THE ROLE of RELAXIN in PROSTATE CANCER by VANESSA

THE ROLE OF RELAXIN IN PROSTATE CANCER

by

VANESSA CAMILLE THOMPSON

B.Sc, The University of Victoria, 2001

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

in

THE FACULTY OF GRADUATE STUDIES

(Genetics)

THE UNIVERSITY OF BRITISH COLUMBIA

July 2007

© Vanessa Camille Thompson, 2007 Abstract

Prostate cancer is the leading cause of cancer in men, and there is currently a lack of novel treatment options for this disease. Relaxin, part of the insulin superfamily, is a potent peptide hormone normally produced and secreted by the human prostate. cDNA and tissue microarray analyses, indicated that relaxin is highly overexpressed in prostate cancer progression to androgen independence (Al), and is negatively regulated by androgens. Characterization of the relaxin receptor, LGR7, in xenografts and human patient tissue microarrays (TMAs) indicated that LGR7 is expressed in the stroma and epithelia, suggesting that relaxin may act in an autocrine and/or paracrine fashion. Relaxin is known to increase angiogenesis through upregulation of vascular endothelial growth factor, and matrix metalloproteases. To elucidate novel pathways that may be upregulated by relaxin in prostate cancer, the effects of relaxin overexpression in the LNCaP prostate cancer xenograft model were analysed by gene expression microarrays. A novel discovery is that the protocadherinY (PCDHY)/Wnt pathway is upregulated by relaxin, resulting in P-catenin translocation from the cell membrane to the cytoplasm and upregulation of Wntll, which can stimulate proliferation, transformation, and migration. Relaxin is well characterized in the uterus and ovary to increase insulin-like growth factor-I (IGF-I); relaxin may also increase IGF-I in prostate cancer. Since IGF-I and various other growth factor signaling is mediated by insulin receptor substrate-2 (IRS-2), and IGF-I signaling is important in prostate cancer progression to Al, we investigated the role of IRS-2 in

LNCaP cells. IRS-2 mRNA is dramatically upregulated by androgens, and decreased by IGF-I in androgen treated cells. IRS-2 was knocked down using IRS-2 siRNA to explore the interaction between the IGF axis and androgen signalling. Combined

IGF-I and androgen treatment reduced transcription of androgen regulated genes,

n prostate specific antigen, insulin degrading enzyme, vascular endothelial growth factor, and clusterin. This indicates that in the presence of IGF-I treatment, IRS-2 mRNA is required for normal androgen mediated transcription. Due to the potential for relaxin to induce proliferation and metastases, and the necessity of IRS-2 to mediate androgen action, relaxin and IRS-2 are intriguing targets for novel, targeted therapeutics for prostate cancer.

in Table of Contents

Abstract ii

Table of Contents iv

List of Tables vi

List of Figures vii

List of Abbreviations ix

Acknowledgements xi

Dedication xii

Co-Authorship Statement xiii

Chapter 1. Introduction 1

1.1 The Prostate 1

1.2 Relaxin 9

1.3 Hypothesis 24

1.4 Objectives 24

1.5 References 26

Chapter 2. Relaxin Becomes Upregulated During Prostate Cancer Progression to

Androgen Independence and is Negatively Regulated by Androgens 40

2.1 Introduction 40

2.2 Materials and Methods 43

2.3 Results 50

2.4 Discussion 59

2.5 References 66

Chapter 3. Relaxin Drives Wnt Signalling Through Upregulation of PCDHY in

Prostate Cancer 71

3.1 Introduction 71

iv 3.2 Materials and Methods 74

3.3 Results 80

3.4 Discussion 92

3.5 References 98

Chapter 4. Suppression of Androgen Signaling by IGF-I due to siRNA Depletion of

IRS-2 102

4.1 Introduction 102

4.2 Materials and methods 104

4.3 Results 107

4.4 Discussion 117

4.5 References 121

Chapter 5. Discussion 125

5.1 Relaxin regulation in prostate cancer progression 125

5.2 Relaxin regulated Wntl 1 pathway 127

5.3 IRS-2 mediates androgen regulated gene expression 130

5.4 Future Directions 132

5.5 References 136

Appendix I. Genes upregulated at least 5-fold in Rl 881-treated cells 139

Appendix II. Genes downregulated at least 5-fold in Rl 881-treated cells 140

Appendix III. University of British Columbia Animal Care Certificate 141

Appendix IV. Primers for quantitative RT-PCR 142

v List of Tables

Table 3.1 List of Figures

Figure 1.1 Histologic grades of prostate adenocarcinoma 4

Figure 1.2 LHRH axis for anti-androgen therapy 6

Figure 1.3 Relaxin structure 12

Figure 1.4 Schematic of LGR7 tertiary structure 13

Figure 1.5 Relaxin signaling pathways used by the relaxin receptor, LGR7 in multiple cell types 15

Figure 2.1 Relaxin levels in LNCaP cells decrease with increased androgen concentration 52

Figure 2.2 Relaxin levels in LNCaP cells decrease with increased duration of androgen treatment 53

Figure 2.3 Relaxin mRNA levels increase with progression to androgen independence in LNCaP subcutaneous xenograft model in nude mice 56

Figure 2.4 Relaxin levels increase in human prostate cancer tissue with increased duration of neoadjuvant hormone therapy (NHT) 58

Figure 3.1 Relaxin is overexpressed in LNCaP-RLX stable cell lines 81

Figure 3.2 Relaxin and LGR7 protein levels are higher in LNCaP-RLX xenografts grown in intact mice compared to controls, using IHC 82

Figure 3.3 LGR7 is expressed in malignant epithelium and stromal cells of prostate.

84

Figure 3.4 LNCaP-RLX xenograft tumours grow more rapidly than LNCaP-GFP xenografts in intact mice 86

Figure 3.5 Wntll staining is increased after six months NHT, and sustained in Al metastases in human patient samples 90

vii Figure 3.6 Relaxin overexpression causes p-catenin to translocate to the cytoplasm in intact mice 91

Figure 3.7 Model of relaxin driving upregulation of PCDHY, with P-catenin translocating to the cytoplasm, and downstream upregulation of Wntl 1 96

Figure 4.1 IGF-I treatment reduces IRS-2 mRNA levels 109

Figure 4.2 AR siRNA knocks down AR mRNA and abrogates androgen mediated transcription of PSA and IRS-2 110

Figure 4.3 IRS-2 siRNA dose curve 112

Figure 4.4 IRS-2 is required for androgen mediated transcription in the presence of

R1881 and IGF-I 113

Figure 4.5 Effect of IRS-2 siRNA on AR and IGF signaling molecules 116

viii List of Abbreviations

Al androgen independence AR androgen receptor ATBF1 at-binding transcription factor 1 Bcl-2 B-cell CLL/lymphoma 2 bHLH class B basic helix-loop-helix cAMP cyclic AMP C02 carbon dioxide CREB cAMP response element binding protein CSS charcoal stripped serum DHT dihydrotestosterone DRE digital rectal exam EGF epidermal growth factor ERK extracellular signal-regulated kinase FCS fetal calf serum FOXO forkhead box 0 FSH follicle stimulating hormone GFP green fluorescent protein GnRH gonadotrope releasing hormone GPR G protein coupled receptor GST glutathione-S-transferase IDE insulin degrading enzyme IGF insulin-like growth factor IGFBP IGF binding protein IGF-IR insulin-like growth factor receptor type I IHC immunohistochemistry INSL insulin-like peptides IRES internal ribosome entry site IRS insulin receptor substrate KGF keratinocyte growth factor KLK kallikrein LGR7 relaxin receptor LGR8 INSL3 receptor LH luteinizing hormone LHRH luteinizing hormone releasing hormone LNCaP- GFP LNCaP xenografts stably transfected with empty vecot control LNCaP- RLX LNCaP xenografts stably overexpressing relaxin M metastasis MAPK mitogen activated protein kinase MEK MAPK/ERK kinase MMP matrix metalloprotease N lymph node NHT neadjuvant hormone therapy NO nitric oxide NOS nitric oxide synthase ODC ornithine decarboxylase PCDH protocadherin PCR polymerase chain reaction PI3K PI3 kinase PIN prostatic intraepithelial neoplasia PKA protein kinase A PKC protein kinase C PSA prostate specific antigen PTEN phosphatase and tensin homolog Q-PCR semi-quantitative real time - PCR relaxin relaxin H2 RLX relaxin RTK receptor tyrosine kinase s.c. sub cutaneous SF serum free siRNA short interfering RNA SRC steroid receptor coactivator SRE sterol response element SREBP sterol response element-binding protein STAT signal transducer and activator of transcription T tumor growth T-cell factor and lymphoid enhancer factor family of TCF/LEF1 transcription factors TFE transcription factor for immunoglobulin heavy-chain enhancer TIMP tissue inhibitors of metalloprotease TMA tissue microarray TNM tumor, node, metastasis TRAMP transgenic adenocarcinoma of mouse prostate UV ultraviolet VEGF vascular endothelial growth factor Wnt wingless-type MMTV integration site family

x Acknowledgements

My experience as a PhD student has been made more enjoyable and fulfilling by many people. I would like to acknowledge the friends and colleagues who have helped along the way. John Cavanagh and Robert Shukin are two great friends whose expertise and insight have been invaluable along the way. My fellow graduate students have inspired me and kept me sane. I would like to thank Dr. Dawn Cochrane, Dr. Lindsay

Brown, Leah Prentice, and Melanie Lehman for all their feedback and support. Dr.

Susan Moore and Dr. Tanya Day have been extremely generous with their assistance. I would like to thank my supervisor, Dr. Colleen Nelson, for her guidance, encouragement, and motivation.

xi Dedication

To my husband, Cory Wood.

Your love and support throughout this process have been immeasurable. Co-Authorship Statement

The work presented in this thesis was conducted under the guidance of my supervisor, Dr. Colleen Nelson, and is due to collaboration with several individual researchers. The specifics of each researcher's involvement are detailed below.

Chapter 2. Tanis Morris performed the xenograft experiment, and contributed the northern blot, Ladan Fazli stained the tissue microarrays and scored them for staining intensity, John Cavanagh developed the antibody against relaxin, Tatyana Hamilton designed the relaxin Q-PCR primers and probes.

Chapter 3. Antonio Hurtado-Coll photomicrographed tissue microarrays and managed automated analysis software, Dmitry Turbin scored for subcellular P-catenin localization in xenograft tissue microarrays, Ladan Fazli manually scored all remaining tissue microarrays.

Chapter 4. Steve Hendy treated cells for microarray analysis; Manuel Altamirano hybridized cDNA to microarrays, and analyzed microarray data with Mauricio Neira.

Melanie Lehman performed statistical analyses; Amy Lubik performed western blots.

Xlll Chapter 1. Introduction

Prostate cancer is the leading cause of cancer in men, and there is currently a lack of targeted treatment options for this disease. Novel research performed in our laboratory demonstrated that an increase in relaxin, a normal prostate secretory protein, correlated with progression to androgen independence in the LNCaP prostate cancer cell line model. Relaxin is of interest due to its pleiotrophic properties, including its involvement in the upregulation of several factors known to be angiogenic or metastatic.

In this dissertation, I describe androgen regulation of relaxin in prostate cancer, and novel roles for relaxin in prostate cancer. Novel relaxin-regulated pathways were first elucidated using cDNA microarray analysis. From these studies it was shown that Wntl 1 and PCDHY are upregulated in relaxin overexpressing prostate cancer cells, which may be a mechanism by which relaxin increases cellular migration. In addition, I show that

IRS-2, a signaling molecule for insulin and insulin-like growth factor pathways, is also downregulated by relaxin, and is strongly upregulated by androgens. As relaxin belongs to the insulin superfamily, the interaction between relaxin and IRS-2 is of interest.

Based on the results presented in this dissertation, relaxin and its downstream targets may be suitable therapeutic targets for prostate cancer.

1.1 The Prostate

Prostate Cancer

Prostate cancer is the most common form of cancer in men, with an expected

22,300 new cases being diagnosed this year in Canada, and the third leading cause of cancer related deaths (Canada, 2007). Prostate cancer is thought to progress from

1 prostatic intraepithelial neoplasia (PIN) to adenocarcinoma, and then spread to secondary sites including bone, lymph node, liver, and lung, with bone being the most predominant site of metastasis (Bagi, 2005). One other major form of prostate disease is benign prostatic hyperplasia, which is marked by increased prostate size, but is not considered a precursor to the malignant disease (Chokkalingam et al., 2003).

Prostate cancer is a multifocal and multiclonal disease; one individual may have multiple tumors, which arise independently through different mechanisms such as loss of

PTEN (Jin-Tang Dong, 2006; Li et al, 1997; Steck et al, 1997). PTEN loss occurs in

23% of high grade PIN, and 68% of prostate adenocarcinomas, indicating a role for

PTEN in prostate cancer development (Yoshimoto et al., 2006). Other tumor suppressor genes deleted or mutated in prostate cancer include ATBF1 (Sun et al., 2005), and p53

(Grignon et al., 1997). However, there appears to be a lack of consistencies of mutations in particular genes and it is accepted that multiple pathways are likely involved in the development and progression of prostate cancer.

There are several established risk factors associated with prostate cancer; most important is age, as the risk of developing prostate cancer increases with age. In addition to age, a family history of prostate cancer is also associated with increased risk of prostate cancer, as one first degree relative (father, brother, or son) with the disease increases risk two-fold, and two first degree relatives further increases the relative risk to

8.8 (Klein, 1995). Ethnic background is also a risk factor; men of African descent have a relative risk of 1.8 over men of European descent (Morton, 1994), and men from Asia have the lowest risk. However, second generation Asians-Americans have increased risk, indicating that lifestyle is important. One lifestyle difference is diet; a higher fat

2 diet has a relative risk of 1.31 (Key, 1995), while various dietary components have been indicated to have apparent protective effects, including lycopenes, in some studies, components of green tea, vitamin E and selenium (Reviewed in Gupta, 2006). These are all antioxidants, and may serve to protect the cells from DNA damage. This is particularly interesting, considering that expression of glutathione-S-transferase (GST), which prevents oxidative stress-induced DNA damage, is commonly lost early in prostate cancer due to promoter methylation (Brooks et al., 1998; Lee et al., 1994; Millar et al., 1999). In addition to established risk factors, several recent reports have shown that several abnormalities, including small nucleotide polymorphisms, along 3 regions of chromosome 8q24 are independently associated with an increased risk for the development of prostate cancer (Gudmundsson et al., 2007; Haiman et al., 2007; Platz,

2007; Schumacher et al., 2007; Suuriniemi et al., 2007; Wang et al., 2007; Witte, 2007;

Yeager et al., 2007). This sheds some light on the poorly understood genetic risk of prostate cancer.

Prostate cancer is detected through the combined use of a digital rectal exam

(DRE), prostate specific antigen (PSA) tests, and a transrectal biopsy. The PSA test measures the concentration of serum PSA, an enzyme produced in the normal prostate, which, when present in the serum, is an indication of tumor size in untreated prostate cancer. An elevated serum PSA of greater than 4-10 ng/ml, and a positive DRE suggest a cancerous lesion, which would then result in a transrectal biopsy for characterization of the potential tumor. Using the Gleason grading system (Gleason and Mellinger, 1974), prostate cancer is given a value of 1-5 based on glandular characteristics, with a lower grade given to more differentiated and normal prostate glands, and a higher grade is

3 given to less differentiated glands (Fig. 1.1). The Gleason score is the additive value of the Gleason grade from the most common pattern with the grade of the second most common; the Gleason score ranges from 2-10. A well defined cancer could have a

Gleason score of 1+2=3 and an aggressive cancer could have a Gleason score of 4+5 = 9

(Humphrey, 2004). A well differentiated cancer is often smaller than a dedifferentiated cancer, although these generalizations do not always hold true. In part for this reason,

PROSTATIC ADENOCARCINOMA (Histologic Grades)

Figure 1.1 Histologic grades of prostate adenocarcinoma, as characterized by Dr. Gleason. Adapted from Humphrey et al. (Humphrey, 2004).

4 prostate cancer can also be characterized clinically using tumor, node, metastasis (TNM) staging, which indicates the extent of tumor growth (T), the number of local lymph nodes affected (N), and the degree of metastatic spread (M) (Hoedemaeker et al., 2000).

Based on Gleason score, TNM staging, and PSA value, the urologist can predict pathological stage, and determine appropriate treatment (Ayyathurai et al., 2006; Partin et al., 1997; Partin et al., 2001).

Androgen dependence and treatment

Prostate cancer is readily curable if the cancer is still contained within the prostatic capsule. In this condition, common primary treatment strategies include radiation and surgery. In addition, patients with low volume cancer or those with other co-morbidities may receive "watchful waiting" - observation of the disease without any treatment. If the cancer has progressed beyond the capsule, the major form of treatment is androgen withdrawal therapy, as prostate cancer cells are androgen dependent

(Huggins and Hodges, 1941). This treatment targets the prostate and metastatic cells, yet is not without side effects, including osteoporosis, fatigue, diminished cognitive function, and loss of libido. Androgen deprivation therapy functions through two mechanisms, firstly through luteinizing hormone releasing hormone (LHRH) agonists or orchiectomy to reduce total circulating androgen levels via reduction of testosterone production, and secondly through AR antagonists by directly inhibiting androgen receptor (AR) signaling (Tammela, 2004).

The original and most effective means of reducing circulating androgen levels is orchiectomy, as the removal of the testes eliminates the major source of androgens with

5 the adrenal glands being the remaining source of androgens (Huggins and Hodges,

1941). Disrupting the LHRH axis is also another option. LHRH acts on the gonadotropic cells of the anterior pituitary, resulting in the synthesis and release of luteinizing hormone (LH) and follicle stimulating hormone (FSH). These two gonadotropes stimulate the production of testosterone, which in turn provides the negative feedback signal to reduce testosterone production (Fig. 1.2). Treatment with

LHRH agonists, such as leuprolide, goserelin, and buserelin, blocks LH secretion.

hypothalamus j J

gland

prostate

Figure 1.2 LHRH axis for anti-androgen therapy Initially testosterone production increases for 4-5 days; however, castrate level testosterone is present within 2-3 weeks. LHRH antagonists block LHRH action directly, resulting in immediate blockage of the LHRH axis, and testosterone production, presenting a benefit over LHRH agonists (reviewed in Brawer, 2006; Debruyne, 2004;

Goldenberg et al, 1995; Tammela, 2004).

Another treatment option is the use of antiandrogens, which inhibit androgen signaling through direct binding of the AR. Nonsteroidal antiandrogens, such as flutamide, nilutamide, and bicalutamide, bind to the AR ligand binding domain, and inhibit activation of the receptor. Antiandrogen-bound AR often binds DNA at target elements but prevents transcription of androgen regulated genes. However, nonsteroidal antiandrogens block the negative feedback effect of testosterone in the hypothalamus, resulting in higher testosterone levels and permitting normal sexual potency (Farla et al.,

2005; Furr and Tucker, 1996). Steroidal antiandrogens, such as cyproterone acetate, compete with ligand for receptor binding similar to nonsteroidal antiandrogens, but impart a negative feedback on the LHRH axis, thereby reducing testosterone levels

(reviewed in Tammela, 2004; Varenhorst et al., 1982).

Intermittent androgen suppression is an alternate form of treatment which seeks to improve quality of life and time to androgen independence (Al), through cycling on and off androgen ablation. Recent clinical trials have suggested that intermittent androgen suppression is equal to or better than the current standard treatment. A clear benefit of this regime is the significant decrease in time a patient is subjected to hormonal treatment, which positively impacts a patient's quality of life (Brawer, 2006;

Bruchovsky et al., 2006; reviewed in Tammela, 2004).

7 Androgen independence

While androgen ablation is initially effective, inevitably the tumour will progress to Al prostate cancer, in which AR is reactivated (Zhang et al., 2003). Feldman and

Feldman (Feldman and Feldman, 2001) described 5 potential mechanisms for the development of Al, which are as follows; 1) AR hypersensitivity, permitting the receptor to utilize what little levels of androgen are present in functionally castrated men. One mechanism, present in 30% of patients studied, involves gene amplification of the AR, resulting in excess AR, and increasing the probability that low levels of ligand will be bound by receptor (Koivisto et al., 1997; Visakorpi et al., 1995). Another mechanism leading to AR hypersensitivity involves increased 5-a-reductase activity, resulting in more intracellular dihydrotestosterone, the most active androgen. 2) The promiscuous receptor, which can be transactivated by ligands other than androgen, permits the transcription of androgen regulated genes in the absence of androgens. For instance, the LNCaP cell line which was derived from a prostate metastasis to lymph node and harbors a T877A mutation, permits AR transactivation by estrogen, progestens, and some anti-androgens (Veldscholte et al, 1992). 3) AR activation in the absence of ligand may occur through phosphorylation of the AR by Her2/neu (Berger et al., 2006;

Craft et al, 1999), insulin-like growth factor-I (IGF-I), epidermal growth factor (EGF), or keratinocyte growth factor (KGF) signaling (Culig et al., 1994). 4) Growth and survival may occur through proliferative and anti-apoptotic mechanisms, such as an increase in Bcl-2 expression (Chi et al., 2001; Gleave et al., 1999), with no requirement of AR or ligand. 5) Cells are present in the prostate that are Al prior to treatment, and are clonally selected for by the absence of androgens (Isaacs, 1999).

8 1.2 Relaxin

History

Relaxin was initially discovered in 1926 by Frederick Hisaw, who discovered that serum from pregnant guinea pigs could lengthen the interpubic ligament in female virgin guinea pigs (Hisaw, 1926). The relaxin protein was isolated from the pregnant porcine corpora lutea of the ovaries, and was termed so for its lengthening or relaxing effects (Fevold et al., 1930). Relaxin was originally considered a hormone facilitating the ease of birth in pregnant mammals, through the lengthening of pubic ligaments and sacroiliac joints, cervical ripening, and inhibiting uterine contractions (Guico-Lamm and

Sherwood, 1988; Hughes and Hollingsworth, 1997; Hwang et al., 1989; Hwang and

Sherwood, 1988; Krantz et al., 1950). The effects on the ligaments, cervix and joints are due in part to collagen remodeling, characterized by decreased collagen production, increased matrix metalloprotease (MMP) production, and decreased tissue inhibitors of metalloproteases (TIMPs). The degree to which relaxin affects collagen remodeling is species specific, with the effect in humans and ruminants not as great as in rodents

(guinea pig, and rat) and pig. In humans, elongation of the sacroiliac joints by relaxin is greater than the pubic symphysis; whereas in cows, relaxin causes cervical ripening

(Fevold et al., 1930). In rats and pigs, relaxin expression is increased in the third trimester of pregnancy, and there is a relaxin surge near parturition (Ivell and Einspanier,

2002). In humans there is no relaxin surge at term; in fact, serum relaxin levels peak in the first trimester, but remain elevated throughout pregnancy (Bell et al., 1987; Eddie et al., 1986; Ivell and Einspanier, 2002; MacLennan et al., 1986a). Elevated serum relaxin

9 levels in the last trimester of pregnancy can result in joint pain due to increased elongation of the pubic symphisis and sacroiliac joints (MacLennan et al., 1986b).

Relaxin production was initially found in the ovary, but further studies found relaxin production in the endometrium (Goldsmith and Weiss, 2005; Pardo et al., 1980;

Pardo and Larkin, 1982; Pardo et al., 1984; Schmidt et al., 1984), the decidua, and the placenta (Koay et al., 1985; Schmidt et al., 1984) of humans, guinea pigs, pigs, and rhesus monkeys. Additionally, the human prostate (Ivell et al., 1989; Sokol et al., 1989;

Yki-Jarvinen et al., 1983), and dogfish and boar testes (Dubois and Dacheux, 1978) were also found to express relaxin. Relaxin is essential to mammary growth, nipple development, and lactation in rats and mice (Hwang et al., 1991; Krajnc-Franken et al.,

2004; Kuenzi and Sherwood, 1992). Other studies found that relaxin is expressed in and can bind to the heart (Osheroff and Ho, 1993), and brain (Burazin, 2000; Osheroff and

Ho, 1993), suggesting non-reproductive functions for the hormone. Relaxin has also been shown to affect water intake, and is postulated to be responsible for water retention during pregnancy, indicating a role for relaxin binding in the brain (Danielson et al.,

1999; Sunn et al., 2002; Zhao et al., 1995).

The peptide structure

A large increase in relaxin research occurred in the late 80's early 90's with the identification of the human relaxin genes, HI and H2, and the discovery that H2 was the predominant transcript of the ovary and prostate (Hudson et al., 1983; Ivell et al., 1989).

Relaxin HI is transcribed, but protein has not been definitively detected in the prostate.

Relaxin H2 is the primary relaxin protein of the prostate, and thus was the focus of study

10 within this thesis. Relaxin H2 will be referred to as "relaxin" for the remainder of this thesis. The relaxin protein shares surprisingly little homology with rat or porcine relaxin, sharing less than 50% identity. In addition, relaxin homology differs by 6% between the two baleen whales, Balaeonoptera acutorostrata and B. edeni, while by less than 10% between the two whales and pig (Schwabe and Bullesbach, 1990). This lack of homology does not indicate a lack of cross reactivity between species. In fact, porcine relaxin is bioactive in many different species, including rat and human (Schwabe and Bullesbach, 1990).

Due to similar chemical characteristics, relaxin was postulated to share structural homology with insulin; this was confirmed upon discovery of the porcine relaxin sequence in 1977 (Schwabe and McDonald, 1977). Great quantities of relaxin were obtainable from porcine ovaries; however, the paucity of human ovaries of pregnant women precluded discovery of the human relaxin gene until 1984 (Hudson et al., 1984).

Relaxin is similar to insulin and the insulin-like growth factors in that they are translated as follows: signal peptide, B-chain, C-chain, A-chain (Gast, 1982; Stults et al., 1990).

For both insulin and relaxin, the C-chain is cleaved from the A and B chains to create the mature peptide (Gast, 1982). Human relaxin tertiary structure is similar to both insulin and porcine relaxin (Eigenbrot et al., 1991). The A- and B-chains are composed of interacting alpha helices connected by two disulfide bonds; as well, the A-chain contains an intrachain disulfide bond (Fig. 1.3) (Canova-Davis et al., 1991; Stults et al., 1990).

The insulin superfamily is made up of insulin, IGF-I, IGF-II, relaxin HI, relaxin

H2, relaxin H3, and insulin-like peptides (INSL) 3-6. INSL3 is essential for the descent of the testes, through interaction with its receptor, LGR8 (Kumagai et al., 2002;

11 Yamazawa et al, 2007; Zimmermann et al., 1999). Insulin and IGF-I signal through the insulin receptor and the IGF-I receptor (IGF-IR), respectively, which are both receptor tyrosine kinases (RTKs). Activation of the receptor results in activation of the intracellular signaling intermediates, insulin receptor substrate (IRS)-l and IRS-2, which then signal to downstream pathways such as Akt (Dearth et al., 2007). Relaxin and

INSL3 bind to the G protein coupled receptors (GPR), LGR7 and LGR8, respectively

(Hsu et al., 2002).

C oomain

Figure 1.3 Relaxin structure. A) Tertiary sturcutre of relaxin, demonstrating interacting alpha helices and cystine bonds. B) Schematic diagram of preprorelaxin, indicating signal peptide, cleavage sites, A-, B-, and C-chains, and cystine bonds. Adapted from (Ivell and Einspanier, 2002).

12 The receptor

LGR7 was identified as the relaxin receptor nearly 80 years after relaxin was first discovered (Hsu et al., 2002). LGR7 is a leucine rich repeat GPR (Fig. 1.4) that shares

Figure 1.4 Schematic of LGR7 tertiary structure. The extracellular domain is composed of leucine-rich repeats and an N-terminal ectodomain. The receptor spans the membrane seven times, characteristic of a GPR, and has an intracellular C-terminus. Adapted from (Ivell and Einspanier, 2002).

structural homology with receptors for the gonadotropins, LH and FSH, and thyrotropin

(Hsu et al, 2000). Relaxin also binds to LGR8 in vitro (Hsu et al., 2002), while INSL3 specifically binds to LGR8 (Kumagai et al., 2002). Relaxin H3 specifically activates

LGR7 but not LGR8 (Sudo et al., 2003). Additional GPRs, GPCR135 and GPCR142, have been found to bind relaxin H3 in vitro; however, GPCR135 is likely to be the relaxin H3 receptor, whereas GPCR142 is activated by INSL5 (Sutton et al., 2005;

Sutton et al., 2006). INSL4 and INSL6 are the remaining members of the insulin superfamily and currently no receptors have been identified for these two proteins.

13 LGR7 mRNA is expressed in many tissues previously characterized to bind relaxin, such as the brain, kidney, testis, placenta, prostate, uterus, ovary, skin heart, adrenal (Hsu et al., 2002). Several LGR7 splice variants that encode truncated proteins have been discovered and they can inhibit full length LGR7 activation without interfering with relaxin binding to the membrane bound receptor (Scott et al., 2006).

Relaxin action was originally characterized by increased cyclic AMP (cAMP) in the pubic symphysis (Braddon, 1978), and rat uterus (Cheah and Sherwood, 1980). cAMP is considered such a definitive response of relaxin bioactivity that it was the characteristic endpoint of several bioassays. Initially uterine strips were assayed for cAMP production, until cultured uterus cells were available that were sensitive and specific to relaxin adminstration (Fei et al., 1990; Kramer et al., 1990). Furthermore, the

THP-1 monocyte cell line responds to relaxin administration with increased levels of cAMP (Parsell et al., 1996).

The mechanism by which relaxin activation causes increased cAMP levels has not been fully elucidated. There is evidence indicating that G-protein signaling is involved in activating adenylate cyclase, as would be expected from a GPR (Hsu et al.,

2002). However, there is evidence that mitogen activated protein kinase (MAPK) and tyrosine kinases are involved in relaxin signaling. Using RTK inhibitors, Bartsch et al

(Bartsch et al., 2001) determined that relaxin-induced increases in cAMP were due to activated adenylate cyclase through inhibition of phosphodiesterase (Fig. 1.5). Relaxin causes an increase in activated MAPK, dependent on MEK activation (Zhang et al.,

2002). One downstream effector activated by MAPK may be cAMP response element

14 Figure 1.5 Relaxin signaling pathways used by the relaxin receptor, LGR7 in multiple cell types. Gas couples LGR7 signalling to adnylate cyclase, resulting in increased cAMP. LGR7 coupling to GPy subunits activates PI3K, which then activates PKC which in turn activates adenylate cyclase. PI3K can also signal through c-Raf to activate the MAPK signaling pathway, and can activate Akt. Adapted from (Bathgate et al., 2006). binding protein (CREB), although CREB may also be activated by cAMP (Zhang et al.,

2002). However, this MAPK activation can be blocked by protein kinase A (PKA) inhibition, indicating that relaxin-induced MAPK signaling is downstream of cAMP signaling (Bathgate et al., 2006). There is a biphasic cAMP response to relaxin, through two signaling mechanisms (Halls et al., 2006; Nguyen and Dessauer, 2005). The first, acute response signals through the G-protein Gas, resulting in increased cAMP through activation of adenylate cyclase. A second mechanism responsible for the sustained elevation of cAMP acts through GPy to activate PI3 kinase (PI3K) (Dessauer and

Nguyen, 2005; Halls et al., 2005; Nguyen and Dessauer, 2005). The mediator between

PI3K activation and adenylate cyclase has been shown to be protein kinase C (PKC) (,

(Nguyen and Dessauer, 2005). Not all signaling pathways are activated by relaxin in

15 every cell, in support of different responses to relaxin in different cells (Dessauer and

Nguyen, 2005; Dschietzig et al., 2003; Nguyen and Dessauer, 2005).

Relaxin functions in different tissues

The major site of relaxin production is the corpus luteum, which expresses far more relaxin in pregnant females than cycling females (Bogie et al., 1995; Soloff et al.,

1992). Relaxin expression in the ovary is secreted into the blood stream, and acts in an endocrine fashion on several different tissues throughout pregnancy. Relaxin is mitogenic in porcine follicular granulosa and thecal cells (Bagnell et al., 1993). Relaxin is also synthesized in the placenta, decidua, brain, prostate, pancreas, and kidney (Bogie et al, 1995; Gunnersen et al, 1995).

Relaxin binds to the uterus, likely to LGR7 (Osheroff et al., 1990; Zhao et al.,

1999), resulting in multiple downstream effects. Relaxin increases uterine growth and elevates E-cadherin protein levels (Hall et al., 1990; Hall et al., 1992; Min et al., 1997;

Ryan et al., 2001). Relaxin increases vascular endothelial growth factor (VEGF) in endometrial cells in vitro, and women treated with systemic relaxin experienced menometrorrhagia, likely due to increased angiogenesis in the endometrium (Palejwala et al., 2002; Unemori et al., 1999). Increased endometrial angiogenesis occurs in part by

VEGF, and facilitates growth of the endometrium throughout the menstrual cycle and pregnancy (Girling and Rogers, 2005). Relaxin has been shown to inhibit murine myometrial contractility, likely as a means to inhibit premature parturition. This is at least in part mediated by increased nitric oxide production, through upregulation of endothelial nitric oxide synthase (Bani et al., 1999a).

