Page 1 of 63 Diabetes

Inhibition of mitochondrial calcium overload by SIRT3 prevents obesity or age-

related whitening of brown adipose tissue

Peng Gao1,#, Yanli Jiang1,2,#, Hao Wu1, Fang Sun1, Yaohong Li2, Hongbo He1, Bin

Wang1, Zongshi Lu1, Yingru Hu1, Xiao Wei1, Yuanting Cui1, Chengkang He1, Lijuan

Wang1, Hongting Zheng3, Gangyi Yang4, Daoyan Liu1, Zhencheng Yan1,*, Zhiming

Zhu1,*

1Department of Hypertension and Endocrinology, Center for Hypertension and

Metabolic Diseases, Daping Hospital, Third Military Medical University, Chongqing

Institute of Hypertension, Chongqing 400042, China

2Department of Endocrinology, Menghai County People's Hospital, Xishuangbanna,

Yunnan 666200, China.

3Department of Endocrinology, Translational Research Key Laboratory for Diabetes,

Xinqiao Hospital, Third Military Medical University, Chongqing 400037, China

4Department of Endocrinology, The Second Affiliated Hospital, Chongqing Medical

University and Chongqing Clinical Research Center for Geriatrics, Chongqing 400010,

China

#These authors contributed equally to this work

*Correspondence to Zhencheng Yan, MD, PhD and Zhiming Zhu, MD, PhD,

Department of Hypertension and Endocrinology, Center for Hypertension and

Metabolic Diseases, Daping Hospital, Third Military Medical University, Chongqing

Institute of Hypertension, 10 Chang Jiang Zhi Lu, Yuzhong District, Chongqing

Diabetes Publish Ahead of Print, published online November 11, 2019 Diabetes Page 2 of 63

400042, China. Tel. +86-23-6876-7849. Email address: [email protected]

(Z.Y.); [email protected] (Z.Z.).

Word Count: 5207

Running title: Capsaicin inhibits BAT whitening by activating AMPK/SIRT3 pathway

Key words: capsaicin, SIRT3, AMPK, brown adipose tissue, mitochondrial calcium overload

Abstract

The whitening and loss of brown adipose tissue (BAT) during obesity and aging promote metabolic disorders and related diseases. The imbalance of Ca2+ homeostasis accounts for the dysfunction and clearance of mitochondria during BAT whitening.

Capsaicin, a dietary factor activating TRPV1, can inhibit obesity induced by high-fat diet (HFD), but whether capsaicin inhibits BAT loss and the underlying mechanism remain unclear. In this study, we determined that the inhibitory effects capsaicin on

HFD-induced obesity and BAT whitening were dependent on the participation of

SIRT3, a critical mitochondrial deacetylase. SIRT3 also mediated all the beneficial effects of capsaicin on alleviating ROS generation, elevating mitochondrial activity and restricting mitochondrial calcium overload induced by HFD. Mechanistically, SIRT3 inhibits mitochondrial calcium uniporter (MCU)-mediated mitochondrial calcium overload by reducing the H3K27ac level on MCU promoter in an AMPK-dependent manner. In addition, HFD also inhibits AMPK activity to reduce SIRT3 expression, which could be reversed by capsaicin. Capsaicin intervention also inhibited aging- induced BAT whitening through this mechanism. In conclusion, this study emphasizes Page 3 of 63 Diabetes

a critical role of AMPK/SIRT3 pathway in the maintenance of BAT morphology and

function, and suggests that intervention in this pathway may be an effective target for

preventing obesity or age-related metabolic diseases.

Introduction

The prevalence of obesity has doubled in more than 70 countries and has continuously

increased, leading to 4.0 million deaths globally (1). Obesity also promotes alterations

in other intermediate risk factors such as hypertension, dyslipidemia, and glucose

intolerance, etc. (2). Previous studies have shown that obesity promotes the

accumulation of white adipose tissue (WAT) to stimulate immune cell infiltration,

contributing to systemic metabolic dysfunction (3). Compared to WAT, the distribution

of brown adipose tissue (BAT) is more specific, mainly located in cervical,

supraclavicular, paravertebral, mediastinal and perirenal regions in humans (4, 5). As

the amount and function of BAT in humans is decreased with aging and obesity, the

decline in BAT function may also facilitate energy storage and metabolic dysfunction

under these conditions (5, 6). However, the molecular mechanisms that account for the

reduced BAT function in obesity and its physiological implications remain elusive.

During obesity, loss of normal structure and function of BAT, also referred as “BAT

whitening”, involves mitochondrial dysfunction as featured by altered oxidative

function, ultrastructure abnormalities and increased oxidative stress (7, 8). As

mitochondrial Ca2+ plays a critical role in regulating mitochondrial activity (9), an

aberrant modulation of mitochondrial calcium level, especially continuous calcium Diabetes Page 4 of 63

overload, increases mitochondrial reactive oxygen species (ROS) production, which is

directly implicated in mitophagy, a process leading to progressive mitochondria loss

(10, 11). The most critical channel mediating Ca2+ uptake is the mitochondrial Ca2+ uniporter (MCU) (12). It has been recently reported that the expression levels of MCU complex members were increased during obesity in adipose tissues of mice and humans

(13). These findings all suggest a critical pathophysiological role of enhanced MCU-

dependent mitochondrial Ca2+ uptake in the development of obesity, however, the

underlying mechanism is still largely unknown.

Nowadays, some active natural ingredients from food, especially the condiments,

such as capsaicin, cinnamaldehyde and menthol, have been received much attention to

be an effective anti-obesity lifestyle intervention approach (14). Since we first reported

that capsaicin prevented obesity in mice in a transient receptor potential vanilloid 1

(TRPV1)-dependent manner (15), emerging evidence from laboratory and clinical

studies support a role of capsaicin as an anti-obesity agent (16). Activation of TRPV1

by capsaicin increased intracellular Ca2+ level in adipocytes, which enhances the activity of Sirtuin 1 (SIRT1) by activating cytosolic AMP kinase (AMPK).

Subsequently, the enhanced SIRT1 activity promoted browning of WAT by increasing the binding activity of PR domain containing 16 (PRDM16), a critical transcription factors promoting the differentiation and maintenance of BAT (17). However, whether capsaicin also exerts a protective role in mitochondrial calcium overload in brown adipocytes to counteract loss of BAT remains unclear. Page 5 of 63 Diabetes

Unlike SIRT1 that is mainly enriched in nuclear, another member of the Sirtuin

family, SIRT3, is preferentially located in mitochondria and highly expressed in BAT

(18). Knockout of SIRT3 in mice on HFD resulted in accelerated obesity and metabolic

syndrome by increasing mitochondrial oxidative stress (19, 20). Both activity and

stability of SIRT3 were decreased by hyperacetylation during obesity and aging (21),

thus the reduction of SIRT3 expression and activity might result in the loss of BAT in

these conditions. Nevertheless, whether SIRT3 is also involved in the regulation of

mitochondrial calcium homeostasis and the effect of capsaicin on obesity need to be

confirmed.

In this study, we aimed to determine the role of SIRT3 in the protective effect of

capsaicin on obesity and aging-induced whitening of BAT and clarify the possible

mechanism. Our results show that SIRT3 plays a crucial role in the maintenance of

BAT and mediates the protective effect of capsaicin by repressing MCU-dependent

mitochondrial Ca2+ overload in brown adipocytes, which might shed light on the

mechanism of loss of BAT during obesity and aging.

RESEARCH DESIGN AND METHODS

Animals and treatment

The SIRT3 knockout (SIRT3-KO) mice (22) were kindly provided by Professor De-Pei

Liu from Chinese Academy of Medical Sciences and Peking Union Medical College

(Beijing, China). The TRPV1 knockout (TRPV1-KO) mice (003770) were purchased

from the Jackson laboratory. All mice were in C57BL/6 background and housed in Diabetes Page 6 of 63

cages at a controlled temperature (22 ± 1°C) and relative humidity (55 ± 5%) in a 12-h light/12-h dark cycle with standard laboratory chow and tap water ad libitum. At the age of 6 weeks, wild-type (WT), SIRT3-KO, or TRPV1-KO male mice were randomized into three groups and were fed standard chow (ND, 10% kcal% fat, 70% kcal% carbohydrate, 20% kcal% protein), a high-fat-diet (HFD, 45% kcal% fat, 35% kcal% carbohydrate, 20% kcal% protein), or a high-fat-diet plus 0.01% capsaicin

(HFCD) for 32 weeks. In another experiment, we used 2-month-old male WT or SIRT3-

KO mice as young and 18- to 20-month-old male mice as aged mice. And they were fed ND or a normal diet plus 0.01% capsaicin (CD) for 12 weeks. We also fed a small number of young WT and SIRT3-KO mice with CD for western blot. The approximate capsaicin intake in the CD or HFCD group was 1.64 μmol/day per mouse. Given of drug dosage between mouse and human is 12.3:1 (23), the converted human dose would be almost equal to that reported in a clinical trial (24). At the end of experiment, the mice were performed physiological tests before they were sacrificed. Tissues were stored in liquid nitrogen or fixed in 10% formalin for H&E staining and ROS detection.

All experimental procedures were performed in accordance with protocols approved by the institutional animal care and research advisory committee at Daping hospital, Third

Military Medical University.

