DOCSLIB.ORG

Tembusu-Related Flavivirus in Ducks, Thailand

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tembusu-Related Flavivirus in Ducks, Thailand Article DOI: http://dx.doi.org/10.3201/eid2112.150600 Tembusu-Related Flavivirus in Ducks, Thailand Technical Appendix Methods Outbreak Investigations During August 2013–September 2014, we investigated outbreaks of a contagious duck disease among ducks characterized by severe neurologic dysfunction and dramatic decreases in egg production in layer and broiler duck farms in Thailand. Epidemiologic information, clinical observations, postmortem examinations, samples collection, and laboratory testing were recorded and analyzed to determine the etiology of the outbreaks. Virus Isolation and Identification Visceral organ samples were collected from affected ducks, including brain, spinal cord, spleen, lung, kidney, proventiculus, and intestine. Each sample was homogenized in sterile phosphate-buffered saline at a 10% suspension (w/v), centrifuged at 3,000 × g for 15 min, then filtered through 0.2-μm filters. The filtered suspensions were inoculated into the allantoic cavities of 9-day-old embryonated chicken eggs. The allantoic fluids and tissue suspensions were then examined for the presence of duck Tembusu virus (DTMUV) by reverse transcription PCR (RT-PCR) by using E gene–specific primers (1). The samples were also tested for avian influenza virus (2), Newcastle disease virus (3,4), and duck herpesvirus (5) to rule out other common viruses that can cause similar symptoms. The tissue suspensions and virus isolates were also tested by hemagglutination tests against 1% chicken erythrocytes at 25°C, pH 7.4 to exclude avian hemagglutinating viruses, including avian influenza virus and Newcastle disease virus. Whole-Genome Sequencing and Phylogenetic Analysis of Thai DTMUV In this study, 1 DTMUV isolate from Thailand (DK/TH/CU-1) was selected and subjected to whole-genome sequencing. Additionally, 5 other isolates (DK/TH/CU-2, Page 1 of 8 DK/TH/CU-3, DK/TH/CU-4, DK/TH/CU-5, and DK/TH/CU-6) were subjected to partial E gene sequencing. Viral RNAs were extracted from allantoic fluid by using NucleoSpin Extract Viral RNA Kit (Macherey-Nagel, Düren, Germany) in accordance with the manufacturer’s instructions. RT-PCR was performed in a single-step reaction by using the AccessQuick RT- PCR System (Promega, Madison, WI, USA). Primers were designed on the basis of the complete genome sequences of DTMUV available in GenBank. The oligonucleotide primer sequences are shown in online Technical Appendix Table 1. The amplicons were then subjected to DNA sequencing (1st Base Laboratories Sdn Bhd, Malaysia). The validated nucleotide sequences were assembled by using SeqMan software v.5.03 (DNASTAR Inc., Madison, Wisconsin, USA). These nucleotide sequences of the Thai DMTUV were submitted to GenBank under accession nos. KR061333–8. Phylogenetic analysis was performed by comparing the nucleotide sequences of polyprotein, E gene and NS genes of the Thai DMTUVs with those of other reference flaviviruses available in GenBank. The nucleotide sequences were aligned by using Muscle v.3.6 (7). The phylogenetic trees were constructed in MEGA v.6.0 by using the neighbor-joining and maximum-likelihood algorithms (8). To determine nucleotide identities, the nucleotide sequences of Thai, Malaysian, and Chinese DTMUVs were aligned and compared in MegAlign software v.5.03 (DNASTAR Inc.) with other reference flaviviruses. References 1. Su J, Li S, Hu X, Yu X, Wang Y, Liu P, et al. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS ONE. 2011;6:e18106. PubMed http://dx.doi.org/10.1371/journal.pone.0018106 2. Spackman E, Senne DA, Myers TJ, Bulaga LL, Garber LP, Perdue ML, et al. Development of a real- time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol. 2002;40:3256–60. PubMed http://dx.doi.org/10.1128/JCM.40.9.3256-3260.2002 3. Ke GM, Yu SW, Ho CH, Chu PY, Ke LY, Lin KH, et al. Characterization of newly emerging Newcastle disease viruses isolated during 2002–2008 in Taiwan. Virus Res. 2010;147:247–57. PubMed http://dx.doi.org/10.1016/j.virusres.2009.11.008 Page 2 of 8 4. Liu H, Wang Z, Wu Y, Zheng D, Sun C, Bi D, et al. Molecular epidemiological analysis of Newcastle disease virus isolated in China in 2005. J Virol Methods. 2007;140:206–11. PubMed http://dx.doi.org/10.1016/j.jviromet.2006.10.012 5. Li H, Liu S, Kong X. Characterization of the genes encoding UL24, TK and gH proteins from duck enteritis virus (DEV): a proof for the classification of DEV. Virus Genes. 2006;33:221–7. PubMed http://dx.doi.org/10.1007/s11262-005-0060-6 9. Huang X, Han K, Zhao D, Liu Y, Zhang J, Niu H, et al. Identification and molecular characterization of a novel flavivirus isolated from geese in China. Res Vet Sci. 2013;94:774–80. PubMed http://dx.doi.org/10.1016/j.rvsc.2012.11.014 7. Edgar RC. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics. 2004;5:113. PubMed http://dx.doi.org/10.1186/1471-2105-5-113 8. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–9. PubMed http://dx.doi.org/10.1093/molbev/msr121 Technical Appendix Table 1. Primers used for whole-genome sequencing of a Thai duck Tembusu virus Primer name Sequence (5′3′) Reference P1f AGAAGTTCRYCTGTGTGA (6) DF_R638 CAGCAGTCTATGTCTTCAGG This study DF_F441 CGATAGTTGCTGGGCTGAAGC This study DF_R1115 GCAGTAAGATCTCACAACCGC This study DF_F954 GCTTCAGCTGTCTGGGGATGC This study DF_R1650 CAATGACTCTTTGTTTTGCCACG This study DF_F1480 CTACACYGCTGAGATGGAGG This study DF_R2463 GCCAAGTCGATTGAGCACCCC This study DF_F2353 GGCACTGCTATTGTGGATGGG This study DF_R3339 GGTGGGGTGGTGCAAGACC This study DF_F3302 GGAACAACTGTCACAGTAACG This study DF_R4694 GCATGACTCCCACTCCAGCC This study DF_F4406 GCATCACAGAGATTTGATGTGG This study DF_R5162 CCTGAACCTGGATGTAGGTCC This study DF_F4874 GCAAGTCATCGTCGTGCAACC This study DF_R5582 GCTCTTCAATGTCTGTTATTGGC This study DF_F5399 GCTCACACCTCAGCGAGTGC This study DF_R6249 GGTCATTGTAACTTATCCCAGC This study DF_F5928 CCAGTTCCTATAACATCAGCC This study DF_R6678 GCTCCAAGACCTGTCTTCCC This study DF_F6494 CGCTCACAGAATGACAGAATCC This study DF_R7348 GGAACATCTGTAGCCACTATGC This study DF_F6807 GAACCAGAGAGACAGAGATCGC This study DF_R8158 CCCTAGCTAGCCATTCCTCGG This study DF_F7940 GCAGGTTCAGGAAGTGAGAGG This study DF_R8536 GGATTGTCTTGGTCATAATGCC This study DF_F8383 GGATGCACAAAACCAACCGC This study DF_R9215 GGCCGAGATGTCACGCAGC This study DF_F8084 GCTGTGTGACATAGGTGAAGC This study DF_R9449 CCACTTCCCCTCTGGTCTTCC This study DF_F9274 GGGACACTAGAATAACCAAGGC This study DF_R10485 CCAACATCCGGTGGCAGGG This study Page 3 of 8 Technical Appendix Table 2. Nucleotide identities of the polyprotein gene sequences of a Thai DTMUV (DK/TH/CU-1) with reference viruses of Ntaya virus group DEDSV- DK/TH/CU-1 WFZ_2012 CJD05 xz_2012 YY5 goose pigeon byd1 BYD-1 MM1775 STWV NTAV BAGV ITV ROCV ILHV ZIKV DK/TH/CU-1 100 97.7 97.6 97.7 97.9 97.8 97.9 97.9 97.9 90.3 89.4 76.9 76.7 77 69.4 68.8 65.2 WFZ_2012 99.1 99.2 99.4 99.3 99.3 99.4 99.4 90.6 89.4 76.9 76.5 77 69.4 68.6 65.2 CJD05 99.1 99.3 99.2 99.3 99.4 99.4 90.6 89.3 76.9 76.5 76.8 69.3 68.6 65.3 xz_2012 99.4 99.3 99.3 99.4 99.4 90.7 89.5 77 76.5 76.8 69.3 68.7 