16 Relaxin is expressed at the same time or prior to prolactin expression, during progression of the menstrual cycle, followed by IGF binding protein-1 (IGFBP-1) expression late in the cycle. All three proteins are expressed in early pregnancy, while they are expressed strongly at late pregnancy in the stroma (Bryant-Greenwood et al.,

1993). A relaxin-induced increase of IGFBP-I and prolactin in human decidual and endometrial stromal cells (Gao et al., 1995; Gao et al., 1994) is mediated by PKA signaling for both genes (Tang et al, 2005). Additionally, the relaxin induction of prolactin is mediated by MAPK activation (Tang et al., 2005). Relaxin induces uterine growth in the pig, which may be mediated in part by increased in IGF-I, IGF-II, IGFBP-

2, and IGFBP-3. IGF-I and IGF-II were elevated only at the protein level, suggesting either increased translation, or increased half life of the protein through interaction with

IGFBP-2 and IGFBP-3. Interestingly, IGFBP-1 was not affected by relaxin in this model (Ohleth et al., 1997). The proliferative effects associated with relaxin in the uterus may be because relaxin upregulates the IGF-I axis.

Relaxin binding in the cervix is enhanced by estrogen priming (Huang et al.,

1993; Osheroff et al., 1990), and results in cervical softening, growth (Hwang et al.,

1989), and increased extensibility in rats (Sherwood et al., 2000). The mechanisms by which relaxin alters the cervix are varied among species. In the rat, relaxin increases cervical size through inhibition of apoptosis (Zhao et al., 1999). Nitric oxide mediates the relaxin induced growth, but not the extensibility or softening of the cervix in rats

(Sherwood et al., 2000). However, in human cervical stromal cell culture, relaxin does not change growth of cervical cells, but causes collagen remodeling to soften cervix

(Hwang et al., 1996). In the rat, relaxin affects cervical softening through less compact

17 collagen fiber bundles and shorter and less dense elastin fibers (Lee et al., 1992), implying collagen remodeling is not limited to pubic ligaments and joints. In the porcine uterine cervix, relaxin-mediated collagen remodeling is mediated by elevated TIMP-1 and -2 expression (Lenhart et al., 2002).

Relaxin plays a minor role in mammary gland growth and development in the rat and mouse (Kass et al., 2001), but is essential for nipple development and lactation

(Hwang et al., 1989). Relaxin depletion in pregnant rats and mice results in impaired nipple development, with decreased size and altered histology, resulting in inability of pups to attach to the nipple, and stimulate prolactin (Kuenzi and Sherwood, 1992; Zhao et al., 1999). In addition, in mice there is no lengthening of the pubic symphisis, resulting in impaired delivery (Zhao et al., 1999). LGR7 knockout mice recapitulate the same phenotype, implying that relaxin signals through LGR7 to cause nipple development, and pubic symphisis elongation.

Several binding sites in the rat brain have been characterized, with binding to the circumventricular organs, (subfornical organ and organum vasculosum of the lamina terminalis) and the paraventricular and supraoptic nuclei, being potential ways by which relaxin controls vascular volume and blood pressure (Osheroff et al., 1990; Osheroff and

Phillips, 1991). Relaxin acts on the subfornical organ, an interface between the blood, brain, and cerebrospinal fluid, to increase drinking in rats (Hornsby et al., 2001; Sunn et al., 2002). Relaxin acts through increasing angiotensin II receptors in the subfornical organ (Hornsby et al., 2001). Depleting relaxin in the subfornical organ results in a cessation of drinking urges associated with pregnancy in rats (Hornsby et al., 2001).

18 Relaxin binds to the heart through LGR7 regardless of estrogen treatment, unlike the uterus, which requires estrogen priming for relaxin receptor production (Osheroff et al., 1992; Zhao et al., 1999). Relaxin protects against myocardial injury through protection from ischemia, in part through involvement of nitric oxide (Bani et al., 1998;

Masini et al., 1997). Nitric oxide production in mast cells is elevated by relaxin (Masini et al., 1994; Masini et al., 1995), which inhibits histamine release from mast cells in the heart (Masini et al., 1997), and results in an inhibition of cardiac anaphylaxis (Masini et al., 2002; Ndisang et al., 2001). In addition, relaxin can inhibit apoptosis in cardiomyocytes through an Akt pathway (Moore et al., 2007). This has led to preclinical research into relaxin as a treatment for acute myocardial infarction, as relaxin improves ventricular performance and protects cardiomyocytes through reduced damage and apoptosis (Perna et al., 2005).

Relaxin causes collagen remodeling in pubic symphisis ligaments; further studies indicated the molecular mechanisms by which relaxin caused collagen remodeling

(Wahl et al., 1977). In human dermal fibroblasts, relaxin caused a decrease in collagen secretion, a decrease in tissue inhibitor of metalloproteases, and an increase in procollagenase, MMP-1 (Unemori and Amento, 1990). The same characteristics are present in a pulmonary fibrosis model, resulting in decreased fibrosis (Unemori et al.,

1996). In a renal fibrosis model, relaxin again decreases collagen production, and increases procollagenase (Masterson et al., 2004). Relaxin decreases TIMP-1, and increases procollagenase and MMP-3, two enzymes which degrade collagen I, the primary collagen component of the human uterine cervix (Palejwala et al., 2001). The large body of evidence that relaxin can remodel the extracellular matrix and reduce

19 fibrosis, led to clinical studies using relaxin to treat systemic scleroderma, a disease of systemic fibrosis (Seibold et al., 2000). While Phase I and II trials were successful in reducing fibrosis, characterized by improving skin elasticity in scleroderma patients,

Phase III trials did not support this data, and the treatment development was discontinued (Gavino and Furst, 2001).

Regulation of relaxin expression

While much is known about the function of relaxin, very little is known about the peptide's regulation. Signal transducer and activator of transcription 3

(STAT3) is bound to the rat relaxin promoter when relaxin levels are low, whereas

STAT5a is bound to the relaxin promoter when relaxin levels are elevated during pregnancy, suggesting a role for these transcription factors in regulating relaxin transcription (Soloff et al., 2003). In the rabbit, relaxin transcription is negatively regulated by retinoids (Bernacki et al., 1998), while in a human choricarcinoma cell line, relaxin is positively regulated by glucocorticoid and progesterone (Garibay-Tupas et al,

2004). In pigs, LH and IGF-I can increase relaxin expression and secretion individually or in combination (Huang et al., 1992; Ohleth and Bagnell, 1999); relaxin is regulated by prolactin and LH in the rat (Peters et al., 2000). However, gonadotropin treatment does not affect relaxin secretion in human seminal fluid (Colon et al., 1994). There is significant species and tissue variation in the expression of this hormone, and the characterization of relaxin transcriptional regulation in the prostate has been limited to reporter assays (Brookes et al., 1998).

20 In prostate

In males, relaxin was originally detected in human seminal plasma, and further analysis indicated that relaxin was produced in the prostate but not the testis (Essig et al.,

1982b; Ivell et al., 1989; Loumaye et al, 1980). Relaxin mRNA expression further indicated that this gland produces, and does not just sequester, relaxin (Bogie et al.,

1995). The relaxin produced by the prostate is H2 relaxin, the same as is produced in the ovary (Ivell et al., 1989; Winslow et al., 1992). The presence of relaxin in this gland led to investigations aimed at determining the function of relaxin in the prostate. Relaxin can affect the motility of sperm, and has been found to maintain sperm motility over time in aged semen samples (Essig et al., 1982a; Lessing et al., 1986; Lessing et al.,

1984; Sarosi et al., 1983). Relaxin can increase sperm motility, and this effect is larger in sperm with compromised motility (Han et al., 2006; Lessing et al., 1986). However, only optimal doses of relaxin are capable of increasing motility as too much or too little relaxin will decrease motility (reviewed in Weiss, 1989). It is possible that relaxin enhances the ability of sperm to penetrate the cervical mucosa (Brenner et al., 1984;

Colon et al., 1989). Relaxin can increase the fertilization of oocytes by sperm of suboptimal quantity or motility (Han et al., 2006; Park et al., 1988). Relaxin knockout studies have also suggested a role for relaxin in prostate development in mice; prostate weight is lower in relaxin knockout mice more than three months old than in wild type controls (Samuel et al., 2003). Also, these mice had increased collagen levels in the prostate, testes, and epididymis. In all tissues examined, the relaxin deficient mice had a denser extracellular matrix, suggesting a decrease in MMP production (Samuel et al,

2003).

21 Various functions in cancer

Relaxin is present in normal and neoplastic breast tissue (Tashima et al., 1994).

In breast cancer cell lines, relaxin increased invasive potential of MCF-7 and SK-BR3, through increased production of MMP-2, -7, and -9 (Binder et al., 2002). Previous studies found relaxin to have a biphasic effect on proliferation and differentiation of

MCF-7 cells in vitro and in xenografts in vivo (Bani et al., 1999b; Bigazzi et al., 1992;

Sacchi et al., 1994). Relaxin overexpression in a canine mammary cell line, CF33.Mt, increased cell motility, but did not affect mitogenesis (Silvertown et al., 2003). These results indicate that relaxin increases invasive potential without increasing proliferation.

Furthermore, relaxin serum levels are elevated in breast cancer patients with metastases, and patients with elevated serum levels of relaxin had decreased overall survival compared to patients with no detectable serum relaxin (Binder et al., 2004). Since serum relaxin is elevated in breast cancer patients with metastases, this hormone may be involved in promoting an invasive phenotype through increased MMPs (Binder et al.,

2004).

Relaxin has clearly been characterized to be expressed and function in the reproductive tissues (Bani, 1997; Gunnersen et al., 1995; Hall et al., 1990; Lenhart et al.,

2002; Schmidt et al., 1984). A survey of relaxin expression in normal and cancerous gynecological tissues indicated relaxin was expressed in the normal endometrium, hydatiform mole, and choriocarcinoma, but was not detectable in cervical adencarcinoma, ovarian cystadenocarcinomas, or endometrial adenocarcinoma (Yki-

Jarvinen et al., 1983). The absence of relaxin expression in endometrial cancer is

22 surprising given that relaxin is mitogenic to normal endometrial tissue (Yki-Jarvinen et al., 1983). However, Kamat et al (2006) found relaxin is expressed in 67% of high grade tumours, and 37% of low grade tumours, indicating that the small sample size (n=10) in the original study may have precluded detection of relaxin-expressing endometrial carcinomas (Yki-Jarvinen et al., 1983). Similar to the function of relaxin expression in mammary carcinoma, relaxin appears to increase invasion of endometrial cell lines through increased levels of MMP-2 and MMP-9, and is associated with invasive phenotype of endometrial carcinoma (Kamat et al., 2006).

Recently, it was shown that relaxin is produced in thyroid carcinoma cell lines, and overexpression of relaxin in these cell lines causes increased migration, without increasing proliferation, in keeping with results seen in other tissues (Hombach-Klonisch et al., 2006). Interestingly, the increased migratory potential was attributed to a novel target of relaxin, cathepsin-L and cathepsin-D (Hombach-Klonisch et al., 2006), which increases invasiveness in several cancer cell lines (Akiharu Dohchin, 2000; Kirschke et al, 2000).

Turning the field of relaxin in cancer on its head, Kim et al (Kim et al., 2006) have cloned relaxin into a lytic adenovirus to enhance the lytic properties of the virus.

The results of this are twofold: 1) relaxin expression appears to increase apoptosis in 3 cell lines, using this system, and 2) relaxin expression results in decreased collagen content, facilitating increased transmission of the virus throughout tumours. This novel combination treatment abrogates lung metastases of mice with C33A or A375-mlnl.luc

(Ganesh et al., 2007) tumours, and completely inhibits tumour growth by the Hepl hepatocellular carcinoma (Kim et al, 2006). This does not indicate that relaxin itself

23 increases apoptosis; rather, relaxin upregulates collagenase activity to increase the lytic properties of this particular virus.

1.3 Hypothesis

Relaxin is involved in the activation of key pathways involved in invasion and angiogenesis during the progression of androgen independent prostate cancer, and therefore may be a suitable target for therapy.

1.4 Objectives

Objective 1. To characterize androgen regulation of relaxin

Preliminary research indicated that relaxin transcription was affected by androgens. Surprisingly, very little is known about the transcriptional regulation of relaxin, especially in the human prostate. The effect of androgens on relaxin levels in prostate cancer is important for those patients who receive androgen withdrawal therapy.

The work of Chapter 2 characterizes androgen effects on relaxin transcription, and the relevance of this work to prostate cancer.

Objective 2. To identify novel pathways regulated by relaxin in prostate cancer

Much work has been done to characterize relaxin, and it is established that relaxin causes an increase in migration and invasiveness in various cancers, although exactly how relaxin affects each cancer differs based on tissue type. cDNA microarray technology is an exciting opportunity to explore novel pathways regulated in prostate cancer by relaxin. One novel pathway regulated by relaxin involves upregulation of

24 Wntl 1 and PCDH11Y, two genes negatively regulated by androgens, similar to relaxin.

Chapter 3 describes the upregulation of the Wntl 1/PCDH11Y pathway by relaxin in prostate cancer.

Additional analysis of the cDNA microarray data indicated that relaxin altered

IRS-2 levels. IRS-2 is a signaling molecule for the insulin receptor and IGF-IR. IRS-2 was an attractive candidate gene to study for many reasons. 1) Relaxin and IGF-I are both part of the insulin superfamily. 2) Relaxin can cause an increase in IGF-I protein or mRNA, depending on the tissue. 3) The signaling pathway of relaxin itself is not fully characterized. Chapter 4 describes a role for IRS-2 in androgen signaling in IGF-I stimulated prostate cancer cells.

These studies identify the dysregualtion of relaxin expression in prostate cancer progression and characterize some of the downstream pathways regulated by relaxin in prostate cancer.

25 1.5 References

Akiharu Dohchin, J.-i.S., Hideyuki Seki, Manabu Masutani, Hiroshi Shiroto, Yoshikazu Kawakami,. 2000. Immunostained cathepsins B and L correlate with depth of invasion and different metastatic pathways in early stage gastric carcinoma. Cancer. 89:482-487. Ayyathurai, R., K. Ananfhakrishnan, R. Rajasundaram, R.J. Knight, H. Toussi, and V. Srinivasan. 2006. Predictive ability of partin tables 2001 in a Welsh population. Urol Int. 76:217-22. Bagi, CM. 2005. Targeting of therapeutic agents to bone to treat metastatic cancer. Adv Drug Deliv Rev. 57:995-1010. Bagnell, C.A., Q. Zhang, B. Downey, and L. Ainsworth. 1993. Sources and biological actions of relaxin in pigs. J Reprod Fertil Suppl. 48:127-38. Bani, D. 1997. Relaxin: a pleiotropic hormone. Gen Pharmacol. 28:13-22. Bani, D., M.C. Baccari, S. Nistri, F. Calamai, M. Bigazzi, and T.B. Sacchi. 1999a. Relaxin up-regulates the nitric oxide biosynthetic pathway in the mouse uterus: involvement in the inhibition of myometrial contractility. Endocrinology. 140:4434-41. Bani, D., D. Flagiello, M.F. Poupon, S. Nistri, F. Poirson-Bichat, M. Bigazzi, and T. Bani Sacchi. 1999b. Relaxin promotes differentiation of human breast cancer cells MCF-7 transplanted into nude mice. Virchows Arch. 435:509-19. Bani, D., E. Masini, M.G. Bello, M. Bigazzi, and T.B. Sacchi. 1998. Relaxin protects against myocardial injury caused by ischemia and reperfusion in rat heart. Am J ' Pathol. 152:1367-76. Bartsch, O., B. Bartlick, and R. Ivell. 2001. Relaxin signalling links tyrosine phosphorylation to phosphodiesterase and adenylyl cyclase activity. Mol Hum Reprod. 7:799-809. Bathgate, R.A., R. Ivell, B.M. Sanborn, O.D. Sherwood, and R.J. Summers. 2006. International Union of Pharmacology LVII: Recommendations for the Nomenclature of Receptors for Relaxin Family Peptides. Pharmacol Rev. 58:7- 31. Bell, R.J., L.W. Eddie, A.R. Lester, E.C. Wood, P.D. Johnston, and H.D. Niall. 1987. Relaxin in human pregnancy serum measured with an homologous radioimmunoassay. Obstet Gynecol. 69:585-9. Berger, R., D.I. Lin, M. Nieto, E. Sicinska, L.A. Garraway, H. Adams, S. Signoretti, W.C. Hahn, and M. Loda. 2006. Androgen-dependent regulation of Her-2/neu in prostate cancer cells. Cancer Res. 66:5723-8. Bernacki, S.H., A. Medvedev, G. Holloway, M. Dawson, R. Lotan, and A.M. Jetten. 1998. Suppression of relaxin gene expression by retinoids in squamous differentiated rabbit tracheal epithelial cells. Mol Cell Endocrinol. 138:115-25. Bigazzi, M., M.L. Brandi, G. Bani, and T.B. Sacchi. 1992. Relaxin influences the growth of MCF-7 breast cancer cells. Mitogenic and antimitogenic action depends on peptide concentration. Cancer. 70:639-43.

26 Binder, C, T. Hagemann, B. Husen, M. Schulz, and A. Einspanier. 2002. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod. 8:789-96. Binder, C, A. Simon, L. Binder, T. Hagemann, M. Schulz, G. Emons, L. Trumper, and A. Einspanier. 2004. Elevated concentrations of serum relaxin are associated with metastatic disease in breast cancer patients. Breast Cancer Res Treat. 87:157-66. Bogie, L.V., M. Mandel, and G.D. Bryant-Greenwood. 1995. Relaxin gene expression in human reproductive tissues by in situ hybridization. J Clin Endocrinol Metab. 80:130-7. Braddon, S.A. 1978. Relaxin-dependent adenosine 6',5'-monophosphate concentration ' changes in the mouse pubic symphysis. Endocrinology. 102:1292-9. Brawer, M.K. 2006. Hormonal therapy for prostate cancer. Rev Urol. 8 Suppl 2:S35-47. Brenner, S.H., J.B. Lessing, C. Schoenfeld, R.D. Amelar, L. Dubin, and G. Weiss. 1984. Stimulation of human sperm cervical mucus penetration in vitro by relaxin. Fertil Steril. 42:92-6. Brookes, D.E., D. Zandvliet, F. Watt, P.J. Russell, and P.L. Molloy. 1998. Relative activity and specificity of promoters from prostate-expressed genes. Prostate. 35:18-26. Brooks, J.D., M. Weinstein, X. Lin, Y. Sun, S.S. Pin, G.S. Bova, J.I. Epstein, W.B. Isaacs, and W.G. Nelson. 1998. CG island methylation changes near the GSTP1 gene in prostatic intraepithelial neoplasia. Cancer Epidemiol Biomarkers Prev. 7:531-6. Bruchovsky, N., L. Klotz, J. Crook, S. Malone, C. Ludgate, W.J. Morris, M.E. Gleave, and S.L. Goldenberg. 2006. Final results of the Canadian prospective phase II trial of intermittent androgen suppression for men in biochemical recurrence after radiotherapy for locally advanced prostate cancer: clinical parameters. Cancer. 107:389-95. Bryant-Greenwood, G.D., E.M. Rutanen, S. Partanen, T.K. Coelho, and S.Y. Yamamoto. 1993. Sequential appearance of relaxin, prolactin and IGFBP-1 during growth and differentiation of the human endometrium. Mol Cell Endocrinol. 95:23-9. Burazin, T., Davern, PJ, McKinley, MJ, Tregear, GW. 2000. Identification of relaxin and relaxin responsive cells in the rat brain. In Third international conference on relaxin and related peptides. Vol. 1. G. Tregear, Ivel R, Bathgate, RA, Wade, JD, editor, Broome Australia. 209-214. Canada, N.C.I.o. 2007. National Cancer Institute of Canada: Canadian Cancer Statistics 2007, Toronto, Canada. Canova-Davis, E., T.J. Kessler, P.J. Lee, D.T. Fei, P. Griffin, J.T. Stults, J.D. Wade, and E. Rinderknecht. 1991. Use of recombinant DNA derived human relaxin to probe the structure of the native protein. Biochemistry. 30:6006-13. Cheah, S.H., and O.D. Sherwood. 1980. Target tissues for relaxin in the rat: tissue distribution of injected 1251-labeled relaxin and tissue changes in adenosine 3',5'- monophosphate levels after in vitro relaxin incubation. Endocrinology. 106:1203-9. Chi, K.N., M.E. Gleave, R. Klasa, N. Murray, C. Bryce, D.E. Lopes de Menezes, S. D'Aloisio, and A.W. Tolcher. 2001. A phase I dose-finding study of combined

27 treatment with an antisense Bcl-2 oligonucleotide (Genasense) and mitoxantrone in patients with metastatic hormone-refractory prostate cancer. Clin Cancer Res. 7:3920-7. Chokkalingam, A.P., O. Nyren, J.E. Johansson, G. Gridley, J.K. McLaughlin, H.O. Adami, and A.W. Hsing. 2003. Prostate carcinoma risk subsequent to diagnosis of benign prostatic hyperplasia: a population-based cohort study in Sweden. Cancer. 98:1727-34. Colon, J., N. Santoro, L. Goldsmith, R. Whitcomb, D. Musket, and G. Weiss. 1994. Relaxin secretion into human semen independent of gonadotropin stimulation. Biol Reprod. 50:187-192. Colon, J.M., C. Gagliardi, C. Schoenfeld, R.D. Amelar, L. Dubin, and G. Weiss. 1989. Human relaxin stimulates human sperm penetration of bovine cervical mucus. Fertil Steril. 52:340-2. Craft, N., Y. Shostak, M. Carey, and C.L. Sawyers. 1999. A mechanism for hormone- independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med. 5:280-5. Culig, Z., A. Hobisch, M.V. Cronauer, C. Radmayr, J. Trapman, A. Hittmair, G. Bartsch, and H. Klocker. 1994. Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res. 54:5474-8. Danielson, L.A., O.D. Sherwood, and K.P. Conrad. 1999. Relaxin is a potent renal vasodilator in conscious rats. J Clin Invest. 103:525-33. Dearth, R.K., X. Cui, H.J. Kim, D.L. Hadsell, and A.V. Lee. 2007. Oncogenic transformation by the signaling adaptor proteins insulin receptor substrate (IRS)- 1 and IRS-2. Cell Cycle. 6:705-13. Debruyne, F.M. 2004. Gonadotropin-releasing hormone antagonist in the management of prostate cancer. Rev Urol. 6 Suppl 7:S25-32. Dessauer, C.W., and B.T. Nguyen. 2005. Relaxin stimulates multiple signaling pathways: activation of cAMP, PI3K, and PKCzeta in THP-1 cells. Ann N Y Acad Sci. 1041:272-9. Dschietzig, T., C. Bartsch, C. Richter, M. Laule, G. Baumann, and K. Stangl. 2003. Relaxin, a pregnancy hormone, is a functional endothelin-1 antagonist: attenuation of endothelin-1-mediated vasoconstriction by stimulation of endothelin type-B receptor expression via ERK-1/2 and nuclear factor-kappaB. CircRes. 92:32-40. Dubois, M.P., and J.L. Dacheux. 1978. Relaxin, a male hormone? Immunocytological localization of a related antigen in the boar testis. Cell Tissue Res. 187:201-14. Eddie, L.W., R.J. Bell, A. Lester, M. Geier, G. Bennett, P.D. Johnston, and H.D. Niall. 1986. Radioimmunoassay of relaxin in pregnancy with an analogue of human relaxin. Lancet. 1:1344-6. Eigenbrot, C, M. Randal, C. Quan, J. Burnier, L. O'Connell, E. Rinderknecht, and A.A. Kossiakoff. 1991. X-ray structure of human relaxin at 1.5 A. Comparison to insulin and implications for receptor binding determinants. J Mol Biol. 221:15- 21. Essig, M., C. Schoenfeld, R.D. Amelar, L. Dubin, and G. Weiss. 1982a. Stimulation of human sperm motility by relaxin. Fertil Steril. 38:339-43.

28 Essig, M., C. Schoenfeld, R.T. D'Eletto, R. Amelar, B.G. Steinetz, E.M. O'Byrne, and G. Weiss. 1982b. Relaxin in human seminal plasma. Ann N Y Acad Sci. 380:224-30. Farla, P., R. Hersmus, J. Trapman, and A.B. Houtsmuller. 2005. Antiandrogens prevent stable DNA-binding of the androgen receptor. J Cell Sci. 118:4187-98. Fei, D.T., M.C. Gross, J.L. Lofgren, M. Mora-Worms, and A.B. Chen. 1990. Cyclic AMP response to recombinant human relaxin by cultured human endometrial cells—a specific and high throughput in vitro bioassay. Biochem Biophys Res Commun. 170:214-22. Feldman, B.J., and D. Feldman. 2001. The development of androgen-independent prostate cancer. Nat Rev Cancer. 1:34-45. Fevold, H.L., F.L. Hisaw, and R.K. Meyer. 1930. The relaxative hormone of the corpus luteum. Its purification and concentration. J. Am. Chem. Soc. 52:3340-3348. Furr, B.J., and H. Tucker. 1996. The preclinical development of bicalutamide: pharmacodynamics and mechanism of action. Urology. 47:13-25; discussion 29- 32. Ganesh, S., M. Gonzalez Edick, N. Idamakanti, M. Abramova, M. Vanroey, M. Robinson, CO. Yun, and K. Jooss. 2007. Relaxin-expressing, fiber chimeric oncolytic adenovirus prolongs survival of tumor-bearing mice. Cancer Res. 67:4399-407. Gao, J., J. Mazella, and L. Tseng. 1995. Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line. Mol Endocrinol. 9:1405-12. Gao, J.G., J. Mazella, and L. Tseng. 1994. Activation of the human IGFBP-1 gene promoter by progestin and relaxin in primary culture of human endometrial stromal cells. Mol Cell Endocrinol. 104:39-46. Garibay-Tupas, J.L., K.J. Okazaki, L.S. Tashima, S. Yamamoto, and G.D. Bryant- Greenwood. 2004. Regulation of the human relaxin genes HI and H2 by steroid hormones. Mol Cell Endocrinol. 219:115-25. Gast, M.J. 1982. Studies of luteal generation and processing of the high molecular weight relaxin precursor. Ann N YAcad Sci. 380:111-25. Gavino, E.S., and D.E. Furst. 2001. Recombinant relaxin: a review of pharmacology and potential therapeutic use. BioDrugs. 15:609-14. Girling, J.E., and P.A. Rogers. 2005. Recent advances in endometrial angiogenesis research. Angiogenesis. 8:89-99. Gleason, D.F., and G.T. Mellinger. 1974. Prediction of prognosis for prostatic adenocarcinoma by combined histological grading and clinical staging. J Urol. 111:58-64. Gleave, M., A. Tolcher, H. Miyake, C. Nelson, B. Brown, E. Beraldi, and J. Goldie. 1999. Progression to androgen independence is delayed by adjuvant treatment with antisense Bcl-2 oligodeoxynucleotides after castration in the LNCaP prostate tumor model. Clin Cancer Res. 5:2891-8. Goldenberg, S.L., N. Bruchovsky, M.E. Gleave, L.D. Sullivan, and K. Akakura. 1995. Intermittent androgen suppression in the treatment of prostate cancer: a preliminary report. Urology. 45:839-44; discussion 844-5. Goldsmith, L.T., and G. Weiss. 2005. Relaxin regulates endometrial structure and function in the rhesus monkey. Ann N YAcad Sci. 1041:110-7.

29 Grignon, D.J., R. Caplan, F.H. Sarkar, C.A. Lawton, E.H. Hammond, M.V. Pilepich, J.D. Forman, J. Mesic, K.K. Fu, R.A. Abrams, T.F. Pajak, W.U. Shipley, and J.D. Cox. 1997. p53 status and prognosis of locally advanced prostatic adenocarcinoma: a study based on RTOG 8610. J Natl Cancer Inst. 89:158-65. Gudmundsson, J., P. Sulem, A. Manolescu, L.T. Amundadottir, D. Gudbjartsson, A. Helgason, T. Rafnar, J.T. Bergthorsson, B.A. Agnarsson, A. Baker, A. Sigurdsson, K.R. Benediktsdottir, M. Jakobsdottir, J. Xu, T. Blondal, J. Kostic, J. Sun, S. Ghosh, S.N. Stacey, M. Mouy, J. Saemundsdottir, V.M. Backman, K. Kristjansson, A. Tres, A.W. Partin, M.T. Albers-Akkers, J. Godino-Ivan Marcos, P.C. Walsh, D.W. Swinkels, S. Navarrete, S.D. Isaacs, K.K. Aben, T. Graif, J. Cashy, M. Ruiz-Echarri, K.E. Wiley, B.K. Suarez, J.A. Witjes, M. Frigge, C. Ober, E. Jonsson, G.V. Einarsson, J.I. Mayordomo, L.A. Kiemeney, W.B. Isaacs, W.J. Catalona, R.B. Barkardottir, J.R. Gulcher, U. Thorsteinsdottir, A. Kong, and K. Stefansson. 2007. Genome-wide association study identifies a second prostate cancer susceptibility variant at 8q24. Nat Genet. 39:631-7. Guico-Lamm, M.L., and O.D. Sherwood. 1988. Monoclonal antibodies specific for rat relaxin. II. Passive immunization with monoclonal antibodies throughout the second half of pregnancy disrupts birth in intact rats. Endocrinology. 123:2479- 85. Gunnersen, J.M., R.J. Crawford, and G.W. Tregear. 1995. Expression of the relaxin gene in rat tissues. Mol Cell Endocrinol. 110:55-64. Gupta, S. 2006. Prostate cancer chemoprevention: Current status and future prospects. Toxicol Appl Pharmacol. Haiman, C.A., N. Patterson, M.L. Freedman, S.R. Myers, M.C. Pike, A. Waliszewska, J. Neubauer, A. Tandon, C. Schirmer, G.J. McDonald, S.C. Greenway, D.O. Stram, L. Le Marchand, L.N. Kolonel, M. Frasco, D. Wong, L.C. Pooler, K. Ardlie, I. Oakley-Girvan, A.S. Whittemore, K.A. Cooney, E.M. John, S.A. Ingles, D. Altshuler, B.E. Henderson, and D. Reich. 2007. Multiple regions within 8q24 independently affect risk for prostate cancer. Nat Genet. 39:638-44. Hall, J.A., T.C. Cantley, B.N. Day, and R.V. Anthony. 1990. Uterotropic actions of relaxin in prepubertal gilts. Biol Reprod. 42:769-74. Hall, J.A., T.C. Cantley, J.M. Galvin, B.N. Day, and R.V. Anthony. 1992. Influence of ovarian steroids on relaxin-induced uterine growth in ovariectomized gilts. Endocrinology. 130:3159-66. Halls, M.L., R.A. Bathgate, and R.J. Summers. 2005. Signal switching after stimulation of LGR7 receptors by human relaxin 2. Ann N YAcad Sci. 1041:288-91. Halls, M.L., R.A.D. Bathgate, and R.J. Summers. 2006. Relaxin Family Peptide Receptors RXFP1 and RXFP2 Modulate cAMP Signaling by Distinct Mechanisms. Mol Pharmacol. 70:214-226. Han, Y.J., A.G. Miah, M. Yoshida, H. Sasada, K. Hamano, T. Kohsaka, and H. Tsujii. 2006. Effect of relaxin on in vitro fertilization of porcine oocytes. J Reprod Dev. 52:657-62. Hisaw, F.L. 1926. Experimental relaxation of the pubic ligament of the guinea pig. Proc Soc Exp Biol Med. 23:661 -663. Hoedemaeker, R.F., A.N. Vis, and T.H. Van Der Kwast. 2000. Staging prostate cancer. Microsc Res Tech. 51:423-9.

