Molecular Systematics and Time-Scale for the Evolution of Timarcha, a Leaf-Beetle Genus with a Disjunct Holarctic Distribution

ARTICLE IN PRESS

MOLECULAR PHYLOGENETICS AND EVOLUTION Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx www.elsevier.com/locate/ympev

Molecular systematics and time-scale for the evolution of Timarcha, a leaf-beetle genus with a disjunct Holarctic distribution

Jesus Gomez-Zurita *

Area de Biologıa Animal, Departamento de Zoologıa y Antropologıa Fısica, Facultad de Biologıa, Universidad de Murcia, 30071 Murcia, Spain

Received 25 November 2003; revised 11 February 2004

Abstract

In recent years we have investigated the evolution of the Holarctic leaf-beetle genus Timarcha using molecular approaches, but to date several important questions remained unanswered, including its systematic arrangement in a temporal context, or the phylogenetic placement of the Nearctic taxa. Here I present a reanalysis of available genetic data together with newly generated data for key taxa (markers 16S rDNA, CO2, ITS-2, and 18S rDNA), including the Nearctic species (subgenus Americanotimarcha), using direct optimization-based phylogenetic reconstructions. Lineage ages are estimated using maximum likelihood branch-length estimates and the molecular clock calibration derived from several presumed vicariance events in the Mediterranean. Phylogenetic analyses and 18S rDNA divergences suggest the ancient divergence of the Nearctic and Palaearctic lineages, related to the North Atlantic opening in the middle Eocene. The diversiﬁcation of the Palaearctic Timarcha seems closely related to the geological evolution of the Mediterranean area during the Tertiary, with Pleistocenic climate changes aﬀecting species ranges and lineage extinction, but not resulting in extensive speciation. Ó 2004 Elsevier Inc. All rights reserved.

Keywords: Chrysomelidae; Coleoptera; Direct optimization; Biogeography; Molecular clock; Speciation; Timarcha; Vicariance

1. Introduction 2003). Only a few cases of sympatry have been reported in Timarcha taxa (Petitpierre, 1973), so that competition The Chrysomelinae leaf-beetle genus Timarcha,with and/or tension contact zones between parapatric species/ about 100 described species (around 150 taxa including populations could have an important effect on reducing subspecies), is largely distributed in Europe (63% of dispersal (Hewitt, 1989). taxa) and North Africa (35%), with a few species along Allopatry and a marked morphological plasticity of the West Coast of North America (2%) (disjunct Hol- the adults contribute to a problematic taxonomy arctic distribution; Bechyne, 1948; Crowson, 1981; Jo- (Jeanne, 1965; Stockmann, 1966; Tiberghien, 1971). For livet, 1946). This genus shows a high proportion of most Timarcha species, multiple intra- and interpopu- endemic taxa exhibiting limited dispersal abilities (Peti- lation polymorphisms in the traits commonly used for tpierre, 1973). Apterism is an obvious restriction to taxonomic purposes make it difficult to find diagnostic dispersal in this genus, as are geographical and ecolog- morphological characters (Bechyne, 1948; Petitpierre, ical barriers such as habitat fragmentation, adaptation 1970a; Stockmann, 1966). Particularly relevant prob- to island-like environments (e.g., valleys and mountain lems in the taxonomy of Timarcha are the distinction of peaks), and strong dependence on the distribution of closely related species, and at higher taxonomical levels, their host-plants (all the species of Timarcha are oli- include the subgeneric classification of the genus. There gophagous, feeding either on Rubiaceae or Plantagina- are four currently recognized subgenera in Timarcha. ceae, with few exceptions) (Gonzalez-Meg ıas et al., The Nearctic subgenus Americanotimarcha (AME) includes taxa showing many autapomorphies in anatomical, ecological, karyological, and biogeographical * Fax: +34-968-364906. characters (Jolivet, 1976; Petitpierre and Jolivet, 1976). E-mail address: [email protected]. In the Palaearctic, Metallotimarcha (MET) is also a

2 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx well-supported subgenus from a morphological point of genetic signals, possibly related to hybridization view (Bechyne, 1948), and several authors consider two between divergent lineages, which has been analyzed in other subgenera, Timarchostoma (TOM) and Timarcha more detail using a phylogeographic approach for the T. s. str. (TIM), whose validity is not so clear (e.g., goettingensis complex (Gomez-Zurita and Vogler, 2003). Stockmann, 1966). However, one of the most interesting points in the The currently accepted systematic hypothesis for evolution of Timarcha, the origin of the current disjunct Timarcha has been founded on alpha-taxonomy, bio- distribution in the Holarctic, and the phylogenetic geography (Bechyne, 1948), and on cytogenetics (Peti- placement of the Americanotimarcha in relation to the tpierre, 1970b, 1976; Petitpierre and Jolivet, 1976). In Palaearctic relatives, has not been addressed yet using this hypothesis, the subgenera Americanotimarcha and molecular evidence. The unavailability of fossils of Metallotimarcha are assumed to be of ancient origin. Timarcha except for Quaternary fossilized specimens of These taxa share some symplesiomorphic characters, T. metallica precludes making any assessment about the like the presence of a weak or absent elytral suture and absolute minimal ages of the lineages in this genus. A the lack of sexual dimorphism, suggesting the primitive molecular phylogenetic approach based on palaeogeo- status of the species in these subgenera (Bechyne, 1948; graphic inferences remains the only strategy to build a Jolivet, 1989). However, their phylogenetic relationship temporal framework for the evolution of this genus. and the time of their separation are not well established. The availability of three different molecular data sets, In the Palaearctic region, the genus would have experi- obtained from a large and systematically representative enced further radiation from the common ancestor that sample of Timarcha taxa, allows us to investigate the also originated the Metallotimarcha lineage, giving rise species tree of the group, overcoming the contingencies to the most primitive forms of the Timarchostoma sub- of the gene tree-based inferences of systematic rela- genus, i.e., the T. goettingensis species complex and re- tionships (Pamilo and Nei, 1988; Wu, 1991). The study lated taxa (TOM1; Bechyne, 1948; Petitpierre, 1970a), of multiple sources of phylogenetic data inevitably poses and subsequently, derived taxa of this subgenus mainly the problem of how to deal with potential conflict of distributed in the Iberian Peninsula. The derived status characters and alternative topologies resulting from of some Timarchostoma taxa (TOM2) is assumed from their analysis. Several strategies have been described to anatomical features such as shape of pronotum, meso- assist in the interpretation of conflict in phylogenetic sternum, and male genitalia, elytral and prothoracic studies and reconcile character or taxonomic incongru- sculptures, and karyotype analysis (Bechyne, 1948; ence. In these approaches, the goal is to find a com- Petitpierre, 1970a,b, 1976). Finally, the most recent promise upon a single solution in which the conflicting speciation events seemed to originate the Timarcha s. str. signal is either disregarded and only areas of congruence (Bechyne, 1948; Petitpierre, 1970a,b, 1976). are considered (taxonomic congruence; Mickevich, Our recent work using two mtDNA (16S rDNA and 1978) or conflict is incorporated in an optimal descrip- CO2; Gomez-Zurita et al., 2000a) and one nuclear (ITS- tion of the data (total evidence or simultaneous analysis; 2; Gomez-Zurita et al., 2000b) molecular markers gave Kluge, 1989). Direct optimization (Wheeler, 1996, partial support to the presented systematic hypothesis, 1999), a method designed to deal with length variable namely the basality of the Metallotimarcha among the sequence data in phylogenetic analyses, is a promising Palaearctic Timarcha. The genetic data also pointed to solution for the analyses of data sets with potential non-distinguishable Timarchostoma and Timarcha s. str. character conflict and is more appropriate and congru- clades, but low resolution affecting the branching of ent with the concept of total evidence (Frost et al., these clades did not allow an unambiguous statement on 2001). The strategy in direct optimization is to recon- the systematic relations of these taxa. Most of the struct a phylogeny based on a homology assessment that morphologically supported taxonomical groupings, optimizes the phylogeny itself, given a particular set of such as the T. goettingensis complex, were recovered in parameters. This is done by implementing a cost func- the gene genealogies, although the evolutionary relation to the alignment which is dynamically finding the tionships among them contradicted to some extent the optimal character transformation associated with an current systematics of Timarcha described above. We optimal (shortest) tree. One important effect of this also have postulated the role of geography and allopatry procedure is that it globally maximizes the congruence as an engine for speciation in the genus and have de- of all characters available for analysis. Direct optimi- scribed the existence of marked geographic structuring zation results are dependent on the initial cost function, in the populations of the T. goettingensis complex which is usually selected using sensitivity analyses (Gomez-Zurita et al., 2000a,b,c; Gomez-Zurita and (Wheeler, 1995), based again on the maximization of Vogler, 2003). Furthermore, the comparison of the congruence between characters analyzed together or evolutionary histories of the mitochondrial and nuclear separately. Given the potential advantages of this markers for the same set of species and individuals re- methodology, I have therefore opted for the use of direct vealed some level of disagreement between their phylo- optimization to generate the most parsimonious and ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 3 internally congruent phylogenetic hypothesis for the 2.2. Sequence data genus Timarcha. The specific aims of the present work will be: (1) to Ethanol preserved or dry collection adult specimens of use the phylogenetic information contained in all three the newly studied taxa were used as a source of DNA for markers in a simultaneous analysis to suggest an ob- molecular analyses using the DNeasy Tissue kit (Qiagen, jective systematics for Timarcha, (2) to place Ameri- West Sussex, UK). DNA quality was checked on a 1% canotimarcha in the obtained phylogenetic context and agarose/Tris–borate–EDTA gel and dilutions were made resolve the subgeneric classification of the genus based to use 1 lL of template dilution in the subsequent PCRs. on the phylogenetic analyses, and (3) to add a time- A partial fragment of the mitochondrial 16S ribosomal framework to the diversification of the genus and dis- gene (16S rDNA) and complete mitochondrial cyto- cuss its relationship with the geological evolution of the chrome oxidase 2 (CO2) and nuclear internal transcribed areas potentially inhabited by Timarcha in the past. spacer 2 (ITS-2) sequences were selected as markers and PCR-amplified using the following combinations of primers. The 30-end of the 16S rRNA gene was amplified 2. Materials and methods using the primers LR-N-13398 (50 CGCCTGTTTATCA AAAACAT 30) and a modified LR-J-12887 (50 CTCCG 2.1. Taxonomic sampling GTTTGAACTCAGATCA 30) from Simon et al. (1994). The CO2 gene was amplified using modified versions of For this study I have sampled 60 specimens classified the Simon et al. (1994) primers TL2-J-3037 (50 TAAT in 41 species of Timarcha representing all major lineages ATGGCAGATTAGTGCATTGGA 30) and TK-N-3785 within the genus (Table 1). Many samples have been (50 GAGACCATTACTTGCTTTCAGTCATCT 30). previously studied by Gomez-Zurita et al. (2000a,b) in The primers used to amplify ITS-2 were White et al.Õs independent analyses for each marker, but the sampling (1990) ITS3 (50 GCATCGATGAAGAACGCAGC 30) has been expanded to include key taxa such as the two and ITS4 (50 TCCTCCGCTTATTGATATGC 30). PCRs North American Americanotimarcha species, T. cerdo were performed using the GeneAmp 9700 thermal cycler and T. intricata (Waldport, Oregon, US), the Metallo- (Applied Biosystems, Foster City, CA) with 2 min at 95 °C timarcha T. hummeli (Sochi, Alek Range, Russia), the followed by 35 cycles of 30 s at 94 °C, 30 s at 50 °C, and North African T. ventricosa (Cap Beddouza, Morocco) 1 min at 72 °C, with a final extension step of 10 min at and T. atlantica (Gadda, Debdou, Morocco), the East- 72 °C. PCR products were checked on a 1.5% agarose/ ern European T. olivieri parnassia (Chelmos Mts. and Tris–borate–EDTA gel and those of the expected length Mt. Parnassos, Greece) and T. rugulosa lomnickii and quality were cleaned using the Geneclean II kit (Kazimier Dolny, Poland), and the French and Iberian (Qbiogene, Livingston, UK). Cleaned PCR products endemics T. maritima (Le Canon, France) and T. erosa were sequenced directly in both directions using the cor- vermiculata (Porto Alto, Portugal), respectively. Addi- responding PCR primers and the ABI PRISM BigDye tional samples expanding the representation of previ- Terminator Cycle Sequencing Ready Reaction with the ously studied taxa include T. metallica (Forêt de Guines, AmpliTaq DNA Polymerase FS kit (Applied Biosystems, France) and T. nicaeensis (Capo Palinuro, Salerno, It- Foster City, CA) following manufacturerÕs instructions. aly). These new sequences used for the study are avail- Sequenced products were purified using sodium acetate able in GenBank with the Accession Nos. AJ278898– and ethanol and sequenced on an ABI 3700 automated AJ278900 and AJ622015–AJ622053. sequencer (Applied Biosystems, Foster City, CA). For a preliminary study of the divergences of Tim- Complete 18S rDNA sequences were sequenced using archa with regard to other Chrysomelinae taxa and as the primers described in Shull et al. (2001) and the same an additional measure of internal genetic variation PCR and sequencing protocols described above. The within Timarcha, I have studied complete 18S rDNA chrysomelid 18S rDNA sequences were aligned using sequences for one representative of each major lineage in the secondary structure model proposed for Drosophila Timarcha and several other taxa within the same sub- melanogaster (Gutell et al., 1994). For this, the stability family. The selected taxa were T. (Americanotimarcha) of the customized secondary structures for Chrysome- cerdo, T. (Metallotimarcha) metallica, T. (Timarchos- linae was evaluated using the software Mfold version 3.1 toma) marginicollis, and T. (Timarcha) nicaeensis, in the (Zuker, 2003), which also assisted in homology assess- tribe Timarchini, and Chrysolina affinis (Segovia, Spain), ment. The selection of the best fitting model for se- Gonioctena olivacea (Sunningdale, UK), Labidomera quence divergence estimation was done using Modeltest clivicollis (Quyon, Canada), Linaeidea aenea (Benedikt- version 3.06 (Posada and Crandall, 1998), which ex- beuern, Germany), Phratora laticollis (London, UK), plores through searches in PAUP* version 4.0b10 and Prasocuris distincta (Teboursouk, Tunisia), among (Swofford, 2002) the likelihood of up to 56 models, from other chrysomelines. These sequences are deposited in the simplest to the most parameter-rich, retrieving the GenBank with the Accession Nos. AJ622054–AJ622063. one that best fits the data. This program also estimates ARTICLE IN PRESS