Indirect calorimetry

The Comprehensive Laboratory Animal Monitoring System (CLAMS; Columbus

Instrument) was used to measure oxygen consumption, carbon dioxide generation, Page 7 of 63 Diabetes

energy expenditure (EE), respiratory exchange ratio (RER) and physical activity of

mice as previously described (25). EE = (3.815 + 1.232 × RER) × VO2 × 0.001

0.75 kcal/kg /h. and RER = VO2/VCO2.VO2 stands for the volume of oxygen consumed

per hour, and VCO2 stands for the volume of carbon dioxide produced per hour.

Because of the huge difference in BW between mice on ND and HFD, we compared

their metabolic rates by normalizing to the metabolic size, as reflected by the BW0.75 of

each mouse (25).

Cell culture and treatments

Primary BAT stromal–vascular fraction (SVF) cells were isolated using collagenase

digestion and followed by density separation as previously described (26). Adipocytes

were stimulated with different concentrations of palmitic acid (PA, P5585, Sigma-

Aldrich) at the same time of drug treatment and incubated for 48 h. The sources and

doses of the drug are as follows, capsaicin (100 μmol/L, 211275, Sigma-Aldrich),

AICAR (1 mmol/L, ab120358, Abcam), compound C (40 μmol/L, ab120843, Abcam),

curcumin (10 μmol/L, 08511, Sigma-Aldrich), MCU inhibitor Ru360 (10 μmol/L,

557440, Sigma-Aldrich). Compound C was added 1 hour before capsaicin treatment to

maintain a better cell status and Ru360 was incubated for 12 h. RNA interference and

plasmid-mediated overexpression were conducted using Lipofectamine 3000 according

to the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA). The cell

number plated was 1×106 per flask. The amount of nucleotide used was 5 μg and the

volume of Lipofectamine 3000 was 3.75 μl. Mouse small interfering RNAs (siRNAs) Diabetes Page 8 of 63

against Sirt3 (sc-61556), Mcu (sc-142052), AMPKα1/2 (sc-45313), Pgc-1α (sc-38885) and negative control siRNA were purchased from Santa Cruz Biotechnology. The full- length p300 expression vector was a kind gift from Dr. Liu’s laboratory. Replication- defective adenoviral vectors expressing mouse SIRT3 (Ad-SIRT3), MCU (Ad-MCU) and PGC-1α (Ad-PGC-1α) were generated by Obio Technology (Shanghai) Corp., Ltd.

Adipocytes were infected with the above adenovirus (MOI = 100). Transfection of si-

RNA or plasmid and adenovirus infection were performed 24 hours prior to treatment

with drugs or PA.

Evaluation of ROS Levels

The ROS levels were measured using a dihydroethidium (DHE) fluorescent probe for

cytosolic ROS detection or MitoSOX Red (ThermoFisher) for mitochondrial ROS

detection as previously described (27) using a Fluoroskan Ascent Fluorometer

(ThermoFisher). To visualize the staining, the sections or specimens were placed on an

inverted fluorescence microscope (Nikon TE2000).

High-Resolution Respirometry

Mitochondrial respiratory function was analyzed using a 2-channel titration injection

respirometer (Oxygraph-2k, Oroboros Instruments) as previously described (28).

2 × 106 adipocytes were harvested, suspended in MiR05 solution, and transferred

separately to oxygraph chambers. Routine respiration was assessed while respiration

was stabilized, and then, the plasma membrane was permeabilized with digitonin (16 μg Page 9 of 63 Diabetes

per 106 cells). Complex I-dependent oxidative phosphorylation (CI OXPHOS) was

measured after addition of glutamate (G), malate (M), and ADP (D). Subsequently,

succinate (S) was added to induce maximal oxidative phosphorylation (OXPHOS)

capacity with convergent input through CI+II OXPHOS. After uncoupling with 2-[[4-

(trifluoromethoxy) phenyl] hydrazinylidene] propanedinitrile (FCCP) in the

noncoupled state, CI+II supported maximal convergent respiratory capacity of the

electron transfer system (CI+II ETS) was measured. The addition of rotenone allowed

the determination of CII ETS. Residual oxygen consumption was evaluated after the

inhibition of CIII with antimycin A.

Intracellular and mitochondrial calcium measurement

Tissue mitochondria were isolated by gradient centrifugation using a commercial kit

(ab110169, Abcam) according to the manufacturer’s instructions. Isolated BAT

mitochondria (50 μg protein) were resuspended in 100 μL high KCl buffer (in mM: 110

KCl, 0.5 KH2PO4, 1 MgCl2, 20 Hepes, 0.01 EGTA, 5 succinate, 0.004 rotenone; pH

7.2) with 1 μM Rhod-2 AM. The cytosolic and mitochondrial Ca2+ concentrations were

measured using Fura-2 AM and Rhod-2 AM (ThermoFisher Scientific), respectively,

as previously described (29, 30).Fluorescent signal was recorded at room temperature

using a Varioskan flash microplate reader (Thermo Electron Corp.).

Real-time PCR

Total RNA was extracted using TRIzol reagent (Invitrogen) according to the Diabetes Page 10 of 63

manufacturer’s protocol. Two-microgram total RNA was used for the first-strand synthesis with cDNA M-MuLV Reverse Transcriptase (New England Biolabs) using random primers. The QuantiTect SYBR Green RT-PCR Kit (QIAGEN) was used for the amplification reactions using the 3-step protocol described by the manufacturer

(LightCycler 96, Roche). The fluorescence curves were analyzed using LightCycler 96 software (Version 1.1). The primers are listed in Table S1.

Western blot analyses

Tissue or cell samples were lysed in RIPA lysis buffer (65 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate and 0.1% SDS) with protease inhibitor cocktail tablets (04693132001; Roche) and phosphatase inhibitor tablets (4906837001; Roche). Equal amounts of protein (20 μg per lane) were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes

(Millipore). After blocking with 0.1% Tween-20 (TBST) containing 5% non-fat dry milk (Blotto, sc-2324, Santa Cruz), the filters were incubated with the following primary antibodies: GAPDH (ab9485, Abcam), PRDM16 (ab106410, Abcam), PGC-

1α (ab54481, Abcam), SIRT3 (sc-99143, Santa Cruz), AMPK (#2532, Cell Signaling

Technology), p-AMPK (#2535, Cell Signaling Technology), UCP1 (SAB1404511,

Invitrogen) and MCU (ab121499, Abcam). After washes and incubation with the appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz

Biotechnology), the immune complexes were visualized using a chemiluminescence

HRP substrate (WBKLS0100; Millipore). Page 11 of 63 Diabetes

Chromatin immunoprecipitation (ChIP)

ChIP assays were carried out as previously described (31). Briefly, about 1×107 brown

adipocytes were cross-linked with 1% formaldehyde, and nuclear extracts were

sonicated on a Bioruptor Plus sonication system (Diagenode). Chromatin lysate was

precleared with Dynabead protein A (Invitrogen) and subjected to immunoprecipitation

with ChIP-grade antibody against normal IgG (#2729, Cell Signaling Technology), c-

fos (#2250, Cell Signaling Technology), c-jun (#9165, Cell Signaling Technology), H3

(ab1791, Abcam), H3K27ac (ab4729, Abcam), H3K27me3 (ab6002, Abcam) or PGC-

1α (NBP1-04676, Novus Biologicals). DNA-protein complex was precipitated with

Dynabead protein A (Invitrogen), eluted in washing buffers and treated with Proteinase

K and RNase A in turn to reverse cross-links. DNA was purified and analyzed by

quantitative RT-PCR (LightCycler 96, Roche) with primers that targeted interesting

DNA sequences. Primer sequences were listed in Table S1.

Statistical Analyses

Quantitative results are expressed as the means ± SD. The differences among ≥3

groups were analyzed using One-way ANOVA followed by the Bonferroni adjustment

for multiple comparisons. Two-way ANOVA was used for body weight (BW), CLAMS

and intraperitoneal glucose tolerance test (IPGTT) data that were repeatedly measured.

Graphs were created using Prism 6.0 (GraphPad Software), and statistical analysis was

performed with GraphPad Prism. A P<0.05 was considered to be statistically significant. Diabetes Page 12 of 63

Results

Deficiency of SIRT3 blocks the inhibitory effect of capsaicin in high fat diet- induced BAT whitening.

To investigate whether SIRT3 participated in the process of BAT whitening, we first detected the expression levels of SIRT3 in all types of WAT and BAT in mice and found that the expression of SIRT3 was much higher in BAT (Figures 1A and 1B).

After 4-month HFD feeding, both mRNA and protein levels of SIRT3 in BAT were significantly reduced (Figures 1C and 1D), whereas in WAT the expression of SIRT3 was almost unchanged (Figures S1A and S1B). Thus, we next determined whether the anti-obese effect of capsaicin was dependent on SIRT3. To this end, 2-month old

TRPV1 and SIRT3 knockout mice were fed with high fat diet for 8 months. As expected, mice on HFD displayed an obvious BW gain compared to those on ND, and capsaicin significantly slowed down the increase of BW and accumulation of WAT mass in HFD- fed mice in a TRPV1-dependent manner (Figures S1C-S1F). We also observed that

SIRT3-KO mice showed a faster weight gain process under HFD, and even in the ND group, SIRT3 knockout also resulted in an obvious weight gain without affecting their food intake amount (Figures 1E-1G, S1F). More importantly, the anti-obese effect of capsaicin almost totally disappeared in SIRT3-KO mice in both the ND group and the

HFD group, indicating that SIRT3 is indispensable for the inhibitory effect of capsaicin on obesity (Figures 1E-1G). Consistently, the protective effect of capsaicin treatment against high fat-impaired glucose tolerance was blocked by knockout of SIRT3 (Figure Page 13 of 63 Diabetes

1H). Similar to TRPV1-KO mice, although the weight of BAT was almost equal in all

groups (Figures 1I and S1G), H&E staining showed that capsaicin could significantly

inhibit the whitening of BAT in mice on HFD, as evidenced by the reduction of lipid

droplet size and elevation of lipid droplet number per field of view (Figures 1J-1L).