65.4 YY5 99.5 99.6 99.6 99.6 90.7 89.5 77 76.6 76.9 69.4 68.7 65.3 goose 99.9 99.6 99.6 90.6 89.5 77 76.5 76.8 69.4 68.7 65.3 pigeon 99.6 99.6 90.7 89.5 77 76.5 76.9 69.4 68.7 65.3 DEDSV-byd1 100 90.7 89.5 77 76.6 76.9 69.4 68.7 65.3 BYD-1 90.7 89.5 77 76.6 76.9 69.4 68.7 65.3 MM1775 94 76.5 76.6 76.9 69.3 68.6 65.1 STWV 76.5 76.5 76.8 69.2 68.4 65.1 NTAV 79.9 80.2 69 68.5 65.2 BAGV 94.9 69.3 69.1 65.2 ITV 69.6 69.1 65.2 ROCV 74.9 65.4 ILHV 65.4 ZIKV 100 *BAGV, Bagaza virus; DK/TH/CU-1, Thai duck tembusu virus; ILHV, Ilheus virus; ITV, Israel turkey meningoencephalomyelitis virus; WFZ_2012, CJD05, xz_2012, YY5, goose, pigeon, DEDSV-byd1, BYD-1, Chinese duck tembusu viruses; MM1775, Tembusu virus strain MM1775; NTAV, Ntaya virus; ROCV, Rocio virus; STWV, Sitiawan virus; ZIKV, Zika virus. Page 4 of 8 A B 60.0 50.0 40.0 30.0 20.0 10.0 DTMUVprevalence (%) 0.0 Aug-13 Sep-13 Oct-13 Nov-13 Dec-13 Jan-14 Feb-14 Mar-14 Apr-14 May-14 Jun-14 Jul-14 Technical Appendix Figure 1. Details of DTMUV outbreaks in Thailand during 2013–2014. A) Locations of DTMUV outbreaks in Thailand. Circles represent provinces where the DMTUV isolated. NR, Nakhon Ratchasima; PC, Prachinburi; CB, Chonburi; SB, Suphanburi. B) Monthly prevalence of DTMUV in farmed ducks, Thailand, 2013–2014. DTMUV, duck Tembusu virus. Page 5 of 8 TA df-2 FX 2012 BYD-1 LD 2010 86 Shandong1 XHZD/2010 Goose 100 JXSP Pigeon JS804 FS 87 JM SD/2011 Chinese DTMUV ZJ-6 TMUV JS/2010 ZJ 407 YY5 CJD05 9992 WR/2010 WFZ 2012 100 CK-SD-11 99 GS-PT-7 100 Du/CH/LSD/110128 FJMH220 99 100 100 JX2 DK/TH/CU-1 Thai DTMUV 100 MM 1775 100 Sitiawan virus Ntaya virus Bagaza virus 100 100 Israel turkey meningoencephalomyelitis virus 100 Rocio virus Ilheus virus St.
Load more

Recommended publications
  • The Role of Genetic Diversity in the Replication, Pathogenicity and Virulence of Murray Valley Encephalitis Virus
    School of Biomedical Sciences The Role of Genetic Diversity in the Replication, Pathogenicity and Virulence of Murray Valley Encephalitis Virus Aziz-ur-Rahman Niazi This thesis is presented for the Degree of Doctor of Philosophy of Curtin University September 2013 Declaration To the best of my knowledge and belief, this thesis contains no material previously published by any other person except where due acknowledgment has been made. This thesis contains no material which has been accepted for the award of any other degree or diploma in any university. Signature:…………………. Date:………………………. Acknowledgement First, I am humbly grateful to The Almighty God for granting me both the ability and determination to carry out this PhD. Next, I express my sincerest gratitude to both my parents who I hold with the highest regard, for their support and affability that made the undertaking of this thesis possible. I only wish that my mother were still alive to share in its completion. My sincere thanks are extended to my wife, Sonia Mohammadi, whom I am forever indebted to for giving up her ambitions of going to university to instead raise our lovely baby daughter, Alia Saba Niazi, born at the beginning of this PhD. Sonia is now expecting our son who will be born soon after completion of this PhD. Special heartfelt thanks also go to my extended family back home whose support has provided me with additional strength and energy to complete this PhD. I would like to cordially express my thanks to my supervisor, Dr David Thomas Williams, first for his help in applying for an Australian Biosecurity Cooperative Research Centre (AB-CRC) scholarship, then for guiding me and inspiring me to be a virologist.