4 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx

Table 1 Timarcha specimens used in the analyses and their collection data Subgenus Code Locality Collection date Collector Species Americanotimarcha Jolivet T. cerdo Stal CERD* USA: Oregon, Waldport 29/04/2002 G.O. Poinar T. intricata Haldeman INTR* USA: Oregon, Waldport 29/04/2002 G.O. Poinar

Metallotimarcha Motschulsky T. hummeli Faldermann HUMM* Russia: Alek Range, Sochi 26/08/1997 A.G. Koval T. metallica (Laicharting) METa Belgium: Forêt dÕAnlier 29/06/1998 P. Verdyck METg* France: Forêt de Guines 16/09/2001 A. Grafteaux and P. Jo- livet METj Germany: Thuringia, Schlagebachtal 06/1997 F. Fritzlar Timarchostoma Motschulsky T. aurichalcea Bechyne1 AURI Spain: Cuenca, Tragacete 5/07/1995 E. Petitpierre and JGZ T. balearica Gory2 BALa Spain: Menorca, Alcoufar 09/1995 JGZ BALe Spain: Mallorca, Esporles 23/04/1997 JGZ T. calceata Perez Arcas2 CALC Spain: Leon, Vegacervera 25/10/1998 J.M. Salgado T. coarcticollis Fairmaire2 COAR Spain: Cadiz, Los Barrios 21/03/1997 E. Petitpierre and JGZ T. cornuta Bechyne1 CORN France: Corsica, Zicavo 06/2000 M. Daccordi T. cyanescens Fairmaire1 CYAN Spain: Cantabria, Cueto 3/11/1996 J. de Diego T. erosa vermiculata Fairmaire2 EROS Portugal: Santarem, Porto Alto 23/10/2002 C. Aguiar and A. Ser- rano T. fallax Perez Arcas1 FALa Spain: Tarragona, Alio 6/10/1994 E. Petitpierre FALc Spain: Alicante, Pto. de la Carrasqueta 16/10/1998 E. Petitpierre and JGZ FALg Spain: Barcelona, Garraf 19/01/1997 A. Sacares and JGZ T. geniculata (Germar)1 GENa Spain: Burgos, Pena~ Amaya 18/09/1995 J. de Diego GENv Spain: Leon, Puerto de Ventana 11/06/1996 E. Petitpierre and JGZ T. goettingensis (Linnaeus)1 GOET Germany: Thuringia, Jena 9–13/04/1997 F. Fritzlar T. gougeleti Fairmaire1 GOUG Spain: A Coruna,~ Fiobre-Bergondo 15/02/1998 A. Baselga T. granadensis Bechyne2 GRAN Spain: Granada, Sierra de Guillimona 13/05/1997 E. Petitpierre and JGZ T. hispanica Herrich-Schaeffer2 HISP Portugal: Algarve, Sao~ Vicente 18/03/1997 E. Petitpierre and JGZ T. insparsa Rosenhauer2 INSP Spain: Granada, Pico Veleta 17/09/1996 E. Petitpierre and JGZ T. intermedia Herrich-Schaeffer2 INMa Spain: Alicante, Arenales del Sol 23/04/1996 E. Petitpierre and JGZ INMr Spain: Almerıa, Rodalquilar 25/04/1996 E. Petitpierre and JGZ T. interstitialis Fairmaire1 INRe Spain: Barcelona, LÕEsquirol 27/10/1996 J. Vives INRs Spain: Girona, Sant Pere de Roda 22/02/1998 A. Sacares and JGZ T. lugens Rosenhauer2 LUGE Spain: Granada, Pico Veleta 17/09/1996 E. Petitpierre and JGZ T. marginicollis Rosenhauer2 MARG Spain: Granada, Pico Veleta 17/09/1996 E. Petitpierre and JGZ T. maritima Perris1 MARI* France: Aquitaine, Le Canon 30/05/2000 M. Scholler€ T. monserratensis Bechyne1 MONS Spain: Barcelona, Collformic 17/08/1998 J. Vives T. olivieri parnassia Fairmaire1 OLIa* Greece: Atica, Mt. Parnassos 18/09/2002 M.A. Arnedo and J. Pons OLIp* Greece: Peloponnesos, Chelmos Mts. 15–16/05/2000 A. Wrzecionko T. perezi Fairmaire1 PERe Spain: Teruel, Ejulve 8/06/1997 E. Petitpierre and JGZ PERi Spain: Leon, Puerto de San Isidro 14/06/1996 E. Petitpierre and JGZ PERl Spain: Teruel, Puerto de Linares 3/07/1997 E. Petitpierre and JGZ PERm Spain: Zaragoza, El Moncayo 31/05/1998 F. Murria and E. Vives PERp Spain: Teruel, Puerto de Cuarto Pelado 3/07/1997 E. Petitpierre and JGZ PERv Spain: Valladolid, Villanubla 13/06/1996 E. Petitpierre and JGZ PERz Spain: Zaragoza, Zaragoza 19/02/1997 F. Murria T. recticollis Fairmaire1 RECT Spain: Lleida, Pla de lÕArtiga 1/07/1997 E. Petitpierre and JGZ T. riffensis Fairmaire2 RIFF Morocco: Tanger, Yebel-Haus 27/03/1999 J.L. Ruiz T. rugulosa lomnickii Miller1 RUGU* Poland: Kazimier Dolny 05/2001 E. Pietrykowska T. sinuatocollis Fairmaire1 SINc Spain: Girona, Coll de la Creueta 19/08/1998 E. Petitpierre and JGZ SINq Spain: Girona, Queixans 07/1998 E. Petitpierre T. strangulata Fairmaire2 STRA Spain: Lleida, Pla de lÕArtiga 1/07/1997 E. Petitpierre and JGZ Timarcha Latreille T. atlantica Bechyne ATLA* Morocco: Debdou, Gadda 16/04/2002 M.A. Arnedo and C. Hernando T. espanoli Bechyne ESPA Spain: Alicante, LÕAltet 30/03/1996 C. Juan T. maroccana Weise MARO Morocco: Moyen Atlas, Tanout-ou-Fillali 25/04/1997 P. Oromı T. nicaeensis Villa NICp Italy: Salerno, Palinuro Cape 6/01/2002 C. OÕToole NICz Italy: Genova, Mt. Zatta 20/09/1998 S. Zoia and F. Polese ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 5