Knockout of SIRT3 obviously promoted lipid droplet accumulation in BAT and

blocked the inhibitory effect of capsaicin on HFD-induced BAT whitening (Figures 1J-

1L). However, although knockout of SIRT3 erased the preventive role of capsaicin in

WAT accumulation, it failed to direct increase the lipid droplet size in WAT (Figures

S1H-S1J), emphasizing a fundamental role of SIRT3 in the maintenance of BAT

structure. These results suggest that the inhibitory effect of capsaicin on BAT whitening

is dependent on the presence of SIRT3.

SIRT3 mediates the promotional effect of capsaicin on BAT function by improving

mitochondrial complex activity.

Next, the consumption of oxygen, generation of carbon dioxide, RER and EE of all

groups of mice were assayed. The EE and physical activity of mice on HFD was

significantly reduced, along with the decrease of O2 consumption and CO2 production,

especially at the nighttime when the mice were more active, suggesting a decline of

BAT function (Figures 2A, 2B, S2A-S2D). Capsaicin significantly increased EE, O2

consumption, CO2 production and physical activity in these mice, implying that

capsaicin might increase BAT activity and aerobic respiratory function, however, all

these effects disappeared in SIRT3 knockout mice (Figures 2A, 2B, S2A-S2D). Also, Diabetes Page 14 of 63

we assessed ROS levels in the frozen slices of BAT from these mice. The results showed that HFD remarkably induced an increase of total ROS level measured by DHE in BAT, which was significantly suppressed by capsaicin treatment (Figures 2C and

2D). However, the ROS generation in the BAT of HFCD-fed SIRT3-KO mice was similar to that of HFD-fed mice, indicating that the suppressive effect of capsaicin on high fat-induced ROS generation was impaired by SIRT3 knockout (Figures 2C and

2D). The results of MitoSOX staining also demonstrated a similar pattern (Figures 2C and 2D). In addition, the promotional effect of capsaicin on the expression of BAT- related markers in BAT of HFD mice, including PRDM16, PGC-1α and UCP-1, was also significantly reduced in SIRT3 knockout mice (Figures 2E and S2E). In parallel, mitochondrial respiration and oxygen consumption of the isolated brown adipocytes from BAT were measured. It showed that mitochondrial respiration, which was represented by CI and CII LEAK, CI, CII and CI plus CII oxidative phosphorylation

(OXPHOS), as well as CI plus CII electron transfer system (ETS), was markedly reduced by HFD and elevated by capsaicin (Figure 2F). Again, all these parameters were almost equal in the BAT of HFCD and HFD-fed SIRT3 knockout mice (Figure

2F), suggesting a crucial role of SIRT3 in the beneficial effect of capsaicin on improving mitochondrial function in BAT.

SIRT3 knockout impairs the inhibitory effect of capsaicin on mitochondrial calcium overload in BAT Page 15 of 63 Diabetes

As excessive mitochondrial Ca2+ level is a chief culprit of mitochondrial dysfunction

(32), we tested the ability of Ca2+ uptake in mitochondria isolated from BAT of mice

on HFD. As expected, mitochondria isolated from BAT of HFD-fed mice showed

higher Ca2+ uptake ability than those on ND (Figure 3A). In addition, these changes

were reversed by dietary capsaicin (Figure 3A). However, knockout of SIRT3 failed to

affect the overall Ca2+ intake of primary brown adipocytes from mice, but significantly

increased the level of Ca2+ influx in mitochondria, especially in mice fed on HFD

(Figures 3B and 3C). Accordingly, the inhibitory effect of capsaicin on HFD-induced

mitochondrial Ca2+ overload in BAT was also blocked in SIRT3-KO mice (Figures 3A

and 3C). To further determine the direct effect of SIRT3 on mitochondrial Ca2+ level,

the expression level of SIRT3 was manipulated by its small interference (si) RNA or

adenovirus (Ad)-mediated overexpression vector in primary brown adipocytes from

WT mice. The brown adipocytes incubated with si-Sirt3 displayed a noticeable

increased mitochondrial Ca2+ uptake, which was more obvious after being treated with

palmitic acid (PA), without affecting cytosolic Ca2+ level or Ca2+-related signaling

component CaMKII (Figures 3D, S3A-S3C). Also, si-Sirt3 significantly attenuated the

inhibitory effect of capsaicin on mitochondrial Ca2+ uptake and blocked the

promotional effect of capsaicin on mitochondrial respiration (Figures 3D and S3D). In

contrast, Ad-SIRT3 inhibited mitochondrial calcium overload induced by PA in brown

adipocytes (Figures 3E and S3E). Accordingly, cells treated by si-Sirt3 displayed a

higher mitochondrial ROS level, whereas Ad-SIRT3 exerted a reversed effect (Figures Diabetes Page 16 of 63

S3F and S3G). These results imply that SIRT3 exerts its beneficial effect on the maintenance of BAT function through inhibiting mitochondrial Ca2+ overload.

SIRT3 inhibits MCU expression to alleviate mitochondrial calcium overload

We next examined the expression of some ion channels mainly controlling mitochondrial calcium intake, such as MCU and MICU1 (32), in BAT of mice. HFD significantly increased the expression of MCU and MICU1 in BAT, while other channels, such as MCUb and MICU2, were not affected (Figures 4A and 4B). Moreover,

SIRT3 knockout directly increased the expression of MCU and MICU1 in BAT, and this trend was more obvious under HFD (Figures 4A and 4B). Capsaicin displayed an inhibitory effect on the expression of MCU and MICU1, which almost disappeared in

SIRT3-KO mice (Figures 4A and 4B), suggesting that SIRT3 was required for the inhibition of capsaicin on mitochondrial calcium overload.

As MICU1 acts as a gatekeeper restricting MCU-mediated calcium influx (33), the expression of MCU was chosen to be knocked down by si-Mcu in primary SIRT3-KO brown adipocytes or si-Sirt3-treated wild-type cells. It was found that si-Mcu not only completely blocked the increase of mitochondrial calcium uptake caused by SIRT3 knockout or si-Sirt3 in brown adipocytes (Figures 4C, 4D, S4A and S4B), but reduced the excessive ROS generation and improved mitochondrial activity in these cells

(Figures S4C-S4E), even though knockdown or inhibition of MCU alone also impaired basal mitochondrial activity probably due to insufficient mitochondrial Ca2+ level

(Figure S4F), suggesting that the increased MCU expression was a main reason for Page 17 of 63 Diabetes

mitochondrial calcium overload and dysfunction in BAT of SIRT3-KO mice. In

contrast, the inhibitory effects of Ad-SIRT3 on PA-induced mitochondrial calcium

overload and dysfunction were also blocked by Ad-MCU (Figures 4E and S5).

However, neither overexpression nor knockdown of MCU failed to affect the

expression of SIRT3 (Figure 4F), indicating that MCU acts as a downstream target of

SIRT3.

Knockout of SIRT3 increases MCU transcription in an AMPK-dependent

epigenetic manner

To further elucidate the mechanism underlying the increased MCU expression in SIRT3

knockout mice, we examined the promoter region of mice Mcu and Micu1 genes and

found potential AP-1 binding sites. Chromatin immunoprecipitation (ChIP) results

indicate that knockout or knockdown of SIRT3 could not directly increase AP-1

binding on these regions, but it can be enhanced by capsaicin intervention (Figures S6A

and S6B). As capsaicin actually reduces the expression of MCU and MICU1, we

switched to examine the histone modification status and found a high acetylation level

of histone lysine 27 on the promoters of Mcu and Micu1. SIRT3 knockout or si-Sirt3

significantly increased H3K27ac in these regions, with a decrease of H3K27me3, while

capsaicin intervention exerted an opposite effect (Figures 5A and 5B). These results

suggest that acetylation of H3K27 might play a key role in the transcription of Mcu and

Micu1.

Next, as p300 is a major histone acetylase accounting for H3K27ac, we treated Diabetes Page 18 of 63

brown adipocytes with an inhibitor of p300 histone acetyltransferase, curcumin (34).

Curcumin potently inhibited the elevation of Mcu or Micu1 expression by SIRT3

knockdown and suppressed the promotional effect of PA on elevation of mitochondrial

calcium uptake, accompanied by a decrease of H3K27ac level on the Mcu or Micu1

gene promoter (Figures 5C-5E, S6C and S6D). In contrast, the inhibitory effect of

capsaicin on Mcu or Micu1 expression was blocked in adipocytes transfected with a

p300 overexpression plasmid (Figures S6E and S6F). These evidences indicate that the

increased H3K27ac level on the promoter of Mcu or Micu1 was an important factor

stimulating their transcription.

The activity of p300 has been reported to be reduced by AMPK (35), a critical

metabolic regulator which could be activated by SIRT3. Thus, we explored whether

AMPK mediated the promotional effect of SIRT3 knockout on MCU expression.