    [Show full text]
  • Data-Driven Identification of Potential Zika Virus Vectors Michelle V Evans1,2*, Tad a Dallas1,3, Barbara a Han4, Courtney C Murdock1,2,5,6,7,8, John M Drake1,2,8
    RESEARCH ARTICLE Data-driven identification of potential Zika virus vectors Michelle V Evans1,2*, Tad A Dallas1,3, Barbara A Han4, Courtney C Murdock1,2,5,6,7,8, John M Drake1,2,8 1Odum School of Ecology, University of Georgia, Athens, United States; 2Center for the Ecology of Infectious Diseases, University of Georgia, Athens, United States; 3Department of Environmental Science and Policy, University of California-Davis, Davis, United States; 4Cary Institute of Ecosystem Studies, Millbrook, United States; 5Department of Infectious Disease, University of Georgia, Athens, United States; 6Center for Tropical Emerging Global Diseases, University of Georgia, Athens, United States; 7Center for Vaccines and Immunology, University of Georgia, Athens, United States; 8River Basin Center, University of Georgia, Athens, United States Abstract Zika is an emerging virus whose rapid spread is of great public health concern. Knowledge about transmission remains incomplete, especially concerning potential transmission in geographic areas in which it has not yet been introduced. To identify unknown vectors of Zika, we developed a data-driven model linking vector species and the Zika virus via vector-virus trait combinations that confer a propensity toward associations in an ecological network connecting flaviviruses and their mosquito vectors. Our model predicts that thirty-five species may be able to transmit the virus, seven of which are found in the continental United States, including Culex quinquefasciatus and Cx. pipiens. We suggest that empirical studies prioritize these species to confirm predictions of vector competence, enabling the correct identification of populations at risk for transmission within the United States. *For correspondence: mvevans@ DOI: 10.7554/eLife.22053.001 uga.edu Competing interests: The authors declare that no competing interests exist.
    [Show full text]
  • Investigation of Dengue Virus Envelope Gene Quasispecies Variation in Patient Samples: Implications for Virus Virulence and Disease Pathogenesis
    Hannah Love Investigation of dengue virus envelope gene quasispecies variation in patient samples: implications for virus virulence and disease pathogenesis Cranfield Health PhD 2011 Supervisors: Prof. David Cullen (Cranfield University) Dr. Jane Burton (Health Protection Agency) Dr. Kevin Richards (Health Protection Agency) This thesis is submitted in partial fulfilment of the requirements for the Degree of Doctor of Philosophy September 2011 © Cranfield University, 2011. All rights reserved. No part of this publication may be reproduced without the written permission of the copyright holder. ABSTRACT i Abstract Due to the error-prone nature of RNA virus replication, each dengue virus (DV) exists as a quasispecies within the host. To investigate the hypothesis that DV quasispecies populations affect disease severity, serum samples were obtained from dengue patients hospitalised in Ragama, Sri Lanka. From the patient sera, DV envelope glycoprotein (E) genes were amplified by high-fidelity RT-PCR, cloned, and multiple clones per sample sequenced to identify mutations within the quasispecies population. A mean quasispecies diversity of 0.018% was observed, consistent with reported error rates for viral RNA polymerases (0.01%; Smith et al., 1997). However, previous studies reported 8.9 to 21.1-fold greater mean diversities (0.16% to 0.38%; Craig et al., 2003; Lin et al., 2004; Wang et al., 2002a). This discrepancy was shown to result from the lower fidelity of the RT-PCR enzymes used by these groups for viral RNA amplification. Previous studies should therefore be re-examined to account for the high number of mutations introduced by the amplification process. Nonsynonymous mutation locations were modelled to the crystal structure of DV E, identifying those with the potential to affect virulence due to their proximity to important structural features.