Table 1 (continued) Subgenus Code Locality Collection date Collector Species T. pimelioides Herrich-Schaeffer PIME Italy: Sicily, Cugno Vasco Cape 5/11/1998 P. Raponese T. punctella s. str. Marseul PUNC Morocco: Nador, Lengua de Tierra 1–5/05/1997 J.M. Guzman T. punctella teleuetica Escalera TELE Morocco: Moyen Atlas, Kelaa-des-Sa- 25/04/1997 P. Oromı hrna T. rugosa (Linnaeus) RUGd* Morocco: Debdou, source Ain-el-Kbira 5/04/1999 I. Ribera RUGm Morocco: Nador, Lengua de Tierra 12/01/1997 J.M. Guzman T. scabripennis Fairmaire SCAB Morocco: Tanger, Yebel-Haus, Haus 27/03/1999 J.L. Ruiz Range T. tenebricosa (Fabricius) TENE Spain: Lleida, Port de la Bonaigua 30/06/1997 E. Petitpierre and JGZ T. ventricosa Weise VENT* Morocco: Cap Beddouza 23/04/2000 I. Ribera Note. The superscripted ‘‘1’’ and ‘‘2’’ in the taxa under Timarchostoma signify their assumed ‘‘primitive’’ (TOM1) or ‘‘derived’’ (TOM2) status based on the traditional systematic proposals for the genus (see main text for details). An asterisk in the taxon code identifies samples newly available for this study. the values of the parameters of the model of choice. processor. In this method, all available character chan- Sequence divergence was estimated from the secondary ges, including insertion/deletion events, are simulta- structure-based alignment in PAUP* using the ‘‘Show neously optimized on multiple trees in such a way that pairwise distances’’ option and applying the appropriate homology assessment and phylogenetic reconstruction correction. Parsimony phylogenetic reconstructions for are not dissociated. The number of character transfor- these data were obtained with PAUP* using a branch- mations required for a particular tree topology is cal- and-bound search with TBR rearrangements and spec- culated and the optimal solution(s) is selected as the ifying gaps as a fifth character step. Node support was tree(s) that minimizes the cost under a particular set of assessed by 1000 bootstrap pseudo-replicates. alignment parameters. In direct optimization analyses it is a common and practical shortcut to split the se- 2.3. Phylogenetic analyses quences into smaller fragments, directing the incorpo- ration of indels to regions of ambiguous homology. This All phylogenetic analyses were run specifying the se- strategy also speeds up significantly the otherwise very quences of the two Americanotimarcha taxa as out- time-consuming calculations (Giribet, 2001). Only the group. Outgroup choice was based on taxonomic, markers with length variation required further parti- ecological, and biogeographical data, as well as on the tioning as follows. 16S rDNA sequences were split into preliminary results obtained from the study of the se- three fragments corresponding to the 50 and 30 conserved quence divergences and a phylogenetic analyses of the ends of the sequence and an intermediate hypervariable 18S rDNA data for representatives of the major Tim- region of 55–60 bp equivalent to the G3 stem/loop of the archa lineages and several other Chrysomelinae taxa. rRNA secondary structure (De Rijk et al., 1996). In The current lack of knowledge about the sister group of ITS-2 partitioning, for which no secondary structure the monogeneric Timarchini tribe also precluded se- model exists to aid in homology assessment, a pre- lecting a reliable outgroup which was not too divergent liminary manual alignment of the sequences assisted to affect to the phylogeny estimates. Rooting the anal- with ClustalW was required to identify conserved areas yses with the most divergent sequences of the ‘‘ingroup’’ of the molecule. Once these conserved areas were iden- was also required because of very high sequence diver- tified, 15 partitions were defined, alternating ‘‘con- gences when comparing the ITS-2 sequences with those served’’ and ‘‘variable’’ regions. Alternative analyses of non-Timarcha taxa, which resulted in trivial homol- using exclusively the ‘‘conserved’’ regions were done to ogy assessments. In spite of the high degree of differ- extract the most conservative estimate of the ITS-2 to- entiation between ITS-2 sequences of the Nearctic and pology. Palaearctic lineages of Timarcha, the identification of For each marker (considered as the sum of its parti- long stretches of similarity, which have been lost from tions) and for each possible combination of markers, other taxa within the same subfamily, strongly suggests including the total evidence, two rounds of analyses a sister-group relationship and an adequate outgroup were run: a sensitivity analysis exploring the effects of choice. different parameter values (gap cost and transition/ Separate and combined phylogenetic analyses of the transversion ratio) and a more intensive analysis using a genetic markers were conducted using direct optimiza- chosen set of parameters based on the sensitivity anal- tion (Wheeler, 1996, 1999) as implemented in the soft- yses. In the exploration of parameter space for sensi- ware POY version 3.0.11 (Wheeler et al., 2002), and all tivity analyses the cost of transversions was fixed and the tree searches were run using the PC version of the following 21 parameter combinations were analyzed: software on a computer equipped with a 2.66 GHz equal cost of gaps and changes (111); gaps twice (112), ARTICLE IN PRESS