AICAR, an activator of AMPK, almost blocked the promotional effect of si-Sirt3 on

both Mcu expression and the increased H3K27ac level on its promoter (Figures 5F and

5G), whereas compound C, an agent inhibiting AMPK activity, or si-RNA-mediated

knockdown the catalytic subunits of AMPK, AMPKα1/2, erased the inhibitory effect of capsaicin on these changes (Figures S6G-S6J). These results suggest that inactivation of AMPK by knockdown of SIRT3 might account for the increased H3K27ac level on the promoter of Mcu, which leads to overexpression of Mcu.

Inactivation of AMPK by HFD reduces SIRT3 expression in BAT Page 19 of 63 Diabetes

Next, we explored the mechanism of the declined SIRT3 expression in BAT of mice

on HFD. The expression of SIRT3 has been reported to be activated by PGC-1α (36),

a downstream target of AMPK (37, 38). As expected, HFD reduced AMPK

phosphorylation and PGC-1α expression in BAT of mice, and capsaicin intervention

significantly inhibited these effects (Figure 6A). Similarly, the inhibitory of PA on

AMPK activity and PGC-1α expression could also be reversed by capsaicin (Figure

6B). Both activation of AMPK by AICAR and adenovirus-mediated overexpression of

PGC-1α upregulated the expression of SIRT3 in the existence of PA (Figures 6C, 6D,

S7A and S7B). In addition, either PGC-1α siRNA or inhibition of AMPK by compound

C abrogated capsaicin-induced SIRT3 expression and PGC-1α siRNA also erased the

promotional effect of AICAR on stimulating SIRT3 expression (Figures 6E-6G, S7C

and S7D), indicating that PGC-1α acts as a downstream target of AMPK to activate

SIRT3 expression. Moreover, ChIP results also indicated that there existed an obvious

positive binding signal of PGC-1α on the promoter of Sirt3 gene, which could be

reduced by PA and enhanced by capsaicin or AICAR treatment (Figure 6H). Thus, the

reduction of AMPK/PGC-1α signaling pathway by HFD might account for the lowered

SIRT3 expression in BAT, and it also suggest that there exists a positive feedback loop

between AMPK and SIRT3 in BAT, which could be activated by capsaicin.

Capsaicin enhances SIRT3 expression in aged mice to attenuate age-related BAT

loss Diabetes Page 20 of 63

Finally, in order to verify whether capsaicin also inhibits aging-induced loss of BAT

by activating SIRT3, WT and SIRT3-KO aged mice were fed with CD for 3 months.

Compared with the young mice, aged mice possessed a higher BW with lower food

intake, and knockout of SIRT3 resulted in an obvious increase of BW without affecting

their food intake (Figures 7A-7C), accompanied by a further impaired glucose tolerance

(Figure 7D). In addition, aging did not lower BAT weight but caused a significant

whitening process in BAT with elevated size and decreased number of lipid droplets,

which was even more obvious in SIRT3-KO mice (Figures 7E-7G). Accordingly, aged

mice consumed less O2 and produced less CO2, and their EE was also lowered (Figures

7H and S8). Moreover, capsaicin intervention also displayed beneficial effects on all the above-mentioned parameters to counteract the influence of aging, but much weaker than that in young mice (Figures 7A-7H, S8). Also, these effects were almost blocked in SIRT3-KO mice (Figures 7A-7H, S8). These results indicate that reduced SIRT3 expression facilitates the process of BAT whitening during aging, which could be partially reversed by capsaicin. Similar to mice received HFD, the BAT of the aged mice also displayed overall repressed expression of SIRT3, p-AMPK and PGC-1α, but

much higher MCU expression, which could be significantly reversed by capsaicin

treatment. Compared to their littermates, the expression of p-AMPK and PGC-1α in the

BAT of SIRT3-KO mice was further downregulated, with overexpression of MCU

(Figures 7I and S9). As expected, the regulatory effects of capsaicin on these gene

expression changes in BAT were almost disappeared by knockout of SIRT3 (Figures

7I and S9). Consistently, the ability of mitochondrial calcium uptake in the primary Page 21 of 63 Diabetes

brown adipocytes from aged mice was obviously elevated, and capsaicin inhibited this

age-related mitochondrial calcium overload in a SIRT3-dependent manner (Figure 7J).

Together, these results support that aging can increase mitochondrial calcium overload

by inhibiting the expression of SIRT3 in BAT, resulting in the whitening and loss of

BAT.

Discussion

In this work, we provide evidence to prove that the decreased SIRT3 expression in BAT

during obesity and aging is an important reason for BAT whitening. The inhibition or

knockout of SIRT3 up-regulates MCU expression via an AMPK-dependent epigenetic

manner and exaggerated MCU-mediated mitochondrial calcium uptake, resulting in

more ROS generation and promotes whitening of BAT. Capsaicin intervention can

promote the expression of SIRT3 by activating AMPK to inhibit mitochondrial calcium

overload in brown adipocytes, thus resist the whitening of BAT (Figure 7K).

Unlike WAT, the origin of brown adipocytes in BAT is very similar to that of skeletal

muscle cells and PRDM16 is required for the differentiate and maintenance of mature

brown adipocytes (39). As knockout of SIRT3 directly reduced the expression of

PRDM16 and blocked the promotional effect of capsaicin on its expression, the

exaggerated BAT whitening caused by SIRT3 knockout would be also related to the

inhibition of differentiation of brown adipocytes. In addition, as the weight of BAT was

not affected by knockout of SIRT3, the increased BW in SIRT3-KO mice on both ND

and HFD mainly depend on the accumulation of WAT, not BAT whitening. However, Diabetes Page 22 of 63

as knockout of SIRT3 directly facilitated the whitening of BAT and blocked the anti- obese effect of capsaicin, the exaggerated BAT whitening process would be critical to

HFD or age-related obesity by slowing down the metabolic rate of the whole body that helps promoting the accumulation of WAT. Thus, the enhanced whitening of BAT caused by SIRT3 knockout could be considered as an important initial step for HFD or aging-induced obesity. In addition, the data on physical activity supports an alternative explanation that capsaicin activation of physical activity through regulation of neuronal or muscle functions as the primary driver for the phenotypes of elevated energy expenditure. Browning of adipose tissue could also be a result of muscle activity, which might be also regulated by SIRT3 (40, 41).

Loss of mitochondria is the main feature of BAT whitening. Enhanced expression of

SIRT3 alleviates ROS accumulation (42), stabilizes the mitochondrial membrane (43) and promotes mitochondrial fusion to sustain the number of mitochondria (44), thus exerts a fundamental protective role in mitochondrial homeostasis. In this study, we found that the role of SIRT3 in maintaining mitochondrial homeostasis is not only confined to the mitochondria itself, but also regulates the ionic homeostasis and epigenetic modification in the whole cell through its downstream target, AMPK.

Interestingly, we also noticed that capsaicin failed to totally block age-related BAT whitening while in young mice it exerted a more potent anti-obesity role against high fat diet , possibly due to the inability of capsaicin to restore SIRT3 expression to the level of young mice in aged mice, thus further emphasizing that the reduced SIRT3 is the key factor leading to BAT whitening. Page 23 of 63 Diabetes

As a highly conserved cellular energy sensor regulating health and longevity, AMPK

is activated by low energy state (45, 46). Besides direct phosphorylating PGC-1α,

AMPK also promotes SIRT1-mediated deacetylation of PGC-1α, both of which lead to

activation of PGC-1α (37, 38). In accordance with our findings, as a downstream target

of PGC-1α (36), SIRT3, in turn, also activates the AMPK/PGC-1α pathway (47, 48).

Our results also confirm that AMPK is indispensable for not only the inhibitory effect

of SIRT3 on MCU expression but also the promotional effect of capsaicin on SIRT3

expression. Moreover, activation of AMPK by capsaicin requires the participation of

SIRT3. These results suggest that these two proteins form a positive feedback loop,

which could act as a link between the energy state of cells and the mitochondrial

function. In addition, it also explains how brown adipocytes sense the excessive energy

status caused by overfeeding or aging, which leads to mitochondrial dysfunction and

clearance.

Increasing evidence has shown that the imbalance of intracellular Ca2+ have an

important effect on adipocytes. A transient rise in cytosolic Ca2+ inhibits triglyceride

accumulation and lipid storage, whereas sustained high levels of Ca2+ inhibit lipolysis

(32). Consistently, we and others have discovered that adipocytes isolated from obese

humans possess an elevated cytosolic Ca2+ level, with a decreased ability of transient

uptake of extracellular Ca2+ (15, 49). Similarly, transient mitochondrial Ca2+ boosts

mitochondrial bioenergetics and activates the citric acid cycle (9), but permanent

calcium overload increases ROS level and stimulates mitophagy (10, 11). These

phenomena may be related to AMPK activity, because AMPK phosphorylation could Diabetes Page 24 of 63

be activated when the cytosolic Ca2+ is transiently elevated, whereas this Ca2+-activated

AMPK activity is also blocked by persistent high intracellular Ca2+ level (50). This mechanism may protect cells from apoptosis and autophagy, but facilitates fat accumulation and insulin resistance. In normal status, although an increase of mitochondrial Ca2+ inhibits the activity of SIRT3 (51), SIRT3 also retrospectively restricts mitochondrial Ca2+ overload by activating AMPK to form a negative feedback loop. However, during obesity or aging, the activity of AMPK could be reduced by sustained elevation of cellular Ca2+ level, not only reduces the expression of SIRT3, but also blocks the inhibitory effect of SIRT3 on MCU, thus aggravating mitochondrial

Ca2+ overload. The present study emphasizes an epigenetic mechanism of AMPK- dependent regulation of mitochondrial Ca2+ homeostasis, and suggests that the regulation of epigenetic modification might be potentially applied in the intervention of metabolic diseases.