30 Hombach-Klonisch, S., J. Bialek, B. Trojanowicz, E. Weber, H.-J. Holzhausen, J.D. Silvertown, A.J. Summerlee, H. Dralle, C. Hoang-Vu, and T. Klonisch. 2006. Relaxin Enhances the Oncogenic Potential of Human Thyroid Carcinoma Cells. Am J Pathol. 169:617-632. Hornsby, D.J., B.C. Wilson, and A.J. Summerlee. 2001. Relaxin and drinking in pregnant rats. Prog Brain Res. 133:229-40. Hsu, S.Y., M. Kudo, T. Chen, K. Nakabayashi, A. Bhalla, P.J. van der Spek, M. van Duin, and A.J. Hsueh. 2000. The three subfamilies of leucine-rich repeat- containing G protein-coupled receptors (LGR): identification of LGR6 and LGR7 and the signaling mechanism for LGR7. Mol Endocrinol. 14:1257-71. Hsu, S.Y., K. Nakabayashi, S. Nishi, J. Kumagai, M. Kudo, O.D. Sherwood, and A.J. Hsueh. 2002. Activation of orphan receptors by the hormone relaxin. Science. 295:671-4. Huang, C, Y. Li, and L.L. Anderson. 1993. Stimulation of collagen secretion by relaxin and effect of oestrogen on relaxin binding in uterine cervical cells of pigs. J Reprod Fertil. 98:153-8. Huang, C.J., Y. Li, M.H. Stromer, and L.L. Anderson. 1992. Synergistic effects of insulin-like growth factor I and gonadotrophins on relaxin and progesterone secretion by ageing corpora lutea of pigs. J Reprod Fertil. 96:415-25. Hudson, P., J. Haley, M. John, M. Cronk, R. Crawford, J. Haralambidis, G. Tregear, J. Shine, and H. Niall. 1983. Structure of a genomic clone encoding biologically active human relaxin. Nature. 301:628-31. Hudson, P., M. John, R. Crawford, J. Haralambidis, D. Scanlon, J. Gorman, G. Tregear, J. Shine, and H. Niall. 1984. Relaxin gene expression in human ovaries and the predicted structure of a human preprorelaxin by analysis of cDNA clones. Embo J. 3:2333-9. Huggins, C, and CV. Hodges. 1941. Studies on prostatic cancer. I. The effect of castration, estrogen and androgen injection on serum phosphatases in metastatic carcinoma of the prostate. Cancer Research. 1:293-297. Hughes, S.J., and M. Hollingsworth. 1997. Relaxin as a relaxant of the isolated rat uterus: comparison with its mechanism of action in vivo. Gen Pharmacol. 29:829-33. Humphrey, P.A. 2004. Gleason grading and prognostic factors in carcinoma of the prostate. Mod Pathol. 17:292-306. Hwang, J.J., A.B. Lee, P.A. Fields, L.M. Haab, L.E. Mojonnier, and O.D. Sherwood. 1991. Monoclonal antibodies specific for rat relaxin. V. Passive immunization with monoclonal antibodies throughout the second half of pregnancy disrupts development of the mammary apparatus and, hence, lactational performance in rats. Endocrinology. 129:3034-42. Hwang, J.J., D. Macinga, and E.A. Rorke. 1996. Relaxin modulates human cervical stromal cell activity. J Clin Endocrinol Metab. 81:3379-84. Hwang, J.J., R.D. Shanks, and O.D. Sherwood. 1989. Monoclonal antibodies specific for rat relaxin. IV. Passive immunization with monoclonal antibodies during the antepartum period reduces cervical growth and extensibility, disrupts birth, and reduces pup survival in intact rats. Endocrinology. 125:260-6.

31 Hwang, J.J., and O.D. Sherwood. 1988. Monoclonal antibodies specific for rat relaxin. III. Passive immunization with monoclonal antibodies throughout the second half of pregnancy reduces cervical growth and extensibility in intact rats. Endocrinology. 123:2486-90. Isaacs, J.T. 1999. The biology of hormone refractory prostate cancer. Why does it develop? Urol Clin North Am. 26:263-73. Ivell, R., and A. Einspanier. 2002. Relaxin peptides are new global players. Trends Endocrinol Metab. 13:343-8. Ivell, R., N. Hunt, F. Khan-Dawood, and M.Y. Dawood. 1989. Expression of the human relaxin gene in the corpus luteum of the menstrual cycle and in the prostate. Mol Cell Endocrinol. 66:251-5. Jin-Tang Dong. 2006. Prevalent mutations in prostate cancer. Journal of Cellular Biochemistry. 97:433-447. Kamat, A.A., S. Feng, I.U. Agoulnik, F. Kheradmand, N.V. Bogatcheva, D. Coffey, A.K. Sood, and A.I. Agoulnik. 2006. The role of relaxin in endometrial cancer. Cancer Biol Ther. 5:71-7. Kass, L., J.G. Ramos, H.H. Ortega, G.S. Montes, L.E. Bussmann, E.H. Luque, and M. Munoz de Toro. 2001. Relaxin has a minor role in rat mammary gland growth and differentiation during pregnancy. Endocrine. 15:263-9. Key, T. 1995. Risk factors for prostate cancer. Cancer Surv. 23:63-77. Kim, J.H., Y.S. Lee, H. Kim, J.H. Huang, A.R. Yoon, and CO. Yun. 2006. Relaxin expression from tumor-targeting adenoviruses and its intratumoral spread, apoptosis induction, and efficacy. JNatl Cancer Inst. 98:1482-93. Kirschke, H., R. Eerola, V.K. Hopsu-Havu, D. Bromme, and E. Vuorio. 2000. Antisense RNA inhibition of cathepsin L expression reduces tumorigenicity of malignant cells. Eur J Cancer. 36:787-95. Klein, E.A. 1995. An update on prostate cancer. Cleve Clin J Med. 62:325-38. Koay, E.S., C.A. Bagnell, G.D. Bryant-Greenwood, S.B. Lord, A.C Cruz, and L.H. Larkin. 1985. Immunocytochemical localization of relaxin in human decidua and placenta. J Clin Endocrinol Metab. 60:859-63. Koivisto, P., J. Kononen, C. Palmberg, T. Tammela, E. Hyytinen, J. Isola, J. Trapman, K. Cleutjens, A. Noordzij, T. Visakorpi, and O.P. Kallioniemi. 1997. Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res. 57:314-9. Krajnc-Franken, M.A.M., A.J.M. van Disseldorp, J.E. Koenders, S. Mosselman, M. van Duin, and J.A. Gossen. 2004. Impaired Nipple Development and Parturition in LGR7 Knockout Mice. Mol. Cell. Biol. 24:687-696. Kramer, S.M., U.E. Gibson, B.M. Fendly, M.A. Mohler, D.W. Drolet, and P.D. Johnston. 1990. Increase in cyclic AMP levels by relaxin in newborn rhesus monkey uterus cell culture. In Vitro Cell Dev Biol. 26:647-56. Krantz, J.C, Jr., H.H. Bryant, and CJ. Carr. 1950. The action of aqueous corpus luteum extract upon uterine activity. Surg Gynecol Obstet. 90:372-5. Kuenzi, M.J., and O.D. Sherwood. 1992. Monoclonal antibodies specific for rat relaxin. VII. Passive immunization with monoclonal antibodies throughout the second half of pregnancy prevents development of normal mammary nipple morphology and function in rats. Endocrinology. 131:1841-7.

32 Kumagai, J., S.Y. Hsu, H. Matsumi, J.-S. Roh, P. Fu, J.D. Wade, R.A.D. Bathgate, and A.J.W. Hsueh. 2002. INSL3/Leydig Insulin-like Peptide Activates the LGR8 Receptor Important in Testis Descent. J. Biol. Chem. 277:31283-31286. Lee, A.B., J.J. Hwang, L.M. Haab, P.A. Fields, and O.D. Sherwood. 1992. Monoclonal antibodies specific for rat relaxin. VI. Passive immunization with monoclonal antibodies throughout the second half of pregnancy disrupts histological changes associated with cervical softening at parturition in rats. Endocrinology. 130:2386-91. Lee, W.H., R.A. Morton, J.I. Epstein, J.D. Brooks, P.A. Campbell, G.S. Bova, W.S. Hsieh, W.B. Isaacs, and W.G. Nelson. 1994. Cytidine methylation of regulatory sequences near the pi-class glutathione S-transferase gene accompanies human prostatic carcinogenesis. Proc Natl Acad Sci U S A. 91:11733-7. Lenhart, J.A., P.L. Ryan, K.M. Ohleth, S.S. Palmer, and CA. Bagnell. 2002. Relaxin increases secretion of tissue inhibitor of matrix metalloproteinase-1 and -2 during uterine and cervical growth and remodeling in the pig. Endocrinology. 143:91-8. Lessing, J.B., S.H. Brenner, J.M. Colon, F.W. Ginsburg, C. Schoenfeld, L.T. Goldsmith, P. Sarosi, R.D. Amelar, L. Dubin, and G. Weiss. 1986. Effect of relaxin on human spermatozoa. J Reprod Med. 31:304-9. Lessing, J.B., S.H. Brenner, C. Schoenfeld, P. Sarosi, R. Amelar, L. Dubin, and G. Weiss. 1984. The effect of an anti-insulin antiserum on human sperm motility. Fertil Steril. 42:309-11. Li, J., C. Yen, D. Liaw, K. Podsypanina, S. Bose, S.I. Wang, J. Puc, C. Miliaresis, L. Rodgers, R. McCombie, S.H. Bigner, B.C. Giovanella, M. Ittmann, B. Tycko, H. Hibshoosh, M.H. Wigler, and R. Parsons. 1997. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science. 275:1943-7. Loumaye, E., S. De Cooman, and K. Thomas. 1980. Immunoreactive relaxin-like substance in human seminal plasma. J Clin Endocrinol Metab. 50:1142-3. MacLennan, A.H., R. Nicolson, and R.C. Green. 1986a. Serum relaxin in pregnancy. Lancet. 2:241-3. MacLennan, A.H., R. Nicolson, R.C Green, and M. Bath. 1986b. Serum relaxin and pelvic pain of pregnancy. Lancet. 2:243-5. Masini, E., D. Bani, M.G. Bello, M. Bigazzi, P.F. Mannaioni, and T.B. Sacchi. 1997. Relaxin counteracts myocardial damage induced by ischemia-reperfusion in isolated guinea pig hearts: evidence for an involvement of nitric oxide. Endocrinology. 138:4713-20. Masini, E., D. Bani, M. Bigazzi, P.F. Mannaioni, and T. Bani-Sacchi. 1994. Effects of relaxin on mast cells. In vitro and in vivo studies in rats and guinea pigs. J Clin Invest. 94:1974-80. Masini, E., M.G. Di Bello, D. Bani, M. Bigazzi, T. Bani Sacchi, and P.F. Mannaioni. 1995. Relaxin inhibits histamine release from mast cells: involvement of nitric oxide production. Inflamm Res. 44 Suppl l:S12-3. Masini, E., G. Zagli, J.F. Ndisang, M. Solazzo, P.F. Mannaioni, and D. Bani. 2002. Protective effect of relaxin in cardiac anaphylaxis: involvement of the nitric oxide pathway. Br J Pharmacol. 137:337-44.

33 Masterson, R., T.D. Hewitson, K. Kelynack, M. Martic, L. Parry, R. Bathgate, I. Darby, and G. Becker. 2004. Relaxin down-regulates renal fibroblast function and promotes matrix remodelling in vitro. Nephrol. Dial. Transplant. 19:544-552. Millar, D.S., K.K. Ow, C.L. Paul, P.J. Russell, P.L. Molloy, and S.J. Clark. 1999. Detailed methylation analysis of the glutathione S-transferase pi (GSTP1) gene in prostate cancer. Oncogene. 18:1313-24. Min, G., M.G. Hartzog, R.L. Jennings, R.J. Winn, and O.D. Sherwood. 1997. Evidence that endogenous relaxin promotes growth of the vagina and uterus during pregnancy in gilts. Endocrinology. 138:560-5. Moore, X.-l., S.-l. Tan, C.-y. Lo, L. Fang, Y.-D. Su, X.-M. Gao, E.A. Woodcock, R.J. Summers, G.W. Tregear, R.A.D. Bathgate, and X.-J. Du. 2007. Relaxin Antagonizes Hypertrophy and Apoptosis in Neonatal Rat Cardiomyocytes. Endocrinology. 148:1582-1589. Morton, R.A., Jr. 1994. Racial differences in adenocarcinoma of the prostate in North American men. Urology. 44:637-45. Ndisang, J.F., R. Baronti, G. Cecere, E. Masini, D. Bani, and P.F. Mannaioni. 2001. Relaxin generates nitric oxide and provides protection against cardiac anaphylaxis. Inflamm Res. 50 Suppl 2:S122-3. Nguyen, B.T., and C.W. Dessauer. 2005. Relaxin stimulates protein kinase C zeta translocation: requirement for cyclic adenosine 3',5'-monophosphate production. Mol Endocrinol. 19:1012-23. Ohleth, K.M., and CA. Bagnell. 1999. Relaxin secretion and gene expression in porcine granulosa and theca cells are stimulated during in vitro luteinization. Biol Reprod. 60:499-507. Ohleth, K.M., J.A. Lenhart, P.L. Ryan, S.V. Radecki, and CA. Bagnell. 1997. Relaxin increases insulin-like growth factors (IGFs) and IGF-binding proteins of the pig uterus in vivo. Endocrinology. 138:3652-8. Osheroff, P.L., M.J. Cronin, and J.A. Lofgren. 1992. Relaxin binding in the rat heart atrium. Proc Natl Acad Sci USA. 89:2384-8. Osheroff, P.L., and W.H. Ho. 1993. Expression of relaxin mRNA and relaxin receptors in postnatal and adult rat brains and hearts. Localization and developmental patterns. J Biol Chem. 268:15193-9. Osheroff, P.L., V.T. Ling, R.L. Vandlen, M.J. Cronin, and J.A. Lofgren. 1990. Preparation of biologically active 32P-labeled human relaxin. Displaceable binding to rat uterus, cervix, and brain. J Biol Chem. 265:9396-401. Osheroff, P.L., and H.S. Phillips. 1991. Autoradiographic localization of relaxin binding sites in rat brain. Proc Natl Acad Sci USA. 88:6413-7. Palejwala, S., D.E. Stein, G. Weiss, B.P. Monia, D. Tortoriello, and L.T. Goldsmith. 2001. Relaxin positively regulates matrix metalloproteinase expression in human lower uterine segment fibroblasts using a tyrosine kinase signaling pathway. Endocrinology. 142:3405-13. Palejwala, S., L. Tseng, A. Wojtczuk, G. Weiss, and L.T. Goldsmith. 2002. Relaxin gene and protein expression and its regulation of procollagenase and vascular endothelial growth factor in human endometrial cells. Biol Reprod. 66:1743-8.

34 Pardo, R., L.H. Larkin, and P.A. Fields. 1980. Immunocytochemical localization of relaxin in endometrial glands of the pregnant guinea pig. Endocrinology. 107:2110-2. Pardo, R.J., and L.H. Larkin. 1982. Localization of relaxin in endometrial gland cells of pregnant, lactating, and ovariectomized hormone-treated guinea pigs. Am J Anat. 164:79-90. Pardo, R.J., L.H. Larkin, and R.H. Renegar. 1984. Immunoelectron microscopic localization of relaxin in endometrial gland cells of the pregnant guinea pig. Anat Rec. 209:373-9. Park, J.M., K. Ewing, F. Miller, C.I. Friedman, and M.H. Kim. 1988. Effects of relaxin on the fertilization capacity of human spermatozoa. Am J Obstet Gynecol. 158:974-9. Parsell, D.A., J.Y. Mak, E.P. Amento, and E.N. Unemori. 1996. Relaxin binds to and elicits a response from cells of the human monocytic cell line, THP-1. J Biol Chem. 271:27936-41. Partin, A.W., M.W. Kattan, E.N. Subong, P.C. Walsh, K.J. Wojno, J.E. Oesterling, P.T. Scardino, and J.D. Pearson. 1997. Combination of prostate-specific antigen, clinical stage, and Gleason score to predict pathological stage of localized prostate cancer. A multi-institutional update. Jama. 277:1445-51. Partin, A.W., L.A. Mangold, D.M. Lamm, P.C. Walsh, J.I. Epstein, and J.D. Pearson. 2001. Contemporary update of prostate cancer staging nomograms (Partin Tables) for the new millennium. Urology. 58:843-8. Perna, A.-M., E. Masini, S. Nistri, V. Briganti, L. Chiappini, P. Stefano, M. Bigazzi, C. Pieroni, T. Bani Sacchi, and D. Bani. 2005. Novel drug development opportunity for relaxin in acute myocardial infarction: evidences from a swine model. FASEB /.:04-3664fje. Peters, C.A., E.T. Maizels, M.C. Robertson, R.P. Shiu, M.S. Soloff, and M. Hunzicker- Dunn. 2000. Induction of relaxin messenger RNA expression in response to prolactin receptor activation requires protein kinase C delta signaling. Mol Endocrinol. 14:576-90. Platz, E.A. 2007. Genetic variation at 8q24 as a susceptibility factor for prostate cancer: definitive results from epidemiologic studies? Cancer Res. 67:2905-7. Ryan, P.L., D.L. Baum, J.A. Lenhart, K.M. Ohleth, and C.A. Bagnell. 2001. Expression of uterine and cervical epithelial cadherin during relaxin-induced growth in pigs. Reproduction. 122:929-37. Sacchi, T.B., D. Bani, M.L. Brandi, A. Falchetti, and M. Bigazzi. 1994. Relaxin influences growth, differentiation and cell-cell adhesion of human breast-cancer cells in culture. Int J Cancer. 57:129-34. Samuel, C.S., H. Tian, L. Zhao, and E.P. Amento. 2003. Relaxin is a key mediator of prostate growth and male reproductive tract development. Lab Invest. 83:1055- 67. Sarosi, P., C. Schoenfeld, J. Berman, R. Basch, G. Randolph, R. Amelar, L. Dubin, B.G. Steinetz, and G. Weiss. 1983. Effect of anti-relaxin antiserum on sperm motility in vitro. Endocrinology. 112:1860-1.

35 Schmidt, C.L., P. Sarosi, B.G. Steinetz, E.M. O'Byrne, J.E. Tyson, K. Horvath, M. Sas, and G. Weiss. 1984. Relaxin in human decidua and term placenta. Eur J Obstet Gynecol Reprod Biol. 17:171-82. Schumacher, F.R., H.S. Feigelson, D.G. Cox, CA. Haiman, D. Albanes, J. Buring, E.E. Calle, S.J. Chanock, G.A. Colditz, W.R. Diver, A.M. Dunning, M.L. Freedman, J.M. Gaziano, E. Giovannucci, S.E. Hankinson, R.B. Hayes, B.E. Henderson, R.N. Hoover, R. Kaaks, T. Key, L.N. Kolonel, P. Kraft, L. Le Marchand, J. Ma, M.C Pike, E. Riboli, M.J. Stampfer, D.O. Stram, G. Thomas, M.J. Thun, R. Travis, J. Virtamo, G. Andriole, E. Gelmann, W.C Willett, and D.J. Hunter. 2007. A common 8q24 variant in prostate and breast cancer from a large nested case-control study. Cancer Res. 67:2951-6. Schwabe, C, and E.E. Bullesbach. 1990. Relaxin. Comp Biochem Physiol B. 96:15-21. Schwabe, C, and J.K. McDonald. 1977. Relaxin: a disulfide homolog of insulin. Science. 197:914-5. Scott, D.J., S. Layfield, Y. Yan, S. Sudo, A.J. Hsueh, G.W. Tregear, and R.A. Bathgate. 2006. Characterization of novel splice variants of LGR7 and LGR8 reveals that receptor signaling is mediated by their unique low density lipoprotein class A modules. J Biol Chem. 281:34942-54. Seibold, J.R., J.H. Korn, R. Simms, P.J. Clements, L.W. Moreland, M.D. Mayes, D.E. Furst, N. Rothfield, V. Steen, M. Weisman, D. Collier, F.M. Wigley, P.A. Merkel, M.E. Csuka, V. Hsu, S. Rocco, M. Erikson, J. Hannigan, W.S. Harkonen, and M.E. Sanders. 2000. Recombinant human relaxin in the treatment of scleroderma. A randomized, double-blind, placebo-controlled trial. Ann Intern Med. 132:871-9. Sherwood, O.D., L.M. Olson, S. Zhao, and H.R. Little. 2000. Inhibition of nitric oxide synthase activity diminishes the acute effects of relaxin on growth, but not softening, of the cervix in the rat. Endocrinology. 141:2458-64. Silvertown, J.D., B.J. Geddes, and A.J. Summerlee. 2003. Adenovirus-mediated expression of human prorelaxin promotes the invasive potential of canine mammary cancer cells. Endocrinology. 144:3683-91. Sokol, R.Z., X.S. Wang, J. Lechago, P.D. Johnston, and R.S. Swerdloff. 1989. Immunohistochemical localization of relaxin in human prostate. J Histochem Cytochem. 37:1253-5. Soloff, M.S., S. Gal, S. Hoare, CA. Peters, M. Hunzicker-Dunn, G.D. Anderson, and T.G. Wood. 2003. Cloning, characterization, and expression of the rat relaxin gene. Gene. 323:149-55. Soloff, M.S., A.R. Shaw, L.E. Gentry, H. Marquardt, and P. Vasilenko. 1992. Demonstration of relaxin precursors in pregnant rat ovaries with antisera against bacterially expressed rat prorelaxin. Endocrinology. 130:1844-51. Steck, P.A., M.A. Pershouse, S.A. Jasser, W.K. Yung, H. Lin, A.H. Ligon, L.A. Langford, M.L. Baumgard, T. Hattier, T. Davis, C. Frye, R. Hu, B. Swedlund, D.H. Teng, and S.V. Tavtigian. 1997. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet. 15:356-62. Stults, J.T., J.H. Bourell, E. Canova-Davis, V.T. Ling, G.R. Laramee, J.W. Winslow, P.R. Griffin, E. Rinderknecht, and R.L. Vandlen. 1990. Structural

36 characterization by mass spectrometry of native and recombinant human relaxin. Biomed Environ Mass Spectrom. 19:655-64. Sudo, S., J. Kumagai, S. Nishi, S. Layfield, T. Ferraro, R.A. Bathgate, and A.J. Hsueh. 2003. H3 relaxin is a specific ligand for LGR7 and activates the receptor by interacting with both the ectodomain and the exoloop 2. J Biol Chem. 278:7855- 62. Sun, X., H.F. Frierson, C. Chen, C. Li, Q. Ran, K.B. Otto, B.L. Cantarel, R.L. Vessella, A. C. Gao, J. Petros, Y. Miura, J.W. Simons, and J.T. Dong. 2005. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer. Nat Genet. 37:407-12. Sunn, N., M. Egli, T.C. Burazin, P. Burns, L. Colvill, P. Davern, D.A. Denton, B.J. Oldfield, R.S. Weisinger, M. Rauch, H.A. Schmid, and M.J. McKinley. 2002. Circulating relaxin acts on subfornical organ neurons to stimulate water drinking in the rat. Proc Natl Acad Sci U S A. 99:1701-6. Sutton, S.W., P. Bonaventure, C. Kuei, D. Nepomuceno, J. Wu, J. Zhu, T.W. Lovenberg, and C. Liu. 2005. G-protein-coupled receptor (GPCR)-142 does not contribute to relaxin-3 binding in the mouse brain: further support that relaxin-3 is the physiological ligand for GPCR135. Neuroendocrinology. 82:139-50. Sutton, S.W., P. Bonaventure, C. Kuei, D. Nepomuceno, J. Wu, J. Zhu, T.W. Lovenberg, and C. Liu. 2006. G-Protein-Coupled Receptor (GPCR)-142 Does Not Contribute to Relaxin-3 Binding in the Mouse Brain: Further Support that Relaxin-3 Is the Physiological Ligand for GPCR135. Neuroendocrinology. 82:139-150. Suuriniemi, M., I. Agalliu, D.J. Schaid, B. Johanneson, S.K. McDonnell, L. Iwasaki, J/L. Stanford, and E.A. Ostrander. 2007. Confirmation of a Positive Association between Prostate Cancer Risk and a Locus at Chromosome 8q24. Cancer Epidemiol Biomarkers Prev. 16:809-814. Tammela, T. 2004. Endocrine treatment of prostate cancer. J Steroid Biochem Mol Biol. 92:287-95. Tang, M., J. Mazella, H.H. Zhu, and L. Tseng. 2005. Ligand activated relaxin receptor increases the transcription of IGFBP-1 and prolactin in human decidual and endometrial stromal cells. Mol Hum Reprod. 11:237-43. Tashima, L.S., G. Mazoujian, and G.D. Bryant-Greenwood. 1994. Human relaxins in normal, benign and neoplastic breast tissue. J Mol Endocrinol. 12:351-64. Unemori, E.N., and E.P. Amento. 1990. Relaxin modulates synthesis and secretion of procollagenase and collagen by human dermal fibroblasts. J Biol Chem. 265:10681-5. Unemori, E.N., M.E. Erikson, S.E. Rocco, K.M. Sutherland, D.A. Parsell, J. Mak, and B. H. Grove. 1999. Relaxin stimulates expression of vascular endothelial growth factor in normal human endometrial cells in vitro and is associated with menometrorrhagia in women. Hum Reprod. 14:800-6. Unemori, E.N., L.B. Pickford, A.L. Salles, C.E. Piercy, B.H. Grove, M.E. Erikson, and E.P. Amento. 1996. Relaxin induces an extracellular matrix-degrading phenotype in human lung fibroblasts in vitro and inhibits lung fibrosis in a murine model in vivo. J Clin Invest. 98:2739-45.

37 Varenhorst, E., L. Wallentin, and K. Carlstrom. 1982. The effects of orchidectomy, estrogens, and cyproterone acetate on plasma testosterone, LH, and FSH concentrations in patients with carcinoma of the prostate. Scand J Urol Nephrol. 16:31-6. Veldscholte, J., C.A. Berrevoets, C. Ris-Stalpers, G.G. Kuiper, G. Jenster, J. Trapman, A.O. Brinkmann, and E. Mulder. 1992. The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. J Steroid Biochem Mol Biol. 41:665-9. Visakorpi, T., E. Hyytinen, P. Koivisto, M. Tanner, R. Keinanen, C. Palmberg, A. Palotie, T. Tammela, J. Isola, and O.P. Kallioniemi. 1995. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet. 9:401-6. Wahl, L.M., R.J. Blandau, and R.C. Page. 1977. Effect of hormones on collagen metabolism and collagenase activity in the pubic symphysis ligament of the guinea pig. Endocrinology. 100:571-9. Wang, L., S.K. McDonnell, J.P. Slusser, S.J. Hebbring, J.M. Cunningham, S.J. Jacobsen, J.R. Cerhan, M.L. Blute, D.J. Schaid, and S.N. Thibodeau. 2007. Two common chromosome 8q24 variants are associated with increased risk for prostate cancer. Cancer Res. 67:2944-50. Weiss, G. 1989. Relaxin in the male. Biol Reprod. 40:197-200. Winslow, J.W., A. Shih, J.H. Bourell, G. Weiss, B. Reed, J.T. Stults, and L.T. Goldsmith. 1992. Human seminal relaxin is a product of the same gene as human luteal relaxin. Endocrinology. 130:2660-8. Witte, J.S. 2007. Multiple prostate cancer risk variants on 8q24. Nat Genet. 39:579-80. Yamazawa, K., Y. Wada, I. Sasagawa, K. Aoki, K. Ueoka, and T. Ogata. 2007. Mutation and polymorphism analyses of INSL3 and LGR8/GREAT in 62 Japanese patients with cryptorchidism. Horm Res. 67:73-6. Yeager, M., N. Orr, R.B. Hayes, K.B. Jacobs, P. Kraft, S. Wacholder, M.J. Minichiello, P. Fearnhead, K. Yu, N. Chatterjee, Z. Wang, R. Welch, B.J. Staats, E.E. Calle, H.S. Feigelson, M.J. Thun, C. Rodriguez, D. Albanes, J. Virtamo, S. Weinstein, F.R. Schumacher, E. Giovannucci, W.C. Willett, G. Cancel-Tassin, O. Cussenot, A. Valeri, G.L. Andriole, E.P. Gelmann, M. Tucker, D.S. Gerhard, J.F. Fraumeni, Jr., R. Hoover, D.J. Hunter, S.J. Chanock, and G. Thomas. 2007. Genome-wide association study of prostate cancer identifies a second risk locus at 8q24. Nat Genet. 39:645-649. Yki-Jarvinen, H., T. Wahlstrom, and M. Seppala. 1983. Immunohistochemical demonstration of relaxin in the genital tract of men. J Reprod Fertil. 69:693-5. Yoshimoto, M., J.C. Cutz, P.A. Nuin, A.M. Joshua, J. Bayani, A.J. Evans, M. Zielenska, and J.A. Squire. 2006. Interphase FISH analysis of PTEN in histologic sections shows genomic deletions in 68% of primary prostate cancer and 23% of high- grade prostatic intra-epithelial neoplasias. Cancer Genet Cytogenet. 169:128-37. Zhang, L., M. Johnson, K.H. Le, M. Sato, R. Ilagan, M. Iyer, S.S. Gambhir, L. Wu, and M. Carey. 2003. Interrogating androgen receptor function in recurrent prostate cancer. Cancer Res. 63:4552-60.

38 Zhang, Q., S.H. Liu, M. Erikson, M. Lewis, and E. Unemori. 2002. Relaxin activates the MAP kinase pathway in human endometrial stromal cells. J Cell Biochem. 85:536-44. Zhao, L., P.J. Roche, J.M. Gunnersen, V.E. Hammond, G.W. Tregear, E.M. Wintour, and F. Beck. 1999. Mice without a functional relaxin gene are unable to deliver milk to their pups. Endocrinology. 140:445-53. Zhao, S., C.H. Malmgren, R.D. Shanks, and O.D. Sherwood. 1995. Monoclonal antibodies specific for rat relaxin. VIII. Passive immunization with monoclonal antibodies throughout the second half of pregnancy reduces water consumption in rats. Endocrinology. 136:1892-7. Zimmermann, S., G. Steding, J.M. Emmen, A.O. Brinkmann, K. Nayernia, A.F. Holstein, W. Engel, and I.M. Adham. 1999. Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol. 13:681-91.

39 Chapter 2. Relaxin Becomes Uprequlated During Prostate Cancer

Progression to Androgen Independence and is Negatively Regulated by

Androgens1

2.1 Introduction

Prostate cancer is the most common cancer in men and the second leading cause of cancer related death. Organ confined early stage disease is curable by surgery; however, advanced prostate cancer is typically treated by androgen ablation which causes an initial apoptotic regression of the cancer. Unfortunately, the remission is usually temporary and Al cells arise that are able to survive and proliferate in the absence of androgens. Therapeutic options at this stage are limited (Craft et al., 1999;

Rennie and Nelson, 1998). This process of progression is considered to be multifactorial, likely driven by genetic aberrations, changes in gene expression and activation of various growth factor pathways. Investigation of these dysregulated pathways will help to identify new therapeutic targets and biomarkers for prognosis.

In the human male relaxin is produced in the secretory epithelial cells of the prostate (Gunnersen et al., 1995a; Sokol et al., 1989; Yki-Jarvinen et al., 1983b), and is

1 A version of this chapter has been published. Thompson, V.C., Morris, T.G., Cochrane, D.R, Cavanagh, J., Wafa, L.A., Hamilton, T., Wang, S., Fazli, L., Gleave, M.E., and Nelson, CC. 2006. Relaxin becomes upregulated during prostate cancer progression to androgen independence and is negatively regulated by androgens. Prostate. 66:1698-709.

40 released into the seminal fluid (De Cooman et al., 1983; Schieferstein et al, 1989) where it is thought to play an important role in fertility. In a study of serum biomarkers in various cancerous and non-cancerous tissue types, relaxin HI was up-regulated in tumors compared to normal prostate tissue (Welsh et al., 2003). The role of relaxin in prostate cancer progression has not been explored. Relaxin has been primarily studied in the context of its role in pregnancy and pelvic girdle relaxation, where it derives it name.

In various tissue types, relaxin causes collagen remodelling through increased collagenases and a concomitant decrease in collagen and tissue inhibitors of metalloproteinases (TIMPs). Relaxin also causes increased angiogenesis through upregulation of vascular endothelial growth factor (VEGF) and matrix metalloproteases

(MMPs) and vasodilation through increased nitric oxide (NO) levels, caused by upregulation of nitric oxide synthase (NOS) (reviewed in Bani, 1997b).

The transcriptional regulation of relaxin in the prostate has not yet been thoroughly elucidated. Promoter-reporter based assays using the relaxin promoter linked to luciferase have been performed (Brookes et al., 1998; Fu, 2000; Gunnersen et al.,

1995b), in prostate cancer cell lines in which Brookes et al (Brookes et al., 1998) found the relaxin promoter to be positively regulated by androgens in the PC-3 prostate cell line transfected with the androgen receptor (AR). However, androgens failed to increase reporter expression under the control of the relaxin promoter in LNCaP cells and non- prostate cells examined: liver, kidney, bladder, lung, breast, and ovarian. These studies suggested that the relaxin 5' upstream regulatory region could be activated by androgens, but this regulation of relaxin was cell type dependent.