6 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx three times (113), four times (114), five times (115), 10 rearrangements. This procedure is known to result times (11X), and 50 times (11L) the cost of nucleotide sometimes in an overestimation of BS values, but is an substitutions; transitions half the cost of transversions acceptable approximation when more specific analyses and gaps (122), and the latter twice (124), three times would require considerably longer computational times (126), four times (128), five times (12X), 10 times (Wheeler et al., 2002). Furthermore, several nodes have (12XX), and 50 times (12C) the cost of transversions; been double-checked using a priori more stringent and excluding transitions (011), with gap costs twice searches using the commands -disagree and -con- (012), three times (013), four times (014), five times strain in POY. This strategy, already used by Frost et (015), 10 times (01X), and 50 times (01L) that of al. (2001), produced essentially the same results as - transversions. Heuristic searches for each parameter bremer for all the nodes tested. combination in sensitivity analyses consisted of five rounds of random addition of taxa for tree building, 2.4. Data statistics with the result of the best round as the initial stage for successive rounds of SPR and TBR searches. The heu- The estimation of standard descriptors of the data, ristic searches were made more efficient by checking tree including base composition and the number of variable topologies within 1% of the obtained minimum tree and informative sites, was done based on one alignment length (commands -slop and -checkslop). After the from each data set obtained from the direct optimiza- initial search, the trees obtained were subject to tree tion procedure in POY using the -impliedalign- fusion and tree drifting (Goloboff, 1999) with two sub- ment option. sequent rounds of each SPR and TBR branch swapping. The criterion of selection of the ‘‘optimal’’ parameter 2.5. Estimation of age of lineages combination was based on character congruence measured using the incongruence length difference index The assessment of a molecular clock operating for a (ILD; Mickevich and Farris, 1981). ILD values were particular data set and the estimation of clade ages re- calculated for every possible combination of markers quires trees with branch lengths proportional to the rate under the different parameter values and the ones se- of character change. Here, branch lengths were opti- lected were those minimizing the relative value of this mized on the selected topology from the total evidence index compared to the total tree length of the respective analyses in POY using maximum likelihood (ML). The combined analysis. selection of the evolutionary model for ML branch- Computationally intensive analyses of the data using length estimation was done with Modeltest, which was the preferred set(s) of parameters consisted of searches implemented using the implied alignment associated to identical to the ones already described, but with 10 the topology obtained with POYÕs direct optimization rounds of random addition of taxa, and the number of and the best parameter combination. random addition sequence tree builds increased to five; The resulting evolutionary model was applied to the these two processes are essentially the same, resulting in tree topology retrieved with direct optimization in POY, a total of 10 5 random addition sequence replicates, both enforcing and not enforcing a molecular clock to but with only 10 rounds of branch swapping, given by test for constancy in the rate of evolution. The presence the -replicates command. The number of iterations of a molecular clock for the separate and combined data for the SPR and TBR branch swapping, and the number sets was assessed by likelihood ratio test comparing the of equally parsimonious trees retained in different stages ML scores with and without constraining a constant of tree search were also increased. The actual commands rate of evolutionary change using PAUP*. Rejection of implemented in POY are included in Appendix A and the molecular clock hypothesis required the transfor- the characteristics of the data partitions can be obtained mation of the data into an ultrametric tree using the from the author upon request. non-parametric rate smoothing method (NPRS; San- Heuristic Bremer support values (BS; Bremer, 1988) derson, 1997) as implemented in TreeEdit version 1.0a8 were calculated to assess the support for each clade. BS (Rambaut and Charleston, 2001). The NPRS trans- were calculated with POY using the -bremer com- formed branch lengths were used to estimate node mand and heuristic searches in which the consensus tree depths (i.e., clade ages) using an absolute evolutionary of the most parsimonious solutions obtained previously rate approximated from several calibration points ob- were used to specify the nodes to constrain the searches. tained from palaeogeographical data of the Western In these searches, the preferred combination of gap/ Mediterranean. I opted for this approach instead of the substitution costs was selected based on the sensitivity assumption of a constant rate, such as the frequently analyses and the searches consisted of 10 rounds of used 2%/My rate, exclusively proposed/derived for mi- random addition of taxa with -buildsperrepli- tochondrial proteins, because of the heterogeneous na- cate set to three (option -approxbuild selected) and ture of the three genetic markers used in this study and tree fuse and drifting algorithms with SPR and TBR the increased uncertainty in this type of calibration ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 7 when the rate is based on a single point given by a hy- of the data. Likelihood scores and the test of topological pothetical vicariance event. The specific palaeogeo- congruence were carried out in PAUP*. graphical events supposedly resulting in lineage vicariance in Timarcha were: (i) 20 Mya the Balearic Islands became isolated [vicariance leading to the pala- 3. Results eoendemic T. balearica] (Roca, 1992); (ii) 20–15 Mya (average 17.5 Mya) marine connections between Te- 3.1. 18S rDNA divergence of Timarcha lineages thys and Paratethys isolated Iberia/Italy from the Bal- kans/Asia Minor [vicariance between T. goettingensis The optimal and less parameterized model obtained complex and the oriental sister T. olivieri] (Oosterbroek with ModelTest to describe the evolution of the 18S and Arntzen, 1992); (iii) 16 Mya extensive areas of rDNA data set was a Tamura and Nei (1993) inland saline lakes in northeast Iberia created a barrier [%A ¼ 24.5, %C ¼ 24.0, %G ¼ 27.5; A > C rate ¼ 1.000, between the southwest of the Peninsula and the north- C > T rate ¼ 10.088] with a high proportion of invari- east, which remained associated to Europe [vicariance of able sites (%I ¼ 0.919). Sequence divergence for 18S the western and eastern T. goettingensis complex lin- rDNA among Chrysomelinae genera was low, ranging eages; Gomez-Zurita et al., 2000c] (Altaba, 1997); (iv) from 0.53% between Prasocuris and Linaeidea to 3.51% 17–13 Mya (average 15 Mya), restoration of marine between Labidomera and Timarcha (Americanotimarcha) conditions between Tethys and Paratethys isolate East (Table 2). The Timarcha samples showed two peaks of Asia Minor from the western Asia Minor and the Bal- divergence, averaging 0.07% for the Palaearctic lineages kans [vicariance HUMM/METx] (Oosterbroek and and 1.19% in the Nearctic/Palaearctic contrasts. The Arntzen, 1992); and (v) 5.3 Mya the end of the Mes- divergence between Americanotimarcha and the re- sinian era interrupts land connections formed after maining Timarcha is of the same order as the other in- desiccation of the Mediterranean [Gibraltar Strait vi- tergeneric estimates, even larger than the comparisons cariances COAR/RIFF and RUGd/ESPA, Gymnesic between Palaearctic Timarcha and Gonioctena and break BALa/BALe, and isolation of Corsica CORN/ Prasocuris, for instance. However, all the Timarcha se- GOET] (Palmer and Cambefort, 2000). quences share at least two exclusive features along the sequence, including the presence of two separate (maybe 2.6. Topological constraints compensatory) insertions of a single nucleotide in the 30- end of the gene. This fact, for a highly conserved gene as In order to comparatively analyze several hypotheses 18S rDNA, strongly suggests the phylogenetic related- of monophyly in the genus Timarcha, a series of con- ness of the two lineages in the Timarchini, which was strained analyses were run in POY using the commands indicated as well by the results of a parsimony analysis -agree and -constrain. Simplified heuristic sear- of these sequences (Fig. 1). ches enforcing various topological constraints consisted of five replicates of random addition of taxa holding a 3.2. Parameter choice from sensitivity analyses maximum of 10 trees per replicate, with the commands - slop and -buildsperreplicate set to five and The study of 21 parameter combinations for the three, respectively, and with final rounds of tree fusing separate and combined analyses of the 16S rDNA, CO2, and tree drifting. The specific topological constraints and ITS-2 markers showed that the best relation of costs used were: (i) each Timarcha subgenus reciprocally for gap insertions and substitutions in terms of maxi- monophyletic [((AME) ((MET) ((TIM) (TOM))))], (ii) mization of congruence for the different partitions, was subgenus Timarcha paraphyletic [((AME) ((MET) (TIM that assigning a cost of one to each type of change de- (TOM))))], (iii) subgenus Timarchostoma paraphyletic tected along the sequence (111; Fig. 2). This cost [((AME) ((MET) (TOM (TIM))))], and finally the tra- scheme, which has been claimed to be the only episte- ditional phylogenetic hypothesis for the genus [((AME) mologically justifiable weighting, maximizes descriptive ((MET) (TOM1 (TOM2 (TIM)))))]. Tree lengths for the efficiency and explanatory power of the characters constrained and unconstrained analyses were compared (Frost et al., 2001) and also happens to be the best op- to assess the effect of including extra assumptions in the tion when, as in this case (if not all), there are no a priori estimation of the phylogeny of Timarcha. Alternatively, hypotheses about the best parameters describing the the likelihood scores of these trees were computed using mutational model operating for the analyzed set of se- the evolutionary model obtained as described in the quences. In the total evidence sensitivity analyses, a previous section to determine congruence between tree better parameter combination was obtained considering topologies by using the Shimodaira–Hasegawa test the cost of transitions half that of transversions and with (Shimodaira and Hasegawa, 1999). The significance in gap cost of 10 over any substitution (12X). However, differences among the likelihood scores was determined this cost scheme produced some obvious problems in the with a one-tailed bootstrap test using 1000 permutations tree topologies, showing relationships that are not ARTICLE IN PRESS

8 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx Labidomera clivicollis — Phratora laticollis —

Fig. 1. Unrooted consensus tree of two equally parsimonious trees (123 Linaeidea aenea — steps; CI ¼ 0.837, RI ¼ 0.767) of the 18S rDNA sequence data for Timarcha and several Chrysomelinae. Numbers at the nodes represent their bootstrap support. — Gonioctena olivacea — Chrysolina aﬃnis — Prasocuris distincta

Fig. 2. Results of the sensitivity analyses for 21 parameter combina- Timarcha nicaeensis — tions in mitochondrial and total evidence analyses. The arrows indicate the preferred parameter sets for the definitive analyses of the data. An asterisk shows an alternative optimal parameter combination for total evidence analyses. Timarcha marginicollis — supported by any independent source of evidence, including morphology, karyology, biogeography, and ecology. These comprise the inclusion of the Metallo- timarcha as sister group of the pair of species T. inter- Timarcha metallica — media/T. lugens and both coming out at the ‘‘top’’ of the tree within the clade of the T. goettingensis species complex, rendering it paraphyletic, or the Americano- timarcha T. intricata within the Palaearctic Timarcha and sister to the North African clade plus T. balearica Timarcha cerdo 0.01186 0.011240.012530.017030.02029 0.00054 0.02235 0.000540.02281 0.009650.02344 0.011800.03512 0.01072 0.00109 0.01464 0.01032 0.01497 0.01250 0.02218 0.01144 0.01538 0.01028 0.01574 0.01245 0.02301 0.01139 0.01531 0.01428 0.01716 0.02145 0.01737 0.00525 0.00784 0.02803 0.00912 0.01468 0.01798 0.01665 0.01646 0.01821 0.01670 0.00774 0.02472 0.02469 — and T. marginicollis. In order to understand the origin of these topological ‘‘conflicts’’ and discard potential arti- facts resulting from the behavior of POY, the (12X) implied alignment was carefully inspected, and found to show fundamental problems of homology assessment within the hypervariable regions of ITS-2, most likely because of a compromise between the cost of substitutions and gap extension. These particular analytical Timarcha metallica Timarcha marginicollis Timarcha nicaeensis Prasocuris distincta Chrysolina affinis Gonioctena olivacea Linaeidea aenea Phratora laticollis Labidomera clivicollis Timarcha cerdo