In summary, we found that capsaicin can activate the AMPK-SIRT3 positive feedback loop to epigenetically inhibit MCU-dependent mitochondrial Ca2+ overload in brown adipocytes, thus maintain the morphology and function of BAT against the whitening stimuli. This work clearly indicates a central role of mitochondrial Ca2+ homeostasis in BAT function, and suggests that intervention in AMPK/SIRT3pathway may be an effective target for preventing obesity or age-related metabolic diseases.

AUTHOR CONTRIBUTIONS

Z.Y., P. G., and Z.Z. initiated the project. P.G. and Y.J. designed the experiments and Page 25 of 63 Diabetes

wrote the paper. P.G. and Y.J. performed experiments with contributions from H.W.,

F.S., H.H., B.W., Z.L., Y.H., X.W., Y.C., C.H., and L.W.. P.G. and Y.J. analyzed data.

P.G., Y.L., H.Z., G.Y., D.L., Z.Y., and Z.Z. critically read and revised the paper. All

authors read and approved the manuscript.

ACKNOWLEDGMENTS

This work was supported by grants from the National Natural Science Foundation of

China (81570761, 31871199 and 81721001), National Key Research and Development

Project (2018YFA0800601), and Innovative Research Team in University (IRT1216).

We thank Tingbing Cao for technical assistance. We also greatly appreciate Prof. De-

Pei Liu and Prof. Hou-Zao Chen from Institute of Basic Medical Sciences, Chinese

Academy of Medical Sciences and Peking Union Medical College (Beijing, China) for

generous providing us the SIRT3-KO mice. Z.Y. is the guarantor of this work and as

such, had full access to all the data in the study and takes responsibility for the integrity

of the data and accuracy of the data analysis.

Data and Resource Availability

The datasets and non-commercial materials generated and/or analyzed during the

current study are available from the corresponding author upon reasonable request.

COMPETING INTERESTS STATEMENT

The authors declare that they have no competing financial interest.

References Diabetes Page 26 of 63

1. Afshin A, Forouzanfar MH, Reitsma MB, Sur P, Estep K, Lee A, Marczak L,

Mokdad AH, Moradi-Lakeh M, Naghavi M, et al. Health Effects of Overweight

and Obesity in 195 Countries over 25 Years. The New England journal of

medicine. 2017;377(1):13-27.

2. Poirier P, Giles TD, Bray GA, Hong Y, Stern JS, Pi-Sunyer FX, Eckel RH,

American Heart A, Obesity Committee of the Council on Nutrition PA, and

Metabolism. Obesity and cardiovascular disease: pathophysiology, evaluation,

and effect of weight loss: an update of the 1997 American Heart Association

Scientific Statement on Obesity and Heart Disease from the Obesity Committee

of the Council on Nutrition, Physical Activity, and Metabolism. Circulation.

2006;113(6):898-918.

3. Ouchi N, Parker JL, Lugus JJ, and Walsh K. Adipokines in inflammation and

metabolic disease. Nature reviews Immunology. 2011;11(2):85-97.

4. Park A, Kim WK, and Bae KH. Distinction of white, beige and brown

adipocytes derived from mesenchymal stem cells. World journal of stem cells.

2014;6(1):33-42.

5. Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC,

Palmer EL, Tseng YH, Doria A, et al. Identification and importance of brown

adipose tissue in adult humans. The New England journal of medicine.

2009;360(15):1509-17.

6. Pfannenberg C, Werner MK, Ripkens S, Stef I, Deckert A, Schmadl M, Reimold

M, Haring HU, Claussen CD, and Stefan N. Impact of age on the relationships Page 27 of 63 Diabetes

of brown adipose tissue with sex and adiposity in humans. Diabetes.

2010;59(7):1789-93.

7. Bournat JC, and Brown CW. Mitochondrial dysfunction in obesity. Current

opinion in endocrinology, diabetes, and obesity. 2010;17(5):446-52.

8. Shimizu I, and Walsh K. The Whitening of Brown Fat and Its Implications for

Weight Management in Obesity. Current obesity reports. 2015;4(2):224-9.

9. Rizzuto R, De Stefani D, Raffaello A, and Mammucari C. Mitochondria as

sensors and regulators of calcium signalling. Nature reviews Molecular cell

biology. 2012;13(9):566-78.

10. Rimessi A, Bonora M, Marchi S, Patergnani S, Marobbio CM, Lasorsa FM, and

Pinton P. Perturbed mitochondrial Ca2+ signals as causes or consequences of

mitophagy induction. Autophagy. 2013;9(11):1677-86.

11. Ikeda K, Maretich P, and Kajimura S. The Common and Distinct Features of

Brown and Beige Adipocytes. Trends in endocrinology and metabolism: TEM.

2018;29(3):191-200.

12. Bravo-Sagua R, Parra V, Lopez-Crisosto C, Diaz P, Quest AF, and Lavandero

S. Calcium Transport and Signaling in Mitochondria. Comprehensive

Physiology. 2017;7(2):623-34.

13. Wright LE, Vecellio Reane D, Milan G, Terrin A, Di Bello G, Belligoli A,

Sanna M, Foletto M, Favaretto F, Raffaello A, et al. Increased mitochondrial

calcium uniporter in adipocytes underlies mitochondrial alterations associated

with insulin resistance. American journal of physiology Endocrinology and Diabetes Page 28 of 63

metabolism. 2017;313(6):E641-E50.

14. Saito M, Yoneshiro T, and Matsushita M. Food Ingredients as Anti-Obesity

Agents. Trends in endocrinology and metabolism: TEM. 2015;26(11):585-7.

15. Zhang LL, Yan Liu D, Ma LQ, Luo ZD, Cao TB, Zhong J, Yan ZC, Wang LJ,

Zhao ZG, Zhu SJ, et al. Activation of transient receptor potential vanilloid type-

1 channel prevents adipogenesis and obesity. Circulation research.

2007;100(7):1063-70.

16. Leung FW. Capsaicin as an anti-obesity drug. Progress in drug research

Fortschritte der Arzneimittelforschung Progres des recherches

pharmaceutiques. 2014;68(171-9.

17. Qiang L, Wang L, Kon N, Zhao W, Lee S, Zhang Y, Rosenbaum M, Zhao Y,

Gu W, Farmer SR, et al. Brown remodeling of white adipose tissue by SirT1-

dependent deacetylation of Ppargamma. Cell. 2012;150(3):620-32.

18. Shi T, Wang F, Stieren E, and Tong Q. SIRT3, a mitochondrial sirtuin

deacetylase, regulates mitochondrial function and thermogenesis in brown

adipocytes. The Journal of biological chemistry. 2005;280(14):13560-7.

19. Hirschey MD, Shimazu T, Jing E, Grueter CA, Collins AM, Aouizerat B,

Stancakova A, Goetzman E, Lam MM, Schwer B, et al. SIRT3 deficiency and

mitochondrial protein hyperacetylation accelerate the development of the

metabolic syndrome. Molecular cell. 2011;44(2):177-90.

20. Weir HJ, Lane JD, and Balthasar N. SIRT3: A Central Regulator of

Mitochondrial Adaptation in Health and Disease. Genes & cancer. 2013;4(3- Page 29 of 63 Diabetes

4):118-24.

21. Kwon S, Seok S, Yau P, Li X, Kemper B, and Kemper JK. Obesity and aging

diminish sirtuin 1 (SIRT1)-mediated deacetylation of SIRT3, leading to

hyperacetylation and decreased activity and stability of SIRT3. The Journal of

biological chemistry. 2017;292(42):17312-23.

22. Lombard DB, Alt FW, Cheng HL, Bunkenborg J, Streeper RS, Mostoslavsky

R, Kim J, Yancopoulos G, Valenzuela D, Murphy A, et al. Mammalian Sir2

homolog SIRT3 regulates global mitochondrial lysine acetylation. Molecular

and cellular biology. 2007;27(24):8807-14.

23. Nair AB, and Jacob S. A simple practice guide for dose conversion between

animals and human. Journal of basic and clinical pharmacy. 2016;7(2):27-31.

24. Lejeune MP, Kovacs EM, and Westerterp-Plantenga MS. Effect of capsaicin on

substrate oxidation and weight maintenance after modest body-weight loss in

human subjects. The British journal of nutrition. 2003;90(3):651-59.

25. Liu Y, Wang TT, Zhang R, Fu WY, Wang X, Wang F, Gao P, Ding YN, Xie

Y, Hao DL, et al. Calorie restriction protects against experimental abdominal

aortic aneurysms in mice. The Journal of experimental medicine.

2016;213(11):2473-88.

26. Cannon B, and Nedergaard J. Cultures of adipose precursor cells from brown

adipose tissue and of clonal brown-adipocyte-like cell lines. Methods in

molecular biology. 2001;155(213-24.

27. Xiong S, Wang P, Ma L, Gao P, Gong L, Li L, Li Q, Sun F, Zhou X, He H, et Diabetes Page 30 of 63

al. Ameliorating Endothelial Mitochondrial Dysfunction Restores Coronary

Function via Transient Receptor Potential Vanilloid 1-Mediated Protein Kinase

A/Uncoupling Protein 2 Pathway. Hypertension. 2016;67(2):451-60.

