethnic group. The frequency of homozygotes for In addition, homozygotes for the mutation M694V the mutation M694V was highest among North Af- were significantly more likely to develop amyloid- rican Jews (73.7%) compared with other ethnic osis at a younger age than patients with other geno- groups. Interestingly, other Jews had a high fre- types. Thus, 25 (56.8%) of 44 patients who were quency of the mutation E148Q. homozygous for M694V and who developed amy- Regarding individuals who were clinically af- loidosis were diagnosed by 20 years of age or earlier, fected but in whom only 1 known mutation had been compared with 2 of 20 compound heterozygotes for identified, the number of unknown second muta- M694V/other and 4 of 7 individuals with the geno- ϭ tions varied among the different ethnic groups. In type other/other (P .001). North African Jews, the number was 8 of 160 alleles (5.0%); in other Jews, 18 of 92 alleles (19.6%); in Effect of the Genotype on the Inflammatory Attacks Turks, 10 of 98 alleles (10.2%); in Armenians living in the United States, 3 of 38 alleles (7.9%); and in Ar- Table 4 depicts the clinical characteristics of the menians living in Yerevan, 41 of 240 alleles (17.1%). FMF patients according to the ethnic groups and the genotype groups. After controlling for ethnic origin by linear regression analysis, we found that those patients who were homozygous for M694V (geno- TABLE 1. Distribution of MEFV Mutation Groups Among the type group 1), compared with genotype groups 2 314 Probands From Different Ethnic Origins and Countries of Ϯ Residence and 3, had a significantly younger age of onset (5.4 5.7 years vs 9.1 Ϯ 8.6 years and 9.5 Ϯ 8.9 years, Mutation Group respectively; P Ͻ .0001), age at diagnosis (11.2 Ϯ 9.9 M694V/ M694V/ Other/ E148Q/ years vs 18.5 Ϯ 12.6 years and 17.7 Ϯ 11.5 years, M694V Other* Other* Other* respectively; P Ͻ .008), and age at commencement of North African Jews (n ϭ 80) 73.7% 20% 0 6.3% colchicine treatment (12.7 Ϯ 9.8 years vs 23.1 Ϯ 15.3 Other Jews (n ϭ 46) 26.1% 41.3% 17.4% 15.2% years and 19.3 Ϯ 11.4 years, respectively; P Ͻ .001). Turks (n ϭ 49) 42.3% 50% 5.8% 1.9% No significant differences were found among the US Armenians (n ϭ 19) 21.0% 52.6% 26.4% 0 Yerevan Armenians (n ϭ 120) 29.6% 53.1% 16.5% .8% genotype groups with regard to the number of at- tacks before commencement of colchicine treatment. * Other tested: M680V; M680I; V726A; M694I; ⌬I692; K695R; Table 5 depicts the type of inflammatory attack in A744S; R761H; T681I; and ⌬M694. Percentage of unknown second mutations: North African Jews FMF patients according to ethnic group and geno- (5.0%); other Jews (19.6%); Turks (10.2%); Armenians living in the type group, and the results of the logistic analysis are United States (7.9%); and Armenians living in Yerevan (17.1%). shown in Table 6. The type of inflammation was

Downloaded from www.aappublications.org/newshttp://www.pediatrics.org/cgi/content/full/105/5/ by guest on September 29, 2021 e70 3of7 TABLE 2. Association Between the Four Genotype Groups and Amyloidosis According to Ethnic Groups and Countries of Residence Mutation Group M694V/M694V M694V/Other* Other*/Other* E148Q/Other* †Statistical Significance (PϽ) North African Jews (n ϭ 121) 9/96 1/20 0/0 0/5 .68 Other Jews (n ϭ 51) 2/10 0/21 0/11 0/9 .03 Turks (n ϭ 49) 9/21 2/24 0/3 0/1 .004 Armenians in United States (n ϭ 29) 3/7 0/14 0/8 0/0 .01 Armenians in Yerevan (n ϭ 121) 21/37 19/64 7/19 0/1 .009 Total (n ϭ 371) 44/171 22/143 7/41 0/16 .008 * Other tested: M680V; M680I; V726A; M694I; ⌬I692; K695R; A744S; R761H; T681I; and ⌬M694. Percentage of unknown second mutations: North African Jews (5.0%); other Jews (19.6%); Turks (10.2%); Armenians living in the United States (7.9%); and Armenians living in Yerevan (17.1%). † Statistical comparison was performed with homozygotes for M694V and pooled data from the other 3 mutation groups.