Table 2 Tamura and Nei (1993) corrected genetic divergences in pairwise comparisons of 18S rDNA sequences for several taxa in the subfamily Chrysomelinae conditions were the only to retrieve trivial non-over- ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 9 lapping alignments locally in several of the ITS-2 par- MARI. The resolution of deep nodes favored by ITS-2 titions, affecting particularly to the two North American is ((AME) ((MET) ((TOM1) (TOM10 (TOM2 (TOM20 taxa and the Metallotimarcha, the most divergent se- TIM))))), similar to the traditional hypothesis for the quences. This behavior, surely responsible for the un- evolution of Timarcha. The alternative resolution sug- reliability of the obtained results in this case, is difficult gested by mtDNA is ((AME) ((MET) (TIM TOM2 to explain at present and would require specific tests to ((TIM0 TOM20) (TOM1 TOM200)))), somehow reversed understand which particular characteristics of the data to the nuclear one. In any case, the support for these or the algorithm condition its performance. alternative resolutions is relatively weak. In the combined analysis of the three data sources, a 3.3. Phylogenetic trees completely resolved tree (except for the collapsed position of PERm) is obtained with higher support than any The combined character matrix (111 costs) had 2377 of the separate analyses. The basal nodes in the true- characters, with almost one-third of them having gaps as Timarcha lineage still receive low support (one to five), a character state, because of length heterogeneity of the but the emerging topology is more similar to that sug- ribosomal sequences (16S rDNA: 510–515 bp; ITS-2 gested by the mtDNA tree in spite of ITS-2 contributing rDNA: 616–720 bp). Up to 1234 positions were variable, with 2/3 of the parsimony informative characters including 896 parsimony informative characters. Each [((AME) ((MET) ((TOM2 TIM) (TOM20 TOM1))))]. character partition was homogeneous in its base composition across taxa, with the mtDNA genes showing a 3.4. Evolutionary rate and age estimates clear AT-bias (Table 3). The use of the (111) cost scheme for each of the data sets resulted in 50 trees of 343 steps The implied alignment associated to the preferred tree for 16S rDNA (Fig. 3A), 12 trees of 953 steps for CO2 topology was used as a tentative hypothesis of character (Fig. 3B), 3 trees of 1011 steps for ITS-2 rDNA homology for the three markers combined. Character (Fig. 4A), 3 trees of 1314 steps for the mtDNA data set change for this alignment accommodates to a general (Fig. 4B), and finally 2 trees of 2461 steps in the total time reversible model (GTR; Rodrıguez et al., 1990) evidence analysis (Fig. 5). The 16S rDNA and CO2 trees (A ¼ 0.320, C ¼ 0.162, G ¼ 0.167; [AC substitution show similar phylogenetic relationships with higher rate] ¼ 1.790, [AG] ¼ 7.928, [AT] ¼ 2.575, [CG] ¼ 3.276, resolution and support in the latter, although in both [CT] ¼ 11.572) with a certain proportion of invariable hypotheses basal relationships are weak (Fig. 3). In sites (I ¼ 0.439) and a heterogeneous rate of substitution contrast, the comparison of the ITS-2 and mtDNA hy- following a gamma distribution (CÞ with alpha shape potheses shows marked differences both in the relative a ¼ 0:582. The same model and parameters were ob- position of several tip nodes and in the resolution of the tained under two different criteria of model selection in basal relationships of the Timarchostoma/Timarcha s. ModelTest, the likelihood ratio test and the Akaike in- str. clade (Fig. 4). Examples of the first type of incon- formation criterion. The likelihood score ( ln) of the gruence are the samples ATLA and RUGm, closely original tree with branch lengths estimated implement- related to RUGd and ESPA in the ITS-2 tree and in the ing the GTR + I + C model and assuming no molecular sister clade to the latter taxa in the mtDNA tree, the clock is ln ¼ 13610.152, and ln ¼ 13915.572 con- EROS/HISP lineage, sister to FALa/FALg in the ITS-2 straining a constant rate of evolution. A likelihood ratio resolution and to GRAN in the mtDNA one, or the test resulted in a significant rejection of the molecular relative positions of MONS/SINc, FALa/FALg or clock for the data (P 0:001, df ¼ 58). An equivalent

Table 3 Data statistics of the molecular markers used in this study, including variable positions, base composition and the results of homogeneity of base composition across taxa Marker No. Variable Parsimony Base composition (%) characters characters informative ACGv2 (177 df) P mtDNA 1238 451 336 36.04 11.85 12.85 27.7250 n.s. 16S rDNA 540 159 113 36.00 8.78 15.09 14.4673 n.s. CO2 698 292 223 36.09 14.04 11.20 30.8798 n.s. ITS-2 1139 783 560 25.77 24.19 23.97 67.9312 n.s. ‘‘Conserved’’ 438 134 94 24.05 25.47 26.05 21.4572 n.s. ‘‘Variable’’ 701 649 466 28.02 22.50 21.26 70.0374 n.s. Total 2377 1234 896 32.41 16.21 16.78 24.1644 n.s. Note. The homology hypothesis for these nucleotide sequences was obtained using the -impliedalignment option in POY in the total evidence analysis specifying each change equally weighted (i.e., 111, see text for details). ARTICLE IN PRESS

10 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx

Fig. 3. Strict consensus trees for the direct optimization analyses (weight scheme 111) of the 16S rDNA (A) and CO2 (B) datasets. The numbers above branches are the estimated Bremer support values using POY; support is zero for unlabelled nodes. Branch shaded diﬀerently for Americanotimarcha (outlined), Metallotimarcha (gray), Timarchostoma group 1 (see main text and Table 1 for details; thin line), Timarchostoma group 2 (hatched) and Timarcha s. str. (thick line). procedure with each of the three markers resulted also in nodes of interest across the phylogeny (Fig. 6C). Using statistically highly signiﬁcant rejections of the molecular this strategy it appears that the split of the Nearctic clock hypothesis. (Americanotimarcha) and Palaearctic lineages occurred A NPRS transformation of the ML branch lengths in 47.61 Mya, with the separation of the Metallotimarcha the combined data analysis was required to produce an lineage from the true Timarcha 27.39 Mya, and the latter ultrametric tree after rejection of the molecular clock starting their radiation 21.16 Mya. hypothesis in order to estimate the ages of cladogenetic events. The transformed tree and the node heights of 3.5. Constrained analyses several presumed vicariant sister lineages, for which a split age could be assumed from the reconstructed his- The direct optimization approach constraining the tory of the Mediterranean basin, were used to estimate reciprocal monophyly of the four subgenera of Timar- an average evolutionary rate for the three markers (Figs. cha and using all the available sequence data with the 6A and B). The resulting rate of 0.41% divergence per (111) cost scheme resulted in two trees of 2541 steps. million years (My) was scaled onto the NPRS trans- Constraining the paraphyly of Timarchostoma, two trees formed tree to extrapolate the age estimation to other were retrieved of 2503 steps, and another two of 2532 ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 11

Fig. 4. Strict consensus trees for the direct optimization analyses (weight scheme 111) of the ITS-2 rDNA (A) and mtDNA (B) datasets. The numbers above branches are the estimated Bremer support values using POY; support is zero for unlabelled nodes. Highlighted nodes in the ITS-2 rDNA tree identify the nodes recovered in the additional analysis using only ‘‘conserved’’ regions with the 111-cost scheme (100 trees of 181 steps). Branch shading as in Fig. 3. steps with the paraphyly of Timarcha s. str. constrained. Conversely, the last constrained analyses, testing for Constraining the traditional systematic hypothesis for deviations from the traditional systematic arrangement Timarcha resulted in three trees of 2510 steps. of Timarcha, rendered a tree with likelihood score The likelihood score of the unconstrained tree eval- ln ¼ 13753.018 and a highly signiﬁcant rejection of uated with the (111) implied alignment matrix and using this systematic hypothesis according to the Shimodaira– the GTR + I + C model was ln ¼ 13610.152. The tree Hasegawa test (P ¼ 0:001). constrained to have reciprocally monophyletic Timar- chostoma and Timarcha s. str. had a likelihood score of ln ¼ 13610.969; that constrained to a paraphyletic 4. Discussion Timarcha s. str. scored ln ¼ 13618.059; the topological constraint for a paraphyletic Timarchostoma including a 4.1. Incongruence among partitions monophyletic Timarcha s. str. clade, resulted in a likelihood score ln ¼ 13600.304. The Shimodaira–Haseg- The accumulation of genetic data to infer the evolu- awa test resulted in the failure to reject any of these tionary histories of organisms reveals that most of these alternative hypotheses, i.e., the probability of deviations data bear a certain homoplasy that can be responsible between null and alternative hypotheses occurring just for incongruence among any given data partitions. Also, by chance was non-signiﬁcant (0:412 > P > 0:791). several biological and population processes can produce ARTICLE IN PRESS

12 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx

Fig. 5. Strict consensus tree for the total evidence direct optimization analysis (weight scheme 111). The numbers above branches are the estimated Bremer support values using POY; support is zero for unlabelled nodes. Highlighted nodes in the tree identify the nodes recovered in the additional analysis using only ‘‘conserved’’ regions of ITS-2 with the 111-cost scheme (four trees of 1574 steps). Branch shading as in Fig. 3.

incongruent but ‘‘true’’ conflicting phylogenetic signals dynamics and/or the possibility of interspecific hybrid- (Brower et al., 1996). ization (Gomez-Zurita and Vogler, 2003). It has been shown in the comparison of the mtDNA The direct optimization strategy implemented in and nuclear ITS-2 trees that some level of character POY and the selection of search parameters based on incongruence is indeed present in the data sets, and the the minimization of the ILD maximizes the congru- available process partitions seem to violate the as- ence among character partitions in the reconstruction sumption of a single hierarchical pattern of relationships of the phylogeny, finding an optimal compromise in for the taxa under study. We have studied and discussed the final resolution of the tree for the conflicting sig- in deeper detail elsewhere some of the causes that could nal from different partitions. The apparent inversion result in significant incongruence in the phylogenetic of polarity in the order of the major lineages in the signal for these markers in Timarcha, particularly for phylogeny estimates of mtDNA and ITS-2 analyses is relatively shallow nodes (Gomez-Zurita and Vogler, resolved in the combined analysis, where an alterna- 2003; Gomez-Zurita et al., 2000b). Among these, we tive solution more similar to the mtDNA signal is considered factors related to their intrinsic evolutionary favored, which in fact is the less ambiguous for ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 13

Fig. 6. Strategy for molecular clock calibration for the Timarcha data. (A) Schematic representation of the calibration points used in the estimation of the evolutionary rate for node datation. (B) Linear regression between hypothesized time of vicariance events and node depth of the suggested vicariant lineages calculated from the total evidence NPRS transformed tree of Timarcha. The slope of the regression is regarded as the average evolutionary rate for the three studied markers. (C) NPRS tree with transformed branch lengths scaled with the slope of the linear regression (0.0041 distance/My). character homology assessment, as it includes less provided by the three molecular markers. Although problematic hypervariable regions. In summary, the we are aware of the ‘‘positively misleading’’ eﬀects of best phylogenetic hypothesis for the genus Timarcha in data combination (Bull et al., 1993), in the absence of terms of resolution and support is the one obtained other sources of phylogenetic information to detect combining in a simultaneous analysis the information areas of random or systematic error in the sample, we ARTICLE IN PRESS