41 In rat luteal cells, relaxin mRNA is upregulated by prolactin or rat placental lactogen, likely signalling through the prolactin receptor. This prolactin induced expression is independent of ERK, and requires PKC delta, however PKC delta is not sufficient for relaxin expression. STAT-3 complexes with PKC delta (Peters et al.,

2000), and has been shown to bind upstream of the relaxin gene. However, STAT-3 appears to repress relaxin expression, while STAT-5 upregulates relaxin expression in the rat (Soloff et al., 2003). AP-1 has also been implicated in relaxin expression

(Bernacki et al., 1998; Garibay-Tupas et al., 1999; Garibay-Tupas et al., 2004; Soloff et al., 2003), possibly mediated through a functional AP-1 binding site in the relaxin H2 upstream region (Garibay-Tupas et al., 1999).

In contrast to previous observations, we have found that the endogenous relaxin

H2 gene in LNCaP cells in vitro is repressed by the administration of androgens. In

LNCaP tumors grown as xenografts in male mice, relaxin is expressed at a low level and upon castration relaxin expression dramatically increases during Al progression.

Furthermore, using tissue arrays of prostate cancer patient samples that have undergone androgen ablation prior to surgery, we have found that relaxin increases with the duration of androgen ablation and is highly expressed compared to untreated or hormone refractory samples. Our observations suggest that relaxin is negatively regulated by androgens in the prostate and hormone ablation in prostate cancer patients leads to an in increase in relaxin production.

42 2.2 Materials and Methods

Plasmid construction

AR expression vector was constructed as previously described by Snoek et. al

(Rennie et al., 1993; Snoek et al., 1996). SRC1 and CBP expression constructs were obtained from Tsai (Onate et al., 1995) and Curran (D'Arcangelo and Curran, 1995), respectively.

Cell Culture and Media

Cell Culture - LNCaP cells, passage 35-50, were maintained in RPMI 1640 with 5% fetal calf serum (FCS) and penicillin/streptomycin at 37 °C and 5% CO2.

Hormone Treatments - Fetal bovine serum (FBS) was incubated with charcoal and dextran (0.1% final), then filtered before use as charcoal stripped serum (CSS). At approximately 60% confluency, LNCaP cells received RPMI + 2% CSS and were allowed to grow for two days. The stock solution of synthetic androgen, R1881, was dissolved in absolute ethanol, and applied to cells in 20%) ethanol. For microarray RNA extraction, LNCaP cells were seeded in 10 cm plates (3 X 106 cells/plate) and incubated until 60-70%) confluency at 37 °C. Cells were transfected with 1.5 jig AR expression vector, 15 ug of empty pRCCMV vector or coregulator (SRC1 or CBP), and 0.5 \ag of pRL-tk renilla luciferase reporter. The AR expression plasmid was transfected into

LNCaP cells because the effect of co-regulators is more marked when the receptor and the co-regulator are overexpressed at the same time; any co-regulator effect is less noticeable when only endogenous receptor is present. Cells were treated with or without

43 InM R1881 ligand in 5% dextran-coated charcoal stripped FBS for 24 hours before

RNA extraction.

Preparation of total RNA

The LNCaP cells were lysed in Trizol (Invitrogen) and total RNA was isolated according to the manufacturer's protocol. Total RNA samples were quantitated using the Pharmacia Biotech Ultrospec 3000.

Microarray procedures

15-20 ug total RNA was used to label cDNA using Cy3 dUTP (GE Healthcare) during reverse transcription by Superscript II (Invitrogen). The labelled cDNA was cleaned using a Qiagen PCR purification kit, spiked with Cy5 labelled reference oligonucleotide and 20 ixg glycogen. Precipitated DNA was resuspended in 50 ul hybridization solution (55 ul formamide, 5X SSC, 0.1% SDS, 25 ug poly dA, 25 ug yeast tRNA, 20 ug salmon testes DNA) and denatured, then applied to denatured slide.

Human Named (Research Genetics) library spotted cDNA slides representing 7,500 genes were prepared by washing in 0.1 % SDS, blocking in 0.1 M boric acid, pH 8.0 and

0.42 g succinic anhydride in l-methyl-2-pyrrolidinone, prior to denaturation in 95 °C water. After overnight hybridization at 42 °C, slides were then washed, dried, and scanned using a Virtek ChipReader.

44 LNCaP xenograft model

All animal procedures were performed with approval of the University of British

Columbia Committee on Animal Care. 2 xlO6 LNCaP cells were inoculated s.c. with equal volumes (120 uL) of Matrigel (Becton Dickinson Labware) in 6 sites (right and left shoulder, right and left flank and right and left hip) in eighteen 6- to 8-week-old athymic male nude mice (BALB/c, Charles River Laboratory) under mefhoxyfluorane anaesthesia (Pitman-Moore) as previously described (Gleave et al., 1992).

Determination of Serum PSA Levels - Blood serum samples were obtained from tail vein incisions every 3-5 days to follow the progression to Al gene expression. Serum PSA levels were determined by an enzymatic immunoassay kit (Abbott IMX), according to the manufacturer's protocol (Gleave et al., 1992).

Surgical Procedures and Harvesting of Tumors - Tumors were grown for 6-8 weeks at which time the tumors were approximately 1.0 cm in diameter. 2 animals were sacrificed using CO2 asphyxiation and the tumors removed surgically, ensuring removal of any stromal layers. Tumors were placed into 4 mL of Trizol (Invitrogen) and immediately frozen at -80°C. The remaining animals were surgically castrated via the scrotal route under mefhoxyfluorane anaesthesia (Pitman-Moore) as previously described (Gleave et al., 1992). The animals were sacrificed, and the tumors harvested at the indicated times post-castration. RNA was isolated from each of the tumors homogenized using a Polytron power homogenizer (Kinematica) in Trizol, using

Invitrogen instructions.

45 Generation of Northern Blot Probes

The relaxin H2 gene was cloned using the primer pairs hRLXH2rev (5' atactcgagatcactattatcagcaaaatctagcaagag 3'), hRLXH2fwd (5' ataggatccatgcctcgcctgttttttttccac 3') from Operon, and LNCaP cDNA as template. The

LNCaP cDNA was generated using random hexamer [p(dN)6, (Roche)] primers and

Superscript II (Life Technologies, Inc.). Relaxin H2 was cloned into pIRES-GFP

(Stratagene), using BamHl and Xhol double digest. This was used as template to generate the northern blot probe. PSA was digested from pBluescriptPSA construct, using EcoRl, and used as template to generate northern blot probes, as described previously (Gleave et al., 1991).

Northern Blot Analysis

15-20 jig of total RNA was denatured in de-ionized formaldehyde/ formamide/

MOPS sample buffer and electrophoresed on a MOPS formaldehyde agarose gel. The

RNA was transferred to a nylon membrane in 20X SSC (3 M sodium chloride, 0.3 M sodium citrate, pH 7.0) for 20 h, then crosslinked to the membrane using a UV

Stratalinker (Stratagene) according to manufacturer's instructions. The membrane was prehybridized in Expresshyb (Clontech) containing denatured salmon testes DNA for 3 hrs at 65 °C on a rotating rack in a hybridization oven. Radioactivity was incorporated into the full length relaxin cDNA probe using Ready-To-Go DNA labelling beads

(Amersham Pharmacia Biotech) to a specific activity of l-2xl08 dpm/ug. The probes were allowed to hybridize to the membrane overnight at 65 °C. High stringency washes were performed on the membranes at 65 °C. The membranes were exposed to Kodak MS

46 film or a phosphoimager screen, and band intensities were analysed using Imagequant

(Amersham).

Q- PCR

2 ug total RNA isolated from LNCaP cells was treated with 1 U DNase I

(amplification grade, Invitrogen) in 1 X DNase reaction buffer. The reaction was stopped with 2.27 mM EDTA and 10 min incubation at 65 °C. DNase treated RNA was added to a mix of IX MMLV first strand synthesis buffer (Invitrogen), 0.01 M DTT

(Invitrogen), 1 mM dNTPs (Invitrogen), 1.33 U/ul RNAsin (Promega), 6.67 U/ul M-

MLV reverse transcriptase (Invitrogen), and 8.33 U/ul random hexamers for reverse transcription. The reverse transcription mix was incubated at room temperature for 10 min, 37 °C for 1 hour, 95 °C for 5 min, then cooled to 4 °C prior to use in quantitative real time PCR (Q -PCR).

The Q- PCR mix contained cDNA from the reverse transcription reaction above, mixed with IX TAQMAN mix (Applied Biosystems), 0.9 uM forward relaxin primer with sequence 5' - TGAAGCCGCAGACAGCAGT - 3' (Operon), 0.9 uM reverse relaxin primer with sequence 5' - AACATGGCAACATTTATTAGCCAA- 3' (Operon), and 0.2 uM relaxin Taqman probe with sequence 5' - VIC-

AAAATACTTAGGCTTGGATACTCATTCTCGAAAAAAGAGA-TAMRA- 3' (UBC

NAPS) to detect relaxin mRNA. 18S rRNA was used as the endogenous control, using

IX primer and probe set (Applied Biosystems). The transcript levels were detected using the wABI 7900 HT Sequence Detection System, with cycling conditions of 50 °C for 2 min, 95 °C for 10 min, and then 40 repeats of 95 °C for 15 sec and 60 °C for 1 min.

47 Antibody to relaxin H2

An antibody to relaxin H2 was made by immunizing mice to synthesized relaxin

A chain conjugated to KLH at the C-terminus using the Imject Immunogen EDC conjugation kit with mcKLH (Pierce). The relaxin A chain was synthesized without a pyroglutamate at the N-terminus to alleviate possible problems during synthesis. All peptide synthesis steps were performed by Dalton Chemical Laboratories.

The anti-relaxin polyclonal antibody was generated by immunizing 3 rabbits with the KLH-conjugated relaxin A chain in Freund's adjuvant, then boosted after 14 and 28 days in Freund's incomplete adjuvant. Rabbits were again boosted at 4 to 6 week intervals in Freund's incomplete adjuvant prior to bleeding. The antiserum was prepared, and the antibody isolated with Protein A/G PLUS agarose beads (Santa Cruz

Biotechnology). The in-house antibody was later tested against the commercial antibody to validate the antibodies.

Tissue Microarrays and Immunohistochemistry

Formalin-fixed, paraffin-embedded human prostate tissue cores were selected from donor tissue blocks, and arranged into two arrays in recipient paraffin blocks using a tissue arrayer (Beecher Instrument, Silver Spring, MD), and 5 um sections cut from the recipient blocks and mounted to slides (Kiyama et al., 2003). On the first array, TMA-

NHT-V2, 111 patient samples were arrayed in triplicate, representing patients treated with neoadjuvant hormone therapy (NHT) for 0 (n=21), <3 (n=21), 3-6 (n=28), and >6 months (n=28), and Al patients (n=13). Al patient samples were collected from distal

48 sites, including bone (n=6), liver (n=2), and lymph nodes (n=3), adrenal (n=2). Tumours from untreated patients had Gleason grades in the range of 3 to 4, with 95% of the tumours having Gleason grade of 3. Tumours in hormone ablated patients can no longer be characterized by Gleason grade, due to morphometric changes induced by androgen withdrawal. However, all patient samples were roughly matched for grade and stage, for both TMA-NHT-V2 and TMA-NHT VI. The second array, TMA-NHT-V1, was described previously (Kiyama et al., 2003). 185 specimens were arrayed in duplicate, representing patients treated with neoadjuvant hormone therapy (NHT) for 0 (n=25), 1 month (n = 56), 3 months (n = 24), and 6-8 months (n = 56), and Al patients (n=24). Al patient samples were collected from transurethral resections. Neoadjuvant hormone therapy involved medical castration via LHRH analogue, with or without non-steroidal anti-androgen, for patients on both TMA-NHT-VI and TMA-NHT-V2. Informed consent was obtained from each patient to use their tissues for research.

Sections were rehydrated, then steamed in citrate buffer (8.2 mM sodium citrate,

1.8 mM citric acid) for antigen retrieval. The sections were blocked with 10%> BSA, and

endogenous peroxidase activity was blocked using 3%> H2C»2 in PBS, prior to incubating with a 1:100 dilution of rabbit anti-relaxin antibody (ImmunDiagnostik for TMA-NHT-

V2or in-house for TMA-NHT-V1) overnight. To detect relaxin staining, DAKO

Envision+ System, HRP (Dako) was applied, Nova-red (Vector, Burlingame, CA) was used as chromogen after PBS washes, and then slides were counter-stained with

Hematoxylin (Vector, Burlingame,CA). Slides were dehydrated, and cover slip applied.

Slides were scored for relaxin staining by a pathologist (L.F.) with a system of four grades of staining: 0 for no staining, 1 for weak staining, 2 for moderate staining, and 3

49 for high staining intensity. Slides were also photomicrographed using the BLISS system

(Bacus Laboratories, Inc. Lombard, IL), and scored with automated quantitative image analysis software, Image Pro-Plus (Media Cybernetics, Carlsbad, CA).

Statistical Analysis

For microarray analysis, ImaGene 4.2 (BioDiscovery) software was used for quantification of spot intensity; GeneSpring 4.2 (Silicon Genetics) was used for subsequent analysis and normalization. To analyse the dose response and timecourse data, a repeated measures ANOVA was performed, followed by the Tukey-Kramer multiple comparisons test. All statistical analyses for timecourse data was conducted using GraphPad Prism (GraphPad Software Inc, San Diego, CA). To analyse the difference between precastrate relaxin levels and levels 35 days post-castration, the best fit line for the curve was generated using Microsoft Excel, providing a slope and an R2 value. Standard error of the mean was used to generate error bars for graphs of both Q-

PCR and northern blot results. Immunohistochemistry scoring results of tissue microarrays stained for relaxin were analysed using Wilcoxon Rank sum test.

2.3 Results

Relaxin is down-regulated by androgens in LNCaP cells in tissue culture

In order to examine the changes in gene expression that occur due to androgen ablation and subsequent Al, we have used microarray-based profiling with the LNCaP human prostate cancer cell line. To determine changes in gene expression due to androgens, total RNA isolated from LNCaP cells transfected with the AR and treated

50 with or without the synthetic androgen, R1881, in vitro was analyzed using cDNA microarrays. Normalized intensity of relaxin in the presence of R1881 was 0.17, but in the absence of R1881 was 2.12. From this data, relaxin was downregulated more than

12-fold by androgens. In subsequent experiments, the same trend was seen irrespective of co-transfected steroid receptor coactivator-1 (SRC-1) or CREB-binding protein

(CBP), two co-regulators of the AR. In these microarrays representing 7,500 genes, 26 genes were upregulated 5-fold or greater by androgens (Appendix I), and 21 genes were downregulated 5-fold or greater by androgens (Appendix II).

To confirm if the relaxin gene was negatively regulated by androgens in prostate cancer cells, Northern blots of total RNA isolated from LNCaP cells cultured in vitro in a dose response curve to R1881 were analyzed (Fig. 2.1). These data showed that in

LNCaP cells treated with increasing concentrations of R1881 for 72 hours, relaxin mRNA levels were significantly decreased up to 2-fold in a dose dependent manner.

Relaxin mRNA levels were significantly lower when LNCaPs were treated with 1.0 nM or 10 nM R1881 (p<0.01, ANOVA, and Tukey comparison test) compared to untreated

LNCaP cells. To ensure that the LNCaP cells were responding to androgen treatment as expected, PSA mRNA levels were also examined by northern blot, and found to increase in response to increased androgen levels.

To further determine the regulation of relaxin by androgens, LNCaP cells were treated in vitro with 1.0 nM R1881 in a time course for up to 72 hours. The maximal decrease in relaxin mRNA levels occurred by 72 hours of R1881 treatment (Fig. 2.2, p<0.001, ANOVA, Tukey comparison test), as determined using Q- PCR to analyse total

RNA isolated from the treated LNCaP cells. These results showed that the level of

51 e P - P 0 LU o o v- t- nMR1881

A

B

c , • r]28s

0.0016

D 0.0014

0.0012

i§ 0.0010

co 0.0003

c 0.0006

| 0.0004

0.0002

0 0 0.01 0.1 1 10 R1881 concentration (ntvl)

Figure 2.1 Relaxin levels in LNCaP cells decrease with increased androgen concentration. Northern blot analyses of androgen titration in LNCaP cells with 72 hours androgen exposure in vitro, probed for A) relaxin, B) PSA. C) Ethidium bromide stain of total RNA run on 1% formaldehyde agarose gel at 90V for 1 hour prior to blotting to nylon membrane. D) Graph shows normalized relaxin levels decrease in a dose dependent manner. Values represent average of at least three experiments, with standard error of the mean represented by error bars. * - significantly lower than control (p-<0.01, ANOVA and Tukey comparison test).

52 w 0)

X 0) mm CD > re

24 48 72 R1881 treatment duration (hours)

Figure 2.2 Relaxin levels in LNCaP cells decrease with increased duration of androgen treatment. Q- PCR analysis of relaxin levels in LNCaP cells treated with 1 nM R1881 for 0 to 72 hours. Graph shows ratio of relative relaxin mRNA levels in Rl 881-treated over control samples, and is representative of results of performed in triplicate, with error bars representing standard error of the mean. * Significantly different (p<0.001, ANOVA with Tukey comparison test) from 0 hr timepoint.

53 relaxin mRNA decreased dramatically by 24 hours of androgen exposure. Further treatment with androgens resulted in a continued suppression of relaxin mRNA levels compared to untreated control (p<0.001, ANOVA, Tukey comparison test), with a non• significant decrease in relaxin levels from 24 hours to 72 hours.

Relaxin levels are increased by androgen ablation in prostate tumors

In order to examine the changes in relaxin gene expression that occur due to androgen ablation and subsequent Al we have used the LNCaP human xenograft prostate tumor model. This tumor model was generated from a lymph node metastasis of advanced prostate cancer and is representative of the human disease in that it is of secretory epithelial origin, expresses an androgen receptor (albeit with a mutated AR that alters ligand specificity) and produces and secretes PSA in response to androgens.

However, unlike the clinical disease the LNCaP tumor model fails to undergo an apoptotic regression upon castration when grown in nude mice. These features of the

LNCaP model make it very useful for studying gene expression changes regulated by androgen ablation, without the confounding affects of induction of apoptosis. In this tumor model we have studied the effects of castration on prostate tumor gene expression and the subsequent progression to Al, as defined by the re-expression of prostate specific antigen (PSA) in the absence of androgens (Bladou et al., 1997; Gleave et al., 1992; Sato et al., 1996). PSA is a serine protease under the control of androgens, normally expressed by the secretory epithelial cells of the prostate (Gleave, 1995), and levels of

PSA detectable in the serum are proportional to tumor burden in an intact animal

(Gleave et al., 1992). After castration in the LNCaP model, PSA levels fall and the

54 tumor volume plateaus for about 21 days, at which time the cells regain the ability to express PSA and grow in the absence of androgens (Bladou et al., 1997; Gleave et al.,

1992; Sato et al., 1996).

Since relaxin levels are down-regulated by androgens in LNCaP cells in vitro, we sought to determine the effect of removal of androgens in vivo, through castration, in the

LNCaP xenograft model. As expected, serum PSA levels dropped after castration, reached nadir level at day 8, and then increased continually through to 35 days post castration, indicating the androgen independent expression of PSA by LNCaP tumor cells. Northern blots were used to assess changes in relaxin and PSA mRNA levels in the LNCaP xenograft model. PSA mRNA levels followed those of serum PSA levels, with nadir levels at 8 days post castration (Fig. 2.3A). Relaxin transcript levels began to increase 9 days after castration, and increased continuously with progression to Al (Fig.

2.3B). Relaxin levels were highest at Al, at approximately 28 times that of pre-castrate levels, as determined by densitometry (Fig. 2.3C). This data indicates that relaxin levels increase dramatically with increased duration of androgen withdrawal.

To analyze protein expression levels of relaxin we created a polyclonal antibody by immunizing rabbits to a synthetic peptide fragment of relaxin H2 A chain. This antibody was validated using recombinant relaxin obtained from ImmunDiagnostik. To determine if relaxin levels also increased in human patient samples following androgen ablation, a tissue microarray (TMA) of prostate cancer samples from 111 patients treated with androgen ablation prior to prostatectomy [neo-adjuvant hormone therapy (NHT)] and control patients (TMA-NHT-V2), was probed by a commercial antibody

(ImmunDiagnostik) to detect relaxin by immunohistochemistry (IHC). This TMA-

55 >< x x x o O O O n O O • ' JL ' . i T -o "o TJ £ "o -a ts ^ ^_ LO Q- CD CO 03 i- CNJ CO A

B

c

Figure 2.3 Relaxin mRNA levels increase with progression to androgen independence in LNCaP subcutaneous xenograft model in nude mice. Northern analysis of 20 ug total RNA from the LNCaP xenograft probed with (A) PSA and (B) Relaxin H2 cDNA. C) Ethidium bromide stain of total RNA run on 1% formaldehyde agarose gel at 90V for 1 hour prior to blotting to the nylon membrane.

56 NHT-V2 contains samples from 5 groups of patients: those who, prior to surgery, underwent hormonal treatment for 0 months, less than 3 months, 3-6 months, and greater than 6 months, as well as those who had Al prostate cancer. The TMA sections were given a score from 0 (no staining) to 3 (intense staining). TMA-NHT-V2 was also scored by automated quantitative software, and scoring results using the software were statistically similar to the results obtained by the pathologist.

The results of the IHC demonstrated that relaxin levels were significantly higher in patients who had been treated with NHT for an increased period of time, with most intense relaxin staining in the >6 month NHT group (Fig. 2.4A). The staining in the >6 month NHT group was significantly different (p<0.05, Wilcoxon rank sum) from the untreated and <3 month NHT groups. Representative staining is shown in figures 2.4B-

E. For TMA-NHT-V2, Al prostate cancer samples were harvested from several metastatic sites: bone, liver, and lymph nodes. Bone metastasis samples had the highest average relaxin staining score (1.44) compared with the liver and lymph node metastases, with scores of 0.5 and 0.83, respectively (data not shown). Differential staining intensity is shown in the biopsy cores from bone and lymph nodes in figures

2.4F and G, respectively. This trend is similar in the TMA-NHT-V1 array (data not shown), which was probed for relaxin using the anti-relaxin antibody generated in our laboratory. Additiaonally, TMA-NHT-V1 contained Al cores from transurethral resections, and these had similar staining scores (1.0) to the samples from patients who had not undergone NHT (1.025) (Data not shown).

Relaxin IHC staining was limited to the prostatic secretory epithelial cells and present in most patient tumor samples, regardless of duration of NHT treatment.

57 A

NHT Groups (months)

- p , . V KIT J >«».1

" v.. • p . „.. - "

T1

Figure 2.4 Relaxin levels increase in human prostate cancer tissue with increased duration of neoadjuvant hormone therapy (NHT). Paraffin embedded tissue samples from patients receiving radical prostatectomy after varying durations of androgen ablation were arrayed in a tissue microarray and assayed immunohistochemically. A) Immunohistochemistry scoring results of tissue microarrays stained for relaxin expression are presented as median score for each timepoint, with standard error indicated. * >6 month treatment group is statistically significant from <3 month and 0 treatment groups (p-value <0.05, Wilcoxon rank sum). ** 3-6 month treatment group is statistically significant from 0 treatment group (p- value <0.05, Wilcoxon rank sum). B-G) Representative images of paraffin embedded sections from tissue array, TMA-NHT-V2, stained for relaxin, x400 magnification. B) 0 month NHT, C) <3 month NHT, D) 3-6 month NHT, E) >6 month NHT, F) Al bone, and G) Al lymph node samples are shown.

58 Staining was more diffuse throughout the cell with increased NHT duration. In addition to staining being more diffuse, staining was more intense in sections with higher scoring

(Fig. 2.4B-G).These results indicate that relaxin levels are elevated in the absence of androgens in human prostate cancer patients, as they are in vitro.

2.4 Discussion

Advanced prostate cancer is commonly treated by androgen ablation therapy, which induces an apoptotic regression of prostate tumors and normal secretory prostate epithelial cells. Unfortunately, this remission is typically temporary with the eventual emergence of Al prostate cancer in the majority of patients. The LNCaP xenograft model has been used extensively to characterize changes in gene expression during progression to Al (Ettinger et al., 2004; Gimenez-Bonafe et al., 2004; Miyake et al.,

2000; Sato et al., 1997). In this study, we found that relaxin levels increase with progression to Al in the LNCaP xenograft model, and in human patient samples following androgen ablation. We also provide evidence that relaxin is negatively regulated by androgens in prostate cancer through the AR.

Since in LNCaP cells, relaxin levels increased in a manner corresponding to the removal of androgens in microarray experiments, we hypothesized that relaxin may be negatively regulated by androgens in the prostate. Our data demonstrate that relaxin levels in vitro decrease in the presence of synthetic androgen, R1881 (Figs. 2.1 and 2.2).

The exact mechanism underlying this regulation is under current investigation.

The relaxin promoter has been described as being regulated positively by androgens when recombinantly linked to a CAT reporter assay in PC-3 cells transfected with the

59 AR (Brookes et al., 1998). The difference in results may simply be due to a difference in cell lines, as PC-3 cells express a different repertoire of proteins than LNCaP.

Alternatively, the difference in results could be because a recombinant reporter assay does not take into consideration all the possible mechanisms for control of relaxin expression, as only 300 and 3000 bp 5' flanking regions were analysed for androgen regulation. It is possible that the negative regulation is not present in the 3000 bp 5 ' flanking region , but instead within an intron (Martinez et al., 1999; Nonaka et al., 2001;

Watt et al., 2001), or that relaxin regulation is dependent on features of chromatin structure.

Dyscoordinate regulation between endogenous promoter and reporter constructs have been noted in other studies. For example, in LNCaP cells and in mice, ornithine decarboxylase (ODC) is upregulated by androgens (Betts et al., 1997; Levillain et al.,

2005; Levillain et al., 2003). However, when a portion of the ODC promoter is transfected into LNCaP, ODC promoter activity is negatively regulated by androgens

(Bai et al., 1998), suggesting that the reporter assay is not representative of the biological conditions within the cell.

Fu et al (Fu, 2000) studied consensus regions in the human and rat relaxin promoters by the electrophoretic mobility shift assay using rat nuclear extracts derived from rat tissue samples. Some consensus regions were bound by factors present only in pregnant rats, and other consensus regions were bound by factors present in pregnant and non-pregnant rats. No studies parallel to the study by Fu et al (Fu, 2000) have been reported in human models, although there have been studies involved in elucidating some of the regulatory regions of the 5' flanking regions of relaxin HI and H2 genes

60 (Brookes et al., 1998; Fu, 2000; Garibay-Tupas et al., 1999; Garibay-Tupas et al., 2004;

Gunnersen et al., 1995b). In pregnant rats, prolactin stimulates relaxin expression

(Peters et al, 2000; Sortino et al., 1989), while in humans, prolactin levels increase due to relaxin expression (Kim et al., 1998; Telgmann and Gellersen, 1998; Tseng and

Mazella, 1999). There is no direct evidence that relaxin expression is stimulated by prolactin in humans.

As relaxin was negatively regulated by androgens in LNCaP cells in vitro, the effect of androgens on relaxin levels in vivo was studied. Relaxin levels increase during progression to Al in the LNCaP xenograft model, with peak relaxin levels at 35 days post-castration, at which time PSA is re-expressed in the absence of androgens, heralding Al in this model (Fig. 2.3). The increase in relaxin levels is also seen in human samples treated with androgen withdrawal therapy (Fig. 2.4A); levels peak following greater than 6 months NHT group, while comparatively decreased in the Al samples. While the LNCaP tumor model mimics many aspects of the clinical disease, there are distinctive differences. Following castration in the LNCaP xenograft, PSA levels decrease as seen in patients; however, LNCaP tumors do not regress, unlike the

NHT treated patients. Furthermore, while the LNCaP cells are considered moderately well differentiated, they would be considered more aggressive than the patient tumors represented in the NHT TMA, because they are derived from a human patient lymph node metastasis. Therefore, the difference in peak relaxin levels may be due to these inherent attributes of the LNCaP model, compared to the clinical disease. As well, the

Al specimens on NHT-TMA-V2 are from different secondary sites, reducing the sample size on the TMA for any one site. As each metastatic lesion would be exposed to a

61 different microenvironment, more samples are necessary to fully explore the protein expression profiles at these different sites. Despite the differences in the peak relaxin levels, relaxin dramatically increases following androgen ablation in both the LNCaP xenograft and patient samples.

An intriguing finding of this study is that relaxin levels increase following androgen ablation, while PSA levels decrease and reach nadir, prior to increasing with progression to Al, which characterized by re-expression of PSA. Some genes may be regulated in the same manner during Al as they were prior to androgen loss. PSA is an excellent example of a gene which is upregulated by androgens and is decreased in hormone responsive tumours upon initiation of androgen ablation therapy, but then is re- expressed in Al tumours. Relaxin is upregulated during androgen ablation, and is subsequently expressed at Al similarly to expression in untreated tumours. The relaxin protein expression profile in the NHT-TMAs is consistent with our hypothesis that relaxin may be involved in activating key pathways in invasion and angiogenesis during the progression of androgen independent prostate cancer. There are a number of possible mechanisms which may lead to Al, as described by Feldman and Feldman

(Feldman and Feldman, 2001). Further testing is required to determine the exact mechanisms by which androgens and other factors control and modulate relaxin expression in the prostate.

Relaxin levels are increased above normal levels in other neoplastic tissues including gastric cells (Stemmermann et al., 1994), breast cells (Tashima et al., 1994), chioriocarcinoma, and hydatiform mole, (Yki-Jarvinen et al., 1983a), as detected by

IHC. This indicates that relaxin may .play a role in tumor progression in these cancer

62 types. Relaxin H2 has been implicated in aggressive cancer, for example, serum relaxin levels are elevated in patients with metastatic breast cancer, compared to localised disease (Binder et al., 2004). Relaxin HI has been reported to be overexpressed 4.6 times in tumor tissue over normal in the prostate (Welsh et al., 2003). Most research into relaxin in cancer has been done in breast cancer (Bani, 1997a; Bani et al., 1999b;

Bani et al, 1994; Bigazzi et al., 1992; Binder et al., 2002; Sacchi et al, 1994; Tashima et al., 1994), with a few studies in ovarian cancer (Yki-Jarvinen et al., 1983a) and prostate cancer cell lines (Brookes et al., 1998; Gunnersen et al., 1995b). To our knowledge, this is the first evidence that relaxin levels increased during progression to Al prostate cancer.

In the present study, there is an apparent differential level of relaxin expression based on tumor site. Bone metastases exhibit the highest relaxin staining of all Al cells studied (Fig. 2.4F-G) as compared to liver and lymph node metastases, and primary site samples. Prostate cancer bone metastases are the most common metastatic lesion of prostate cancer and modulate bone turnover through the degradation of the extracellular matrix (Bogdanos et al., 2003). Relaxin may play a role in general in the invasion phenotype of metastases by increasing collagen remodeling, through increased MMPs and decreased TIMPs. The bone environment may have increased levels of growth factors that further stimulate the production of relaxin, such as has been noted for IGF-1 signalling increasing relaxin in the placenta (Huang et al., 1992).

Like relaxin, other genes are similarly downregulated by androgens, and become upregulated during Al progression. ET-1 is upregulated with progression to Al, and downregulated by androgens in PC-3 cells with transfected androgen receptor (Granchi

63 et al., 2001). Other groups have done large-scale analyses of genes and proteins regulated by androgens in the prostate and found a series of genes to be repressed by androgens; however, fewer genes or proteins have been reported to be down-regulated by androgens than up-regulated (Clegg et al., 2002; Jiang and Wang, 2003; Martin et al.,

2004; Wang et al., 1997). For instance, in the rat ventral prostate, 1.8% of genes studied were up-regulated 2.3 fold or more, while 1.6 % of genes were down regulated by androgens (Jiang and Wang, 2003). Those upregulated genes were classified into several groups, including metabolism, chaperones and trafficking, and protein sysnthesis. The down regulated genes were of diverse functional ontologies including insulin like growth factor binding protein-3 (IGFBP-3), ATP-binding cassette protein

(Abca8), MHC class I antigen gene, Fos-related antigen, and TIMP-3. In accordance with those studies, TIMP-3 and MHC class I antigen are also down-regulated in the microarrays used in this study. Of note is that of 52 genes downregulated by androgens

2.3 fold or more, 6(11%>) are MHC antigens or MHC receptor chains (Jiang and Wang,

2003). Using mass spectrometry to determine androgen regulation of secreted proteins,

Martin et al (2004) found that 9% of proteins were upregulated, while 2.5 % were downregulated, including IGFBP-2. Like relaxin, IGFBP-2 has been shown to increase during progression to Al (Kiyama et al., 2003).