28. Li P, Wang B, Sun F, Li Y, Li Q, Lang H, Zhao Z, Gao P, Zhao Y, Shang Q, et

al. Mitochondrial respiratory dysfunctions of blood mononuclear cells link with

cardiac disturbance in patients with early-stage heart failure. Scientific reports.

2015;5(10229.

29. Wang B, Xiong S, Lin S, Xia W, Li Q, Zhao Z, Wei X, Lu Z, Wei X, Gao P, et

al. Enhanced Mitochondrial Transient Receptor Potential Channel, Canonical

Type 3-Mediated Calcium Handling in the Vasculature From Hypertensive Rats.

Journal of the American Heart Association. 2017;6(7).

30. Feng S, Li H, Tai Y, Huang J, Su Y, Abramowitz J, Zhu MX, Birnbaumer L,

and Wang Y. Canonical transient receptor potential 3 channels regulate

mitochondrial calcium uptake. Proceedings of the National Academy of

Sciences of the United States of America. 2013;110(27):11011-6.

31. Lu Z, Cui Y, Wei X, Gao P, Zhang H, Wei X, Li Q, Sun F, Yan Z, Zheng H, et

al. Deficiency of PKD2L1 (TRPP3) Exacerbates Pathological Cardiac

Hypertrophy by Augmenting NCX1-Mediated Mitochondrial Calcium

Overload. Cell reports. 2018;24(6):1639-52.

32. Arruda AP, and Hotamisligil GS. Calcium Homeostasis and Organelle Function

in the Pathogenesis of Obesity and Diabetes. Cell metabolism. 2015;22(3):381-

97. Page 31 of 63 Diabetes

33. Mallilankaraman K, Doonan P, Cardenas C, Chandramoorthy HC, Muller M,

Miller R, Hoffman NE, Gandhirajan RK, Molgo J, Birnbaum MJ, et al. MICU1

is an essential gatekeeper for MCU-mediated mitochondrial Ca(2+) uptake that

regulates cell survival. Cell. 2012;151(3):630-44.

34. Marcu MG, Jung YJ, Lee S, Chung EJ, Lee MJ, Trepel J, and Neckers L.

Curcumin is an inhibitor of p300 histone acetylatransferase. Medicinal

chemistry. 2006;2(2):169-74.

35. Zhang Y, Qiu J, Wang X, Zhang Y, and Xia M. AMP-activated protein kinase

suppresses endothelial cell inflammation through phosphorylation of

transcriptional coactivator p300. Arteriosclerosis, thrombosis, and vascular

biology. 2011;31(12):2897-908.

36. Kong X, Wang R, Xue Y, Liu X, Zhang H, Chen Y, Fang F, and Chang Y.

Sirtuin 3, a new target of PGC-1alpha, plays an important role in the suppression

of ROS and mitochondrial biogenesis. PloS one. 2010;5(7):e11707.

37. Jager S, Handschin C, St-Pierre J, and Spiegelman BM. AMP-activated protein

kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-

1alpha. Proceedings of the National Academy of Sciences of the United States

of America. 2007;104(29):12017-22.

38. Canto C, Gerhart-Hines Z, Feige JN, Lagouge M, Noriega L, Milne JC, Elliott

PJ, Puigserver P, and Auwerx J. AMPK regulates energy expenditure by

modulating NAD+ metabolism and SIRT1 activity. Nature.

2009;458(7241):1056-60. Diabetes Page 32 of 63

39. Kajimura S, and Saito M. A new era in brown adipose tissue biology: molecular

control of brown fat development and energy homeostasis. Annual review of

physiology. 2014;76(225-49.

40. Jing E, Emanuelli B, Hirschey MD, Boucher J, Lee KY, Lombard D, Verdin

EM, and Kahn CR. Sirtuin-3 (Sirt3) regulates skeletal muscle metabolism and

insulin signaling via altered mitochondrial oxidation and reactive oxygen

species production. Proceedings of the National Academy of Sciences of the

United States of America. 2011;108(35):14608-13.

41. Jing E, O'Neill BT, Rardin MJ, Kleinridders A, Ilkeyeva OR, Ussar S, Bain JR,

Lee KY, Verdin EM, Newgard CB, et al. Sirt3 regulates metabolic flexibility of

skeletal muscle through reversible enzymatic deacetylation. Diabetes.

2013;62(10):3404-17.

42. Papa L, and Germain D. SirT3 regulates the mitochondrial unfolded protein

response. Molecular and cellular biology. 2014;34(4):699-710.

43. Hafner AV, Dai J, Gomes AP, Xiao CY, Palmeira CM, Rosenzweig A, and

Sinclair DA. Regulation of the mPTP by SIRT3-mediated deacetylation of

CypD at lysine 166 suppresses age-related cardiac hypertrophy. Aging.

2010;2(12):914-23.

44. Samant SA, Zhang HJ, Hong Z, Pillai VB, Sundaresan NR, Wolfgeher D,

Archer SL, Chan DC, and Gupta MP. SIRT3 deacetylates and activates OPA1

to regulate mitochondrial dynamics during stress. Molecular and cellular

biology. 2014;34(5):807-19. Page 33 of 63 Diabetes

45. Hardie DG, Ross FA, and Hawley SA. AMPK: a nutrient and energy sensor that

maintains energy homeostasis. Nature reviews Molecular cell biology.

2012;13(4):251-62.

46. Xiao B, Sanders MJ, Underwood E, Heath R, Mayer FV, Carmena D, Jing C,

Walker PA, Eccleston JF, Haire LF, et al. Structure of mammalian AMPK and

its regulation by ADP. Nature. 2011;472(7342):230-3.

47. Pillai VB, Sundaresan NR, Kim G, Gupta M, Rajamohan SB, Pillai JB, Samant

S, Ravindra PV, Isbatan A, and Gupta MP. Exogenous NAD blocks cardiac

hypertrophic response via activation of the SIRT3-LKB1-AMP-activated

kinase pathway. The Journal of biological chemistry. 2010;285(5):3133-44.

48. Palacios OM, Carmona JJ, Michan S, Chen KY, Manabe Y, Ward JL, 3rd,

Goodyear LJ, and Tong Q. Diet and exercise signals regulate SIRT3 and

activate AMPK and PGC-1alpha in skeletal muscle. Aging. 2009;1(9):771-83.

49. Byyny RL, LoVerde M, Lloyd S, Mitchell W, and Draznin B. Cytosolic calcium

and insulin resistance in elderly patients with essential hypertension. American

journal of hypertension. 1992;5(7):459-64.

50. Park S, Scheffler TL, and Gerrard DE. Chronic high cytosolic calcium decreases

AICAR-induced AMPK activity via calcium/calmodulin activated protein

kinase II signaling cascade. Cell calcium. 2011;50(1):73-83.

51. Ren T, Zhang H, Wang J, Zhu J, Jin M, Wu Y, Guo X, Ji L, Huang Q, Zhang

H, et al. MCU-dependent mitochondrial Ca(2+) inhibits NAD(+)/SIRT3/SOD2

pathway to promote ROS production and metastasis of HCC cells. Oncogene. Diabetes Page 34 of 63

2017;36(42):5897-909.

Figure legends

Figure 1. The inhibitory effect of capsaicin on BAT whitening is dependent on SIRT3.

(A, B) The mRNA (A) and protein expression level (B) of SIRT3 in epididymal white adipose tissue (eWAT), inguinal WAT (iWAT), subcutaneous WAT (sWAT) and brown adipose tissue (BAT) of mice (n = 6). (C, D) The mRNA (C) and protein expression level (D) of SIRT3 in BAT of mice fed with normal diet (ND) or high fat diet (HFD) (n = 6). Western blot results shown in B and D are representative of six blots. GAPDH served as a loading control. (E) Changes of BW in wild-type (WT) or

SIRT3 knockout (SIRT3-KO) mice fed with ND, HFD or high fat plus capsaicin diet

(HFCD) for 32 weeks (n = 6-7). (F) Photographs showing the whole appearance of mice in indicated group at the end of experiment. Each figure was 19 cm (length) × 7 cm

(width). (G) Food intake of WT or SIRT3-KO mice fed with ND, HFD or HFCD for 8 days at the end of intervention (n = 6). The cumulative amounts are shown on the right.

(H) The blood glucose levels during IPGTT (2 g/kg) performed on mice in indicated groups (n = 6). (I) The BAT weight of WT or SIRT3-KO mice fed with ND, HFD or

HFCD (n = 6). (J) Representative H&E staining images of BAT of mice in indicated groups. Bar represents 50 μm. (K, L) The size (K) and number (L) of lipid droplets in

BAT of mice in indicated groups (n = 18). Each point represents the statistical average of a single slice. The data are presented as the mean ± SD, accompanied by scatter Page 35 of 63 Diabetes

points in some figures. *P<0.05, **P<0.01, ***P<0.001, compared with BAT (A, B)

or ND group (others); #P<0.05, ##P<0.01, ###P<0.001, compared with WT group.