14 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx regard the one presented here as the most robust references therein). Also, in either case the disjunct hypothesis for the evolution of Timarcha. distribution needs to assume extinctions from vast areas, which are considerably larger in the case of the 4.2. Systematics and evolution of Timarcha Beringean hypothesis and with the need of more ad hoc suppositions to explain the absence of Timarcha 4.2.1. The Americanotimarcha lineage in most of the Palaearctic region. The persistence of One of the main aims of this work was to address Americanotimarcha exclusively in the west coast of the question of the systematic placement of the sub- North America could be a climatic or habitat relict genus Americanotimarcha with regard to the other after pleistocenic extinctions, related to the severity Timarcha subgenera. As mentioned above, the subge- and extent of the last glaciations in North America nus is considered primitive, but a lack of information (Hewitt, 2000). Moreover, its current distribution or rigorous analyses has not previously permitted a pattern could be expected if the glacial refuge of the robust statement of its phylogenetic position to be lineage was found in present-day Alaska, as has been made. Parsimony (PAUP*) and POY direct optimi- reported for some mammals and plants (e.g., Conroy zation analyses of mtDNA data, using other available and Cook, 2000; Hansen and Engstrom, 1996; Heaton 16S rDNA and CO2 Chrysomelidae sequences, un- et al., 1996). ambiguously placed this taxon as basal to the re- The high genetic and phylogenetic divergence of the maining Timarcha sequences (not shown), a result that Nearctic compared to the Palaearctic lineage of Tim- has been also confirmed by the study of 18S rDNA archa is in agreement with the taxonomic, ecological, sequences (see Fig. 1). For both mtDNA markers and and cytological differences observed between both the ITS-2 gene, the Americanotimarcha sequences are groups. Americanotimarcha are very different in their clearly the most divergent, and for the nuclear marker, morphological features (although less so with the Me- the typically fast divergence that accumulates for un- tallotimarcha), showing elytra only weakly fused, ab- related or distantly related lineages has erased many sence of sexual dimorphism, lack of ventral furrows in sequence features characteristic of the Palaearctic lin- female tarsi, free lateral lobes of tegmen basally, virtual eages of the genus. This information was comple- lack of reflex bleeding characteristic of the true Tim- mented using nuclear 18S rDNA data showing that archa (Iablokoff-Khnzorian, 1966; Jolivet, 1989). The Americanotimarcha sequences were relatively distant to Nearctic Timarcha have been reported feeding on those from other Timarcha, which were otherwise very Vaccinium (Ericaceae), a trophic selection shared with homogeneous, and that the measured sequence diver- Metallotimarcha but not with the other Timarcha gence was comparable to other estimated intergeneric (Poinar et al., 2002). However, their main trophic divergences within the same subfamily. Therefore, we preference is on Rosaceae of the genera Rubus and can conclude that the origin of the Americanotimarcha Fragaria, trophism exclusive and on plants of the lineage was an ancient event in the evolution of the lineage of the rosids, which is phylogenetically distant genus, estimated from our evolutionary rates to have from the asterid Rubiaceae, the main trophic prefer- occurred in the middle Eocene (Lutetian age, approx. ence for the Palaearctic Timarcha (Jolivet, 1989; Soltis 47.6 Mya), prior to the radiation of the Palaearctic et al., 1999). Finally, the only studied karyotype of taxa. This predates a previous proposal suggesting the Americanotimarcha is of 2n ¼ 44 (meioformula: early Oligocene (36.5 Mya) for the separation of the 21 + Xyp), which is by far the highest chromosome Nearctic and Palaearctic lineages of Timarcha (Crow- number in the tribe, with karyotypes ranging from son, 1981; Jolivet, 1989), but in any case it seems that (2n ¼ 18 to 2n ¼ 30; 2n ¼ 20 in Metallotimarcha) it can be related to a vicariance event due to the de- (Gomez-Zurita et al., 2004; Petitpierre, 1970b, 1976; finitive separation of North America and Europe with Petitpierre and Jolivet, 1976). the opening of the North Atlantic which ended in the The molecular phylogenetic analyses, measures of Late Eocene (Briggs, 1987; Sanmartın et al., 2001 and genetic divergence (particularly 18S rDNA), estimated references therein). The presence of Americanotimarcha age of the lineage and reinterpretation of available data exclusively in North America could alternatively be from morphology and ecology of Americanotimarcha explained by dispersal from Eurasia via the Beringean are more consistent with the idea of this taxon being a connection (Jolivet, 1989). However, the age of the genus different from the Palaearctic Timarcha. lineage, as estimated from the phylogenetic analyses presented here, is much older than the Oligocenic 4.2.2. The Metallotimarcha lineage connection between western and eastern Palaearctic The Palaearctic Timarcha constitute a highly sup- after the drying up of the Turgai Sea (now the Ural ported monophyletic clade which radiated further after Mountains), that allowed extensive biotic exchange the vicariant event that isolated it from the sister and a potential migration route to the Bering region Americanotimarcha. This radiation occurred in the late and North America (Sanmartın et al., 2001 and Oligocene and early Miocene (27.4–21.2 Mya), when the ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 15

Mediterranean area experienced very dramatic changes, no statistically significant differences with the uncon- with massive tectonic movements, mountain range for- strained tree. These alternatives, on the other hand, are mation, and complex series of separation and bridging mutually exclusive. Obviously, a taxon cannot be of emerged land (Gelabert et al., 2002; Oosterbroek and monophyletic and paraphyletic at the same time, and Arntzen, 1992). The palaeogeographic history of the simultaneous failure to reject both alternatives can be Mediterranean basin in this period could create suitable interpreted as the branch defining the potential clade conditions for the extensive allopatric diversification of having length zero. In other words, there is a lack of organisms with limited dispersal capabilities such as the evidence for considering as separate lineages any of the flightless Timarcha. two so-called subgenera Timarchostoma and Timarcha s. The first split in the phylogeny, dated in the middle str. on the basis of the phylogenetic analyses. In sum- Oligocene (27.4 Mya), separated the most plesiomor- mary, in the absence of additional research relating phic lineage of the Timarcha, the subgenus Metallotim- species like T. intermedia, T. lugens, T. balearica,andT. archa. This well-defined subgenus consists of four marginicollis and their close relatives to the subgenus currently recognized species and is mainly distributed in Timarcha s. str. or conclusive data proving the mono- the Balkans and Asia Minor, with one species (T. met- phyly of either subgenera, the most conservative taxo- allica) widely distributed in continental Europe (War- nomic solution is to treat them as synonyms. chalowski, 2003). The origin and evolution of this The origin of this large radiation in the genus Tim- lineage could be traced back to the existence of a land- archa has been dated using molecular evidence to take mass, roughly corresponding to the main current area of place during the Burdigalian (21.2 Mya). During this distribution of the subgenus, which separated the Tethys period the Mediterranean was still dynamically chang- from the Paratethys seas during this period, and that ing its configuration, but areas especially rich in species formed bridges with the rest of Europe subsequently (see of Timarcha, like the Atlas range or the Iberian Penin- references in Oosterbroek and Arntzen, 1992). sula were already recognizable entities. Other areas of endemicity of Timarcha, including the already men- 4.2.3. The Timarchostoma–Timarcha lineage tioned Balkans area, but also proto-Italy and the land The separation of the Timarchostoma and Timarcha s. promontories that would end up forming SE Iberia, the str. subgenera has been a controversial issue, with au- Balearic Islands or Corsica and Sardinia, were also thors either defending their separation or treating them forming and isolated in the early Miocene (Gelabert et as synonyms. The lack of consensus is due to both al., 2002). subgenera being defined on the basis of very labile The ‘‘contemporaneous’’ origin of several lineages of morphological characters (e.g., relative length of mid- Timarcha during this period through vicariance and tibiae compared to the corresponding tarsi in males, dispersal could explain in part the lack of strong phy- length of marginal ridge of the elytra). In previous logenetic signal in the basal areas of this radiation and molecular phylogenetic analyses this issue was also dis- the apparent conflicting resolutions for different genetic cussed, although very preliminarily (Gomez-Zurita et markers; extinction of lineages or insufficient sampling al., 2000a,b), and the possible synonymy has not been of taxa potentially structuring the tree in its basal por- formally established yet. tion are alternative explanations. During this period, After the current molecular phylogenetic analyses, between 21.0 and 16.0 Mya, originated most Timarcha the hypothesis of either subgenus being monophyletic is lineages easily recognizable nowadays by their general at odds for the inclusion within the Timarcha s. str. clade habitus (T. goettingensis complex, T. hispanica or T. of the SE Iberian endemic T. (Timarchostoma) margin- coarcticollis lineages), by peculiar ecological adaptations icollis, and for the low support (3–5) separating it from (trophic selection on Brassicaceae in T. lugens/T. inter- other Timarchostoma like T. balearica and the pair T. media), or unique karyotype arrangements (T. balearica intermedia/T. lugens. The tree reconstructed constrain- 2n ¼ 22, T. strangulata 2n ¼ 28, or T. calceata 2n ¼ 30). ing the reciprocal monophyly of these two subgenera According to the phylogenetic reconstruction, the first requires 80 additional steps (3.3% extra tree length), Timarcha s. str. (in its former meaning) lineage appeared almost twice the extra steps needed when the paraphyly later, during the middle Miocene (15.6 Mya), with of Timarchostoma is enforced (42 steps; 1.7%). Enforc- ancestors leading to modern taxa in Europe (T. nicae- ing the paraphyly of Timarcha s. str. produces a tree 71 ensis and T. tenebricosa) and North Africa (T. maroc- steps longer (2.9%). These data suggest the existence of cana and T. scabripennis). A second wave of speciation two phylogenetically recognizable lineages that could be would have occurred within this Timarcha lineage in identified as subgenera, as the morphology suggests. North Africa during the late Miocene (approx. Alternative hypothesis testing using Shimodaira- 7.7 Mya), slightly before the outbreak of the ÔMessinian Hasegawa tests to evaluate the possibility of either crisis.Õ subgenus being monophyletic or paraphyletic with The so-called Messinian crisis, a desiccation of the respect to the other, show that each tested possibility has Mediterranean about 6 Mya caused by negative hydric ARTICLE IN PRESS