Relaxin is a provocative potential therapeutic target, as levels increase with progression to Al. It has been previously described that relaxin upregulates matrix metalloproteases (MMPs) in many tissues, as well as in human breast cell lines, MCF-7 and SKBR3 (rev. in Bani, 1997b; Binder et al., 2002). Relaxin also increases VEGF levels in several tissues, (Palejwala et al., 2002; Unemori et al., 1999; Unemori et al.,

64 2000). An increase in angiogenesis would be most pronounced if both VEGF and

MMPs were being upregulated by relaxin, as both are angiogenic factors (Chiarugi et al.,

2000; Galligioni and Ferro, 2001), and could be a key factor in metastases (Weidner et al., 1993). Relaxin increases nitric oxide through the upregulation of nitric oxide synthase (NOS), and this could lead to increased blood flow to the tumor region, lending a proliferative advantage to prostate cancer cells (Bani et al., 1999a; Bani et al., 1998;

Bani et al., 1995; Danielson et al., 1999). Nitric oxide has likewise been linked to angiogenesis (Cooke, 2003). Studies are underway to determine if these linkages exist in prostate cancer.

Clearly relaxin is tightly regulated in a tissue specific manner. We have shown that in the human prostate secretory epithelial cells relaxin is negatively regulated by androgens in that in the absence of androgens, as in androgen ablation, relaxin levels increase in a dose and time-dependent manner. Future studies will investigate the interaction between the androgen receptor and the relaxin promoter, and the role of relaxin in prostate cancer progression, with respect to downstream effectors including

VEGF, NOS, MMPs, and TIMPs.

65 2.5 References

Bai, G., S. Kasper, R.J. Matusik, P.S. Rennie, J.A. Moshier, and A. Krongrad. 1998. Androgen regulation of the human ornithine decarboxylase promoter in prostate cancer cells. J Androl. 19:127-35. Bani, D. 1997a. Relaxin and breast cancer. Bull Cancer. 84:179-82. Bani, D. 1997b. Relaxin: a pleiotropic hormone. Gen Pharmacol. 28:13-22. Bani, D., M.C. Baccari, S. Nistri, F. Calamai, M. Bigazzi, and T.B. Sacchi. 1999a. Relaxin up-regulates the nitric oxide biosynthetic pathway in the mouse uterus: involvement in the inhibition of myometrial contractility. Endocrinology. 140:4434-41. Bani, D., P. Failli, M.G. Bello, C. Thiemermann, T. Bani Sacchi, M. Bigazzi, and E. Masini. 1998. Relaxin activates the L-arginine-nitric oxide pathway in vascular smooth muscle cells in culture. Hypertension. 31:1240-7. Bani, D., D. Flagiello, M.F. Poupon, S. Nistri, F. Poirson-Bichat, M. Bigazzi, and T. Bani Sacchi. 1999b. Relaxin promotes differentiation of human breast cancer cells MCF-7 transplanted into nude mice. Virchows Arch. 435:509-19. Bani, D., E. Masini, M.G. Bello, M. Bigazzi, and T.B. Sacchi. 1995. Relaxin activates the L-arginine-nitric oxide pathway in human breast cancer cells. Cancer Res. 55:5272-5. Bani, D., A. Riva, M. Bigazzi, and T. Bani Sacchi. 1994. Differentiation of breast cancer cells in vitro is promoted by the concurrent influence of myoepithelial cells and relaxin. Br J Cancer. 70:900-4. Bernacki, S.H., A. Medvedev, G. Holloway, M. Dawson, R. Lotan, and A.M. Jetten. 1998. Suppression of relaxin gene expression by retinoids in squamous differentiated rabbit tracheal epithelial cells. Mol Cell Endocrinol. 138:115-25. Betts, A.M., I. Waite, D.E. Neal, and C.N. Robson. 1997. Androgen regulation of ornithine decarboxylase in human prostatic cells identified using differential display. FEBSLett. 405:328-32. Bigazzi, M., M.L. Brandi, G. Bani, and T.B. Sacchi. 1992. Relaxin influences the growth of MCF-7 breast cancer cells. Mitogenic and antimitogenic action depends on peptide concentration. Cancer. 70:639-43. Binder, C, T. Hagemann, B. Husen, M. Schulz, and A. Einspanier. 2002. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod. 8:789-96. Binder, C, A. Simon, L. Binder, T. Hagemann, M. Schulz, G. Emons, L. Trumper, and A. Einspanier. 2004. Elevated concentrations of serum relaxin are associated with metastatic disease in breast cancer patients. Breast Cancer Res Treat. 87:157-66. Bladou, F., M.E. Gleave, F. Penault-Llorca, G. Serment, P.H. Lange, and R.L. Vessella. 1997. [In vitro and in vivo models developed from human prostatic cancer]. Prog Urol. 7:384-96. Bogdanos, J., D. Karamanolakis, R. Tenta, A. Tsintavis, C. Milathianakis, C. Mitsiades, and M. Koutsilieris. 2003. Endocrine/paracrine/autocrine survival factor activity of bone microenvironment participates in the development of androgen ablation

66 and chemotherapy refractoriness of prostate cancer metastasis in skeleton. Endocr Relat Cancer. 10:279-89. Brookes, D.E., D. Zandvliet, F. Watt, P.J. Russell, and P.L. Molloy. 1998. Relative activity and specificity of promoters from prostate-expressed genes. Prostate. 35:18-26. Chiarugi, V., M. Ruggiero, and L. Magnelli. 2000. Molecular polarity in endothelial cells and tumor-induced angiogenesis. Oncol Res. 12:1-4. Clegg, N., B. Eroglu, C. Ferguson, H. Arnold, A. Moorman, and P.S. Nelson. 2002. Digital expression profiles of the prostate androgen-response program. J Steroid Biochem Mol Biol. 80:13-23. Cooke, J.P. 2003. NO and angiogenesis. Atheroscler Suppl. 4:53-60. Craft, N., Y. Shostak, M. Carey, and C.L. Sawyers. 1999. A mechanism for hormone- independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med. 5:280-5. Danielson, L.A., O.D. Sherwood, and K.P. Conrad. 1999. Relaxin is a potent renal vasodilator in conscious rats. J Clin Invest. 103:525-33. DArcangelo, G., and T. Curran. 1995. Human genetics. Smart transcription factors. Nature. 376:292-3. De Cooman, S., P. Gilliaux, and K. Thomas. 1983. Immunoreactive relaxin-like substance in human split ejaculates. Fertil Steril. 39:111-3. Ettinger, S.L., R. Sobel, T.G. Whitmore, M. Akbari, D.R. Bradley, M.E. Gleave, and C.C. Nelson. 2004. Dysregulation of sterol response element-binding proteins and downstream effectors in prostate cancer during progression to androgen independence. Cancer Res. 64:2212-21. Feldman, B.J., and D. Feldman. 2001. The development of androgen-independent prostate cancer. Nat Rev Cancer. 1:34-45. Fu, P., Gunnersen, J, Tregear, G, Roche, P. 2000. Identification of consensus sequences in the rat relaxin promoter which bind nuclear proteins. In Third international conference on relaxin and related peptides. Vol. 1. G. Tregear, Ivel R, Bathgate, RA, Wade, JD, editor. Kluwer Academic Publishers, Broome Australia. 149-150. Galligioni, E., and A. Ferro. 2001. Angiogenesis and antiangiogenic agents in non-small cell lung cancer. Lung Cancer. 34:3-7. Garibay-Tupas, J.L., K. Csiszar, M. Fox, S. Povey, and G.D. Bryant-Greenwood. 1999. Analysis of the 5'-upstream regions of the human relaxin HI and H2 genes and their chromosomal localization on chromosome 9p24.1 by radiation hybrid and breakpoint mapping. J Mol Endocrinol. 23:355-65. Garibay-Tupas, J.L., K.J. Okazaki, L.S. Tashima, S. Yamamoto, and G.D. Bryant- Greenwood. 2004. Regulation of the human relaxin genes HI and H2 by steroid hormones. Mol Cell Endocrinol. 219:115-25. Gimenez-Bonafe, P., M.N. Fedoruk, T.G. Whitmore, M. Akbari, J.L. Ralph, S. Ettinger, M.E. Gleave, and C.C. Nelson. 2004. YB-1 is upregulated during prostate cancer tumor progression and increases P-glycoprotein activity. Prostate. 59:337-49. Gleave, M., J. Hsieh, C. Gao, A. von Eschenbach, and L. Chung. 1991. Acceleration of human prostate cancer growth in vivo by factors produced by prostate and bone fibroblasts. Cancer Res. 51:3753-3761.

67 Gleave, M.E., J.T. Hsieh, H.C. Wu, A.C. von Eschenbach, and L.W. Chung. 1992. Serum prostate specific antigen levels in mice bearing human prostate LNCaP tumors are determined by tumor volume and endocrine and growth factors. Cancer Res. 52:1598-605. Gleave, M.E., S.L. Goldenberg, andN. Bruchovsky. 1995. Prostate specific antigen as a prognostic predictor in prostate cancer. In Hormone-Dependent Cancer. Granchi, S., S. Brocchi, L. Bonaccorsi, E. Baldi, M.C. Vinci, G. Forti, M. Serio, and M. Maggi. 2001. Endothelin-1 production by prostate cancer cell lines is up• regulated by factors involved in cancer progression and down-regulated by androgens. Prostate. 49:267-77'. Gunnersen, J.M., R.J. Crawford, and G.W. Tregear. 1995a. Expression of the relaxin gene in rat tissues. Mol Cell Endocrinol. 110:55-64. Gunnersen, J.M., P.J. Roche, G.W. Tregear, and R.J. Crawford. 1995b. Characterization of human relaxin gene regulation in the relaxin-expressing human prostate adenocarcinoma cell line LNCaP.FGC. J Mol Endocrinol. 15:153-66. Huang, C.J., Y. Li, M.H. Stromer, and L.L. Anderson. 1992. Synergistic effects of insulin-like growth factor I and gonadotrophins on relaxin and progesterone secretion by ageing corpora lutea of pigs. J Reprod Fertil. 96:415-25. Jiang, F., and Z. Wang. 2003. Identification of androgen-responsive genes in the rat ventral prostate by complementary deoxyribonucleic acid subtraction and microarray. Endocrinology. 144:1257-65. Kim, J.J., R.C. Jaffe, and A.T. Fazleabas. 1998. Comparative studies on the in vitro decidualization process in the baboon (Papio anubis) and human. Biol Reprod. 59:160-8. Kiyama, S., K. Morrison, T. Zellweger, M. Akbari, M. Cox, D. Yu, H. Miyake, and M.E. Gleave. 2003. Castration-Induced Increases in Insulin-Like Growth Factor- Binding Protein 2 Promotes Proliferation of Androgen-independent Human Prostate LNCaP Tumors. Cancer Res. 63:3575-3584. Levillain, O., J.J. Diaz, O. Blanchard, and H. Dechaud. 2005. Testosterone down- regulates ornithine aminotransferase gene and up-regulates arginase II and ornithine decarboxylase genes for polyamines synthesis in the murine kidney. Endocrinology. 146:950-9. Levillain, O., A. Greco, J.-J. Diaz, R. Augier, A. Didier, K. Kindbeiter, F. Catez, and M. Cayre. 2003. Influence of testosterone on regulation of ODC, antizyme, and Nl- SSAT gene expression in mouse kidney. Am J Physiol Renal Physiol. 285:F498- 506. Martin, D.B., D.R. Gifford, M.E. Wright, A. Keller, E. Yi, D.R. Goodlett, R. Aebersold, and P.S. Nelson. 2004. Quantitative proteomic analysis of proteins released by neoplastic prostate epithelium. Cancer Res. 64:347-55. Martinez, A., A.M. Lefrancois-Martinez, M. Manin, S. Guyot, C. Jean-Faucher, G. Veyssiere, A. Kahn, and C. Jean. 1999. 5'-flanking and intragenic sequences confer androgenic and developmental regulation of mouse aldose reductase-like gene in vas deferens and adrenal in transgenic mice. Endocrinology. 140:1338- 48. Miyake, H., M. Pollak, and M.E. Gleave. 2000. Castration-induced up-regulation of insulin-like growth factor binding protein-5 potentiates insulin-like growth

68 factor-I activity and accelerates progression to androgen independence in prostate cancer models. Cancer Res. 60:3058-64. Nonaka, M.L, G. Wang, T. Mori, H. Okada, and M. Nonaka. 2001. Novel androgen- dependent promoters direct expression of the C4b-binding protein alpha-chain gene in epididymis. J Immunol. 166:4570-7. Onate, S.A., S.Y. Tsai, M.J. Tsai, and B.W. O'Malley. 1995. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science. 270:1354-7. Palejwala, S., L. Tseng, A. Wojtczuk, G. Weiss, and L.T. Goldsmith. 2002. Relaxin gene and protein expression and its regulation of procollagenase and vascular endothelial growth factor in human endometrial cells. Biol Reprod. 66:1743-8. Peters, C.A., E.T. Maizels, M.C. Robertson, R.P. Shiu, M.S. Soloff, and M. Hunzicker- Dunn. 2000. Induction of relaxin messenger RNA expression in response to prolactin receptor activation requires protein kinase C delta signaling. Mol Endocrinol. 14:576-90. Rennie, P.S., N. Bruchovsky, K.J. Leco, P.C. Sheppard, S.A. McQueen, H. Cheng, R. Snoek, A. Hamel, M.E. Bock, and B.S. MacDonald. 1993. Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol Endocrinol. 7:23-36. Rennie, P.S., and C.C. Nelson. 1998. Epigenetic mechanisms for progression of prostate cancer. Cancer Metastasis Rev. 17:401-9. Sacchi, T.B., D. Bani, M.L. Brandi, A. Falchetti, and M. Bigazzi. 1994. Relaxin influences growth, differentiation and cell-cell adhesion of human breast-cancer cells in culture. Int J Cancer. 57:129-34. Sato, N., M.E. Gleave, N. Bruchovsky, P.S. Rennie, S.L. Goldenberg, P.H. Lange, and L.D. Sullivan. 1996. Intermittent androgen suppression delays progression to androgen-independent regulation of prostate-specific antigen gene in the LNCaP prostate tumour model. J Steroid Biochem Mol Biol. 58:139-46. Sato, N., M.D. Sadar, N. Bruchovsky, F. Saatcioglu, P.S. Rennie, S. Sato, P.H. Lange, and M.E. Gleave. 1997. Androgenic induction of prostate-specific antigen gene is repressed by protein-protein interaction between the androgen receptor and AP-l/c-Jun in the human prostate cancer cell line LNCaP. J Biol Chem. 272:17485-94. Schieferstein, G., W. Voelter, H. Seeger, and T.H. Lippert. 1989. Immunoreactive relaxin in seminal plasma of man. IntJFertil. 34:215-8. Snoek, R., P.S. Rennie, S. Kasper, R.J. Matusik, and N. Bruchovsky. 1996. Induction of cell-free, in vitro transcription by recombinant androgen receptor peptides. J Steroid Biochem Mol Biol. 59:243-50. Sokol, R.Z., X.S. Wang, J. Lechago, P.D. Johnston, and R.S. Swerdloff. 1989. Immunohistochemical localization of relaxin in human prostate. J Histochem Cytochem. 37:1253-5. Soloff, M.S., S. Gal, S. Hoare, CA. Peters, M. Hunzicker-Dunn, G.D. Anderson, and T.G. Wood. 2003. Cloning, characterization, and expression of the rat relaxin gene. Gene. 323:149-55. Sortino, M.A., M.J. Cronin, and P.M. Wise. 1989. Relaxin stimulates prolactin secretion from anterior pituitary cells. Endocrinology. 124:2013-5.

69 Stemmermann, G.N., W. Mesiona, F.C. Greenwood, and G.D. Bryant-Greenwood. 1994. Immunocytochemical identification of a relaxin-like protein in gastrointestinal epithelium and carcinoma: a preliminary report. J Endocrinol. 140:321-5. Tashima, L.S., G. Mazoujian, and G.D. Bryant-Greenwood. 1994. Human relaxins in normal, benign and neoplastic breast tissue. J Mol Endocrinol. 12:351-64. Telgmann, R., and B. Gellersen. 1998. Marker genes of decidualization: activation of the decidual prolactin gene. Hum Reprod Update. 4:472-9. Tseng, L., and J. Mazella. 1999. Prolactin and its receptor in human endometrium. Semin Reprod Endocrinol. 17:23-7. Unemori, E.N., M.E. Erikson, S.E. Rocco, K.M. Sutherland, D.A. Parsell, J. Mak, and B.H. Grove. 1999. Relaxin stimulates expression of vascular endothelial growth factor in normal human endometrial cells in vitro and is associated with menometrorrhagia in women. Hum Reprod. 14:800-6. Unemori, E.N., M. Lewis, J. Constant, G. Arnold, B.H. Grove, J. Normand, U. Deshpande, A. Salles, L.B. Pickford, M.E. Erikson, T.K. Hunt, and X. Huang. 2000. Relaxin induces vascular endothelial growth factor expression and angiogenesis selectively at wound sites. Wound Repair Regen. 8:361-70. Wang, Z., R. Tufts, R. Haleem, and X. Cai. 1997. Genes regulated by androgen in the rat ventral prostate. Proc Natl Acad Sci USA. 94:12999-3004. Watt, F., A. Martorana, D.E. Brookes, T. Ho, E. Kingsley, D.S. O'Keefe, P.J. Russell, W.D. Heston, and P.L. Molloy. 2001. A tissue-specific enhancer of the prostate- specific membrane antigen gene, FOLH1. Genomics. 73:243-54. Weidner, N., P.R. Carroll, J. Flax, W. Blumenfeld, and J. Folkman. 1993. Tumor angiogenesis correlates with metastasis in invasive prostate carcinoma. Am J Pathol. 143:401-9. Welsh, J.B., L.M. Sapinoso, S.G. Kern, D.A. Brown, T. Liu, A.R. Bauskin, R.L. Ward, N.J. Hawkins, D.I. Quinn, P.J. Russell, R.L. Sutherland, S.N. Breit, CA. Moskaluk, H.F. Frierson, Jr., and G.M. Hampton. 2003. Large-scale delineation of secreted protein biomarkers overexpressed in cancer tissue and serum. Proc Natl Acad Sci US A. 100:3410-5. Yki-Jarvinen, H., T. Wahlstrom, and M. Seppala. 1983a. Immunohistochemical demonstration of relaxin in gynecologic tumors. Cancer. 52:2077-80. Yki-Jarvinen, H., T. Wahlstrom, and M. Seppala. 1983b. Immunohistochemical demonstration of relaxin in the genital tract of men. J Reprod Fertil. 69:693-5.

70 Chapter 3. Relaxin Drives Wnt Signalling Through Upregulation of PCDHY in Prostate Cancer1

3.1 Introduction

In men, prostate cancer is the most common cancer and the third leading cause of cancer related death. Early stage, organ confined disease is curable by surgery; however, advanced stage disease is commonly treated with androgen ablation, causing an initial apoptotic response, and decrease in tumour size. Inevitably, androgen independent (Al) cells arise which can survive and proliferate in the absence of androgens, for which there are limited therapeutic options (Clarke, 2006; Craft et al.,

1999; Rennie and Nelson, 1998). Progression to Al is considered to be multifactorial, likely driven by genetic aberrations, changes in gene expression and activation of various growth factor pathways. Investigation of these dysregulated pathways will help to identify new therapeutic targets and biomarkers for prognosis.

In the human prostate, the peptide hormone, relaxin, is produced by the secretory epithelial cells (Gunnersen et al., 1995; Sokol et al., 1989; Yki-Jarvinen et al., 1983), and secreted into the seminal fluid (De Cooman et al., 1983; Schieferstein et al., 1989) where

1 A version of this chapter will be submitted for publication. Thompson, V.C., Hurtado-Coll, A, Turbin, D, Fazli, L, Huntsman, D, Gleave, ME, Nelson, CC. Relaxin drives Wnt signalling through upregulation of PCDHY in prostate cancer.

71 it is thought to play an important role in fertility. Historically, relaxin has been considered a pregnancy hormone, and studies into pelvic girdle relaxation have elucidated the pleiotrophic functions of this hormone. Relaxin-induced collagen remodelling is achieved through increased collagenases within the MMP family and decreased tissue inhibitors of matrix metalloproteinases (TIMPs) and collagen. Relaxin also upregulates nitric oxide through upregulation of nitric oxide synthase, and vascular endothelial growth factor (VEGF), which, in conjunction with a decrease in TIMPs and increase in matrix metalloproteases, increases angiogenesis (reviewed in Bani, 1997).

Relaxin has been shown to increase angiogenesis and tumour volume of PC-3 xenografts

(Silvertown et al., 2006), to facilitate Al growth of LNCaP xenografts overexpressing a p53 mutation (R273H) (Silvertown et al., 2007; Vinall et al., 2006), and decrease survival in the transgenic adenocarcinoma of mouse prostate (TRAMP) mice systemically overexpressing relaxin. Knocking down relaxin function through relaxin antagonists or relaxin receptor (LGR7) siRNA decreases growth of prostate tumour models (Feng et al., 2007; Silvertown et al., 2007). Relaxin expression is negatively regulated by androgens in LNCaP cells in vitro and in LNCaP tumors, and these observations are also seen in clinical prostate cancer specimens following androgen ablation (Thompson et al., 2006).

LNCaP cells overexpressing protocadherinY (PCDHY) are resistant to stress conditions, such as androgen ablation (Chen et al., 2002). PCDHY mRNA in LNCaP xenografts is very low in intact nude mice and 2 days post castration, but elevated 28 days post castration. However, PCDHY protein appears to increase by 2 days post castration. PCDHY is localized to the cytoplasm, and binds /?-catenin through a serine

72 rich catenin binding domain (Chen et al., 2002). /5-catenin is exclusively localized to the membrane in untreated LNCaPs in tissue culture (de la Taille et al., 2003), but is driven to the nucleus in PCDHY overexpressing cells, increasing Wnt signalling via TCF elements in the colon cancer cell line, HCT116, and in several prostate cell lines regardless of AR status (Yang et al., 2005). PCDHY mRNA expression is higher in human prostate tumour cells than normal cells, is increased further with androgen ablation therapy, and is highest at Al (Terry et al., 2006a). PCDHY overexpression confers invasive potential, and Al growth of xenografts implanted into castrated nude mice (Terry et al., 2006a). Several neuroendocrine differentiation markers in prostate cancer cells are increased by PCDHY, including neuron-specific enolase, c-myc, cyclin

DI, c-ret, and cox-2. Additionally, several Wnts are upregulated by PCDHY, including

Wnt3, WntlOA, Wnt7B, and Wntl 1 (Yang et al, 2005).

Wntl 1 functions in gastrulation, causing E-cadherin to dissociate from the plasma membrane (Ulrich et al., 2005). In IEC6 intestinal epithelial cells, Wntl 1 causes cell mobility, transformation, and proliferation (Ouko et al., 2004b). Human prostate cancer samples express elevated Wntl 1, proportional to Gleason Grade (Zhu et al.,

2004b). Wntl 1 is inhibited by androgens in LNCaP cells, although this is relieved in Al xenografts (Zhu et al., 2004b).

To study the role of relaxin in prostate cancer, we generated LNCaP xenografts stably overexpressing relaxin (LNCaP-RLX). LNCaP-RLX tumours displayed an increased take rate and showed an accelerated growth rate compared to controls.

Microarray gene expression analysis of RNA isolated from xenografts indicated Wntl 1 is strongly upregulated by relaxin. As Wntl 1 is upregulated by PCDHY, we examined

73 whether PCDHY was upregulated by relaxin. Relaxin overexpression in LNCaP cells upregulates PCDHY in the presence and absence of androgens; we postulate relaxin acts in an autocrine fashion upstream of PCDHY in regulating increased Wnt signaling and

Wntll levels.

3.2 Materials and Methods

Plasmid construction

The relaxin H2 gene was cloned from LNCaP cDNA [generated using random hexamer (Roche, Palo Alto, CA, USA) primers and Superscript II (Invitrogen, Carlsbad,

CA, USA)], and the primer pairs hRLXH2rev (5'

ATACTCGAGATCACTATTATCAGCAAAATCTAGCAAGAG 3'), hRLXH2fwd (5'

ATAGGATCCATGCCTCGCCTGTTTTTTTTCCAC 3') (Operon, Huntsville, AL,

USA), into pIRES-GFP (Stratagene, La Jolla, CA, USA). pExchange nodule neoR

(Stratagene) was inserted into pIRES-GFP-RLX and pIRES-GFP.

Cell Culture and Media

Cell Culture - LNCaP cells, passage 35-50, were maintained in RPMI 1640 with 5% fetal bovine serum (FBS) and penicillin/streptomycin at 37 °C and 5% CO2.

Hormone Treatments - At approximately 60% confluency, LNCaP cells received RPMI

+ 2% charcoal stripped serum (CSS) (Hyclone, Logan, UT, USA) for 48 h prior to

R1881 treatment.

74 Stable cells - Wells of 6-well plates were transfected with 2jag pIRES-RLX vector, or empty vector control (pIRES-GFP) using lipofectin (Invitrogen, Carlsbad, CA, USA) selected using 300 ug/ml G418 (Invitrogen), and screened for GFP fluorescence.

Preparation of total RNA

LNCaP cells were lysed in Trizol (Invitrogen) and total RNA isolated according to manufacturer's protocol; RNA was quantified using the ND-1000 Spectrophotometer

(Nanodrop Technologies, Wilmington, DE, USA). For microarray analysis, total RNA concentration and quality were evaluated using the 2100 Bioanalyser (Agilent, Santa

Clara, CA, USA).

LNCaP xenograft model

2 xlO6 LNCaP-RLX, or LNCaP-GFP cells were inoculated s.c. with equal volumes Matrigel (Becton Dickinson Labware, Bedford, MA, USA) in four sites (right and left shoulder and hip) in eight 6- to 8-week-old athymic male nude mice (BALB/c,

Charles River Laboratory, Wilmington, MA, USA) per cell line (intact mouse experiment), or in three sites (right and left shoulder, right hip) in twelve 6- to 8-week- old athymic male nude mice (BALB/c, Charles River Laboratory) per cell line (castrated mouse experiment), under mefhoxyfluorane anaesthesia (Pitman-Moore, Mississauga,

ON, Canada) as previously described (Gleave et al., 1992). Tumour length, width and height were measured thrice weekly, and volume calculated using the formula V= ttLWH/6. Tumors were grown for 42 days to approximately 100 mm3. 8 animals per group were surgically castrated via the scrotal route under mefhoxyfluorane anaesthesia

75 (Pitman-Moore) as previously described (Gleave et al., 1992). The animals were sacrificed 18 days post-castration, or 50 days post-inoculation for intact mice, using CO2 asphyxiation, and the tumors removed surgically, ensuring removal of any stromal layers. Tumours were dissected and frozen in liquid nitrogen for protein or RNA isolation, or formalin fixed for paraffin embedding. RNA was isolated from homogenized tumours in Trizol as previously described (Thompson et al., 2006). All animal procedures were performed with approval of the University of British Columbia

Committee on Animal Care (Appendix III).

Northern Blot Analysis

15-20 ug total RNA was analysed using northern blot analysis as previously described (Thompson et al., 2006). Briefly, RNA was electrophoresed, transferred to a nylon membrane, and prehybridized prior to hybridizing the membrane with 32P-labelled probe overnight. The membranes were exposed to Kodak MS film or a phosphoimager screen.

Microarray Analysis

Total RNA was treated for microarray hybridization using the 3DNA Array 350 kit (Genisphere, Hatfield, PA, USA), as described previously (Kojima et al., 2006).

Briefly, cDNA synthesized from 15 ug total RNA, was concentrated using a Microcon

YM-30 Centrifugal Filter (Millipore, Billerica, MA, USA). Samples were run in duplicate in each channel, with Universal Human Reference RNA (Strategene) as normalization control in the alternate channel.

76 cDNA in formamide-based hybridization buffer was hybridized to microarrays

(Array Facility of The Prostate Centre at Vancouver General Hospital, Vancouver,

Canada) spotted in duplicate with 21 329 70mer probe Human Operon Version 2.0 library (Operon, Huntsville, AL, USA). 3DNA Array 350 Capture Reagent was hybridized in formamide buffer to labelled cDNA previously hybridized and microarrays scanned on a Scan Array Express (Perkin Elmer, Wellesley, MA, USA). Microarray spot intensity was quantified using ImaGene 4.2 software (BioDiscovery, EI Segundo,

CA, USA), normalized using GeneSpring 4.2 (Agilent Technologies, Palo Alto, CA,

USA), and further analyzed using Ingenuity Pathways Analysis (Ingenuity Systems,

Redwood City, CA, USA).

Semi-Quantitative Real Time - PCR

2 ug total LNCaP RNA was DNase I (Invitrogen) treated, then reverse transcribed in IX M-MLV first strand synthesis buffer, 0.01 M DTT, 1 mM dNTPs, 6.67

U/ul M-MLV reverse transcriptase (all from Invitrogen), 1.33 U/ul RNAsin (Promega,

Madison, WI, USA), and 8.33 U/ul random hexamers.

The semi-quantitative real time - PCR (Q-PCR) mix contained cDNA from the reverse transcription reaction, IX TaqMan mix (Applied Biosystems, Foster City, CA,

USA), and primers and probes for relaxin, (see Appendix IV for sequences), Wntl 1,

IRS-2 (Applied Biosystems), and 18S rRNA as the endogenous control (Applied

Biosystems). PCDHY was detected using SYBR Green (Invitrogen) and P-actin as the endogenous control. Transcript levels were detected using the ABI 7900 HT Sequence

Detection System (Applied Biosystems).

77 Tissue Microarrays

Formalin fixed xenograft tumours were paraffin embedded, arrayed into two tissue microarrays (TMAs), sliced, and affixed to slides. The intact mouse-TMA contained 10 LNCaP-GFP tumours, and 12 LNCaP-RLX tumours, in quadruplicate. The castrated mouse-TMA contained 24 LNCaP-GFP tumours, and 28 LNCaP-RLX tumours, in triplicate.

The TMA of 111 human patient samples was generated as previously described as TMA-NHT-V2 in Chapter 2 (Kiyama et al., 2003a; Thompson et al., 2006). Briefly, formalin-fixed, paraffin-embedded human prostate tissue cores were selected, arrayed into recipient paraffin blocks, and 5 |im sections cut and mounted to slides (Kiyama et al., 2003b). This TMA consisted of 111 patient samples arrayed in triplicate, representing patients roughly matched for stage and grade, treated with neoadjuvant hormone therapy (NHT) for 0 (n=21), <3 (n=21), 3-6 (n=28), and >6 months (n=28), and

Al patients (n=13). Al patient samples were collected from distal sites, including bone

(n=6), liver (n=2), lymph nodes (n=3), and adrenal (n=2). Neoadjuvant hormone therapy involved medical castration via LHRH analogue, with or without non-steroidal anti- androgen. Informed consent was obtained from each patient to use their tissues for research.

Immunohistochemistry

Immunohistochemical (IHC) staining was performed with heat-activated antigen retrieval in citrate buffer (Thompson et al., 2006) for LGR7, relaxin, Wntl 1, and |3-

78 catenin. LGR7 was detected using rabbit polyclonal anti-LGR7 antibody (GeneTex, San

Antonio, TX, USA) diluted 1:100; relaxin was detected using rabbit polyclonal anti-

relaxin H2 antibody (Thompson et al., 2006) diluted 1:100, and Wntl 1 was detected

using goat anti-mouse Wntl 1 antibody (R&D Systems, Minneapolis, MN, USA) diluted

1:100, then treated with biotinylated secondary antibody (DAKO LSAB+ System,

LINK, Mississauga, Canada). IHC staining for P-catenin was performed with Vector

M.O.M Immunodetection Kit (Vector, Burlingame, CA, USA) and mouse anti-P-catenin

antibody (BD Transduction, San Jose, CA USA) diluted 1:100. IHC utilized the

Discovery XT (Ventana Medical Systems, Tucson, AZ).

Slides were scored for relaxin, LGR7, and Wntl 1 staining by a pathologist (L.F.)

with a system of four grades of staining: 0 - absent, to 3 - high staining intensity. Slides

were scored for subcellular localization of P-catenin by a pathologist (D.T.), using a

system of 3 grades of staining at the cytoplasmic membrane and the cytoplasm. Slides were photomicrographed using the BLISS system (Bacus Laboratories, Inc. Lombard,

IL, USA), and scored with automated quantitative image analysis software, Image Pro-

Plus (Media Cybernetics, Carlsbad, CA, USA).

Statistics

To analyze the relaxin expression by Q-PCR, and IHC, a two-tailed student's t-

test was performed using GraphPad Prism (GraphPad Software, Inc., San Diego, CA).

Standard error of the mean was used to generate error bars for graphs of both Q-PCR

and tumour volume results.

79 3.3 Results

Relaxin overexpression results in larger tumours through paracrine or autocrine fashion

To study the role of relaxin in prostate cancer, we created LNCaP cells stably overexpressing relaxin (LNCaP-RLX), using a pIRES-GFP vector (Fig. 3.1 A). Northern blot analysis indicated that in vitro LNCaP-RLX expressed higher levels of relaxin than empty vector (LNCaP-GFP) or parental controls (Fig. 3.IB). The relaxin message in

LNCaP-RLX samples is larger than the endogenous relaxin mRNA species due to the

IRES and GFP mRNA sequences present on the bicistronic message. This was validated by probing for GFP, which co-migrated with the overexpressed relaxin band, was detectable in LNCaP-GFP, and was not present in parental LNCaPs.