    [Show full text]
  • Evolution of the Sequence Composition of Flaviviruses
    Loyola University Chicago Loyola eCommons Bioinformatics Faculty Publications Faculty Publications 2010 Evolution of the Sequence Composition of Flaviviruses Alyxandria M. Schubert Catherine Putonti Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/bioinformatics_facpub Part of the Bioinformatics Commons, and the Biology Commons Recommended Citation Schubert, A and C Putonti. "Evolution of the Sequence Composition of Flaviviruses." Infections, Genetics, and Evolution 10(1), 2010. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Bioinformatics Faculty Publications by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Elsevier, 2010. Author's Accepted Manuscript Evolution of the Sequence Composition of Flaviviruses Alyxandria M. Schubert1 and Catherine Putonti1,2,3* 1 Department of Bioinformatics, Loyola University Chicago, Chicago, IL USA 2 Department of Biology, Loyola University Chicago, Chicago, IL USA 3 Department of Computer Science, Loyola University Chicago, Chicago, IL USA * To whom correspondence should be addressed. Email: [email protected] Fax number: 773-508-3646 Address: 1032 W. Sheridan Rd., Chicago, IL, 60660 Author's Accepted Manuscript Schubert, AM and Putonti, C. Evolution of the Sequence Composition of Flaviviruses. Infection, Genetics and Evolution. Abstract The adaption of pathogens to their host(s) is a major factor in the emergence of infectious disease and the persistent survival of many of the infectious diseases within the population. Since many of the smaller viral pathogens are entirely dependent upon host machinery, it has been postulated that they are under selection for a composition similar to that of their host.
    [Show full text]
  • Mosquitoes of the Caribbean
    Vector Hazard Report: Mosquitoes of the Caribbean 1 Table of Contents Reference Map Vector Ecology Month of Maximum Precipitation Month of Maximum Temperature Monthly Climate Maps Human Density Soil Drainage Mosquito-Borne Disease Hazards of the Caribbean Aedes Arboviruses Yellow Fever Dengue Fever Zika Virus Malaria Infectious Days Temperature Suitability Incidence Estimate/ Entomological Inoculation Rate Mosquitoes of Medical Importance Aedes (Stg.) aegypti (Linnaeus, 1762) Species Information/ Habitat Suitability Model Aedes (Stg.) albopictus (Skuse, 1894) Species Information/ Habitat Suitability Model Aedes (Och.) scapularis (Rondani, 1848) Species Information/ Habitat Suitability Model Aedes (Och.) taeniorhynchus (Wiedemann, 1821) Species Information/ Habitat Suitability Model Aedes (Gym.) mediovittatus (Coquillett, 1906) Species Information Anopheles (Nys.) albimanus Wiedemann, 1820 Species Information/ Habitat Suitability Model Anopheles (Nys.) aquasalis Curry, 1932 Species Information/ Habitat Suitability Model Anopheles (Ano.) quadrimaculatus Say, 1824 Species Information/ Habitat Suitability Model Anopheles (Nys.) argyritarsis Robineau-Desvoidy, 1827 Species Information/ Habitat Suitability Model Anopheles (Ano.) crucians Wiedemann, 1828 Species Information/ Habitat Suitability Model Culex (Cux.) nigripalpus Theobald, 1901 Species Information/ Habitat Suitability Model Culex (Cux.) quinquefasciatus Say, 1823 Species Information/ Habitat Suitability Model Culex (Mel.) erraticus (Dyar and Knab, 1906) Species Information Culex (Mel.)