Figure 2. Deficiency of SIRT3 blocks the beneficial effects of capsaicin on BAT

metabolism and function. (A) Oxygen consumption, Carbon dioxide production,

Respiratory exchange ratio and Energy expenditure of WT and SIRT3-KO mice on ND,

HSD or HFCD, detected by the Comprehensive Laboratory Animal Monitoring System

(CLAMS) (n = 6). (B) The physical activity of WT and SIRT3-KO mice on ND, HSD

or HFCD (n = 6). (C, D) Representative images of Cytosolic ROS measured by

dihydroethidium (DHE) (left) and mitochondrial ROS measured by MitoSOX Red

(right) in BAT of mice from indicated groups. Bar, 100 μm. The quantitative results are

shown in D (n = 6). (E) Representative western blots of SIRT3, PRDM16, PGC-1α and

UCP1in BAT of WT or SIRT3-KO mice on ND, CD, HFD or HFCD. Results shown

are representative of three blots. GAPDH served as a loading control. (F) The protocol

used to measure mitochondrial oxygen consumption in adipocytes from BAT of mice.

Routine, CI LEAK (proton leak), CI OXPHOS (oxidative phosphorylation), CI+II

OXPHOS, CI+II ETS (electron transfer system), CII ETS and Residential oxygen

consumption of brown adipocytes from mice in indicated groups are shown, detected

by high-resolution respirometry (n = 6). The data are presented as the mean ± SD,

accompanied by scatter points in A, D, E and G. *P<0.05, **P<0.01, ***P<0.001,

compared with ND group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT group. Diabetes Page 36 of 63

Figure 3. The inhibitory effect of capsaicin on mitochondrial calcium overload in BAT is blocked by SIRT3 knockout. (A) Relative Ca2+ fluorescent signal in isolated BAT mitochondria from WT and SIRT3-KO mice on ND, HFD or HFCD. The quantitative results are shown on the right (n = 3 independent experiments). (B) Thapsigargin- induced SR Ca2+ release and Ca2+ uptake via store operated channels (SOCs) after SR

Ca2+ depletion in primary brown adipocytes from indicated groups. The quantitative result of SOC-induced Ca2+ uptake is shown on the right (n=3 independent experiments). (C) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from indicated groups. The quantitative results are shown on the right (n=3 independent experiments). (D) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice, treated by palmitic acid (PA), si-Sirt3 or capsaicin. The quantitative results are shown on the right (n=3 independent experiments). (E) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice, treated by PA,

Ad-GFP or Ad-SIRT3. The quantitative results are shown on the right (n=3 independent experiments). The data are presented as the mean ± SD. *P<0.05, **P<0.01,

***P<0.001, compared with ND or vehicle group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT (A-C), si-con (D) or Ad-GFP (E) group.

Figure 4. MCU mediates the promotional effect of SIRT3 knockout on mitochondrial calcium overload. (A) Relative mRNA expression levels of Mcu, Micu1, Mcub and

Micu2 in BAT of WT or SIRT3-KO mice on ND, HFD or HFCD (n = 6). (B)

Representative western blots of MCU in BAT of WT or SIRT3-KO mice on ND, CD, Page 37 of 63 Diabetes

HFD or HFCD. Results shown are representative of three blots. GAPDH served as a

loading control. The quantitative results are shown below (n = 3). (C) Relative

mitochondrial Ca2+ uptake in primary brown adipocytes from WT or SIRT3-KO mice,

treated by si-con or si-Mcu. The quantitative results are shown on the right (n=3

independent experiments). (D) Relative mitochondrial Ca2+ uptake in primary brown

adipocytes from WT mice, treated by si-con, si-Sirt3 or si-Mcu. The quantitative results

are shown on the right (n=3 independent experiments). (E) Relative mitochondrial Ca2+

uptake in primary brown adipocytes from WT mice, treated by palmitic acid (PA), Ad-

GFP, Ad-SIRT3 and/or Ad-MCU. The quantitative results are shown on the right (n=3

independent experiments). (F) Representative western blots of MCU and SIRT3 in

primary brown adipocytes from WT mice, treated with si-Mcu or Ad-MCU. Results

shown are representative of three blots. GAPDH served as a loading control. The

quantitative results are shown below (n = 3). The data are presented as the mean ± SD.

*P<0.05, **P<0.01, ***P<0.001, compared with ND (A, B), si-con (C, F), si-sirt3 (D)

or vehicle (E) group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT (A-C), si-con

(D) or Ad-GFP (E) group.

Figure 5. Knockout of SIRT3 increases MCU transcription in an epigenetic manner.

(A) ChIP-qPCR results of the relative binding level of IgG, H3K27ac or H3K27me3

on Mcu promoter in primary brown adipocytes of indicated groups (n=3). (B) ChIP-

qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter

in primary brown adipocytes of WT mice treated with capsaicin or vehicle (n=3). (C) Diabetes Page 38 of 63

Relative mRNA expression levels of Mcu and Micu1 in primary brown adipocytes of

WT mice treated with PA, si-Sirt3 and/or curcumin (n = 3). (D) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with PA, si-Sirt3 and/or curcumin (n = 3). (E)

Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice treated with PA, si-Sirt3 and/or curcumin. The quantitative results are shown on the right (n=3 independent experiments). (F) Relative mRNA expression levels of Mcu and Micu1 in primary brown adipocytes of WT mice treated with PA, si-Sirt3 and/or AICAR (n = 3).

(G) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with PA, si-Sirt3 and/or

AICAR (n = 3). The data are presented as the mean ± SD. *P<0.05, **P<0.01,

***P<0.001, compared with si-con (A), WT (A) or vehicle (B-G) group; #P<0.05,

##P<0.01, ###P<0.001, compared with si-con (C-G) group.

Figure 6. Capsaicin increases SIRT3 expression by activating AMPK/PGC-1α pathway.

(A) Representative western blots of p-AMPK, AMPK and PGC-1α in BAT of WT mice on ND, CD, HFD or HFCD. The quantitative results are shown below (n = 6). (B)

Representative western blots of p-AMPK, AMPK and PGC-1α in primary brown adipocytes of WT mice, treated by capsaicin or different doses of palmitic acid (PA).

The quantitative results are shown below (n = 3). (C) Representative western blots of p-AMPK, AMPK and SIRT3 in primary brown adipocytes of WT mice, treated by

AICAR or PA. The quantitative results are shown below (n = 3). (D) Representative Page 39 of 63 Diabetes

western blots of PGC-1α and SIRT3 in primary brown adipocytes of WT mice, treated

by Ad-PGC-1α or PA. The quantitative results are shown below (n = 3). (E)

Representative western blots of PGC-1α and SIRT3 in primary brown adipocytes of

WT mice, treated by si-Pgc-1α or capsaicin. The quantitative results are shown below

(n = 3). (F) Representative western blots of p-AMPK, AMPK and SIRT3 in primary

brown adipocytes of WT mice, treated by compound C or capsaicin. The quantitative

results are shown below (n = 3). (G) Representative western blots of p-AMPK, AMPK,

PGC-1α and SIRT3 in primary brown adipocytes of WT mice, treated by si-Pgc-1α or

AICAR. The quantitative results are shown on the right (n = 3). Results shown are

representative of three blots in A-G. GAPDH served as a loading control. (H) ChIP-

qPCR results of the relative binding level of PGC-1α on Sirt3 promoter in primary

brown adipocytes of WT mice treated with PA, capsaicin and/or AICAR (n=3). The

data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, compared

between HFD and ND (A), between PA and vehicle (B-D, H), between capsaicin and

vehicle (E, F) or between AICAR and vehicle (G); #P<0.05, ##P<0.01, ###P<0.001,

compared between CD and ND (A) or between other treatments and their individual

controls (B-H).

Figure 7. Knockout of SIRT3 blocks the inhibitory effect of capsaicin on age-related

whitening of BAT. (A) Changes of BW in young or aged wild-type (WT) or SIRT3

knockout (SIRT3-KO) mice fed with normal diet (ND) or capsaicin diet (CD) for 12

weeks (n = 6). (B) Photographs showing the whole appearance of mice in indicated Diabetes Page 40 of 63

group at the end of experiment. Each figure was 19 cm (length) × 7 cm (width). (C)

Food intake of young or aged WT or SIRT3-KO mice fed with ND or CD for 8 days at the end of intervention (n = 6). The cumulative amounts are shown on the right. (D)

The blood glucose levels during IPGTT (2 g/kg) performed on mice in indicated groups

(n = 6). (E) The BAT weight of young or aged WT or SIRT3-KO mice fed with ND or

CD (n = 6). (F) Representative H&E staining images of BAT of mice in indicated groups. Bar represents 50 μm. (G) The size (left) and number (right) of lipid droplets in BAT of mice in indicated groups (n = 18). Each point represents the statistical average of a single slice. (H) Oxygen consumption, Carbon dioxide production, and

Energy expenditure of young or aged WT and SIRT3-KO mice on ND or HFCD, detected by the Comprehensive Laboratory Animal Monitoring System (CLAMS) (n =

6). (I) Representative western blots of SIRT3, MCU, p-AMPK, AMPK and PGC-1α in in BAT of young or aged WT or SIRT3-KO mice on ND or CD. Results shown are representative of three blots. GAPDH served as a loading control. (J) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from indicated groups. The quantitative results are shown on the right (n=3 independent experiments). (K) The working model of the study: HFD or aging induces mitochondrial Ca2+ overload, which results in the whitening of BAT, by inhibition of AMPK/SIRT3 pathway and increasing the acetylation level of histone 3 on Mcu promoter. Capsaicin antagonizes these changes by activation of AMPK/SIRT3 pathway and SIRT3 is required for the inhibitory effect of capsaicin on mitochondrial Ca2+ overload. The pointed arrow represents activation and the flat arrow represents suppression. The data are presented Page 41 of 63 Diabetes

as the mean ± SD, accompanied by scatter points in some figures. *P<0.05, **P<0.01,