LNCaP-RLX and LNCaP-GFP were inoculated s.c. into intact male nude mice and resulting xenografts analysed for relaxin expression. LNCaP-RLX xenografts had substantially higher levels of relaxin mRNA than control, which was barely detectable using northern blot analysis (Fig. 3.1C). Tissue microarrays (TMAs) of paraffin embedded xenografts were generated to characterize protein expression differences in

LNCaP-RLX and LNCaP-GFP. Protein levels of relaxin were 1.4 fold (p<0.05, t-test) higher than control tumour as measured by immunohistochemistry (IHC) in LNCaP -

RLX-TMA-I (Fig. 3.2A). Relaxin staining is largely cytoplasmic, and restricted to the epithelial cells (Fig. 3.2B-C). To help determine if relaxin overexpression could have a biological effect through an autocrine or paracrine mechanism, LNCaP-RLX-TMA-I was analyzed for the relaxin receptor, LGR7. All tumors analyzed had detectable levels

80 P CMV

Relaxin

IRES

GFP

r PCMV ^> Relaxing IRES ^> GFP ^>

PCMV ^> IRES^> GFP ^>

R

_XJ p o ct •1 "D CL C O TO Z CD LNCaP-GFP LNCaPftLX O

RLX-IRES-GFP RLX-IRES-GFP

relaxin relaxin

RLX-IRES-GFP

Figure 3.1 Relaxin is overexpressed in LNCaP-RLX stable cell lines, a) Schematic drawing of pIRES-RLX-neo construct, indicating pIRES sequence between relaxin and GFP genes. LNCaP-RLX expresses higher levels of relaxin-containing transcript than LNCaP-GFP using Northern blot b) in tissue culture and c) in xenografts, detected using 15 ug total RNA on Northern blots probed for relaxin.

81 3 3 s o 2.5 2.5 - X 2 rr 2 O 0) 1.5 1.5 OJ 1 — 1 > 0.5 m H 0.5 < 0 0 LNCaP-GF LNCaP-RLX LNC;iP-GFPLNCaP RLX

Figure 3.2 Relaxin and LGR7 protein levels are higher in LNCaP-RLX xenografts grown in intact mice compared to controls, using IHC. a) Average intensity of relaxin in LNCaP-RLX and LNCaP-GFP xenografts in LNCaP-RLX-TMA-I. Representative images of relaxin staining in b) LNCaP-GFP and c) LNCaP-RLX xenografts, d) LGR7 protein levels are slightly higher in relaxin overexpressing LNCaP xenografts in intact mice compared to empty vector controls. Representative images of LGR7 staining in e) LNCaP-GFP and f) LNCaP-RLX xenografts. Error bars are standard error of the mean.

82 of LGR7 staining, with relaxin overexpressing tumors having marginally 1.17 fold

(p<0.03, t-test) higher levels of LGR7 than control tumors (Fig. 3.2D). Both LNCaP-

RLX and LNCaP-GFP xenografts stained positively for LGR7 in prostate cancer epithelial cells (Fig. 3.2E-F), indicating that relaxin is capable of acting in an autocrine fashion in xenografts in vivo.

LGR7 levels were examined in a TMA of human patient samples treated for various durations of androgen ablation prior to radical prostatectomy (TMA-NHT-V2)

(Fig. 3.3). LGR7 levels were detectable in stromal and malignant epithelial cells at all conditions. LGR7 levels in stromal cells of patients were slightly suppressed in the less than three month NHT group compared to the untreated group, but increased with duration of androgen ablation to the greater than 6 month androgen ablation group.

LGR7 levels were low in the stroma of androgen independent (Al) tissue, especially bone metastases. In the cancerous epithelial cells of patients, LGR7 was present in the untreated group, and subsequently declined slightly with increasing duration of androgen ablation, with the lowest point at 3-6 months treatment. The epithelial LGR7 levels were higher at the greater than 6 month treatment group, and highest in the Al samples. The presence of LGR7 in stroma and epithelia indicates potential autocrine and paracrine functions for relaxin in the prostate.

We have previously shown that relaxin is upregulated in Al progression of prostate cancer (Thompson et al., 2006); therefore, we examined the effect of relaxin on prostate cancer growth using the LNCaP xenograft model in intact mice. The data demonstrated that the tumour take rate was higher in LNCaP-RLX cell line with 41% tumour take rate, compared to a 28% tumour take rate in the control group; however, the

83 2.5

P?1.5

O'J 1 H

0.5 H

<3M 3-6M >6M A]

NHT Groups (months)

3

1 -

E

-

Figure 3.3 LGR7 is expressed in malignant epithelium and stromal cells of prostate. The average scoring results of NHT array (human patients) stained for LGR7 in stroma (light shading), and cancer cells (dark shading) a). Representative LGR7 staining of b) 0, c) 3 months, d) 3-6 months, and e) 9 months NHT, and f) Al bone metastases. Error bars are standard error of the mean.

X4 size of tumours in intact mice was not statistically larger in LNCaP-RLX tumours over control (Fig. 3.4A).

To determine the effect of relaxin overexpression in an androgen depleted environment, LNCaP-RLX and LNCaP-GFP were inoculated s.c. into male nude mice that were subsequently castrated after six weeks. LNCaP-RLX xenografts had 45 fold

(p<0.009, t-test) higher levels of relaxin mRNA than control, as determined by Q-PCR.

TMAs were generated from paraffin embedded xenografts for protein expression and localization analyses, and labeled LNCaP-RLX-TMA-C. LNCaP-RLX xenografts from castrate mice did not exhibit higher relaxin protein levels than control, determined by

IHC of LNCaP-RLX-TMA-C; however, the staining intensity was higher than in the

LNCaP-GFP samples from intact mice (Data not shown). This suggests that endogenous relaxin protein levels are elevated in castration, supporting RNA data in

Chapter 2, and that the relaxin protein levels in the control xenografts are similar to those in LNCaP-RLX in castrated mice. As expected, there was no change in LGR7 between the 2 groups using IHC in LNCaP-RLX-TMA-C. Despite this, LNCaP-RLX tumours displayed an increased take rate of 83% compared to 67% in the LNCaP-GFP group. The tumours in the LNCaP-RLX group grew more rapidly than those in the

LNCaP-GFP group by as early as 39 days post inoculation (Fig. 3.4B), at which point the mice had not been castrated. After castration at day 42, growth rates of LNCaP-RLX and control xenografts were approximately the same. At termination of the experiment,

21 days post castration, the average LNCaP-RLX tumour size was 172 mm3 compared to control at 89 mm3. We anticipate that since endogenous relaxin is elevated by castration

(Chapter 2: Thompson et al., 2006), and there is no difference in protein levels of relaxin

85 B

time post inoculation (days)

Figure 3.4 LNCaP-RLX xenograft tumours grow more rapidly than LNCaP-GFP xenografts in intact mice. Nude mice were inoculated with 2 x 106 LNCaP-RLX or LNCaP-GFP cells, and examined for tumor volume, a) LNCaP-RLX tumors tended to be larger than LNCaP-GFP xenografts in intact mice, though the difference was not significant, b) In a subsequent experiment, LNCaP-RLX xenografts grew faster than LNCaP-GFP prior to castration 42 days after inoculation, resulting in LNCaP-RLX xenografts being larger than LNCaP-GFP xenografts; however, tumour growth rates were similar after castration for both LNCaP-RLX and LNCaP-GFP. Error bars are standard error of the mean.

86 between LNCaP-GFP and LNCaP-RLX in the xenograft TMAs from castrated mice, the effects of overexpressed recombinant relaxin are less evident.

Relaxin overexpressing tumours upregulate Wntl 1 by upregulating PCDHY

To investigate novel mechanisms by which relaxin overexpression might affect prostate tumours, RNA from LNCaP-RLX and LNCaP-GFP xenografts grown in intact mice was expression profiled using high density oligomer microarrays representing 21

329 genes. Assembling this data set into Ingenuity Pathway Analysis helped highlight biological pathways that might be regulated by relaxin in prostate tumours. One gene highly upregulated by relaxin was Wntl 1, which was upregulated an average 3.56 fold in 8 tumours. The results were validated using Q-PCR, and found to be upregulated 5.6 fold in the same set of tumours (Table 3.1). Two androgen regulated genes, PSA and

IRS-2 (Chapter 4), were downregulated in LNCaP-RLX compared to LNCaP-GFP in microarray analysis, and validated using Q-PCR (Table 3.1). Wntl 1 levels are not highly upregulated in relaxin overexpressing tumours compared to LNCaP-GFP controls in castrated mice (Table 3.1), but this is likely due to Wntl 1 being upregulated by androgen withdrawal, a condition which also upregulates relaxin as we have previously shown (Thompson et al., 2006). Wntl 1 was also slightly upregulated in LNCaP-RLX cells grown in tissue culture, compared to LNCaP-GFP controls (Table 3.1). As we found Wntl 1 to be upregulated by relaxin overexpression, and Wntl 1 is upregulated in the absence of androgens, we examined if androgen withdrawal treatment in human patients resulted in increased Wntl 1 levels. Indeed Wntl 1 levels in Al metastases and

87 Table 3.1 Relaxin overexpression upregulates PCDHY and Wntll. Summary of results of relaxin overexression in vivo and in vitro. Results are fold change above LNCaP-GFP.

cell line treatment PCDHY Wnt11 IRS 2 LNCaP-GFP intact mouse 1.00 1.00 1.00 LNCaP-RLX intact mouse 1.83 5.60 0.58 LNCaP-GFP Cx Mouse 1.00 1.00 1.00 LNCaP-RLX Cx Mouse 2.63 1.23 0.84 LNCaP-GFP in vitro 1.00 1.00 1.00 LNCaP-RLX in vitro 3.64 1.32 0.50

Cx: castrated samples from patients treated with NHT for greater than six months were significantly higher than in untreated patient samples (Fig. 3.5).

Since Wntl 1 has been shown to be upregulated by PCDHY (Yang et al., 2005), we investigated whether relaxin upregulated PCDHY as well. By Q-PCR we found that

PCDHY is upregulated in LNCaP-RLX cells in tissue culture over LNCaP-GFP, as well as in xenografts, in both castrated and intact mice. In intact mice, relaxin upregulates

PCDHY 1.83 fold (p<0.15, t-test) over control tumours, whereas in castrated mice, relaxin upregulates PCDHY 2.63 fold (p<0.05, t- test) over control (Table 3.1). In tissue culture, LNCaP-RLX has 3.6 fold higher PCDHY levels compared to LNCaP-GFP

(Table 3.1). This suggests that relaxin upregulates PCDHY in an autocrine fashion, independently of androgen withdrawal, and elevated PCDHY in turn upregulates Wntl 1.

Relaxin overexpression causes P-catenin to migrate to the cytoplasm

PCDHY expression causes /?-catenin to leave the cytoplasmic membrane and move to cytoplasm or nucleus (Yang et al., 2005). To determine if the increase in

PCDHY expression in LNCaP-RLX cells resulted in altered /?-catenin localization,

LNCaP-RLX-TMA-I and LNCaP-RLX-TMA-C were stained for y9-catenin and scored for subcellular localization (Fig. 3.6). There was no detectable change in /?-catenin localization in castrated mice, utilizing IHC. /J-catenin is located primarily at the cytoplasmic membrane in LNCaP-RLX and control xenografts from intact nude mice

(Fig. 3.6A); however, LNCaP-RLX samples have 1.4 fold higher cytoplasmic /5-catenin levels than the controls, though the change is statistically significantly different (p<0.2, t-test) (Fig. 3.6B). These results indicate that relaxin upregulation causes increased

89 D

2.5

CO

S 1.5

? 1.0 o

w 0.5 <3 3-6 >6M 0.0 ml NHT Groups (months)

Figure 3.5 Wntll staining is increased after six months NHT, and sustained in Al metastases in human patient samples. Representative Wntl 1 IHC staining of the epithelia in patients receiving NHT for a) O mo, b) <3 mo, c) 3-6 mo, d) >6 mo, and in Al metastases in e) bone or f) liver, g) The average Wntl 1 scoring results. Error bars are standard error of the mean.

90 q i/gi

s

2

LNCiiP- RLX

B

5 o 16

1.2 •ca

0 8

If) iS a. o 04 >. O

LNCaP-

RLX

Figure 3.6 Relaxin overexpression causes p-catenin to translocate to the cytoplasm in intact mice, a) Membrane P-catenin staining is no different in LNCaP-RLX than LNCaP-GFP xenografts in intact mice (p-value >0.5, t-test). b) LNCaP-RLX xenografts have a higher proportion of cytoplasmic P-catenin than control xenografts in intact mice, though this is not statistically significant (p-value <0.2, t-test).

91 cytoplasmic P-catenin localization, likely due to an upregulation of PCDHY in intact mice.

3.4 Discussion

The aim of this work was to identify biological pathways regulated by relaxin in prostate cancer cells. Relaxin is a peptide hormone of diverse functions in many tissues.

We show that relaxin overexpression enhances tumour growth in xenografts in intact mice, and illuminate a novel relaxin-regulated pathway involving PCDHY and Wntl 1.

Additionally the distribution of the relaxin receptor, LGR7, is characterized for the first time here in human prostate cancer patient samples.

LNCaP-RLX xenografts in intact male nude mice exhibited no significant difference in tumour volume from control, although in castrated nude mice LNCaP-RLX were larger. This difference in tumour volume was apparent before castration of mice, indicating that relaxin enhances prostate cancer cell growth in vivo in the presence of androgens. Endogenous relaxin is upregulated in prostate cancer xenografts from castrated mice (Data not shown), and in patients following androgen ablation (Chapter 2:

Thompson et al., 2006). This may explain why there is no difference in tumour growth rate after castration between LNCaP-RLX and LNCaP-GFP. In support of this, relaxin protein levels were similar in LNCaP-GFP and LNCaP-RLX groups when the tumours were harvested post-castration.

Other groups have seen relaxin increase tumour volume through various mechanisms in prostate cancer, including increased angiogenesis (Silvertown et al.,

92 2006), increased proliferation (Feng et al., 2007), and p53 mutation (Vinall et al., 2006), and in other cancers, including mammary (Binder et al., 2002; Radestock et al., 2005), thyroid (Hombach-Klonisch et al., 2006), and endometrial cancers (Kamat et al., 2006).

We sought, in an unbiased approach, novel mechanisms of relaxin action using microarray analysis.

To see if prostate cancer cells could themselves be responsive to relaxin, we examined LGR7 levels and cell type distribution. LGR7 is present in LNCaP xenografts in intact male nude mice, and has been detected in LNCaP cells in vitro (Vinall et al.,

2006) and in PC3 cells in vivo (Silvertown et al., 2006). Xenograft results were validated in human prostate cancer samples. We characterize for the first time LGR7 protein in malignant epithelial and stromal prostate cells, indicating the potential of paracrine and autocrine roles of relaxin in prostate cancer. Compared to epithelial relaxin expression, the increase of stromal LGR7 is delayed in androgen ablated prostate cancer patients (Thompson et al., 2006). The epithelial cells maintain LGR7 throughout androgen ablation with minor fluctuations. LGR7 is almost exclusively localized to the malignant epithelial cells of Al bone metastases, which also express elevated levels of relaxin (Thompson et al., 2006). Taken together, these results indicate an autocrine role for relaxin in prostate cancer.

Microarray analysis of LNCaP-RLX xenografts compared to control indicated upregulation of Wntl 1, a novel function for relaxin. Like relaxin, Wntl 1 has been reported to be upregulated by androgen ablation (Zhu et al., 2004a). Wntl 1 is negatively regulated by androgens in prostate cancer, and negatively regulates AR transcriptional activity in androgen dependent cells. This complex regulation is relieved, however, in

93 Al prostate cancer cells (Zhu et al, 2004a). Wntl 1 is upregulated in prostate cancers with increased Gleason score (Zhu et al., 2004a), has been shown to transform and enhance migration of mammary (Christiansen et al., 1996) and intestinal epithelial cells

(Ouko et al., 2004a). In some tissues, relaxin is capable of enhancing cell migration

(Kamat et al., 2006; Silvertown et al., 2003), and Wntl 1 expression may be a novel mechanism by which relaxin mediates this effect.

As Wntl 1 is upregulated by PCDHY (Yang et al., 2005), another gene upregulated in Al (Terry et al., 2006a), we sought to determine the hierarchy of this pathway. PCDHY and Wntl 1 were both upregulated in LNCaP-RLX xenografts in the presence or absence of androgens, indicating that relaxin is likely upstream of both

PCDHY and Wntl 1. PCDHY enables LNCaP growth in castrated hosts (Terry et al,

2006a), suggesting a novel method by which relaxin may aid LNCaP grow faster than controls in castrated mice. In addition, LNCaP-RLX cells grown in vitro in full serum exhibit upregulated levels of PCDHY and Wntl 1, further suggesting an autocrine mechanism of relaxin effect on LNCaP cells.

PCDHY is a protocadherin that lacks a signal sequence; therefore, it is localized to the cytoplasm (Chen et al, 2002). PCDHY shares homology with the protocadherins, and shares homology at its C-terminal with the P-catenin binding domain of E-cadherin. p-catenin and PCDHY colocalize to the cytoplasm, permitting P-catenin mediated signalling (Chen et al., 2002). To confirm that PCDHY mediated upregulation of

Wntl 1, we assayed TMAs of LNCaP-RLX and LNCaP-GFP xenografts for p-catenin subcellular localization, and determined that P-catenin is driven to the cytoplasm in

LNCaP-RLX, but not in LNCaP-GFP. The cytoplasmic localization of p-catenin by IHC

3 94 is indicative of P-catenin signalling (Chesire et al., 2000; Terry et al., 2006a). Our work supports previous results, indicating that the canonical p-catenin pathway is upregulated through upregulation of PCDHY (Chen et al, 2002; Terry et al., 2006a; Yang et al.,

2005) .

Wnt signalling has been postulated to be relevant in prostate cancer through a number of lines of evidene, with about 5% of cancers having P-catenin or adenomatous polyposis coli mutations (Chesire et al., 2000; Voeller et al., 1998). P-catenin has been studied in malignant mesothelioma (Fox and Dharmarajan, 2006), lung (Daniel et al.,

2006) , multiple myeloma (Pearse, 2006), and colon cancer (Radtke and Clevers, 2005).

In colon cancer, there are inactivating mutations in the proteins involved in P-catenin degradation, as well as activating mutations in p-catenin (Terry et al., 2006b). Very few activating mutations of P-catenin have been found in prostate cancer, although in some cases there is P-catenin accumulation without activating mutations in P-catenin itself

(Chesire et al, 2000).

P-catenin is involved in cell-cell interactions through E-cadherin and a-catenin, is localized to the cytoplasmic membrane, and in the absence of Wnt signalling, cytosolic

P-catenin is degraded. Upon Wnt signalling, P-catenin dissociates from the cytoplasmic membrane, localizes in the cytosol and ultimately enters the nucleus, to activate

TCF/LEF1 transcription factors (reviewed in Terry et al., 2006b). P-catenin interacts with the AR in a ligand - dependent fashion (Mulholland et al., 2002) which is competitive with TCF/LEF1 interaction (Song et al., 2003). This interaction is ligand and AR dose dependent, and can overcome activating mutants of P-catenin (Chesire and

Isaacs, 2002; Mulholland et al., 2003). However, in the absence of androgen, relaxin is

95 CRJ3T) -—— upregulates

Birds to anc cajses dissociation from the Beta-catenin -nt-v'Tibran©, resulting in upregulation of beta-caienm- responsive genes

WNT11

Figure 3.7 Model of relaxin driving upregulation of PCDHY, with p-catenin translocating to the cytoplasm, and downstream upregulation of Wntl 1.

96 upregulated (Thompson et al, 2006), upregulating PCDHY, and this stabilizes P-catenin in the cytoplasm. In our model (Fig. 3.7), there is limited ligand for the AR, thus the competition between AR and TCF binding for P-catenin is low, with P-catenin binding

TCF. This is evidenced by enhanced P-catenin activation seen in PCDHY overexpressing cells (Terry et al., 2006a).

To summarize, relaxin is negatively regulated by androgens, and is upregulated with progression to Al prostate cancer. Overexpression of relaxin results in upregulation of PCDHY and Wntl 1. Relaxin overexpression results in p-catenin translocating from the cytoplasmic membrane to the cytoplasm. PCDHY upregulates Wntl 1, likely through P-catenin signalling, in LNCaP cells (Yang et al., 2005). We add to the previous work to postulate that relaxin is driving this process by upregulating PCDHY.

Interestingly, relaxin, Wntl 1, and PCDHY are negatively regulated by androgens in

LNCaP cells. Relaxin overexpression is able to upregulate PCDHY and Wntl 1 even in the presence of androgens, in tissue culture conditions and in xenografts, therefore relaxin is likely upstream of Wntl 1 and PCDHY.

97 3.5 References

Bani, D. 1997. Relaxin: a pleiotropic hormone. Gen Pharmacol. 28:13-22. Binder, C, T. Hagemann, B. Husen, M. Schulz, and A. Einspanier. 2002. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod. 8:789-96. Chen, M.W., F. Vacherot, A. De La Taille, S. Gil-Diez-De-Medina, R. Shen, R.A. Friedman, M. Burchardt, D.K. Chopin, and R. Buttyan. 2002. The emergence of protocadherin-PC expression during the acquisition of apoptosis-resistance by prostate cancer cells. Oncogene. 21:7861-71. Chesire, D.R., CM. Ewing, J. Sauvageot, G.S. Bova, and W.B. Isaacs. 2000. Detection and analysis of beta-catenin mutations in prostate cancer. Prostate. 45:323-34. Chesire, D.R., and W.B. Isaacs. 2002. Ligand-dependent inhibition of beta-catenin/TCF signaling by androgen receptor. Oncogene. 21:8453-69. Christiansen, J.H., S.J. Monkley, and B.J. Wainwright. 1996. Murine WNT11 is a secreted glycoprotein that morphologically transforms mammary epithelial cells. Oncogene. 12:2705-11. Clarke, N.W. 2006. Management of the spectrum of hormone refractory prostate cancer. Eur Urol. 50:428-38; discussion 438-9. Craft, N., Y. Shostak, M. Carey, and C.L. Sawyers. 1999. A mechanism for hormone- independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med. 5:280-5. Daniel, V.C, CD. Peacock, and D.N. Watkins. 2006. Developmental signalling pathways in lung cancer. Respirology. 11:234-40. De Cooman, S., P. Gilliaux, and K. Thomas. 1983. Immunoreactive relaxin-like substance in human split ejaculates. Fertil Steril. 39:111-3. de la Taille, A., M.A. Rubin, M.-W. Chen, F. Vacherot, S.G.-D. de Medina, M. Burchardt, R. Buttyan, and D. Chopin. 2003. {betaj-Catenin-related Anomalies in Apoptosis-resistant and Hormone-refractory Prostate Cancer Cells. Clin Cancer Res. 9:1801-1807. Feng, S., I.U. Agoulnik, N.V. Bogatcheva, A.A. Kamat, B. Kwabi-Addo, R. Li, G. Ayala, M.M. Ittmann, and A.I. Agoulnik. 2007. Relaxin promotes prostate cancer progression. Clin Cancer Res. 13:1695-702. Fox, S., and A. Dharmarajan. 2006. WNT signaling in malignant mesothelioma. Front Biosci. 11:2106-12. Gleave, M.E., J.T. Hsieh, H.C Wu, A.C von Eschenbach, and L.W. Chung. 1992. Serum prostate specific antigen levels in mice bearing human prostate LNCaP tumors are determined by tumor volume and endocrine and growth factors. Cancer Res. 52:1598-605. Gunnersen, J.M., R.J. Crawford, and G.W. Tregear. 1995. Expression of the relaxin gene in rat tissues. Mol Cell Endocrinol. 110:55-64. Hombach-Klonisch, S., J. Bialek, B. Trojanowicz, E. Weber, H.J. Holzhausen, J.D. Silvertown, A.J. Summerlee, H. Dralle, C. Hoang-Vu, and T. Klonisch. 2006.

98 Relaxin enhances the oncogenic potential of human thyroid carcinoma cells. Am J Pathol. 169:617-32. Kamat, A.A., S. Feng, I.U. Agoulnik, F. Kheradmand, N.V. Bogatcheva, D. Coffey, A.K. Sood, and A.I. Agoulnik. 2006. The role of relaxin in endometrial cancer. Cancer Biol Ther. 5:71-7. Kiyama, S., K. Morrison, T. Zellweger, M. Akbari, M. Cox, D. Yu, H. Miyake, and M.E. Gleave. 2003a. Castration-induced increases in insulin-like growth factor- binding protein 2 promotes proliferation of androgen-independent human prostate LNCaP tumors. Cancer Res. 63:3575-84. Kiyama, S., K. Morrison, T. Zellweger, M. Akbari, M. Cox, D. Yu, H. Miyake, and M.E. Gleave. 2003b. Castration-Induced Increases in Insulin-Like Growth Factor-Binding Protein 2 Promotes Proliferation of Androgen-independent Human Prostate LNCaP Tumors. Cancer Res. 63:3575-3584. Kojima, S., D.J. Mulholland, S. Ettinger, L. Fazli, C.C. Nelson, and M.E. Gleave. 2006. Differential regulation of IGFBP-3 by the androgen receptor in the lineage- related androgen-dependent LNCaP and androgen-independent C4-2 prostate cancer models. Prostate. 66:971-86. Mulholland, D.J., H. Cheng, K. Reid, P.S. Rennie, and C.C. Nelson. 2002. The androgen receptor can promote beta-catenin nuclear translocation independently of adenomatous polyposis coli. J Biol Chem. 277:17933-43. Mulholland, D.J., J.T. Read, P.S. Rennie, M.E. Cox, and C.C. Nelson. 2003. Functional localization and competition between the androgen receptor and T-cell factor for nuclear beta-catenin: a means for inhibition of the Tcf signaling axis. Oncogene. 22:5602-13. Ouko, L., T.R. Ziegler, L.H. Gu, L.M. Eisenberg, and V.W. Yang. 2004a. Wntl 1 signaling promotes proliferation, transformation, and migration of IEC6 intestinal epithelial cells. J Biol Chem. 279:26707-15. Ouko, L., T.R. Ziegler, L.H. Gu, L.M. Eisenberg, and V.W. Yang. 2004b. Wntl 1 Signaling Promotes Proliferation, Transformation, and Migration of IEC6 Intestinal Epithelial Cells. J. Biol. Chem. 279:26707-26715. Pearse, R.N. 2006. Wnt antagonism in multiple myeloma: a potential cause of uncoupled bone remodeling. Clin Cancer Res. 12:6274s-6278s. Radestock, Y., C. Hoang-Vu, and S. Hombach-Klonisch. 2005. Relaxin downregulates the calcium binding protein S100A4 in MDA-MB-231 human breast cancer cells. Ann N YAcad Sci. 1041:462-9. Radtke, F., and H. Clevers. 2005. Self-renewal and cancer of the gut: two sides of a coin. Science. 307:1904-9. Rennie, P.S., and C.C. Nelson. 1998. Epigenetic mechanisms for progression of prostate cancer. Cancer Metastasis Rev. 17:401-9. Schieferstein, G., W. Voelter, H. Seeger, and T.H. Lippert. 1989. Immunoreactive relaxin in seminal plasma of man. IntJFertil. 34:215-8. Silvertown, J.D., B.J. Geddes, and A.J. Summerlee. 2003. Adenovirus-mediated expression of human prorelaxin promotes the invasive potential of canine mammary cancer cells. Endocrinology. 144:3683-91.

99 Silvertown, J.D., J. Ng, T. Sato, A.J. Summerlee, and J.A. Medin. 2006. H2 relaxin overexpression increases in vivo prostate xenograft tumor growth and angiogenesis. Int J Cancer. 118:62-73. Silvertown, J.D., J.C. Symes, A. Neschadim, T. Nonaka, J.C.H. Kao, A.J.S. Summerlee, and J.A. Medin. 2007. Analog of H2 relaxin exhibits antagonistic properties and impairs prostate tumor growth. FASEB J. 21:754-765. Sokol, R.Z., X.S. Wang, J. Lechago, P.D. Johnston, and R.S. Swerdloff. 1989. Immunohistochemical localization of relaxin in human prostate. J Histochem Cytochem. 37:1253-5. Song, L.N., R. Herrell, S. Byers, S. Shah, E.M. Wilson, and E.P. Gelmann. 2003. Beta- catenin binds to the activation function 2 region of the androgen receptor and modulates the effects of the N-terminal domain and TIF2 on ligand-dependent transcription. Mol Cell Biol. 23:1674-87. Terry, S., L. Queires, S. Gil-Diez-de-Medina, M.W. Chen, A. de la Taille, Y. Allory, P.L. Tran, CC. Abbou, R. Buttyan, and F. Vacherot. 2006a. Protocadherin-PC promotes androgen-independent prostate cancer cell growth. Prostate. 66:1100- 13. Terry, S., X. Yang, M.W. Chen, F. Vacherot, and R. Buttyan. 2006b. Multifaceted interaction between the androgen and Wnt signaling pathways and the implication for prostate cancer. J Cell Biochem. 99:402-10. Thompson, V.C., T.G. Morris, D.R. Cochrane, J. Cavanagh, L.A. Wafa, T. Hamilton, S. Wang, L. Fazli, M.E. Gleave, and CC. Nelson. 2006. Relaxin becomes upregulated during prostate cancer progression to androgen independence and is negatively regulated by androgens. Prostate. 66:1698-709. Ulrich, F., M. Krieg, E.M. Schotz, V. Link, I. Castanon, V. Schnabel, A. Taubenberger, D. Mueller, P.H. Puech, and CP. Heisenberg. 2005. Wntl 1 functions in gastrulation by controlling cell cohesion through Rab5c and E-cadherin. Dev Cell. 9:555-64. Vinall, R.L., C.G. Tepper, X.B. Shi, L.A. Xue, R. Gandour-Edwards, and R.W. de Vere White. 2006. The R273H p53 mutation can facilitate the androgen-independent growth of LNCaP by a mechanism that involves H2 relaxin and its cognate receptor LGR7. Oncogene. 25:2082-93. Voeller, H.J., C.I. Truica, and E.P. Gelmann. 1998. Beta-catenin mutations in human prostate cancer. Cancer Res. 58:2520-3. Yang, X., M.W. Chen, S. Terry, F. Vacherot, D.K. Chopin, D.L. Bemis, J. Kitajewski, M.C Benson, Y. Guo, and R. Buttyan. 2005. A human- and male-specific protocadherin that acts through the wnt signaling pathway to induce neuroendocrine transdifferentiation of prostate cancer cells. Cancer Res. 65:5263-71. Yki-Jarvinen, H., T. Wahlstrom, andM. Seppala. 1983. Immunohistochemical demonstration of relaxin in the genital tract of men. J Reprod Fertil. 69:693-5. Zhu, H., M. Mazor, Y. Kawano, M.M. Walker, H.Y. Leung, K. Armstrong, J. Waxman, and R.M. Kypta. 2004a. Analysis of Wnt gene expression in prostate cancer: mutual inhibition by WNT11 and the androgen receptor. Cancer Res. 64:7918- 26.

100 Zhu, H., M. Mazor, Y. Kawano, M.M. Walker, HY. Leung, K. Armstrong, J. Waxman, and R.M. Kypta. 2004b. Analysis of Wnt Gene Expression in Prostate Cancer: Mutual Inhibition by WNT11 and the Androgen Receptor. Cancer Res. 64:7918- 7926.

101 Chapter 4. Suppression of Androgen Signaling by IGF-I due to siRNA

Depletion of IRS-21

4.1 Introduction

In men, prostate cancer is the most commonly diagnosed cancer and the third leading cause of cancer related deaths (Canada, 2007). Prostate cancer is dependent upon androgens for survival, and is commonly treated by androgen ablation, resulting in tumour regression. In approximately 80% of men this treatment eventually fails, resulting in androgen independent (Al) prostate cancer, for which treatment options are limited (Rennie and Nelson, 1998). This is in part due to a lack of understanding of the mechanisms driving Al in prostate cancer cells. Therefore, new insights into these mechanisms are invaluable for developing new therapies for Al prostate cancer. One possible means by which prostate cancer cells may be able to proliferate in the absence of testicular androgens is by reactivation of the androgen receptor (AR). There is evidence to suggest that AR signaling can be modulated by various growth factors that have been shown to activate the AR in the absence of androgens (Culig et al., 1994; reviewed in Feldman and Feldman, 2001), while other lines of evidence show that

A version of this chapter will be submitted for publication. Thompson, V.C., Lehman, M., Lubik, A., Moore, S., Neira, M., Altamirano, M., Hendy,S., Nelson, C.C. Suppression of androgen signaling by IGF-I due to siRNA depletion of IRS-2.