TABLE 3. Association of Genotype and Ethnic Group With Onset of Amyloidosis Before 20 Years of Age in Untreated Patients Mutation Group M694V/M694V M694V/Other* Other*/Other* E148Q/Other* †Statistical Significance (PϽ) North African Jews 8/14 0/2 0/0 0/0 .47 Other Jews 2/2 0/3 0/3 0/1 .03 Turks 4/7 1/7 0/1 0/1 .10 Armenians in United States 3/6 0/9 0/3 0/0 .02 Armenians in Yerevan 8/12 1/22 ‡4/9 0/1 .002 Total 25/41 2/43 4/16 0/3 .0001 * Other tested: M680V; M680I; V726A; M694I; ⌬I692; K695R; A744S; R761H; T681I; and ⌬M694. Percentage of unknown second mutations: North African Jews (5.0%); other Jews (19.6%); Turks (10.2%); Armenians living in the United States (7.9%); and Armenians living in Yerevan (17.1%). † Statistical significance between homozygotes for M694V and the other 3 mutation groups (M694V/other, E148Q/other, and other/ other). ‡ These 4 were individuals with genotypes V726A/M680I (2 individuals), M680I/M680I (1 individual), and M680I/M694I (1 individual).

TABLE 4. Clinical Characteristics of FMF Patients According to Ethnicity, Country of Residence, and Genotype Groups Age of Onset Age at Diagnosis Age at Initiation of Colchicine Number of Attacks per Year North African Jews (n ϭ 131) 4.7 Ϯ 5.9 7.9 Ϯ 8.7 8.8 Ϯ 8.8 13.6 Ϯ 12.2 Other Jews (n ϭ 51) 6.9 Ϯ 8.5 8.3 Ϯ 8.9 9.3 Ϯ 10.5 12.9 Ϯ 11.3 Turks (n ϭ 49) 12.3 Ϯ 9.9 18.8 Ϯ 10.3 18.2 Ϯ 11.1 12.6 Ϯ 27.3 US Armenians (n ϭ 29) 9.8 Ϯ 7.2 24.1 Ϯ 17.2 24.8 Ϯ 17.5 5.2 Ϯ 8.7 Yerevan Armenians (n ϭ 122) 8.0 Ϯ 7.5 16.7 Ϯ 9.9 23.3 Ϯ 10.8 30.8 Ϯ 25.9 Linear regression (P*Ͻ) .001 .0001 .0001 .0001 By genotype group M694V/M694V (n ϭ 179) 5.4 Ϯ 5.7 11.2 Ϯ 9.9 12.7 Ϯ 9.8 18.8 Ϯ 22.4 M694V/other (n ϭ 150) 9.1 Ϯ 8.6 18.5 Ϯ 12.6 23.1 Ϯ 15.3 25.3 Ϯ 24.8 Other/other (n ϭ 53) 9.5 Ϯ 8.9 17.7 Ϯ 11.5 19.3 Ϯ 11.4 21.5 Ϯ 21.6 Linear regression (P**Ͻ) .0001 .008 .001 NS NS indicates not significant. * The linear regression comparisons were made with the North African Jews ethnic group. ** The linear regression comparisons were made with the M694V/M694V group.

similar in all genotype groups except for arthritis, Effect of Ethnicity on the Inflammatory Attacks which was more common in homozygotes for Ͻ As depicted in Table 4, a significant association M694V (39%) compared with group 2 (28%; P .002) was found between the number of attacks (before Ͻ and group 3 (25%; P .002). This difference was also commencement of colchicine treatment), country of found to be statistically significant, controlling for residence, and ethnicity. Armenians living in Yer- the number of years since commencement of colchi- evan had a markedly higher number of attacks per cine treatment (in addition to controlling for ethnic- year (30.8 Ϯ 25.9) than all other ethnic groups (13.6 Ϯ ity). Colchicine treatment was given to only 42% of 12.2, 12.9 Ϯ 11.3, 12.6 Ϯ 27.3, and 5.2 Ϯ 8.7; P Ͻ the Armenian patients from Yerevan, which is a sig- .0001). The North African Jews had a significantly nificantly lower percentage than that for the other earlier age of onset, age at diagnosis, and age at ethnic groups (84%–94.2%). The percentage of pa- commencement of colchicine compared with all the tients treated with colchicine was significantly more other ethnic groups. common in homozygotes for mutation M694V The inflammatory type of FMF attack was differ- (75.4%) compared with group 2 (62.7%) and group 3 ent in Armenians compared with in North African (54.7%; P ϭ .02). Jews (Tables 5 and 6). Armenians from Yerevan had

