Whole Genome Sequencing (WGS) – What Is It and How We Use It to Find Disease Variants

Give a Dog a Genome update and Complex Disease Research at the AHT Dr Cathryn Mellersh and Dr Sally Ricketts Talk Layout • Canine genetics at the AHT • Give a Dog a Genome, part I – background • Whole Genome Sequencing (WGS) – what is it and how we use it to find disease variants • Give a Dog a Genome, part II – update • Complex disease investigation Canine Genetics at AHT • The broad aim of the Canine Genetics Research group at the Animal Health Trust is to investigate the genetic basis of important inherited diseases in dogs and identify genetic variants that underpin those diseases. • Our definition of important is a disease that is painful, causes visual impairment, requires surgical or medical intervention or otherwise reduces the quality or length of life of affected dogs. • An immediate-term objective of our research is to develop DNA tools that dog breeders can use to reduce the incidence of disease in future generations of dogs and that veterinary surgeons can use to help diagnose disease. • A longer-term aim is for our findings to improve our understanding of the biology underlying disease in dogs and other species. Give a Dog a Genome • The Give a Dog a Genome project was established to help us meet our objectives more time- and cost-effectively • In 2015 the Kennel Club Charitable Trust awarded the KCGC £50,000 to spend on Whole Genome Sequencing (WGS) • This is sufficient funding to sequence ~25 whole genomes • On 25th January 2016 the Kennel Club contacted the Breed Health Co- ordinators of all 215 registered breeds, inviting them to participate in Give a Dog a Genome • We invited each breed community to donate £1000 • We promised to match each donation with £1000 from the KCCT funding to fund the sequencing of the whole genome of a dog of that breed. • If successful this matched funding approach would enable us to sequence 50 whole genomes Canine Reference Genome • In 2004 the Canine Genome Sequencing Project produced a high- quality draft sequence of a female boxer named Tasha, known as CanFam1.0 • By comparing Tasha with many other breeds, the project also compiled an initial set of ~2.5 million single nucleotide polymorphisms (SNPs) • The current version of the canine reference genome is CanFam3.1 Variation • There is a lot of variation within the canine genome • Most of that variation is neutral • Some of the variation is positive, or advantageous • Some of the variation is deleterious (contributes to risk of disease) • The challenge is to identify the deleterious variants within all the background, non-deleterious variation Whole Genome Sequencing and using it to find disease variants Affected Dog = CASE CASE CGATTATGATCAACTGGACTAGGCATGACACACCGATCGGTCGAATCGCTCGT CASE CGATTATGATCAACTGGACTAGGCATGACACACCGATCGGTCGAATCGCTCGT REF CGATCATGATCAACTAGACTAGGCATGACATACCGATCGATCGAATCGATCGT DOG 1 CGATTATGATCAACTAGACCAGGCATGGCATACCGATCGATCGAATCGCTCGT DOG 2 CGATCATGATCAACTGGACTAGGCATGACATACCGATCGATCGAATCGATCGT DOG 3 CGATTATGATCAACTAGACTACGCATGACACACCGATCGATCGATTCGATCGG DOG 5 CGATCATGATCAACTGGACTAGGCATGACATACCGATCGATCGAATCGATCGT DOG 4 CGATCATGATCAACTAGACTACGCATGACATACCGATCGATCGAATCGATCGT DOG 6 CGAACATGATCAACTGGACTAGGCATGACATACGGATCGATCGAATCGATCGT DOG 7 CGATCATGATCAACTAGACTACGCATGACATACCGATCGATCGAATCGATCGT DOG 8 CGATCATGATCAACTGGACTAGGCATGACATACGGATCGATCGAATAGATCGT Give a Dog a Genome • 77 breeds have signed up to GDG since its official launch • All have donated at least £1000 • Some breeds have elected to have more than one genome sequenced • The KCCT has donated a further £25,000 to support this project… • …taking total raised >£150,000 • We have now sequenced 89 genomes • Sequence analysis is well underway Give a Dog a Genome • 69 affected with a disorder that is a demonstrable health concern in the breed • 20 healthy controls • Analysis of some genomes is being undertaken at the AHT • Data from 29 dogs have been shared with 17 research groups from Europe and USA Sequenced Dogs Prioritised: • Simple/single gene diseases • Complex diseases AHT currently working on • Diseases that researchers at other institutions currently working on Simple/single gene diseases • Diseases caused by a (single), high impact variant/mutation • Diseases follow a very characteristic inheritance pattern in families • Causal mutations can be identified with a small number of cases – because they all share the same mutation. PRA in Giant Schnauzers • Novel form of PRA in family of Giant Schnauzers • 3 cases in a litter of seven, parents