    [Show full text]
  • Newly Recognized Mosquito-Associated Viruses in Mainland China, in the Last Two Decades Hong Liu†, Xiaoyan Gao†, Guodong Liang*
    Liu et al. Virology Journal 2011, 8:68 http://www.virologyj.com/content/8/1/68 REVIEW Open Access Newly recognized mosquito-associated viruses in mainland China, in the last two decades Hong Liu†, Xiaoyan Gao†, Guodong Liang* Abstract There are four principal arboviruses in mainland China. Two kinds of them are mosquito-borne viruses, namely Japanese encephalitis virus and dengue virus, which lead to Japanese encephalitis, and dengue fever/dengue hemorrhagic fever respectively; the other two are tick-borne viruses, namely tick-borne encephalitis virus and Crimean-Congo hemorrhagic fever virus (also known as Xinjiang hemorrhagic fever virus), which contribute to tick- borne encephalitis and Xinjiang hemorrhagic fever respectively. With exception of these four main arboviruses, many other mosquito-associated viruses have been isolated and identified in recent years. These newly isolated and identified mosquito-associated viruses are probably responsible for human and animal infections and diseases. The purpose of this review is to describe the newly isolated mosquito-associated viruses in mainland China which belong to five viral families, including their virological properties, phylogenetic relationships, serological evidence, as well as to appeal the public health concentration worldwide. Introduction are arboviral diseases were caused by tick-borne arbo- Arboviruses comprise a group of viruses that reproduce viruses: tick-borne encephalitis virus (TBEV) and Crim- in sensitive blood-sucking arthropods [1]. There are ean-Congo hemorrhagic fever virus (CCHFV) (also more than 550 species listed in the international catalog, known as Xinjiang hemorrhagic fever virus, XHFV). JE of which more than 128 are known to infect humans and DEN are nationally notifiable communicable dis- and livestock and most are mosquito borne [2].
    [Show full text]
  • Emerging-Arboviruses-Why-Today.Pdf
    One Health 4 (2017) 1–13 Contents lists available at ScienceDirect One Health journal homepage: www.elsevier.com/locate/onehlt Emerging arboviruses: Why today? MARK ⁎ Ernest Goulda, , John Petterssonc,d, Stephen Higgse,f, Remi Charrela,b, Xavier de Lamballeriea,b a Emergence des Pathologies Virales (EPV: Aix-Marseille Université-IRD 190-INSERM 1207-EHESP), Marseille, France b Institut Hospitalo-Universitaire Méditerranée Infection, APHM Public Hospitals of Marseille, Marseille, France c Department of Infectious Disease Epidemiology and Modelling/Molecular Biology, Domain for Infection Control and Environmental Health, Norwegian Institute of Public Health, Oslo, Norway d Department of Medical Biochemistry and Microbiology (IMBIM), Zoonosis Science Center, Uppsala University, Uppsala, Sweden e Diagnostic Medicine and Pathobiology, Kansas State University, Manhattan, United States f KS Biosecurity Research Institute, Kansas State University, Manhattan, United States ARTICLE INFO ABSTRACT Keywords: The recent global (re)emergence of arthropod-borne viruses (arboviruses), such as chikungunya and Zika virus, Emerging arboviruses, was widely reported in the media as though it was a new phenomenon. This is not the case. Arboviruses and Arthropods, other human microbial pathogens have been (re)emerging for centuries. The major difference today is that Mosquitoes, arbovirus emergence and dispersion are more rapid and geographically extensive, largely due to intensive Evolution, growth of global transportation systems, arthropod adaptation to increasing urbanisation, our failure to contain Anthropology, mosquito population density increases and land perturbation. Here we select examples of (re)emerging patho- Dispersal, ff Global distribution genic arboviruses and explain the reasons for their emergence and di erent patterns of dispersal, focusing particularly on the mosquito vectors which are important determinants of arbovirus emergence.
    [Show full text]
  • Complete Genome Sequence of T'ho Virus, a Novel Putative Flavivirus
    Briese et al. Virology Journal (2017) 14:110 DOI 10.1186/s12985-017-0777-6 RESEARCH Open Access Complete genome sequence of T’Ho virus, a novel putative flavivirus from the Yucatan Peninsula of Mexico Thomas Briese1, Maria A. Loroño-Pino2, Julian E. Garcia-Rejon2, Jose A. Farfan-Ale2, Carlos Machain-Williams2, Karin S. Dorman3, W. Ian Lipkin1 and Bradley J. Blitvich4* Abstract Background: We previously reported the discovery of a novel, putative flavivirus designated T’Ho virus in Culex quinquefasciatus mosquitoes in the Yucatan Peninsula of Mexico. A 1358-nt region of the NS5 gene was amplified and sequenced but an isolate was not recovered. Results: The complete genome of T’Ho virus was sequenced using a combination of unbiased high-throughput sequencing, 5′ and 3′ rapid amplification of cDNA ends, reverse transcription-polymerase chain reaction and Sanger sequencing. The genome contains a single open reading frame of 10,284 nt which is flanked by 5′ and 3′ untranslated regions of 97 and 556-nt, respectively. Genome sequence alignments revealed that T’Ho virus is most closely related to Rocio virus (67.4% nucleotide identity) and Ilheus virus (65.9%), both of which belong to the Ntaya group, followed by other Ntaya group viruses (58.8–63.3%) and Japanese encephalitis group viruses (62.0–63.7%). Phylogenetic inference is in agreement with these findings. Conclusions: This study furthers our understanding of flavivirus genetics, phylogeny and diagnostics. Because the two closest known relatives of T’Ho virus are human pathogens, T’Ho virus could be an unrecognized cause of human disease.