4of7 GENOTYPE/PHENOTYPEDownloaded from CORRELATION www.aappublications.org/news IN FAMILIAL by guest MEDITERRANEAN on September 29, 2021 FEVER TABLE 5. Clinical Characteristics of the FMF Inflammatory Attacks in Patients According to Ethnicity, Country of Residence, and Genotype Groups Fever Abdominal Pain Pleuritis Arthritis Percentage Treated With Colchicine* North African Jews (n ϭ 131) 81.9% 78.4% 18.2% 24.3% 94.2% Other Jews (n ϭ 51) 84.8% 80.8% 13.3% 11.1% 93.5% Turks (n ϭ 49) 90.6% 87.5% 44.8% 45.2% 84.0% US Armenians (n ϭ 29) 93.1% 86.2% 51.7% 34.5% 93.3% Yerevan Armenians (n ϭ 122) 100% 89.3% 78.7% 44.3% 42.0% P†Ͻ NS NS .001 .001 .001 By mutation group M694V/M694V (n ϭ 179) 86.9% 84.7% 38.6% 39.0% 75.4% M694V/other (n ϭ 150) 92.7% 83.0% 50.8% 27.8% 62.7% Other/other (n ϭ 53) 88.9% 81.2% 41.2% 25.4% 54.7% P‡Ͻ NS NS NS .04 .02 NS indicates not significant. * Among known patients but excluding those on colchicine after the diagnosis of amyloidosis. † Multiple regression analysis (95% CI) compared with the North African Jews ethnic group. ‡ Multiple regression analysis (95% CI) compared with the M694V/M694V group. a higher frequency of abdominal pain (89% vs 78%; showed no correlation between the severity of the P Ͻ .01), pleuritis (79% vs 18%; P Ͻ .002), and arthri- disease and amyloidosis, and the fact that some pa- tis (44% vs 24%; P Ͻ .002). Armenians in California tients developed amyloidosis before FMF epi- and Turks had a significantly higher prevalence of sodes,6,11 although there appear to be several patients pleuritis (52%, P Ͻ .02 and 45%, P Ͻ .002), and with mutations other than M694V who also devel- arthritis (34%, P Ͻ .01 and 45%, P Ͻ .002), compared oped this complication. with North African Jews. No significant differences In addition, there have been 3 previous reports of were found between North African Jews and other amyloidosis in patients not carrying the mutation Jews living in Israel in any of these parameters. M694V: 2 patients with amyloidosis who were both When this analysis was performed after controlling compound heterozygotes V726A/M680I23; an Arab for the number of years since commencement of kindred where all the affected individuals were ho- colchicine treatment (in addition to controlling for mozygotes for M694I21; and a patient with systemic the mutation group), similar significant findings amyloidosis who was homozygous for V726A.24 were demonstrated, except that the frequency of ab- Thus, the potential for development of amyloidosis dominal pain in the Armenians from Yerevan was no in affected patients must be considered, even when longer significantly different. Compared with North the M694V mutation is not detected. African Jews, Armenians from Yerevan were less commonly treated with colchicine (42% vs 94.2%; Effect of Genotype Versus Environment/Ethnicity on P Ͻ .001). FMF Inflammatory Attacks We also found an association between ethnicity DISCUSSION and country of residence with disease severity. Be- Association of Mutation M694V and Amyloidosis cause suspicion of the diagnosis of FMF is based on The results of this study revealed a significant the clinical picture, it is influenced by various param- association between the presence of the M694V mu- eters, such as awareness of the physician and family, tation in both the homozygous and heterozygous prevalence of the disease, and accessibility to and use state and the development of amyloidosis. In addi- of health services by the public. Therefore, we con- tion, the findings suggest that the development of sidered the number of attacks before commencement amyloidosis does not correlate with disease severity of treatment with colchicine to be the most objective as assessed by the number of inflammatory attacks. characteristic for severity and the one the least in- This finding is consistent with previous reports that fluenced by the above mentioned parameters. We