16 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx balance, resulted in another sudden change in the con- possibly accompanied by a progressive increase in figuration of the sea basin, with several emerged lands chromosome number, supposedly led to the former connected by land bridges offering opportunity for dis- Timarcha s. str., which would be the most derived line- persal, e.g., North Africa–Iberia, Balearic Islands, age (Petitpierre, 1973). The molecular phylogeny of Corsica–Sardinia (Palmer and Cambefort, 2000). The Timarcha points to a slightly different systematic ar- restoration of the sea level after the opening of the Gi- rangement compared to the one proposed based on braltar Strait at the end of the Messinian (5.3 Mya) morphological, biogeographical, and/or cytotaxonomi- would create new conditions for vicariance and allo- cal data. Constraining a topology compatible with the patric speciation (Palmer and Cambefort, 2000, and traditional hypothesis for the evolution of the genus references therein). Several splits in the phylogenetic tree Timarcha produced a tree 49 steps longer than the un- of Timarcha can be related to these events, including constrained analysis (2.0% increased length) and the species pairs with representatives in North Africa and Shimodaira-Hasegawa test resulted in a significant re- south of the Iberian Peninsula (T. rugosa/T. espanoli, T. jection of the null-hypothesis of a systematic arrange- riffensis/T. coarcticollis), the Corsican T. cornuta, and its ment compatible with these traditional views. continental European counterparts, or the highly di- Traditional approaches to the systematics of Timar- vergent samples of T. balearica from different islands in cha did not use formal systematics methods (such as the Balearic archipelago. cladistics) for the inference of species relationships, and In the evolution of Timarcha it could be possible that were mainly based upon subjective and sometimes am- Pleistocene climatic changes had a rather important role biguous character states and polarities. Conflicts such as in driving its speciation and diversification (Bechyne, the one emerging in the comparison between molecular 1948). This could be suggested by the highest species versus traditional phylogenetic proposals in Timarcha richness in the supposed southern Mediterranean refu- constitute a ‘‘type I’’ incongruence (Brower et al., 1996), gia during the Quaternary glaciations (particularly the i.e., a comparison with a hypothesis ‘‘with limited or Iberian Peninsula). However, in the light of the observed absent empirical foundations,’’ which is not a real, genetic divergences and the estimated ages of lineages, it measurable or testable problem of incongruence any- is quite evident that most speciation events, including way. To achieve a consensus between the various sour- the most recent diversification of the species-rich T. ces of information, including molecular and goettingensis complex, occurred during the Tertiary, as morphological data, and reach a robust systematic hy- suggested above, accompanying the geological evolution pothesis for the genus, it is advisable to revisit the va- of the Mediterranean basin. The Pleistocenic influence lidity of traditionally used morphological characters and on Timarcha probably conditions the present distribu- to rephrase the assumptions made in the morphological, tion of many species through range contractions and biogeographical, and cytotaxonomical studies in the post-glacial dispersals and most likely resulted in the light of the new molecular data. extinction of several lineages. However, its role in the studied cladogenetic patterns for the genus is very limited. Acknowledgments

4.3. Differences with the traditional hypothesis and I would like to dedicate this work to Prof. Eduard general considerations Petitpierre (Univ. Balearic Islands, Spain), from whom I inherited the interest in Timarcha and leaf beetles in In the molecular phylogeny of Timarcha it appears general and with whom I journeyed in many occasions that the most recent radiation in the genus corresponds collecting them. He is a strong influence in my career to the T. goettingensis complex, sister to the T. hispanica and I owe him the deepest respect and warmest lineage, and deeply related to the lineage including friendship. I am indebted to the collectors that helped species formerly treated as derived Timarchostoma, such in the extremely important task of providing Timarcha as T. balearica, T. coarcticollis or T. intermedia. The T. samples all along these years. Thanks to Anabela goettingensis complex was considered the most ancestral Cardoso, Dan Duran, Ignacio Ribera, Max Barclay, for the Palaearctic Timarcha (excluding Metallotimar- and Michael Balke for collecting Chrysomelinae sam- cha) in the previous systematic proposals for the genus ples used for the investigation of 18S rDNA sequence (Bechyne, 1948; Petitpierre, 1970a,b, 1976). From this divergence. My understanding and adopted strategy to species stock, the other groups would gradually appear the study of Timarcha has benefited from enlightening through successive series of transition forms interpreted discussions with Carlos Juan, Eduard Petitpierre, and from the analysis of morphological variation. The T. Miquel Palmer (Univ. Balearic Islands, Spain), God- hispanica lineage was proposed to derive from a T. go- frey Hewitt, Brent Emerson, and Kamal Ibrahim ettingensis-like ancestor, and it would give rise in turn to (Univ. East Anglia, Norwich, UK), Alfried Vogler, the other Timarchostoma. An independent origin, Anabela Cardoso, Dan Duran, Joan Pons, and Igna- ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 17 cio Ribera (NHM, London), Lluc Garcia, Antoni A.4. Searches with topological constraints Sacares (MBCN, Soller, Spain), and Pierre Jolivet (Paris, France). Anabela Cardoso read a preliminary poy -noleading -outgroup CERD -noran- version of this work and made very useful suggestions. domizeoutgroup -molecularmatrix [matrix file] Rob DeSalle and two anonymous referees made very -extensiongap 1 -agree -constrain [con- helpful comments and suggestions to further improve straints file] -replicates 5 -stopat 3 -sprmax- it. Daegan Inward kindly revised the language style of trees 1 -tbrmaxtrees 2 -maxtrees 10 - the final version of this work. This study has benefited holdmaxtrees 50 -fitchtrees -seed -1 -slop 5 from the MCYT project REN2003-03667 and a Marie -checkslop 5 -buildsperreplicate 3 - Curie Return Grant (Contract No. MERG-CT-2004- buildspr -buildtbr -approxbuild -build- 50004). maxtrees 1 -treefuse -fuselimit 5 -fuse- mingroup 3 -numdriftchanges 5 -driftspr - numdriftspr 3 -drifttbr -numdrifttbr 5 [data Appendix A files] > [output file.out]

A.1. Searches in sensitivity analyses

poy -molecularmatrix [matrix file] -noleading -norandomizeoutgroup -replicates 5 - References sprmaxtrees 2 -tbrmaxtrees 2 -maxtrees 4 - holdmaxtrees 50 -fitchtrees -seed -1 -slop Altaba, C., 1997. Phylogeny and biogeography of midwife toads 10 -checkslop 10 -multibuild 5 -buildspr - (Alytes, Discoglossidae): a reappraisal. Control Zool. 66, 257–262. Bechyne, J., 1948. Contribution a la connaissance du genre Timarcha buildtbr -approxbuild -buildmaxtrees 2 - Latr. 12: Etudes phyllogenetiques et zoogeographiques (Col. minstop 5 -treefuse -fuselimit 10 -num- Phytophaga, Chrysomelidae). Sbor. Narod. Mus. Praze 4, 1–62. driftchanges 2 -driftspr -numdriftspr 2 - Bremer, K., 1988. The limits of amino acid sequence data in drifttbr -numdrifttbr 2 [data file] > [output fi- angiosperm phylogenetic reconstruction. Evolution 42, 795–803. le.sa] Briggs, J.C., 1987. Biogeography and Plate Tectonics. Elsevier, Amsterdam. Brower, A.V.Z., DeSalle, R., Vogler, A.P., 1996. Gene trees, species A.2. Searches with parameters of choice trees, and systematics: a cladistic perspective. Annu. Rev. Ecol. Syst. 27, 423–450. Bull, J.J., Huelsenbeck, J.P., Cunningham, C.W., Swofford, D.L., poy -noleading -outgroup CERD -noran- Waddell, P.J., 1993. Partitioning and combining data in phyloge- domizeoutgroup -molecularmatrix [matrix file] netic analysis. Syst. Biol. 42, 384–397. -replicates 10 -stopat 5 -sprmaxtrees 1 - Conroy, C.J., Cook, J.A., 2000. Phylogeography of a post-glacial extensiongap 1 -tbrmaxtrees 2 -maxtrees 20 colonizer: Microtus longicaudus (Rodentia: Muridae). Mol. Ecol. 9, 165–175. -holdmaxtrees 100 -fitchtrees -seed -1 - Crowson, R.A., 1981. The Biology of the Coleoptera. Academic Press, slop 10 -checkslop 5 -buildsperreplicate 5 London. -buildspr -buildtbr -approxbuild -build- De Rijk, P., Van de Peer, Y., De Wachter, R., 1996. Database on the maxtrees 1 -treefuse -fuselimit 10 -fuse- structure of large ribosomal subunit RNA. Nucleic Acids Res. 24, mingroup 5 -driftspr -numdriftspr 5 - 92–97. Frost, D.R., Rodrigues, M.T., Grant, T., Titus, T.A., 2001. Phylog- drifttbr -numdrifttbr 10 -impliedalign- enetics of the lizard genus Tropidurus (Squamata: Tropiduridae: ment [data files] > [output file.out] Tropidurinae): direct optimization, descriptive efficiency, and sensitivity analysis of congruence between molecular data and morphology. Mol. Phylogenet. Evol. 21, 352–371. A.3. Searches for Bremer support estimation Gelabert, B., Sabat, F., Rodrıguez-Perea, A., 2002. A new proposal for the late Cenozoic geodynamic evolution of the western Mediter- poy -noleading -outgroup CERD -noran- ranean. Terra Nova 14, 93–100. domizeoutgroup -molecularmatrix [matrix file] Giribet, G., 2001. Exploring the behavior of POY, a program for direct -replicates 10 -sprmaxtrees 2 -tbrmaxtrees optimization of molecular data. Cladistics 17, S60–S70. Goloboff, P., 1999. Analyzing large data sets in reasonable times: 3 -maxtrees 5 -holdmaxtrees 20 -fitchtrees - solutions for composite optima. Cladistics 15, 415–428. seed -1 -buildsperreplicate 3 -buildspr - Gomez-Zurita, J., Vogler, A.P., 2003. Incongruent nuclear and buildtbr -approxbuild -buildmaxtrees 2 - mitochondrial phylogeographic patterns in the Timarcha goetting- minstop 3 -treefuse -fuselimit 7 -tree- ensis species complex (Coleoptera, Chrysomelidae). J. Evol. Biol. fusespr -treefusetbr -numdriftchanges 2 - 16, 833–843. driftspr -numdriftspr 2 -drifttbr -num- Gomez-Zurita, J., Juan, C., Petitpierre, E., 2000a. The evolutionary history of the genus Timarcha (Coleoptera, Chrysomelidae) drifttbr 2 -bremer -constrain [constraints file] inferred from mitochondrial COII gene and partial 16S rDNA [data files] > [output file.bs] sequences. Mol. Phylogenet. Evol. 14, 304–317. ARTICLE IN PRESS