102 prostatic androgens may be responsible for reactivation of AR (Mostaghel et al., 2007;

Titus et al., 2005).

IGF-I binds to and activates the IGF-I receptor (IGF-IR), which is a receptor tyrosine kinase. Insulin receptor substrates, IRS-1 and IRS-2, dock with the ligand- bound IGF-IR, are phosphorylated, and activate PI-3 kinase, resulting in Akt activation.

The downstream effects of Akt activation are increased proliferation, and inhibition of apoptosis and differentiation (reviewed in Meinbach and Lokeshwar, 2006). An additional pathway activated by IGF-IR is the MAPK pathway, with an end result of cell proliferation (reviewed in Krueckl et al., 2004; Meinbach and Lokeshwar, 2006). In mice, IRS-1 and IRS-2 are transforming in breast (Dearth et al., 2006), while overexpression of IGF-I in basal cells results in prostate cancer (DiGiovanni et al.,

2000) . IGF-I and IGF-IR are elevated in Al prostate cancer models (Nickerson et al.,

2001) . Increased plasma levels of IGF-I in humans result in an increased risk of prostate cancer (Chan et al., 1998). This indicates that IGF-I is capable of transforming the prostate, and may enable prostate cells to survive and proliferate in the absence of androgens.

IGF-I has been shown to alter AR signaling, although the results are somewhat controversial; in some cases IGF-I increases androgen receptor activation (Culig et al.,

1994), and in other cases represses androgen receptor activity (Lin et al., 2003; Lin et al.,

2001; Plymate et al, 2004). We found that IRS-2 mRNA is strongly upregulated by androgens in LNCaP cells, and that the treatment of these cells with IGF-I can lower

IRS-2 mRNA levels. We knocked down IRS-2 using siRNA as a means of exploring the interaction between the IGF axis and androgen signaling. IRS-2 knockdown led to

103 altered regulation of androgen responsive genes, prostate specific antigen (PSA), insulin

degrading enzyme (IDE), vascular endothelial growth factor (VEGF), and clusterin,

indicating that in the presence of IGF-I treatment IRS-2 is required for androgen

regulation of these gene targets.

4.2 Materials and methods

Cell Culture and Media

Cell Culture - LNCaP cells, passage 35-50, were maintained in RPMI 1640 with 5%

fetal bovine serum (FBS) and penicillin/streptomycin at 37 °C and 5% CO2.

Hormone Treatments - At approximately 60% confluency, LNCaP cells received RPMI

+ 2% charcoal stripped serum (CSS) (Hyclone, Logan, UT, USA) for 48 h prior to 1 nM

R1881 treatment or ethanol control. For microarray analysis, cells were treated with

R1881 for 72 h. For IGF-I treatment, cells were treated +/- R1881 for 72 h prior to

serum free (SF) media for 2 h, followed by 16 h 50 ng/ml IGF-I.

IRS2 siRNA experiments - Initial siRNA treatment dose curve included 5, 10, 25 and 50

nM siRNA in FBS; 5 nM siRNA was used in further experiments. For studies on effect

of IGF-I and R1881 in IRS-2 siRNA treated cells, cells were treated with R1881 for 48 h

prior to treatment of negative control siRNA or IRS-2 siRNA (Ambion, Austin, TX)

. using a 1:100 ratio of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) to SF media

for 4 hours, followed by replacement CSS and R1881. 24 h later, 50 ng/ml IGF-I was

added for 16 h incubation without SF media pretreatment.

104 AR siRNA experiments - experiments were conducted in the presence and absence of 1 nM R1881as described for IRS2 siRNA, except no IGF-I treatment was given, and cells were harvested 48 hours post siRNA addition. As well, 25 nM AR siRNA was used.

Preparation of total RNA

LNCaP cells were lysed in Trizol (Invitrogen) and total RNA isolated according to manufacturer's protocol; RNA was quantified using the ND-1000 Spectrophotometer

(Nanodrop Technologies, Wilmington, DE, USA). For microarray analysis, total RNA concentration and quality were evaluated using the 2100 Bioanalyser (Agilent, Santa

Clara, CA, USA).

Microarray Analysis

Total RNA was treated for hybridization to microarrays using the 3DNA Array

350 kit (Genisphere, Hatfield, PA, USA), following manufacturer's instructions, and as described previously (Kojima et al., 2006). Briefly, cDNA was synthesized from 10 ug total RNA with Superscript II, then concentrated using a Microcon YM-30 Centrifugal

Filter (Millipore, Billerica, MA, USA). Samples, in triplicate, were labelled with

Cyanine 5 dUTP, with Universal Human Reference RNA (Strategene, La Jolla, CA,

USA) as normalization control in the Cyanine 3 dUTP channel.

cDNA in formamide-based hybridization buffer was hybridized to microarrays

(Array Facility of The Prostate Centre at Vancouver General Hospital, Vancouver,

Canada) spotted in duplicate with 21 329 70mer probe Human Operon Version 2.0 library (Operon, Huntsville, AL, USA). 3DNA Array 350 Capture Reagent was

105 hybridized in formamide buffer to labelled cDNA previously hybridized and microarrays scanned on a Scan Array Express (Perkin Elmer, Wellesley, MA, USA). ImaGene 4.2

(BioDiscovery, EI Segundo, CA, USA) software was used for microarray spot intensity quantification; GeneSpring 4.2 (Agilent Technologies, Palo Alto, CA, USA) was used for normalization, and further analysis utilized Ingenuity Pathways Analysis (Ingenuity

Systems, Redwood City, CA, USA). Additional analysis was performed, including preliminary quality analysis of the microarray hybridizations using in-house quality scripts written in R, based on Bioconductor packages 'arrayQuality' and 'Limma'.

Normalization and statistical analysis of differential expression across different conditions was performed using linear models for microarrays implemented in 'Limma'

(Smyth, 2005).

Semi-Quantitative Real Time - PCR

2 ug total LNCaP RNA was DNase I (Invitrogen) treated, then reverse transcribed in IX M-MLV first strand synthesis buffer, 0.01 M DTT, 1 mM dNTPs, 6.67

U/ul M-MLV reverse transcriptase (all from Invitrogen), 1.33 U/ul RNAsin (Promega,

Madison, WI, USA), and 8.33 U/ul random hexamers.

The semi-quantitative real time - PCR (Q-PCR) mix contained cDNA from the reverse transcription reaction, IX TaqMan mix (Applied Biosystems, Foster City, CA,

USA), and 0.9 uM forward PSA primer, 5' - TCTGCGGCGGTGTTCTG - 3', 0.9 uM reverse PSA primer, 5' - GCCGACCCAGCAAG - 3', and 0.2 uM PSA Taqman probe,

5' - FAM - CTACCCACTGCATCAGGAACAA -TAMRA- 3', or 0.9 uM forward clusterin primer, 5' - GAGCAGCTGAACGAGCAGTTT - 3', 0.9 uM reverse clusterin

106 primer, 5' - CTTCGCCCTTGCGTGAGGT - 3', and 0.2 uM clusterin Taqman probe, 5'

- (6-FAM)ACTGGGTGTCCCGGCTGGCA-(TAMRA-Q) - 3' (all from Operon), IRS-

2, VEGF, or IDE primer and probe mixes, (Applied Biosystems), and 18S rRNA primer and probe mix as the endogenous control (Applied Biosystems). Transcript levels were detected using the ABI 7900 HT Sequence Detection System (Applied Biosystems).

Statistics

Error bars represent standard error of the mean. Data from the AR siRNA experiment were analysed with a one-way ANOVA, followed by Tukey's multiple comparison test. Data from the IRS-2 siRNA dose curve experiment were log transformed prior to analysis by one way ANOVA, followed by Dunnett's multiple comparison test. Data from the IRS-2 siRNA plus IGF-I experiment were log transformed prior to analysis by Student's t-test with Benjamin and Hochberg multiple test correction.

4.3 Results

IRS-2 is upregulated by androgens, and decreased by IGF-I

To identify genes strongly upregulated by androgens, we compared expression profiles of LNCaP cells treated in vitro with InM R1881 for 72 hours with ethanol control treated LNCaPs, using high density oligo microarrays representing 21 329 genes.

We found that IRS-2 is consistently upregulated 12-fold by androgens, regardless of any additional treatment of LNCaPs, using microarray analysis (data not shown). R1881

107 consistently induced IRS-2 levels as much as 3.6 fold in LNCaPs using Q-PCR in several experiments (Figs. 4.1 and 4.4A).

When LNCaP cells are grown in serum free (SF) conditions for 2h prior to 16 hour IGF-I treatment in SF media, there is an approximately 50% reduction in IRS-2 levels regardless of whether cells are co-treated with androgen or not; however, IRS-2 levels are almost 100% higher when cells are treated with R1881 and IGF-I than when treated with IGF-I alone (Fig. 4.1). The decrease in IRS-2 in response to IGF-I treatment has been characterized at the protein level, as IGF-I treatment increases proteasomal degradation of IRS-2 (Briaud et al., 2005; Kim et al., 2005; Morelli et al.,

2003; Rui et al, 2001); however, the effect of IGF-I on IRS-2 levels in the prostate has not been explored.

To further characterize the androgen mediated change in IRS-2, we used siRNA to knock down the AR (Fig. 4.2). In these R1881 treated cells, IRS-2 levels were reduced by approximately 30% compared to negative control treated cells. The AR levels were reduced by more than 50%, as was the hallmark androgen regulated gene,

PSA. This further indicates that IRS-2 is regulated by androgens, and this regulation is mediated through the AR.

108 3

2.5

2

1 5

o •4—' UJ an +

GO 00 Si-

Figure 4.1 IGF-I treatment reduces IRS-2 mRNA levels. LNCaP cells were treated with or without 1 nM R1881 in 2% CSS for 80h, serum starved for 2 h, then treated with 50 ng/ml IGF-I. Q-PCR results are fold change in mRNA compared to ethanol control, and representative of at least 3 experiments. Error bars are standard error of the mean.

109 Lipofectamine Negative ARsiRNA control siRNA

Figure 4.2 AR siRNA knocks down AR mRNA and abrogates androgen mediated transcription of PSA and IRS-2. LNCaP cells were treated with 1 nM R1881 in 2% CSS for 48h, prior to treatment with 25 nM AR siRNA or negative siRNA. AR expression: dark shading; PSA expression: hatch marks; IRS-2 expression: light shading. Q-PCR results are fold change in mRNA compared to R1881 treated lipofectamine control, and representative of at least 3 experiments. * pO.001 compared to negative siRNA or liopfectamine control, ** p<0.05 compared to negative siRNA or liopfectamine control, f p<0.05 compared to lipofectamine control (ANOVA and Tukey's Multiple Comparison Test). Error bars are standard error of the mean.

110 Decreasing IRS-2 levels alters IGF-I and androgen regulation of androgen responsive genes

Since IGF-I, which signals through IRS-2, has been reported to activate the AR, and we demonstrated that IRS-2 is upregulated by androgens in LNCaP cells, we wanted to examine the effect of IRS-2 siRNA treatment on androgen regulated gene expression in LNCaP cells. We first determined that 5 nM siRNA was the minimal concentration suitable for knocking down IRS-2 mRNA; IRS-2 mRNA was reduced to 39% of negative control levels, using Q-PCR (Fig. 4.3). Compared to negative siRNA treated cells, IRS-2 siRNA reduces IRS-2 levels to 28% with R1881 treatment alone, and to

19%o in R1881 and IGF-I co-treated cells. IRS-2 is decreased by IRS-2 siRNA in all treatment conditions other than control, compared to respective treatment conditions in negative siRNA. However, IRS-2 levels do not drop below ethanol control treated levels seen in negative siRNA cells except when IGF-I is added to IRS-2 siRNA treated cells

(Fig. 4.4A). Treating LNCaP cells with negative control siRNA decreased the magnitude of androgen-mediated upregulation of IRS-2, likely due to an off-target effect of the siRNA which in part decrease AR mRNA levels (Fig. 4.2). IGF-I alone decreases

IRS-2 levels in cells treated with IRS-2 siRNA (Fig 4.4A). In R1881 treated cells transfected with siRNA, IRS-2 levels are decreased slightly by IGF-I. These results likely differ from those seen in Figure 4.1 since cells treated with siRNA were not serum starved prior to treatment with IGF-I.

Ill 2

CN CO CC cCDn a as sz o

.0

5 10 25 50

nM siRNA

Figure 4.3 IRS-2 siRNA dose curve. Effect of IRS-2 siRNA to knock down IRS-2 mRNA was compared to negative siRNA at 5, 10, 25, and 50 nM siRNA, in 5% FBS- RPMI. Q-PCR results are fold change in mRNA compared to lipofectamine control (0 nM siRNA), when treated with negative siRNA (light shading), or IRS-2 siRNA (dark shading). Results are representative of experiment performed in triplicate.

112 siRNA Neg IRS-2 siRNA Neg IRS-2

R1B81 + + + + + + R1881 + + + + + + IGF-I + + - + + - + IGF-I + - + + - + + - + 6 5 f D 4.5 5 * 4 3.5 o 4 r ** * ce rf i—; OT ] : —Cn 9 2 £2 * 1.5 fr• 1 it :p:*=ti=op I 0.5 An, l*L 0 trr. 1*1 Pi (1 n 0 40 t 3.5 35 3 30 02.5 25 2 2 < 20 2! r ° 1 5 k~ j r -j Q_ 15 n w n 10 L a; 5 0.5 0 _ r—i I—I ft 0 14

12 a T ^10 ** i-n ' **' f •** CD 8 * to o= 6 H 4 1 itl S 2 n n PI r*i 0 -ft

Figure 4.4 IRS-2 is required for androgen mediated transcription in the presence of R1881 and IGF-I. LNCaP cells were treated with or without 1 nM R1881 in 2% CSS for 48h, then treated with 5 nM IRS-2, negative siRNA, or lipofectamine control for 24 h, then treated with 50 ng/ml IGF-I for 16 h. Q-PCR results are fold change in mRNA compared to ethanol control treated lipofectamine control, and representative of at least 3 experiments. IRS-2 siRNA decreases A) IRS-2 mRNA, and several AR- regulated genes, including B) PSA, C) clusterin, D) IDE, and E) VEGF mRNA in the presence of R1881 and IGF-I.

113 To explore the effects of IRS-2 on androgen signaling in LNCaP cells, we examined PSA and total clusterin, two androgen-regulated genes, in IRS-2 siRNA treated cells using Q-PCR (Fig. 4.4 B and C). PSA and total clusterin levels were increased by 1 nM R1881 as expected (Cochrane et al., 2007). PSA and clusterin leVels were not significantly affected by IGF-I treatment except when cells were treated with

IRS-2 siRNA and R1881, which caused a very large decrease in PSA and clusterin mRNA. The effect of IGF-I on PSA expression agrees with others who have shown that

IGF-I does not affect the androgen mediated increase of PSA in LNCaP cells (Culig et al., 1994). In the negative control siRNA treatment group, PSA mRNA levels are not as strongly upregulated by androgens. This is similar to the effect of negative siRNA treatment on IRS-2 levels which we have shown result in a slight decrease of AR levels

(Fig. 4.2). However, treatment with negative siRNA causes an increase in total clusterin mRNA levels compared to treatment with lipofectamine only. The decrease of PSA and total clusterin in IRS-2 siRNA treated cells due to IGF-I and R1881 indicates that IRS-2 is required for androgen signaling in the presence of IGF-I.

We have also identified in our microarray and expression studies herein that IDE and VEGF are both upregulated by R1881 or IGF-I alone, with R1881 causing a much larger increase than IGF-I in untreated cells. VEGF is decreased by IGF-I alone in IRS-

2 siRNA treated cells. In control treated cells, VEGF is upregulated by R1881 regardless of IGF-I treatment. In summary, all of these androgen responsive genes are downregulated by IGF-I and Rl 881 with knockdown of IRS-2 with siRNA. IGF-I signaling is not simply abrogated by decreased IRS-2, but is actually negatively affecting

AR-regulated gene expression, as decreased IRS-2 results in decreased androgen activity

114 in the presence of IGF-I. This implies that IRS-2 is required for optimal androgen- mediated transcription in the presence of IGF-I.

Effect of IRS-2 siRNA on downstream signaling molecules

To determine that androgen signaling was affected by IRS-2, and not merely by loss of AR or IGF-IR, we looked at protein levels of IRS-2, AR and IGF-IR. IRS-2 is undetectable in any samples, (Fig. 4.5 A) likely due to low levels of IRS-2 protein. To ensure that the siRNA treatment did not affect the IGF-IR, we examined IGF-IR protein levels. IGF-IR is present in all conditions, indicating that the lack of androgen signaling in the IRS-2 siRNA group treated with R1881 and IGF-I is not due to a lack of IGF-IR

(Fig. 4.5A). Likewise, we examined AR levels, and found that AR is much lower in

IRS-2 siRNA treated cells treated with R1881in the presence and absence of IGF-I (Fig.

4.5 A). However, the AR levels appear to be similar in R1881 or R1881 and IGF-I treated cells. The androgen regulated genes had very different expression levels in these two groups, with co- treatment of IGF-I and R1881 greatly decreasing levels of androgen responsive genes, PSA, VEGF, clusterin, and IDE, compared to R1881 treatment alone. This indicates that while AR levels are lower in this condition, this is not the source of decreased androgen signaling in the presence of R1881 and IGF-I.

To determine if signaling was occurring through IRS-2 in response to androgen treatment, we performed an immunoassay to detect downstream signaling molecules.

Akt, p38, and ERK are present in all samples (Fig. 4.5B), indicating that these proteins would still be capable of transmitting IGF-I signal. This indicates that IRS-2 downregulation may have a role in the IGF-I mediated inhibition of androgen signaling.

115 siRNA Neg IRS-2

A R1881 --++--++..++ IGF-I -+-+-+-+-+- +

AR » T— ff, — 1 —- —* —* *"'

vinculin — —.«•»<

IGF-IR beta _

SiRNA Neg _j_RS-2 FJ R1881 + + - - + + - - + + IGF-I -+-+-+-+-+.+

Akt

p38 •

vinculin •

ERK mm

vinculin _;

Figure 4.5 Effect of IRS-2 siRNA on AR and IGF signaling molecules. Western blots of 50 u.g total protein indicate IRS-2, AR, and IGF-IR are expressed in all conditions A), as are phospho-IRS-2 and downstream signaling molecules, Akt, p38 and ERK B). Under each blot vinculin loading control is shown. Blots were stripped and reprobed for vinculin.

116 4.4 Discussion

In this study, we show for the first time that androgens upregulate IRS-2 mRNA in prostate cancer cells. IRS-1 has been shown to be upregulated by testosterone in preadipocyte and myoblast cell lines (Chen et al., 2006); however, this is the first indication that IRS-2 is upregulated by androgens. Previously it has been shown that progesterone upregulates IRS-2 (Cui et al., 2003; Vassen et al., 1999), and estrogen upregulates IRS-1 (Lee et al., 1999; Oesterreich et al., 2001) in breast cancer models.

IGF-IR has also been shown to be upregulated by androgens (Krueckl et al., 2004) suggesting androgens likely accentuate IGF-I signalling through multiple mechanisms.

IRS-2 regulation, though, is complex; IRS-2 mRNA is downregulated by IGF-I in SF media (Fig. 4.1), but not in CSS media (Fig 4.3A). In other studies it has been shown that EGF blocks the IGF-I mediated proteasomal degradation of IRS-1 in prostate

(Zhang et al., 2000), but mRNA levels were not examined. IRS-2 is downregulated by

IGF-I treatment in serum starved cells by proteasomal degradation, but transcriptional regulation was not found (Briaud et al, 2005; Kim et al., 2005; Rui et al., 2001). It is possible that using Q-PCR to detect mRNA changes is more sensitive than previous methods used or that the cell culture context results in differential observations.

While there is no evidence of IRS-2 mRNA regulation by IGF-I, there is evidence that IRS-2 mRNA is downregulated by insulin. Interestingly, desensitization by insulin, through prolonged insulin treatment, results in IGF-I desensitization, and vice versa. There is no desensitization to IR by platelet derived growth factor or FBS. This may be due in part to heterodimerization between the insulin receptor (IR) and IGF-IR.

However, elevated insulin levels decrease IRS-2 mRNA and protein (Ide et al., 2004;

117 Pirola et al., 2003; Shimomura et al., 2000; Zhang et al, 2001). This decrease in IRS-2 transcription is mediated through the Akt/PI3K pathway in liver cells (Hirashima et al.,

2003), and L6 muscle cells (Pirola et al, 2003). PTEN overexpression or PI3K inhibition in the PTEN null breast cell line, MDA-MB-468, resulted in increased IRS-2

RNA and protein (Simpson et al., 2001). Therefore, it is possible that the observed increased IRS-2 bound to the p85 PI3K subunit in the presence of PI3K inhibitor in

LNCaP cells is due to increased total IRS-2 levels (Krueckl et al., 2004).

The mechanism of IRS-2 transcriptional regulation has been further defined through knockout studies in mice. In IRS-2-/- mice, insulin effects are attenuated due to loss of IRS-2, but sterol response element-binding protein-lc (SREBP-lc) is upregulated, as in wild type mice (Shimomura et al., 2000). SREBPs bind to the sterol response element (SRE) and inhibit IRS-2 transcription by inhibiting co-activator binding to the promoter (Zhang et al., 2001). FOXOl and FOX03a increase IRS-2 (Ide et al., 2004) synergistically with TFE3, a bHLH protein and transcription factor, through an E-box in the insulin response element (Nakagawa et al., 2006). SRC-3, an AR coactivator (Wu et al., 2004; Zhou et al., 2005), and AP-1 also positively regulate IRS-2 transcription in the PC3 prostate cancer cell line (Yan et al., 2006).

The effect of IGF-I treatment on prostate cancer cells has been widely studied.

Increased IGF-I levels have been correlated with increased risk of prostate cancer (Chan et al., 1998), and IGF-I is elevated in prostate cancer patients over controls (Scorilas et al., 2003). IGF-I has been seen to augment the activity of the AR in the presence or absence of androgens (Culig et al., 1994). The increase in PSA mRNA can be used to measure AR transactivation in LNCaPs, and in the present study we found IGF-I in the

118 presence of CSS to have little to no effect on PSA levels. While the lack of effect of

IGF-I alone on PSA levels agrees with previous results in LNCaPs (Culig et al., 1994), the R1881 and IGF-I result differs from the same study (Culig et al, 1994), which found that IGF-I and 5 nM R1881 increased AR transactivation. There are several reasons why the results of this study differ from the results in LNCaP in the previous study, including duration and concentration of R1881 and IGF-I treatments. It is possible that increased duration of IGF-I treatment is required for AR-stimulating effects. An additional study in LNCaPs has shown no difference in androgen response by IGF-I treatment in an androgen responsive luciferase reporter assay (Krueckl et al., 2004).

The endogenous androgen regulated genes, PSA, VEGF, and clusterin, are upregulated by R1881 when IRS-2 levels are depressed by IRS-2 siRNA, but expression is severely depressed when co-treated with R1881 and IGF-I. This is not due to a decrease in AR or IGF-IR, since there is no difference in these proteins between R1881 alone or R1881 and IGF-I treatment when IRS-2 siRNA is knocked down. These results demonstrate that IRS-2 is required for androgen mediated gene expression in the presence of IGF-I in LNCaP cells.

Knocking down IRS-2 in LNCaP cells should diminish IGF-I activation of the

Akt signaling pathway, because there is no IRS-1 in LNCaPs (Krueckl et al., 2004;

Nickerson et al., 2001). The MAPK response to IGF-I in LNCaP cells has been described as minimally present (Krueckl et al., 2004; Rochester et al., 2005). MAPK is activated by IRS-2 signalling in L6 cells (Zhang et al., 2001), and could play some role in LNCaPs. Akt, p38, and ERK are present in all conditions, indicating that signaling could occur through any of these molecules, so any changes due to IRS-2 siRNA are

119 likely through depletion of IRS-2 and not downstream signaling molecules.

Phosphorylation studies at short durations, up to 30 minutes, post IGF-I addition will have to be conducted to determine signaling pathways involved. Perhaps the Erk signaling pathway is negatively affecting AR transactivation when IRS-2 is downregulated at the mRNA level.

The expected result of knocking down IRS-2 would be to abrogate the signaling cascade of IGF-I. However, the results herein show a marked inhibitory effect of IGF-I on androgen regulated gene expression when IRS-2 is knocked down. It is difficult to directly compare the effect of IRS-2 knockdown to other studies that disrupt the IGF axis, such as IGF-IR inhibition or knock down (Rochester et al., 2005), as the end points in these two studies were different. The IGF-IR knockdown study suggests that IGF-IR signaling is necessary for phosphorylated Akt. Perhaps in our study, the treatment with

IRS-2 siRNA inhibits the phosphorylation of Akt, resulting in altered androgen signalling. Regardless of the mechanism involved, we have shown that IRS-2, an androgen regulated gene in prostate cancer cells, is required for androgen signaling in the presence of IGF-I. These studies indicate that targeting IRS-2 in prostate cancer patients may result in decrease androgen receptor function and IGF signaling.

120 4.5 References

Briaud, I., L.M. Dickson, M.K. Lingohr, J.F. McCuaig, J.C. Lawrence, and C.J. Rhodes. 2005. Insulin receptor substrate-2 proteasomal degradation mediated by a mammalian target of rapamycin (mTOR)-induced negative feedback down- regulates protein kinase B-mediated signaling pathway in beta-cells. J Biol Chem. 280:2282-93. Canada, N.C.I.o. 2007. National Cancer Institute of Canada: Canadian Cancer Statistics 2007, Toronto, Canada. Chan, J.M., M.J. Stampfer, E. Giovannucci, P.H. Gann, J. Ma, P. Wilkinson, C.H. Hennekens, and M. Pollak. 1998. Plasma insulin-like growth factor-I and prostate cancer risk: a prospective study. Science. 279:563-6. Chen, X., X. Li, H.Y. Huang, and J.F. Lin. 2006. [Effects of testosterone on insulin receptor substrate-1 and glucose transporter 4 expression in cells sensitive to insulin]. Zhonghua YiXue Za Zhi. 86:1474-7. Cochrane, D.R., Z. Wang, M. Muramaki, M.E. Gleave, and C.C. Nelson. 2007. Differential regulation of clusterin and its isoforms by androgens in prostate cells. JBiol Chem. 282:2278-87. Cui, X., Z. Lazard, P. Zhang, T.A. Hopp, and A.V. Lee. 2003. Progesterone crosstalks with insulin-like growth factor signaling in breast cancer cells via induction of insulin receptor substrate-2. Oncogene. 22:6937-41. Culig, Z., A. Hobisch, M.V. Cronauer, C. Radmayr, J. Trapman, A. Hittmair, G. Bartsch, and H. Klocker. 1994. Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res. 54:5474-8. Dearth, R.K., X. Cui, H.J. Kim, I. Kuiatse, N.A. Lawrence, X. Zhang, J. Divisova, O.L. Britton, S. Mohsin, D.C. Allred, D.L. Hadsell, and A.V. Lee. 2006. Mammary tumorigenesis and metastasis caused by overexpression of insulin receptor substrate 1 (IRS-1) or IRS-2. Mol Cell Biol. 26:9302-14. DiGiovanni, J., K. Kiguchi, A. Frijhoff, E. Wilker, D.K. Bol, L. Beltran, S. Moats, A. Ramirez, J. Jorcano, and C. Conti. 2000. Deregulated expression of insulin-like growth factor 1 in prostate epithelium leads to neoplasia in transgenic mice. Proc Natl Acad Sci USA. 97:3455-60. Feldman, B.J., and D. Feldman. 2001. The development of androgen-independent prostate cancer. Nat Rev Cancer. 1:34-45. Hirashima, Y., K. Tsuruzoe, S. Kodama, M. Igata, T. Toyonaga, K. Ueki, C. Kahn, and E. Araki. 2003. Insulin down-regulates insulin receptor substrate-2 expression through the phosphatidylinositol 3-kinase/Akt pathway. J Endocrinol. 179:253- 266. Ide, T., H. Shimano, N. Yahagi, T. Matsuzaka, M. Nakakuki, T. Yamamoto, Y. Nakagawa, A. Takahashi, H. Suzuki, H. Sone, H. Toyoshima, A. Fukamizu, and N. Yamada. 2004. SREBPs suppress IRS-2-mediated insulin signalling in the liver. Nat Cell Biol. 6:351-7. Kim, B., CM. van Golen, and EX. Feldman. 2005. Insulin-like growth factor I induces preferential degradation of insulin receptor substrate-2 through the

121 phosphatidylinositol 3-kinase pathway in human neuroblastoma cells. Endocrinology. 146:5350-7. ' Kojima, S., D.J. Mulholland, S. Ettinger, L. Fazli, CC. Nelson, and M.E. Gleave. 2006. Differential regulation of IGFBP-3 by the androgen receptor in the lineage- related androgen-dependent LNCaP and androgen-independent C4-2 prostate cancer models. Prostate. 66:971-86. Krueckl, S.L., R.A. Sikes, N.M. Edlund, R.H. Bell, A. Hurtado-Coll, L. Fazli, M.E. Gleave, and M.E. Cox. 2004. Increased insulin-like growth factor I receptor expression and signaling are components of androgen-independent progression in a lineage-derived prostate cancer progression model. Cancer Res. 64:8620-9. Lee, A.V., J.G. Jackson, J.L. Gooch, S.G. Hilsenbeck, E. Coronado-Heinsohn, C.K. Osborne, and D. Yee. 1999. Enhancement of insulin-like growth factor signaling in human breast cancer: estrogen regulation of insulin receptor substrate-1 expression in vitro and in vivo. Mol Endocrinol. 13:787-96. Lin, H.K., Y.C Hu, L. Yang, S. Altuwaijri, Y.T. Chen, H.Y. Kang, and C. Chang. 2003. Suppression versus induction of androgen receptor functions by the phosphatidylinositol 3-kinase/Akt pathway in prostate cancer LNCaP cells with different passage numbers. J Biol Chem. 278:50902-7. Lin, H.K., S. Yeh, H.Y. Kang, and C. Chang. 2001. Akt suppresses androgen-induced apoptosis by phosphorylating and inhibiting androgen receptor. Proc Natl Acad Sci USA. 98:7200-5. Meinbach, D.S., and B.L. Lokeshwar. 2006. Insulin-like growth factors and their binding proteins in prostate cancer: cause or consequence? Urol Oncol. 24:294-306. Morelli, C, C. Garofalo, M. Bartucci, and E. Surmacz. 2003. Estrogen receptor-alpha regulates the degradation of insulin receptor substrates 1 and 2 in breast cancer cells. Oncogene. 22:4007-16. Mostaghel, E.A., S.T. Page, D.W. Lin, L. Fazli, I.M. Coleman, L.D. True, B. Knudsen, D.L. Hess, CC Nelson, A.M. Matsumoto, W.J. Bremner, M.E. Gleave, and P.S. Nelson. 2007. Intraprostatic androgens and androgen-regulated gene expression persist after testosterone suppression: therapeutic implications for castration- resistant prostate cancer. Cancer Res. 67:5033-41. Nakagawa, Y., H. Shimano, T. Yoshikawa, T. Ide, M. Tamura, M. Furusawa, T. Yamamoto, N. Inoue, T. Matsuzaka, A. Takahashi, A.H. Hasty, H. Suzuki, H. Sone, H. Toyoshima, N. Yahagi, and N. Yamada. 2006. TFE3 transcriptionally activates hepatic IRS-2, participates in insulin signaling and ameliorates diabetes. Nat Med. 12:107-13. Nickerson, T., F. Chang, D. Lorimer, S.P. Smeekens, C.L. Sawyers, and M. Pollak. 2001. In vivo progression of LAPC-9 and LNCaP prostate cancer models to androgen independence is associated with increased expression of insulin-like growth factor I (IGF-I) and IGF-I receptor (IGF-IR). Cancer Res. 61:6276-80. Oesterreich, S., P. Zhang, R.L. Guler, X. Sun, E.M. Curran, W.V. Welshons, C.K. Osborne, and A.V. Lee. 2001. Re-expression of estrogen receptor alpha in estrogen receptor alpha-negative MCF-7 cells restores both estrogen and insulin• like growth factor-mediated signaling and growth. Cancer Res. 61:5771-7. Pirola, L., S. Bonnafous, A.M. Johnston, C. Chaussade, F. Portis, and E. Van Obberghen. 2003. Phosphoinositide 3-Kinase-mediated Reduction of Insulin

122 Receptor Substrate-1/2 Protein Expression via Different Mechanisms Contributes to the Insulin-induced Desensitization of Its Signaling Pathways in L6 Muscle Cells. J. Biol. Chem. 278:15641-15651. Plymate, S.R., M.K. Tennant, S.H. Culp, L. Woodke, M. Marcelli, I. Colman, P.S. Nelson, J.M. Carroll, C.T. Roberts, Jr., and J.L. Ware. 2004. Androgen receptor (AR) expression in AR-negative prostate cancer cells results in differential effects of DHT and IGF-I on proliferation and AR activity between localized and metastatic tumors. Prostate. 61:276-90. Rennie, P.S., and CC. Nelson. 1998. Epigenetic mechanisms for progression of prostate cancer. Cancer Metastasis Rev. 17:401-9. Rochester, M.A., J. Riedemann, G.O. Hellawell, S.F. Brewster, and V.M. Macaulay. 2005. Silencing of the IGF1R gene enhances sensitivity to DNA-damaging agents in both PTEN wild-type and mutant human prostate cancer. Cancer Gene Ther. 12:90-100. Rui, L., T.L. Fisher, J. Thomas, and M.F. White. 2001. Regulation of insulin/insulin-like growth factor-1 signaling by proteasome-mediated degradation of insulin receptor substrate-2. J Biol Chem. 276:40362-7. Scorilas, A., M. Plebani, S. Mazza, D. Basso, A.R. Soosaipillai, N. Katsaros, F. Pagano, and E.P. Diamandis. 2003. Serum human glandular kallikrein (hK2) and insulin• like growth factor 1 (IGF-1) improve the discrimination between prostate cancer and benign prostatic hyperplasia in combination with total and %free PSA. Prostate. 54:220-9. Shimomura, I., M. Matsuda, R.E. Hammer, Y. Bashmakov, M.S. Brown, and J.L. Goldstein. 2000. Decreased IRS-2 and increased SREBP-lc lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol Cell. 6:77-86. Simpson, L., J. Li, D. Liaw, I. Hennessy, J. Oliner, F. Christians, and R. Parsons. 2001. PTEN Expression Causes Feedback Upregulation of Insulin Receptor Substrate 2. Mol. Cell. Biol. 21:3947-3958. Smyth, G.K. 2005. Limma: linear models for microarray data. In Bioinformatics and Computational Biology Solutions using R and Bioconductor. V.C.R. Gentleman, Dudoit, S., Irizarry, R., Huber, W., editor. Springer, New York. 397-420. Titus, M.A., M.J. Schell, F.B. Lih, K.B. Tomer, and J.L. Mohler. 2005. Testosterone and Dihydrotestosterone Tissue Levels in Recurrent Prostate Cancer. Clin Cancer Res. 11:4653-4657. Vassen, L., W. Wegrzyn, and L. Klein-Hitpass. 1999. Human Insulin Receptor Substrate-2 (IRS-2) Is a Primary Progesterone Response Gene 10.1210/me. 13.3.485. Mol Endocrinol. 13:485-494. Wu, R.C., J. Qin, P. Yi, J. Wong, S.Y. Tsai, M.J. Tsai, and B.W. O'Malley. 2004. Selective phosphorylations of the SRC-3/AIB1 coactivator integrate genomic reponses to multiple cellular signaling pathways. Mol Cell. 15:937-49. Yan, J., C.T. Yu, M. Ozen, M. Ittmann, S.Y. Tsai, and M.J. Tsai. 2006. Steroid receptor coactivator-3 and activator protein-1 coordinately regulate the transcription of components of the insulin-like growth factor/AKT signaling pathway. Cancer Res. 66:11039-46.