TABLE 6. Effects of Ethnicity, Country of Residence, and Genotype on Selected Clinical Characteristics of the FMF Attacks (Adjusted Odds Ratio, 95% CI) Fever Abdominal Pain Pleuritis Arthritis North African Jews (n ϭ 131) 1 1 1 1 Other Jews (n ϭ 51) 1.27 (.42–3.79) 1.41 (.54–3.68) .89 (.31–2.56) .72 (.24–2.13) Turks (n ϭ 49) 2.06 (.56–7.61) 2.13 (.67–6.82) 4.12† (1.68–10.10) 3.60† (1.50–8.61) US Armenians (n ϭ 29) 3.0 (.61–15.02) 2.07 (.62–6.97) 6.16† (2.38–15.95) 3.06* (1.17–8.0) Yerevan Armenians (n ϭ 122) 7.0 (0–7.00) 2.75* (1.23–6.17) 20.89† (9.98–43.73) 4.38† (2.27–8.43) By mutation groups M694V/M694V (n ϭ 179) 1 1 1 1 M694V/other (n ϭ 150) 1.15 (.43–3.04) .65 (.32–1.33) .74 (.43–1.27) .36† (.20–.65) Other/other (n ϭ 53) .75 (.21–2.61) .73 (.27–1.94) .47 (.22–1.00) .33† (.15–.76) * P Ͻ .01; † P Ͻ .002, where P ϭ logistic analysis following control for the mutation groups. Comparisons made with the North African Jews ethnic group.