    [Show full text]
  • Japanese Encephalitis As an Emerging Virus: the Emergence and Spread of Japanese Encephalitis Virus in Australasia J.S
    Japanese Encephalitis as an Emerging Virus: The Emergence and Spread of Japanese Encephalitis Virus in Australasia J.S. MACKENZIE, C.A. JOHANSEN, S.A. RITCHIE, A.F. VAN DEN HURK, and R.A. HALL Introduction .. .. 49 2 Background. .. 51 2.1 JE and Other Flaviviruses ofindonesia . .. 51 2.1.1 The Western Indonesian Archipelago (Sumatra, Java, Kalimantan, Bali) . .. 51 2.1.2 The Eastern Indonesian Archipelago (Wallacea) . .. 52 2.2 JE and Other Flaviviruses of Australasia . .. 53 2.2.1 Flaviviruses of Papua New Guinea and Irian Jaya . .. 53 2.2.2 Flaviviruses of Australia. .. 54 3 The Emergence of JE in Australasia . .. 55 3.1 The Emergence of JE Virus in the Torres Strait of Northern Australia . .. 55 3.2 JE Virus in Papua New Guinea and Irian Jaya. .. 58 4 Vectors and Vertebrate Hosts: The Potential for Establishment in Australasia . .. 59 4.1 Entomological Studies: JE Vectors in Australasia. .. 60 4.2 Vertebrate Hosts of JE and JE Serogroup Viruses in Australasia. .. 61 5 Possible Mechanisms of Spread of JE into and within Australasia . .. 64 6 The Potential of JE to Spread into the Pacific . .. 67 References . .. 67 1 Introduction Japanese encephalitis (JE) virus has a great propensity to spread, expanding its range through much of southeastern Asia in the past four decades (UMENAI et al. 1985; BURKE and LEAKE 1988; VAUGHN and HOKE 1992; MONATH and HEINZ 1996). In the 1990s, JE spread into southern Pakistan (IGARASHI et al. 1994) and to Haryana State (PRASAD et al. 1993) and Kerala State (DHANDA et al. 1997) in northwestern and southwestern India, respectively.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,679,472 B1 Reichert Et Al
    USOO8679472B1 (12) United States Patent (10) Patent No.: US 8,679,472 B1 Reichert et al. (45) Date of Patent: Mar. 25, 2014 (54) CRYSTAL OF HUMAN INTERFERON ALPHA 6,180,096 B1 1/2001 Kline 2B IN COMPLEX WITH ZINC 6,250,469 B1 6/2001 Kline 6,482.613 B1 1 1/2002 Goeddelet al. 6,524,570 B1 2/2003 Glue et al. (75) Inventors: Paul Reichert, Montville, NJ (US); 6,610,830 B1 8, 2003 Goeddeletal. Marianna Marshall Long, 2008/0201 123 A1* 8/2008 Cosgrove ........................ TO3/11 Birmingham, AL (US); Alan W. Hruza, Hackettstown, NJ (US); Peter Orth, OTHER PUBLICATIONS New York, NY (US); Tattanahalli L. Ramagopal et al., Acta Crystallographica Section D. Biological Crys Nagabhushan, Parsippany, NJ (US) tallography D59:868-875, 2003.* Kitago et al., Acta Crystallographica Section D. Biological Crystal (73) Assignee: Merck, Sharp & Dohme Corp., lography D61: 1013-1021, 2005.* Rahway, NJ (US) Radhakrishnan et al., Zinc mediated dimer of human interferon-C2b revealed by X-ray crystallography. Structure (1996) 4(12): 1453 (*) Notice: Subject to any disclaimer, the term of this 1463. patent is extended or adjusted under 35 Physicians Desk Reference(R) Electronic Library-Rebetron(R), U.S.C. 154(b) by 210 days. RebetolR, Intron RA (last accessed Oct. 2007). Physicians Desk Reference(R). Electronic Library-Pegasys(R (last (21) Appl. No.: 11/973,362 accessed Oct. 2007). Physicians Desk Reference R. Electronic Library-ActimmuneR (last Filed: Oct. 5, 2007 accessed Oct. 2007). (22) Physicians Desk Reference(R). Electronic Library-Betaseron(R) (last accessed Oct. 2007). Related U.S.