18 J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx

Gomez-Zurita, J., Juan, C., Petitpierre, E., 2000b. Sequence, second- Petitpierre, E., 1976. Further cytotaxonomical and evolutionary ary structure and phylogenetic analyses of the ribosomal internal studies on the genus Timarcha Latr. (Coleoptera: Chrysomelidae). transcribed spacer 2 (ITS2) in the Timarcha leaf beetles (Coleop- Genet. Iber. 28, 57–81. tera: Chrysomelidae). Insect Mol. Biol. 9, 591–604. Petitpierre, E., Jolivet, P., 1976. Phylogenetic position of the American Gomez-Zurita, J., Petitpierre, E., Juan, C., 2000c. Nested cladistic Timarcha Latr. (Coleoptera, Chrysomelidae) based on chromo- analysis, phylogeography and speciation in the Timarcha goett- somal data. Experientia 32, 157–158. ingensis complex (Coleoptera, Chrysomelidae). Mol. Ecol. 9, Poinar, G., Jolivet, P., Grafteaux, A., 2002. New food-plants provide 557–570. clues for the origin and distribution of Timarcha (Col. Chrysome- Gomez-Zurita, J., Pons, J., Petitpierre, E., 2004. The evolutionary lidae Chrysomelinae). Lambillionea 102, 103–109. origin of a novel karyotype in Timarcha (Coleoptera, Chrysome- Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of lidae) and general patterns of chromosome evolution in the genus. DNA substitution. Bioinformatics 14, 817–818. J. Zool. Syst. Evol. Res., in press. Rambaut, A., Charleston, M., 2001. TreeEdit, Version 1.0 alfa 8. Gonzalez-Meg ıas, A., Gomez, J.M., Sanchez-Pi nero,~ F., 2003. Ecology University of Oxford, Oxford. of the high mountain chrysomelid Timarcha lugens Rosenhauer Roca, E., 1992. LÕestructura de la conca catalano-balear: paper de la (Chrysomelinae). In: Jolivet, P., Santiago-Blay, J.A., Schmitt, M., compresio i de la distensio en la seva genesi. PhD Thesis, (Eds.), New Developments on the Biology of Chrysomelidae. SPB University of Barcelona, Spain. Academic Publishing, The Hague, (in press). Rodrıguez, F., Oliver, J.F., Marın, A., Medina, J.R., 1990. The general Gutell, R.R., Larsen, N., Woese, C.R., 1994. Lessons form an evolving stochastic model of nucleotide substitution. J. Theor. Biol. 142, rRNA: 16S and 23S rRNA structures from a comparative 485–501. perspective. Microbiol. Rev. 58, 10–26. Sanderson, M.J., 1997. A nonparametric approach to estimating Hansen, B.C.S., Engstrom, D.R., 1996. Vegetation history of Pleasant divergence times in the absence of rate constancy. Mol. Biol. Evol. Island, southeastern Alaska, since 13,000 yr B.P. Quatern. Res. 46, 14, 1218–1231. 161–175. Sanmartın, I., Enghoff, H., Ronquist, F., 2001. Patterns of animal Heaton, T.H., Talbot, S.L., Shields, G.F., 1996. An ice age refugium dispersal, vicariance and diversification in the Holarctic. Biol. J. for large mammals in the Alexander Archipelago, southeastern Linn. Soc. 73, 345–390. Alaska. Quatern. Res. 46, 1–8. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log- Hewitt, G.M., 1989. The subdivision of species by hybrid zones. In: likelihoods with applications to phylogenetic inference. Mol. Biol. Otte, D., Endler, J.A. (Eds.), Speciation and its Consequences. Evol. 16, 1114–1116. Sinauer Associates, Sunderland, MA, pp. 85–110. Shull, V.L., Vogler, A.P., Baker, M.D., Maddison, D.R., Hammond, Hewitt, G.M., 2000. The genetic legacy of the Quaternary ice ages. P.M., 2001. Sequence alignment of 18S ribosomal RNA and the Nature 405, 907–913. basal relationships of Adephagan beetles: evidence for monophyly Iablokoff-Khnzorian, S.M., 1966. Considerations sur lÕedeage des of aquatic families and the placement of the Trachypachidae. Syst. Chrysomelidae et son importance phylogenique. LÕEntomologiste Biol. 50, 945–969. 22, 115–136. Simon, C., Frati, F., Beckenbach, A.T., Crespi, B., Liu, H., Flook, Jeanne, C., 1965. Revision des especes francßaises du genre Timarcha P., 1994. Evolution, weighting, and phylogenetic utility of Latr. (Coleopt. Chrysomelidae). Actes Soc. Linn. Bordeaux 102, 1– mitochondrial gene sequences and a compilation of conserved 25. polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, Jolivet, P., 1946. Notes additives et correctives sur la repartition 651–701. geographique du genre Timarcha Latr. (Col. Chrysomelidae). Bull. Soltis, P.S., Soltis, D.E., Chase, M.W., 1999. Angiosperm phylogeny Soc. Linn. Normandie 5, 33–34. inferred from multiple genes as a tool for comparative biology. Jolivet, P., 1976. Notes preliminaires sur la biologie des Timarcha du Nature 402, 402–404. Pacifique Nord Occidental Americain (Americanotimarcha Jolivet) Stockmann, R., 1966. Etude de la variabilite de quelques especes (Coleoptera Chrysomelidae). Cah. Pacifique 19, 153–165. francßaises du genre Timarcha Latreille (Col. Chrysomelidae). Ann. Jolivet, P., 1989. A propos des Timarcha Nord-Americains (Col. Soc. ent. Fr. (N.S.) 2, 105–126. Chrysomelidae). LÕEntomologiste 45, 27–34. Swofford, D.L., 2002. PAUP*. Phylogenetic Analysis Using Parsi- Kluge, A.G., 1989. A concern for the evidence and a phylogenetic mony ( and other Methods). Version 4. Sinauer Associates, hypothesis of relationships among Epicrates (Boidae, Serpentes). Sunderland, MA. Syst. Zool. 38, 7–25. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide Mickevich, M.F., 1978. Taxonomic congruence. Syst. Zool. 27, 143– substitutions in the control region of mitochondrial DNA in 158. humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Mickevich, M.F., Farris, J.S., 1981. The implications of congruence in Tiberghien, G., 1971. Etudes systematiques sur les Chrysomelides du Menidia. Syst. Zool. 30, 351–370. genre Timarcha (Col.). La variabilite des caracteres externes et leur Oosterbroek, P., Arntzen, J.W., 1992. Area-cladograms of Circum- interpretation en systematique (1re partie). Bull. Soc. ent. Fr. 76, Mediterranean taxa in relation to Mediterranean palaeogeography. 185–192. J. Biogeogr. 19, 3–20. Warchalowski, A., 2003. Chrysomelidae. The leaf-beetles of Europe Palmer, M., Cambefort, Y., 2000. Evidence for reticulate palaeogeog- and the Mediterranean area. Natura optima dux Foundation, raphy: beetle diversity linked to connection-disjunction cycles of Warszawa. the Gibraltar start. J. Biogeogr. 27, 403–416. Wheeler, W.C., 1995. Sequence alignment, parameter sensitivity, Pamilo, P., Nei, M., 1988. Relationships between gene trees and and the phylogenetic analysis of molecular data. Syst. Biol. 44, species trees. Mol. Biol. Evol. 5, 568–583. 321–331. Petitpierre, E., 1970a. Variaciones morfologicas y de la genitalia en las Wheeler, W.C., 1996. Optimization alignment: the end of multiple Timarcha Lat. (Col. Chrysomelidae). P. Inst. Biol. Apl. 48, 5–16. sequence alignment in phylogenetics? Cladistics 12, 1–9. Petitpierre, E., 1970b. Cytotaxonomy and evolution of Timarcha Latr. Wheeler, W.C., 1999. Measuring topological congruence by extending (Coleoptera: Chrysomelidae). Genet. Iber. 22, 67–120. character techniques. Cladistics 15, 131–135. Petitpierre, E., 1973. Estudios Sistematicos, Citogeneticos y Evolutivos Wheeler, W.C., Gladstein, D., De Laet, J., 2002. POY version 3.0. sobre el Genero Timarcha (Coleoptera, Chrysomelidae). PhD Phylogeny reconstruction via Direct Optimization of DNA and Thesis Summary, Publ. Univ. of Barcelona, Barcelona. other data. American Museum of Natural History, New York. ARTICLE IN PRESS

J. Gomez-Zurita / Molecular Phylogenetics and Evolution xxx (2004) xxx–xxx 19

White, T.J., Bruns, T., Lee, S., Taylor, J.W., 1990. Ampliﬁcation and Wu, C.-I., 1991. Inferences of species phylogeny in relation to direct sequencing of fungal ribosomal RNA genes for phylogenet- segregation of ancient polymorphisms. Genetics 127, 429– ics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. 435. (Eds.), PCR Protocols: a Guide to Methods and Applications. Zuker, M., 2003. Mfold web server for nucleic acid folding and Academic Press, New York, pp. 315–322. hybridization prediction. Nucleic Acids Res. 31, 3406–3415.