Downloaded from www.aappublications.org/newshttp://www.pediatrics.org/cgi/content/full/105/5/ by guest on September 29, 2021 e70 5of7 found that the number of attacks per year in Arme- FMF patients. Based on our findings, however, it nians living in Yerevan was significantly higher than seems that children who are homozygotes for M694V in Armenians living in the United States (although are at the highest risk, and this group should be both groups have the same genotype distribution) given colchicine treatment for life. This requires a and than in other ethnic groups. In Israel, the num- high level of awareness of all pediatricians working ber of attacks per year as well as the other parame- in communities with a high prevalence of FMF. In ters were found to be similar in both North African mildly affected patients (those with infrequent in- Jews and other Jews, even though the mutation/ flammatory attacks) who do not carry this mutation, genotype distribution was different. Therefore, envi- we recommend that the patients should be either ronment (country of residence) seems to exert the treated or tested every 6 months for the presence of greater influence on the severity and type of FMF proteinuria. The need for continuous treatment inflammation. seems to be less indicated in the case of those pa- It is well known that the FMF inflammatory at- tients where 1 or both mutations are E148Q, and in tacks can be triggered by stress and extreme physical this group, colchicine treatment should be given to exercise.25 Therefore, the effect of environment on the those patients who develop severe inflammatory ep- inflammatory attacks in cyclic diseases like FMF is isodes and/or proteinuria caused by amyloidosis. expected and is also seen in other cyclic conditions, such as sickle cell anemia, etc. However, in contrast ACKNOWLEDGMENTS to sickle cell anemia, where only 1 mutation exists, in This project was partially supported by a research award from FMF the predisposition to the effect of environment Mifal Hapayis, by the Israeli Ministry of Health Chief Scientist is dependent on which mutations are present, dem- Grant 4209, and by Grant 32/97-18.0 from the Israeli Academy of onstrated by the fact that this is greater in homozy- Science. gotes for M694V. Recently, based on the screening of We thank the FMF families for participating in the study. the Israeli normal population for MEFV mutations and comparison with the distribution of the muta- REFERENCES tions in the patients, it has been found that E148Q is 1. Sohar E, Gafni J, Pras M, Heller H. Familial Mediterranean fever: a frequent in the normal population but is markedly survey of 470 cases and review of the literature. Am J Med. 1967;43: less frequently represented in the patients than is 227–253 expected.17,26 This suggests a reduced penetrance of 2. Daniels M, Shohat T, Brenner-Ullman A, Shohat M. Familial Mediter- E148Q. As recent studies, including one by us, show ranean fever: high gene frequency among the non-Ashkenazic and Ashkenazic Jewish populations in Israel. Am J Med Genet. 1995;55: that carriers of E148Q are more frequent than carriers 311–314 17,26 of M694V in Jews, it seems that patients with 3. Rogers DB, Shohat M, Petersen GM, et al. Familial Mediterranean fever E148Q are frequently undiagnosed and, therefore, in Armenians: autosomal recessive inheritance with high gene fre- untreated with colchicine. quency. Am J Med Genet. 1989;34:168–172 4. Schwabe AD, Peters RS. Familial Mediterranean fever in Armenians: Although it is possible that E148Q represents a analysis of 100 cases. Medicine. 1974;53:453–462 polymorphism rather than a mutation, based on hap- 5. Tauber T, Zimand S, Kutzer E. Recurrent pericarditis in familial Med- lotype and family studies performed up to now, it is iterranean fever. Harefuah. 1995;128:611–612 regarded as a mutation.17 In our current study, we 6. Pras M, Bronshpigel N, Zemer D, Gafni J. Variable incidence of amy- found only 16 patients with the mutation E148Q, loidosis in familial Mediterranean fever among different ethnic groups. Johns Hopkins Med J. 1982;150:22–25 possibly because most such patients are phenotypi- 7. Gafni J, Ravid M, Sohar E. The role of amyloidosis in familial Mediter- cally normal and none developed amyloidosis. These ranean fever: a population study. Isr J Med Sci. 1968;4:995–999 findings concur with those of other researchers.17,27 8. Heller H, Sohar E, Sherf L. Familial Mediterranean fever. Arch Intern There have been no documented cases of amyloid- Med. 1958;102:50–71 9. Zemer D, Pras M, Sohar E, et al. Colchicine in the prevention and osis in homozygotes for E148Q and only 1 in a pa- treatment of the amyloidosis of familial Mediterranean fever. N Engl tient who was a compound heterozygote M694V/ J Med. 1986;314:1001–1005 E148Q,28 which suggests that this mutation carries a 10. Livneh A, Zemer D, Langevitz ZP, et al. Colchicine treatment of AA relatively low risk for FMF related amyloidosis. So amyloidosis in familial Mediterranean fever. Arthritis Rheum. 1994;37: far, it would seem that amyloidosis may develop 1804–1811 11. Heller H, Sohar E, Gafni J, Heller J. Amyloidosis in familial Mediterra- rarely only when this mutation is combined with nean fever: An independent genetically determined characteristic. Arch M694V (ie, M694V/E148Q). Intern Med. 1961;107:539–550 Because it has also been found that individuals 12. Pras E, Aksentijevich I, Gruberg L, et al. Mapping of a gene causing who are homozygous for M694V may be only mildly familial Mediterranean fever to the short arm of chromosome 16. N Engl J Med. 1992;326:1509–1513 or not at all affected in terms of the inflammatory 13. Shohat M, Bu X, Shohat T, et al. The gene for familial Mediterranean attacks, now that molecular testing is available, it is fever in both Armenians and non-Ashkenazi Jews is linked to the important to test for the common MEFV mutations in ␣-globin complex on 16p: evidence for locus homogeneity. Am J Hum every patient suffering from unexplained recurrent Genet. 1992;51:1349–1354 abdominal pain with fever, arthritis, or recurrent 14. The International FMF Consortium. Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial fever. Such testing is also indicated and recom- Mediterranean fever. Cell. 1997;90:797–807 mended for all siblings of known FMF patients. 15. The French FMF Consortium. A candidate gene for familial Mediterra- nean fever. Nat Genet. 1997;17:25–31 CONCLUSION 16. Bernot A, da Silva C, Petit JL, et al. Non-founder mutations in the MEFV gene establish this gene as the cause of familial Mediterranean fever. Because colchicine has been shown to be effective Hum Mol Genet. 1998;7:1317–1325 9,10 in preventing the development of amyloidosis, 17. Aksentijevich I, Torosyan Y, Samuels J, et al. Mutation and haplotype lifelong treatment has been recommended for all studies of Familial Mediterranean fever reveal new ancestral relation-