123 Zhang, H., H. Hoff, and C. Sell. 2000. Insulin-like growth factor I-mediated degradation of insulin receptor substrate-1 is inhibited by epidermal growth factor in prostate epithelial cells. J Biol Chem. 275:22558-62. Zhang, J., J. Ou, Y. Bashmakov, J.D. Horton, M.S. Brown, and J.L. Goldstein. 2001. Insulin inhibits transcription of IRS-2 gene in rat liver through an insulin response element (IRE) that resembles IREs of other insulin-repressed genes. Proc Natl Acad Sci USA. 98:3756-61. Zhou, H.J., J. Yan, W. Luo, G. Ayala, S.H. Lin, H. Erdem, M. Ittmann, S.Y. Tsai, and M.J. Tsai. 2005. SRC-3 is required for prostate cancer cell proliferation and survival. Cancer Res. 65:7976-83.

124 Chapter 5. Discussion

5.1 Relaxin regulation in prostate cancer progression

This thesis describes the effect of androgens on relaxin and the effect of relaxin on androgen regulated genes in prostate cancer. The negative effect of androgens on relaxin expression and the clinical relevance of this finding are described in Chapter 2.

This study was the first to characterize the negative regulation of relaxin by androgens in the prostate. Vinall et al (2006) noticed an increase relaxin expression in androgen free conditions in a concurrent study, further supporting our observations. These results illustrate a possible discoordinate regulation between the endogenous relaxin promoter and exogenous relaxin promoter regions used in a chloramphenicol acetyltransferase reporter assay (Brookes et al., 1998). This discoordinate regulation is similar to that seen between endogenous and exogenous ornithine decarboxylase promoters in LNCaP cells (Bai et al., 1998; Betts et al., 1997). The human patient tissue microarray results for relaxin, LGR7, and Wntl 1 expression are supportive of the results obtained in the model system to human prostate cancer. Also, the large patient sample size used in

TMAs permits greater confidence in findings. These studies would further benefit from correlation of staining intensity to survival data; no survival data is available at this time due to lack of sufficient followup time of this contemporary cohort. Survival results could be examined with the use of a different prostate cancer tissue collection sufficiently mature for survival data. Regardless, the elevated relaxin levels seen in patients undergoing androgen ablation therapy indicate there may be a role for relaxin in promoting prostate cancer progression to androgen independence.

125 The function of relaxin overexpression in prostate cancer is addressed in Chapter

3. The relaxin receptor, LGR7, was characterized to be expressed in human patient prostate cancer and prostate stroma, indicating that increased relaxin levels can act in these cells through autocrine or paracrine mechanisms. Our work adds to recent results that demonstrated LGR7 mRNA to be expressed in cancerous and noncancerous tissues

(Feng et al, 2007), through identifying protein expression, and its localization to the stromal and cancerous tissue. It is possible that the effects described for relaxin overexpression in prostate cancer may result from relaxin signaling through LGR7 in both paracrine and autocrine mechanisms (Feng et al., 2007; Silvertown et al., 2006;

Silvertown et al., 2007; Thompson et al., 2006; Vinall et al, 2006).

We used in vivo studies to examine gene expression affected by relaxin overexpression because this considers the endocrine effects of the host and paracrine effects of the surrounding tissue. An example of the difference between in vitro and in vivo expression is that LGR7 is not expressed at detectable levels in LNCaP cells in vitro in our lab (Personal observations), but is detectable in vivo. Pretreatment with estrogen enhances relaxin effects in some tissues of the female reproductive tract (Huang et al.,

1993; Kapila and Xie, 1998; Mushayandebvu and Rajabi, 1995; Sherwood et al, 2000), indicating that LGR7 levels are affected by cell type interactions and factors that may not be present in growth media. It is not unlikely that the in vivo environment, such as that described in this thesis, contains factors that alter expression profiles of LGR7 and other molecules that are relevant to prostate cancer compared to what is seen in cell culture.

126 5.2 Relaxin regulated Wnt11 pathway

Through use of a gene expression microarray screen, I identified that the

Wntl 1/PCDH11Y pathway is upregulated in relaxin overexpressing LNCaP xenografts

(Chapter 3). PCDH11Y, a newly discovered protein, upregulates Wnt signaling and permits Al growth of prostate cancer cells (Terry et al., 2006; Yang et al., 2005).

PCDH11Y is negatively regulated by androgens (Chen et al., 2002), and its upregulation by relaxin, which is itself upregulated in the absence of androgens (Chapter 2), is interesting. Upregulation of PCDH11Y by relaxin resulted in similar results as androgen withdrawal-mediated upregulation of PCDH11Y, in that increased PCDH11Y expression resulted in P-catenin moving to the nucleus, and increased Wntl 1 levels

(Chapter 3). PCDH11Y upregulates other Wnt molecules (Yang et al., 2005); therefore, it may be possible that relaxin is associated with the increase in additional Wnt molecules.

Wntl 1 is characterized in embryonic development and in intestinal epithelial cells to stimulate cellular motility (De Calisto et al, 2005; Ouko et al., 2004; Zhu et al.,

2006); this may be a novel mechanism by which relaxin increases motility of prostate cancer cells (Feng et al., 2007). The presence of LGR7 and elevation of relaxin levels prior to Wntl 1 levels in TMAs of samples from patients undergoing androgen ablation further suggests that relaxin may act through its receptor to increase Wntl 1 in prostate cancer specimens (Chapters 2 & 3).

Relaxin has been implicated separately in prostate and cancer growth (Bigazzi et al., 1992; Binder et al., 2002; Samuel et al., 2003); therefore the effects of relaxin on

LNCaP xenograft growth were of interest. The finding that relaxin enhances tumour

127 growth agrees with other reports of relaxin overexpression in prostate cancer xenografts

(Feng et al., 2007; Silvertown et al., 2006; Silvertown et al., 2007), and is the first time this study has been performed on LNCaP cells in a suitable murine host, nude mice.

Previous studies into the effect of relaxin overexpression on LNCaP growth in SCID mice has resulted in minimal tumour take and growth, and little information of relaxin effect on LNCaP growth is reported (Silvertown et al, 2007). Our data led us to suggest a model of relaxin upregulation causing increased PCDH11Y levels, which in turn increase Wntl 1, potentially resulting in increased migration.

The s.c. LNCaP xenograft model has some inherent limitations for determining the effects of relaxin overexpression on prostate cancer. This model system is limited to monitoring tumour volume. The mechanism by which tumour volume changes can not be readily addressed in this system. LNCaP xenografts are well vascularized, and the effect of relaxin on angiogenesis may not be detectable in this system. Also, it may be difficult for further increases in angiogenesis to occur in the s.c. model, and another model, such as the kidney capsular model may be more appropriate. However, the increased tumour volume in the relaxin overexpressing xenografts suggests the possibility that relaxin may increase angiogenesis. Additionally, relaxin overexpressing

PC-3 xenografts were shown to be more well vascularized that controls (Silvertown et al., 2006). The other major relaxin-mediated effect hypothesised, was increased metastatic capability; however, the s.c. LNCaP xenograft model in nude mice is not appropriate for this observation, as LNCaP cells rarely metastasize in this model. A more appropriate model for examining this phenotype would be the orthotopic LNCaP xenograft in SCID mice. The LNCaP xenograft model has inherent heterogeneity, with

128 variations in tumour size and vascularity between tumours, evidenced even between different tumours on the same mouse. Additionally, the exact dimensions of a tumour can be difficult to measure. As a result, the average tumour volume between two groups can be expected to have quite large variance. These limitations of the s.c. LNCaP xenograft model can also explain the difference in results for the two in vivo experiments (Fig. 3.4 A & B). As well, the two experiments differed slightly, with the initial experiment utilizing intact mice having four inoculation sites, while the second experiment involving mice castrated after tumours were established had only three inoculation sites per mouse.

The LNCaP model is well characterized to be androgen sensitive, proliferating in the presence of androgens, and surviving in the absence of androgens (Gleave et al.,

1992). It secretes PSA, which can be used to monitor the androgen dependent status of the tumor (Gleave et al., 1992). These characteristics mimic the human disease, and make this cell line a useful model system. However, LNCaP tumors do not regress in the absence of androgens, and this is different from the human disease (Gleave et al.,

1992). LNCaP cells grown as xenografts can vary in vascularization, and tumour take, which may be a source of variation among biological replicates. Regardless, this xenograft is a suitable model of the human disease in its progression from androgen dependence to androgen independence.

129 5.3 IRS-2 mediates androgen regulated gene expression

In examining microarray results, I noticed that relaxin affects the regulation of genes that are characterized to be regulated by androgens, in the presence or absence of androgens. I have discussed the regulation of PCDH11Y and Wntl 1 above. Relaxin overexpression also results in downregulation of IRS-2 (Chapter 3), which is highly upregulated by androgens (Chapter 4). This is the first indication that IRS-2 is regulated by androgens; however, similar results have been found for IRS-1 in preadipocytes and moblasts (Chen et al, 2006), and IRS-1 and IRS-2 are also known to be regulated by other steroids in other tissue types (Cui et al., 2003; Lee et al., 1999; Oesterreich et al.,

2001; Vassen et al., 1999). IRS-1 is present in the prostate, prostatic intraepithelial neoplasia, and some prostate cancers (Liao et al., 2005). IRS-1 is expressed at low levels in DU145, and in prostate cell lines derived from normal prostate cells (Reiss et al., 2000); however, this protein is not expressed in LNCaPs, likely due to promoter methylation (Nickerson et al., 2001; Reiss et al., 2000), and is not expressed in LAPC4 or LAPC9 (Nickerson et al., 2001).

Effects of IGF-I on IRS-2 mRNA levels have not been described previously.

IRS-2 has a role in androgen-mediated signaling in the presence of IGF-I, as may be inferred from other studies into effects of IGF axis on AR activity (Culig et al., 1994); however, this is the first report of the requirement of IRS-2 for normal androgen mediated signaling in the presence of IGF-I stimulation. The decrease in IRS-2 by relaxin (Chapter 3) may explain the altered androgen signaling seen by relaxin overexpression. It seems that relaxin, like IGF-I, may alter androgen mediated signaling. However, unlike IGF-I, relaxin seems to inversely affect androgen signaling.

130 To attempt to characterize the effect of IRS-2 in androgen and IGF-I signaling in

LNCaP cells, I used IRS-2 siRNA. siRNA is still a novel technology, and there are "off- target" effects to consider when conducting these experiments. The use of a negative siRNA aims to control for this. Using antisense oligonucleotides, neutralizing antibodies, or small molecule inhibitors are additional ways to examine the effect of knocking down individual targets. Any results observed consistently among multiple mechanisms would increase the likelihood that the results observed are due to knocking down the target, and not an artifact of the treatment itself.

An additional novel technology used extensively for this thesis is gene expression microarrays, and this technology is continually evolving. Gene lists are being re-annotated on a regular basis as new information on gene sequences becomes available. New methods for hybridizing, printing, scanning, and analyzing arrays have emerged throughout the course of my candidacy. In fact, there are several generations of microarrays used in this thesis. The microarrays used in the identification of relaxin as a gene negatively regulated by androgens are quite different from those used in the relaxin overexpression study. The methods used to analyse the results of the relaxin overexpression study and the androgen regulation of IRS-2 differed. Regardless, the existing results have been confirmed using independent techniques such as Q-PCR or northern blots. The use of large numbers of biological and technical replicates increased the confidence of the microarray results. New array developments permit for more reliable data mining, with fewer falsely identified changes in gene expression.

Furthermore, advances in pathway analysis such as Ingenuity Pathway Analysis has helped tremendously in understanding the large data sets generated in this thesis.

131 5.4 Future Directions

We characterized quite fully the effect of androgens on relaxin expression, the involvement of the AR in this regulation, and the relevance in xenografts and human patient samples. However, we have not described the mechanism by which the AR mediates repression of relaxin, or what factors are driving relaxin expression in the prostate. Future studies to address this include treating prostate cells with prolactin, a hormone known to increase relaxin expression in some tissues, which is also implicated in prostate cancer; and studies to see if the AR is directly interacting with the relaxin promoter, such as DNA footprinting, chromatin immunoprecipitation analysis, and gel electrophoretic mobility shift assays.

Current evidence indicates that relaxin is involved in increasing tumor invasiveness through increasing tumour volume, motility and angiogenesis (Chapter 3,

Feng et al., 2007; Silvertown et al., 2006), but an increase in metastases has not been shown (Feng et al., 2007). Further research into metastatic spread using the orthotopic murine model of prostate cancer may provide additional information. Patients with metastatic breast cancer had elevated serum relaxin levels (Binder et al., 2004), and this may be an area worth studying in prostate cancer. Relaxin has been difficult to study in the sera due to poor antibodies and low circulating levels of the hormone, but newer antibodies may permit for more sensitive studies on serum relaxin levels.

The results of relaxin overexpression indicate an association between relaxin overexpression and altered PCDH11Y, Wntl 1, and IRS-2 expression. Relaxin can be knocked down in vivo using anstisense oligonucleotides to relaxin. The results of knocking down relaxin on PCDH11Y, Wntl 1, and IRS-2 will further characterize the

132 function of relaxin in the upregulation of these genes. Another way of identifying the role of relaxin on PCDH11Y or IRS-2 expression is using reporter assays to see if relaxin dosing causes increased PCDH11Y or decreased IRS-2 promoter activity in

LNCaP cells. These cells may need to be transfected with LGR7 in order for in vitro assays to be successful. Another option to see the effects of relaxin in vitro may be to co- culture LNCaPs with prostatic stromal cells expressing LGR7.

Wntl 1 has been shown to be transforming and to increase motility in other cell lines (Christiansen et al., 1996; Ouko et al., 2004). Treating LNCaPs with Wntl 1 would aid in determining if this increases cellular motility. Increased motility has been characterized for relaxin previously (Feng et al., 2007), and Wntl 1 would be a novel means of increasing relaxin-induced motility.

The PCDH11 Y/Wntl 1 and IRS-2 pathways were not the only ones identified in microarray analysis of relaxin overexpressing LNCaPs. Several interesting pathways were identified and validated using microarray analysis, and warrant further study.

Clathrin-D and clathrin-L were recently identified to be regulated by relaxin in thyroid carcinoma (Hombach-Klonisch et al., 2006), and would also be of interest to study.

Current research arising from this thesis involves examining the effects of blocking 5-a- reductase activity on androgen regulated gene expression at the protein level, using prostate cancer samples from patients treated with the 5-a-reductase blocker, dutasteride.

The effects of dutasteride on PCDH11Y, IRS-2, relaxin, and other proteins will be analyzed.

The work done to identify IRS-2 as an androgen and IGF-I regulated gene is in early stages. It would be of great interest to fully characterize the effects of IGF-I and

133 androgens on IRS-2 levels and androgen signaling. Further information would be obtained by determining the effect that serum and knocking down IRS-2 have on these treatments in vitro. This characterization would require survival and proliferation assays, and an examination of the downstream signaling pathways involved in IGF-I mediated androgen signaling. Additional analysis of the effect of IGF-I on androgen responsive genes could be achieved through ARE-luciferase assays. One way to screen for novel targets regulated by androgen and IGF-I treatment of cells is through microarray analysis of mRNA, microRNA, and protein, and these experiments are currently being performed in our lab in IRS-2 siRNA and AR siRNA treated cells. The comparison of genes differentially regulated between these two experiments will help to identify genes regulated by both androgens and IRS-2.

The finding that IRS-2 siRNA is highly effective at decreasing AR mediated signaling in IGF-I stimulated LNCaPs indicates that this could make a good therapeutic target in patients with demonstrated increased levels of IGF-I. It would be interesting to compare all of the IRS-2 knockdown studies done in LNCaP with similar studies in another cell line that expresses IRS-1. There is significant, though not complete, redundancy between these molecules. In a patient expressing both IRSs in normal tissue, but who has lost one of IRS-1 or IRS-2 in a tumour for which IGF-I signaling is deemed important, knocking down the remaining IRS molecule could be a fairly low- toxic therapy. There may be sufficient cross talk to enable the patient to survive with relatively minimal side effects. Another potential therapeutic approach may be to inhibit multiple targets at once, such as knockdown of both IRS-2 and relaxin simultaneously or in sequence in the presence and absence of androgens respectively.

134 The hypothesis of this thesis is that relaxin is involved in the activation of key pathways involved in invasion and angiogenesis during the progression of androgen independent prostate cancer, and therefore may be a suitable target for therapy. The technologies and models used in this thesis were unable to determine if relaxin increases angiogenesis in prostate cancer; however, relaxin is involved in increased invasive qualities, can increase tumour size, and upregulates genes that promote Al growth, and indicate that this may be a suitable target for novel therapeutics.

135 5.5 References

Bai, G., S. Kasper, R.J. Matusik, P.S. Rennie, J.A. Moshier, and A. Krongrad. 1998. Androgen regulation of the human ornithine decarboxylase promoter in prostate cancer cells. JAndrol. 19:127-35. Betts, A.M., I. Waite, D.E. Neal, and C.N. Robson. 1997. Androgen regulation of ornithine decarboxylase in human prostatic cells identified using differential display. FEBSLett. 405:328-32. Bigazzi, M., M.L. Brandi, G. Bani, and T.B. Sacchi. 1992. Relaxin influences the growth of MCF-7 breast cancer cells. Mitogenic and antimitogenic action depends on peptide concentration. Cancer. 70:639-43. Binder, C, T. Hagemann, B. Husen, M. Schulz, and A. Einspanier. 2002. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod. 8:789-96. Binder, C, A. Simon, L. Binder, T. Hagemann, M. Schulz, G. Emons, L. Trumper, and A. Einspanier. 2004. Elevated concentrations of serum relaxin are associated with metastatic disease in breast cancer patients. Breast Cancer Res Treat. 87:157-66. Brookes, D.E., D. Zandvliet, F. Watt, P.J. Russell, and P.L. Molloy. 1998. Relative activity and specificity of promoters from prostate-expressed genes. Prostate. 35:18-26. Chen, M.W., F. Vacherot, A. De La Taille, S. Gil-Diez-De-Medina, R. Shen, R.A. Friedman, M. Burchardt, D.K. Chopin, and R. Buttyan. 2002. The emergence of protocadherin-PC expression during the acquisition of apoptosis-resistance by prostate cancer cells. Oncogene. 21:7861-71. Chen, X., X. Li, H.Y. Huang, and J.F. Lin. 2006. [Effects of testosterone on insulin receptor substrate-1 and glucose transporter 4 expression in cells sensitive to insulin]. Zhonghua YiXueZaZhi. 86:1474-7. Christiansen, J.H., S.J. Monkley, and B.J. Wainwright. 1996. Murine WNT11 is a secreted glycoprotein that morphologically transforms mammary epithelial cells. Oncogene. 12:2705-11. Cui, X., Z. Lazard, P. Zhang, T.A. Hopp, and A.V. Lee. 2003. Progesterone crosstalks with insulin-like growth factor signaling in breast cancer cells via induction of insulin receptor substrate-2. Oncogene. 22:6937-41. Culig, Z., A. Hobisch, M.V. Cronauer, C. Radmayr, J. Trapman, A. Hittmair, G. Bartsch, and H. Klocker. 1994. Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res. 54:5474-8. De Calisto, J., C. Araya, L. Marchant, C.F. Riaz, and R. Mayor. 2005. Essential role of non-canonical Wnt signalling in neural crest migration. Development. 132:2587- 2597. Feng, S., I.U. Agoulnik, N.V. Bogatcheva, A.A. Kamat, B. Kwabi-Addo, R. Li, G. Ayala, M.M. Ittmann, and A.I. Agoulnik. 2007. Relaxin promotes prostate cancer progression. Clin Cancer Res. 13:1695-702.

136 Gleave, M.E., J.T. Hsieh, H.C. Wu, A.C. von Eschenbach, and L.W. Chung. 1992. Serum prostate specific antigen levels in mice bearing human prostate LNCaP tumors are determined by tumor volume and endocrine and growth factors. Cancer Res. 52:1598-605. Hombach-Klonisch, S., J. Bialek, B. Trojanowicz, E. Weber, HJ. Holzhausen, J.D. Silvertown, A.J. Summerlee, H. Dralle, C. Hoang-Vu, and T. Klonisch. 2006. Relaxin enhances the oncogenic potential of human thyroid carcinoma cells. Am J Pathol. 169:617-32. Huang, C, Y. Li, and L.L. Anderson. 1993. Stimulation of collagen secretion by relaxin and effect of oestrogen on relaxin binding in uterine cervical cells of pigs. J Reprod Fertil. 98:153-8. Kapila, S., and Y. Xie. 1998. Targeted induction of collagenase and stromelysin by relaxin in unprimed and beta-estradiol-primed diarthrodial joint fibrocartilaginous cells but not in synoviocytes. Lab Invest. 78:925-38. Lee, A.V., J.G. Jackson, J.L. Gooch, S.G. Hilsenbeck, E. Coronado-Heinsohn, C.K. Osborne, and D. Yee. 1999. Enhancement of insulin-like growth factor signaling in human breast cancer: estrogen regulation of insulin receptor substrate-1 expression in vitro and in vivo. Mol Endocrinol. 13:787-96. Liao, Y., U. Abel, R. Grobholz, A. Hermani, L. Trojan, P. Angel, and D. Mayer. 2005. Up-regulation of insulin-like growth factor axis components in human primary prostate cancer correlates with tumor grade. Human Pathology. 36:1186-1196. Mushayandebvu, T., and M. Rajabi. 1995. Relaxin stimulates interstitial collagenase activity in cultured uterine cervical cells from nonpregnant and pregnant but not immature guinea pigs; estradiol-17 beta restores relaxin's effect in immature cervical cells. Biol Reprod. 53:1030-1037. Nickerson, T., F. Chang, D. Lorimer, S.P. Smeekens, C.L. Sawyers, and M. Pollak. 2001. In vivo progression of LAPC-9 and LNCaP prostate cancer models to androgen independence is associated with increased expression of insulin-like growth factor I (IGF-I) and IGF-I receptor (IGF-IR). Cancer Res. 61:6276-80. Oesterreich, S., P. Zhang, R.L. Guler, X. Sun, E.M. Curran, W.V. Welshons, C.K. Osborne, and A.V. Lee. 2001. Re-expression of estrogen receptor alpha in estrogen receptor alpha-negative MCF-7 cells restores both estrogen and insulin• like growth factor-mediated signaling and growth. Cancer Res. 61:5771-7. Ouko, L., T.R. Ziegler, L.H. Gu, L.M. Eisenberg, and V.W. Yang. 2004. Wntll signaling promotes proliferation, transformation, and migration of IEC6 intestinal epithelial cells. J Biol Chem. 279:26707-15. Reiss, K., J.Y. Wang, G. Romano, F.B. Furnari, W.K. Cavenee, A. Morrione, X. Tu, and R. Baserga. 2000. IGF-I receptor signaling in a prostatic cancer cell line with a PTEN mutation. Oncogene. 19:2687-94. Samuel, C.S., H. Tian, L. Zhao, and E.P. Amento. 2003. Relaxin is a key mediator of prostate growth and male reproductive tract development. Lab Invest. 83:1055- 67. Sherwood, O.D., L.M. Olson, S. Zhao, and H.R. Little. 2000. Inhibition of nitric oxide synthase activity diminishes the acute effects of relaxin on growth, but not softening, of the cervix in the rat. Endocrinology. 141:2458-64.

137 Silvertown, J.D., J. Ng, T. Sato, AJ. Summerlee, and J.A. Medin. 2006. H2 relaxin overexpression increases in vivo prostate xenograft tumor growth and angiogenesis. Int J Cancer. 118:62-73. Silvertown, J.D., J.C. Symes, A. Neschadim, T. Nonaka, J.C.H. Kao, A.J.S. Summerlee, and J.A. Medin. 2007. Analog of H2 relaxin exhibits antagonistic properties and impairs prostate tumor growth. FASEB J. 21:754-765. Terry, S., L. Queires, S. Gil-Diez-de-Medina, M.W. Chen, A. de la Taille, Y. Allory, P.L. Tran, CC. Abbou, R. Buttyan, and F. Vacherot. 2006. Protocadherin-PC promotes androgen-independent prostate cancer cell growth. Prostate. 66:1100- 13. Thompson, V.C, T.G. Morris, D.R. Cochrane, J. Cavanagh, L.A. Wafa, T. Hamilton, S. Wang, L. Fazli, M.E. Gleave, and CC Nelson. 2006. Relaxin becomes upregulated during prostate cancer progression to androgen independence and is negatively regulated by androgens. Prostate. 66:1698-709. Vassen, L., W. Wegrzyn, and L. Klein-Hitpass. 1999. Human Insulin Receptor Substrate-2 (IRS-2) Is a Primary Progesterone Response Gene. Mol Endocrinol. 13:485-494. Vinall, R.L., C.G. Tepper, X.B. Shi, L.A. Xue, R. Gandour-Edwards, and R.W. de Vere White. 2006. The R273H p53 mutation can facilitate the androgen-independent growth of LNCaP by a mechanism that involves H2 relaxin and its cognate receptor LGR7. Oncogene. 25:2082-93. Yang, X., M.W. Chen, S. Terry, F. Vacherot, D.K. Chopin, D.L. Bemis, J. Kitajewski, M.C Benson, Y. Guo, and R. Buttyan. 2005. A human- and male-specific protocadherin that acts through the wnt signaling pathway to induce neuroendocrine transdifferentiation of prostate cancer cells. Cancer Res. 65:5263-71. Zhu, S., L. Liu, V. Korzh, Z. Gong, and B.C. Low. 2006. RhoA acts downstream of Wnt5 and Wntl 1 to regulate convergence and extension movements by involving effectors Rho kinase and Diaphanous: use of zebrafish as an in vivo model for GTPase signaling. Cell Signal. 18:359-72.

138 Appendix I. Genes upregulated at least 5-fold in R1881-treated cells

UP WITH R1881 (5 fold or higher) Gene Accession Number "kallikrein 2, prostatic" AI927872 chymotrypsinogen B1 AA845168 "CDC14 (cell division cycle 14, S. cerevisiae) homolog A" N68854 alkylation repair; alkB homolog AA609609 villin-like AI887514 "CDC14 (cell division cycle 14, S. cerevisiae) homolog B" AA417319 leukocyte-associated Ig-like receptor 1 AA991196 "inositol 1,4,5-triphosphate receptor, type 2" AA479093 "CD3Z antigen, zeta polypeptide (TiT3 complex)" AI289821 brain-specific angiogenesis inhibitor 3 H17398 "TATA box binding protein (TBP)-associated factor, RNA AI493402 polymerase I, A, 48kD" "protein kinase, AMP-activated, gamma 3 non-catalytic subunit" AA256383 prostate epithelium-specific Ets transcription factor AI668916 hypothetical protein AA708886 "POU domain, class 3, transcription factor 1" AI807330 v-myb avian myeloblastosis viral oncogene homolog N49284 cytochrome c oxidase subunit Vila polypeptide 1 (muscle) AA872125 leukocyte membrane antigen H84077 tyrosinase-related protein 1 AA424996 "butyrophilin, subfamily 3, member A3" AA478585 cathepsin K (pycnodysostosis) R00859 C18B11 homolog (44.9kD) R32439 "butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma- AA455988 butyrobetaine hydroxylase) 1" a disintegrin and metalloproteinase domain 3a (cyritestin 1) AA435963 glycoprotein A repetitions predominant AA122287 "collagen, type XV, alpha 1" AA455157

139 Appendix II. Genes down regulated at least 5-fold in R1881-treated cells

DOWN WITH R1881 (5 fold or higher) Gene Accession Number "CDC20 (cell division cycle 20, S. cerevisiae, homolog)" AA598776 hypothetical protein MGC2487 AI279844 regulator of G-protein signalling 11 AA887530 Human normal keratinocyte mRNA AI024655 diptheria toxin resistance protein required for diphthamide biosynthesis AI018643 (Saccharomyces)-like 2 Kaiso AI151208 CD 14 antigen AA701476 LIM domain only 4 H27986 "sirtuin (silent mating type information regulation 2, S.cerevisiae, AA935564 homolog) 7" "EST, Highly similar to CA34 HUMAN COLLAGEN ALPHA 3(IV) AI952285 CHAIN PRECURSOR [H.sapiens]" toll-like receptor 7 N30597 GPI-anchored metastasis-associated protein homolog AA479609 "branched chain keto acid dehydrogenase El, beta polypeptide (maple AA427739 syrup urine disease)" intercellular adhesion molecule 3 AA479188 hypothetical protein DKFZp761D1823 AA775405 toll-like receptor 3 R76099 tight junction protein 3 (zona occludens 3) AA402040 nuclear body protein Spl40 H66484 formin (limb deformity) AI040235 N-Acetylglucosamine kinase AI669862 "MAD (mothers against decapentaplegic, Drosophila) homolog 3" W72201

140 Appendix IV. Primers for quantitative RT-PCR

Primer/probe Sequence relaxin forward 5' - TGAAGCCGCAGACAGCAGT - 3' relaxin reverse 5' - AACATGGCAACATTTATTAGCCAA- 3' relaxin probe 5' - VIC- AAAATACTTAGGCTTGGATACTCATTCTCG AAAAAAGAGA-TAMRA- 3' PCDH11Y forward 5' - AAACATTATCTCCAGGAGTTTGGA - 3' PCDH11Y reverse 5' - TTGCCCTGGATACCTTTCAGA - 3' p-actin forward 5' - GCTCTTTTCCAGCCTTCCTT - 3' P-actin reverse 5' - CGGATGTCAACGTCACACTT - 3'

142