clinically unaffected • Sequenced genomes of both parents and two affected littermates Filter for highest effect score Filter for segregation in cases and parents Screen variants in GDG and DBVD consortium (452 dogs) Single candidate variant in NECAP1 Since GDG was launched… …the Canine Genetics Research team at the AHT has identified the mutations responsible and launched DNA tests for: 1. Cerebellar cortical degeneration in the Hungarian Vizsla 2. Retinopathy in the Swedish Vallhund 3. Primary open angle glaucoma in the Shar Pei 4. Progressive retinal atrophy in the Giant Schnauzer 5. Progressive retinal atrophy in the Lhasa Apso 6. Cerebellar ataxia in the Norwegian Buhund 7. Oculoskeletal defect in the Northern Inuit The Give a Dog a Genome bank has benefitted all these studies Complex Disease Team Complex disease definition: • Multiple variants, in more than one gene, can combine to cause increased risk of disease • Environmental factors also contribute to risk – for example may be a trigger for disease onset if an individual has a set of risk variants Aim of research: • To develop predictive tools to identify dogs at greater risk of these diseases • To better understand the biology underlying disease development Objectives: • Large-scale sample collections • Genome scans (genome-wide association studies) and whole genome sequencing Current focus: • Neurological diseases - idiopathic epilepsy, movement disorders • Hereditary cataract • Diseases with an immune component - polymyositis in Hungarian Vizslas Idiopathic epilepsy • Epilepsy is the most prevalent canine neurological disorder • Characterised by recurrent seizures • Usually defined as two or more seizures at least 24hrs apart • Before idiopathic epilepsy can be diagnosed all other possible causes of seizures, or other diseases which could look like seizures, need to be excluded • Epilepsy was the most commonly reported health concern in the AHT’s Give a Dog a Genome breed health summaries • Genetics of idiopathic epilepsy in dogs To date only one common haplotype covering part of the ADAM23 gene has been reproducibly associated with idiopathic epilepsy in several breeds Breeds to study Current focus: • Border Collie • Italian Spinone Future breeds (5 in the first instance) selected after review of: • Literature: • VetCompass data • Breed-specific surveys/case series/clinical papers • International Veterinary Epilepsy Task Force • Breed health and conservation plans: • Kennel Club • Give a Dog a Genome breeds: • 12 breeds • Examine KCGC sample collections for these breeds • Collaborations: • Hannes Lohi – University of Helsinki, Finland • Bill Ollier/Lorna Kennedy/Andrea Short – University of Manchester, UK Sample collection Cases (Dogs with the disease): • Breed surveys • Review of cases by veterinary neurologist • Clinical characterisation of disease by specialist clinicians • Estimation of prevalence in breed Controls (Dogs without the disease): • Unaffected dogs over the typical age of onset and of the same breed Case collections: • Submitted during consultation with specialist clinicians • Submitted directly by owner with epilepsy questionnaire • Kennel Club mailing Control collections: • Submitted directly by owner • Kennel Club mailings • Dog shows • Breed health days Genome-wide association study • Enabled by the availability of the canine genomic sequence and the development of high density marker arrays • Scan the entire genome for regions associated with disease • Require no prior knowledge of genes associated with disease • Utilises a set of individuals affected with a particular disease (cases) and individuals clear of the disease (controls) • Relatively quick to conduct once a robust set of samples is obtained • Aim for 96 cases and 96 controls Manhattan plot Potential outcomes • Identification of set of genetic variants that are reproducibly associated with risk of idiopathic epilepsy for a particular breed • Development of a genetic risk score that identifies individuals in a population at greatest genetic risk of disease • Integration of this information into breeding tools • Better understanding of the biological processes underlying idiopathic epilepsy • Better treatments/diagnosis Acknowledgements Kennel Club Charitable Trust Breed Health Co-ordinators Cathryn Mellersh Louise Burmeister/Tom Marchant Ellen Schofield Chris Jenkins Rebekkah Hitti-Malin Louise Pettitt Hattie Wright Katherine Stanbury Bryan McLaughlin Carly Jacobs Donna Foster Luisa De Risio Tom Lewis Oliver Forman Mike Boursnell Katherine Lawson-Phillips.

Load more