6of7 GENOTYPE/PHENOTYPEDownloaded from CORRELATION www.aappublications.org/news IN FAMILIAL by guest MEDITERRANEAN on September 29, 2021 FEVER ships and evidence for a high frequency with reduced penetrance in the 23. Yalc¸inkaya F, Akar N, Misirlioglu M. Familial Mediterranean fever— Ashkenazi Jewish population. Am J Hum Genet. 1999;64:949–962 amyloidosis and the Val726Ala mutation. N Engl J Med. 1998;338:993. 18. Booth DR, Gillmore JD, Booth SE, Pepys MB, Hawkins PN. Pyrin/ Letter marenostrin mutations in familial Mediterranean fever. Q J Med. 1998; 24. Pras M. Familial Mediterranean fever: from the clinical syndrome to the 91:603–606 cloning of the pyrin gene. Scand J Rheumatol. 1998;27:92–97 19. Magal N, Lotan R, Allon-Shalev S, Khamaysi N, Shohat M. A new hot 25. Eliakim M, Levy M, Ehrenfeld M. Recurrent Polyserositis, Familial Medi- spot in the gene causing familial Mediterranean fever. Am J Hum Genet. terranean Fever, Periodic Disease. Amsterdam, The Netherlands: Elsevier/ 1998;63(suppl):A372, 2155 North-Holland Biomedical Press; 1981:84 20. Pras E, Langevitz P, Livneh A, et al. Genotype-phenotype correlation in 26. Stoffman N, Magal N, Shohat T, et al. Higher than expected carrier rates familial Mediterranean fever (a preliminary report). In: Sohar E, Gafni J, for familial Mediterranean fever in various Jewish ethnic groups. Eur J Pras M, eds. Familial Mediterranean Fever. Tel Aviv, Israel: Freund Pub- Hum Genet. In press lishing House; 1997:260–264 27. Livneh A, Langevitz P, Shinar Y, et al. MEFV mutation analysis in 21. Dewalle M, Domingo C, Rozenbaum M, et al. Phenotype-genotype patients suffering from amyloidosis of familial Mediterranean fever. correlation in Jewish patients suffering from familial Mediterranean Amyloid. 1999;6:1–6 fever (FMF). Eur J Hum Genet. 1998;6:95–97 28. Samuels J, Aksentijevich I, Torosyan Y, et al. Familial Mediterranean 22. Shohat M, Magal N, Shohat T, et al. Phenotype-genotype correlation in fever at the millenium: clinical spectrum, ancient mutations, and a familial Mediterranean fever: evidence for an association between survey of 100 American referrals to the National Institutes of Health. Met694Val and amyloidosis. Eur J Hum Genet. 1999;7:287–292 Medicine. 1998;77:268–297

Downloaded from www.aappublications.org/newshttp://www.pediatrics.org/cgi/content/full/105/5/ by guest on September 29, 2021 e70 7of7 Familial Mediterranean Fever: Effects of Genotype and Ethnicity on Inflammatory Attacks and Amyloidosis Aviva Mimouni, Nurit Magal, Nava Stoffman, Tamy Shohat, Ara Minasian, Michael Krasnov, Gabrielle J. Halpern, Jerome I. Rotter, Nathan Fischel-Ghodsian, Yehuda L. Danon and Mordechai Shohat Pediatrics 2000;105;e70 DOI: 10.1542/peds.105.5.e70

Updated Information & including high resolution figures, can be found at: Services http://pediatrics.aappublications.org/content/105/5/e70 References This article cites 24 articles, 0 of which you can access for free at: http://pediatrics.aappublications.org/content/105/5/e70#BIBL Subspecialty Collections This article, along with others on similar topics, appears in the following collection(s): Genetics http://www.aappublications.org/cgi/collection/genetics_sub Permissions & Licensing Information about reproducing this article in parts (figures, tables) or in its entirety can be found online at: http://www.aappublications.org/site/misc/Permissions.xhtml Reprints Information about ordering reprints can be found online: http://www.aappublications.org/site/misc/reprints.xhtml

Downloaded from www.aappublications.org/news by guest on September 29, 2021 Familial Mediterranean Fever: Effects of Genotype and Ethnicity on Inflammatory Attacks and Amyloidosis Aviva Mimouni, Nurit Magal, Nava Stoffman, Tamy Shohat, Ara Minasian, Michael Krasnov, Gabrielle J. Halpern, Jerome I. Rotter, Nathan Fischel-Ghodsian, Yehuda L. Danon and Mordechai Shohat Pediatrics 2000;105;e70 DOI: 10.1542/peds.105.5.e70

The online version of this article, along with updated information and services, is located on the World Wide Web at: http://pediatrics.aappublications.org/content/105/5/e70

Pediatrics is the official journal of the American Academy of Pediatrics. A monthly publication, it has been published continuously since 1948. Pediatrics is owned, published, and trademarked by the American Academy of Pediatrics, 345 Park Avenue, Itasca, Illinois, 60143. Copyright © 2000 by the American Academy of Pediatrics. All rights reserved. Print ISSN: 1073-0397.

Downloaded from www.aappublications.org/news by guest on September 29, 2021