    [Show full text]
  • Molecular Epidemiology of Yellow Fever Virus
    213 Rev Biomed 2010; 21:213-220 Review Molecular epidemiology of yellow fever virus Alan D. T. Barrett Center for Biodefense and Emerging Infectious Diseases, Sealy Center for Vaccine development, Institute for Human Infec- tions and Immunity, and Department of Pathology, University of Texas Medical Branch, Galveston, Texas, USA ABSTRACT Despite a safe and effective vaccine, there are still y epidemias. En conjunto, todos estos estudios approximately 200,000 cases, including 30,000 han ayudado enormemente en la salud pública y deaths, caused by yellow fever virus (YFV). The continuarán realizando aportes importantes en el last 25 years has seen the classic studies on YFV futuro. extended by the use of molecular techniques. A total of seven genotypes of the virus have been Palabras clave: fiebre amarilla, flavivirus, epide- identified, five in Africa and two in South America. miología molecular, variación genética Extensive genetic studies have been used to refine the epidemiology of YFV and been applied to 1. Yellow fever virus investigations of outbreaks and epidemics. Overall, Yellow fever virus (YFV) is the prototype these studies have greatly aided public health and virus of the family Flaviviridae that takes its name will continue to make important contributions in from the latin for yellow (flavus). The virus is a the future. member of the genus Flavivirus that contains 67 human and animal viruses. Initially, the genus Key words: yellow fever, flaviviruses, molecular was divided, on the basis of plaque reduction epidemiology, genetic
    [Show full text]
  • Dating the Origin of the Genus Flavivirus in the Light of Beringian Biogeography
    Journal of General Virology (2014), 95, 1969–1982 DOI 10.1099/vir.0.065227-0 Dating the origin of the genus Flavivirus in the light of Beringian biogeography John H.-O. Pettersson and Omar Fiz-Palacios Correspondence Department of Systematic Biology, Evolutionary Biology Centre, Uppsala University, John H.-O. Pettersson Uppsala, Sweden [email protected] or [email protected] The genus Flavivirus includes some of the most important human viral pathogens, and its members are found in all parts of the populated world. The temporal origin of diversification of the genus has long been debated due to the inherent problems with dating deep RNA virus evolution. A generally accepted hypothesis suggests that Flavivirus emerged within the last 10 000 years. However, it has been argued that the tick-borne Powassan flavivirus was introduced into North America some time between the opening and closing of the Beringian land bridge that connected Asia and North America 15 000–11 000 years ago, indicating an even older origin for Flavivirus. To determine the temporal origin of Flavivirus, we performed Bayesian relaxed molecular clock dating on a dataset with high coverage of the presently available Flavivirus diversity by combining tip date calibrations and internal node calibration, based on the Powassan virus and Beringian land bridge biogeographical event. Our analysis suggested that Flavivirus originated ~85 000 (64 000–110 000) or 120 000 (87 000–159 000) years ago, depending on the circumscription of the genus. This is significantly older than estimated previously. In light of our results, we propose that it is likely that modern humans came in contact with several members of the genus Flavivirus much earlier than suggested previously, and that it is possible that the spread of several Received 28 February 2014 flaviviruses coincided with, and was facilitated by, the migration and population expansion of Accepted 4 June 2014 modern humans out of Africa.
    [Show full text]