***P<0.001, compared with young ND group; #P<0.05, ##P<0.01, ###P<0.001,

compared with WT group. Diabetes Page 42 of 63

Figure 1. The inhibitory effect of capsaicin on BAT whitening is dependent on SIRT3. (A, B) The mRNA (A) and protein expression level (B) of SIRT3 in epididymal white adipose tissue (eWAT), inguinal WAT (iWAT), subcutaneous WAT (sWAT) and brown adipose tissue (BAT) of mice (n = 6). (C, D) The mRNA (C) and protein expression level (D) of SIRT3 in BAT of mice fed with normal diet (ND) or high fat diet (HFD) (n = 6). Western blot results shown in B and D are representative of six blots. GAPDH served as a loading control. (E) Changes of BW in wild-type (WT) or SIRT3 knockout (SIRT3-KO) mice fed with ND, HFD or high fat plus capsaicin diet (HFCD) for 32 weeks (n = 6-7). (F) Photographs showing the whole appearance of mice in indicated group at the end of experiment. Each figure was 19 cm (length) × 7 cm (width). (G) Food intake of WT or SIRT3-KO mice fed with ND, HFD or HFCD for 8 days at the end of intervention (n = 6). The cumulative amounts are shown on the right. (H) The blood glucose levels during IPGTT (2 g/kg) performed on mice in indicated groups (n = 6). (I) The BAT weight of WT or SIRT3-KO mice fed with ND, HFD or HFCD (n = 6). (J) Representative H&E staining images of BAT of mice in indicated groups. Bar represents 50 μm. (K, L) The size (K) and number (L) of lipid droplets in BAT of mice in indicated groups (n = 18). Each point represents the statistical average of a single slice. The data are presented as the mean ± SD, accompanied Page 43 of 63 Diabetes

by scatter points in some figures. *P<0.05, **P<0.01, ***P<0.001, compared with BAT (A, B) or ND group (others); #P<0.05, ##P<0.01, ###P<0.001, compared with WT group.

210x252mm (300 x 300 DPI) Diabetes Page 44 of 63

Figure 2. Deficiency of SIRT3 blocks the beneficial effects of capsaicin on BAT metabolism and function. (A) Oxygen consumption, Carbon dioxide production, Respiratory exchange ratio and Energy expenditure of WT and SIRT3-KO mice on ND, HSD or HFCD, detected by the Comprehensive Laboratory Animal Monitoring System (CLAMS) (n = 6). (B) The physical activity of WT and SIRT3-KO mice on ND, HSD or HFCD (n = 6). (C, D) Representative images of Cytosolic ROS measured by dihydroethidium (DHE) (left) and mitochondrial ROS measured by MitoSOX Red (right) in BAT of mice from indicated groups. Bar, 100 μm. The quantitative results are shown in D (n = 6). (E) Representative western blots of SIRT3, PRDM16, PGC-1α and UCP1in BAT of WT or SIRT3-KO mice on ND, CD, HFD or HFCD. Results shown are representative of three blots. GAPDH served as a loading control. (F) The protocol used to measure mitochondrial oxygen consumption in adipocytes from BAT of mice. Routine, CI LEAK (proton leak), CI OXPHOS (oxidative phosphorylation), CI+II OXPHOS, CI+II ETS (electron transfer system), CII ETS and Residential oxygen consumption of brown adipocytes from mice in indicated groups are shown, detected by high-resolution respirometry (n = 6). The data are presented as the mean ± SD, accompanied by scatter points in A, D, E and G. *P<0.05, **P<0.01, ***P<0.001, compared with ND group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT group. Page 45 of 63 Diabetes

213x300mm (300 x 300 DPI) Diabetes Page 46 of 63

Figure 3. The inhibitory effect of capsaicin on mitochondrial calcium overload in BAT is blocked by SIRT3 knockout. (A) Relative Ca2+ fluorescent signal in isolated BAT mitochondria from WT and SIRT3-KO mice on ND, HFD or HFCD. The quantitative results are shown on the right (n = 3 independent experiments). (B) Thapsigargin-induced SR Ca2+ release and Ca2+ uptake via store operated channels (SOCs) after SR Ca2+ depletion in primary brown adipocytes from indicated groups. The quantitative result of SOC-induced Ca2+ uptake is shown on the right (n=3 independent experiments). (C) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from indicated groups. The quantitative results are shown on the right (n=3 independent experiments). (D) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice, treated by palmitic acid (PA), si-Sirt3 or capsaicin. The quantitative results are shown on the right (n=3 independent experiments). (E) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice, treated by PA, Ad-GFP or Ad-SIRT3. The quantitative results are shown on the right (n=3 independent experiments). The data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, compared with ND or vehicle group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT (A-C), si-con (D) or Ad-GFP (E) group. Page 47 of 63 Diabetes

174x280mm (300 x 300 DPI) Diabetes Page 48 of 63

Figure 4. MCU mediates the promotional effect of SIRT3 knockout on mitochondrial calcium overload. (A) Relative mRNA expression levels of Mcu, Micu1, Mcub and Micu2 in BAT of WT or SIRT3-KO mice on ND, HFD or HFCD (n = 6). (B) Representative western blots of MCU in BAT of WT or SIRT3-KO mice on ND, CD, HFD or HFCD. Results shown are representative of three blots. GAPDH served as a loading control. The quantitative results are shown below (n = 3). (C) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT or SIRT3-KO mice, treated by si-con or si-Mcu. The quantitative results are shown on the right (n=3 independent experiments). (D) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice, treated by si-con, si-Sirt3 or si-Mcu. The quantitative results are shown on the right (n=3 independent experiments). (E) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice, treated by palmitic acid (PA), Ad-GFP, Ad-SIRT3 and/or Ad-MCU. The quantitative results are shown on the right (n=3 independent experiments). (F) Representative western blots of MCU and SIRT3 in primary brown adipocytes from WT mice, treated with si-Mcu or Ad-MCU. Results shown are representative of three blots. GAPDH served as a loading control. The quantitative results are shown below (n = 3). The data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, compared with ND (A, B), si-con Page 49 of 63 Diabetes

(C, F), si-sirt3 (D) or vehicle (E) group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT (A-C), si- con (D) or Ad-GFP (E) group.

198x244mm (300 x 300 DPI) Diabetes Page 50 of 63

Figure 5. Knockout of SIRT3 increases MCU transcription in an epigenetic manner. (A) ChIP-qPCR results of the relative binding level of IgG, H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of indicated groups (n=3). (B) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with capsaicin or vehicle (n=3). (C) Relative mRNA expression levels of Mcu and Micu1 in primary brown adipocytes of WT mice treated with PA, si-Sirt3 and/or curcumin (n = 3). (D) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with PA, si-Sirt3 and/or curcumin (n = 3). (E) Relative mitochondrial Ca2+ uptake in primary brown adipocytes from WT mice treated with PA, si-Sirt3 and/or curcumin. The quantitative results are shown on the right (n=3 independent experiments). (F) Relative mRNA expression levels of Mcu and Micu1 in primary brown adipocytes of WT mice treated with PA, si-Sirt3 and/or AICAR (n = 3). (G) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with PA, si-Sirt3 and/or AICAR (n = 3). The data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, compared with si-con (A), WT (A) or vehicle (B-G) group; #P<0.05, ##P<0.01, ###P<0.001, compared with si-con (C-G) group.

210x239mm (300 x 300 DPI) Page 51 of 63 Diabetes Diabetes Page 52 of 63

Figure 6. Capsaicin increases SIRT3 expression by activating AMPK/PGC-1α pathway. (A) Representative western blots of p-AMPK, AMPK and PGC-1α in BAT of WT mice on ND, CD, HFD or HFCD. The quantitative results are shown below (n = 6). (B) Representative western blots of p-AMPK, AMPK and PGC-1α in primary brown adipocytes of WT mice, treated by capsaicin or different doses of palmitic acid (PA). The quantitative results are shown below (n = 3). (C) Representative western blots of p-AMPK, AMPK and SIRT3 in primary brown adipocytes of WT mice, treated by AICAR or PA. The quantitative results are shown below (n = 3). (D) Representative western blots of PGC-1α and SIRT3 in primary brown adipocytes of WT mice, treated by Ad-PGC-1α or PA. The quantitative results are shown below (n = 3). (E) Representative western blots of PGC-1α and SIRT3 in primary brown adipocytes of WT mice, treated by si-Pgc-1α or capsaicin. The quantitative results are shown below (n = 3). (F) Representative western blots of p-AMPK, AMPK and SIRT3 in primary brown adipocytes of WT mice, treated by compound C or capsaicin. The quantitative results are shown below (n = 3). (G) Representative western blots of p-AMPK, AMPK, PGC-1α and SIRT3 in primary brown adipocytes of WT mice, treated by si-Pgc-1α or AICAR. The quantitative results are shown on the right (n = 3). Results shown are representative of three blots in A-G. GAPDH served as a loading control. Page 53 of 63 Diabetes

(H) ChIP-qPCR results of the relative binding level of PGC-1α on Sirt3 promoter in primary brown adipocytes of WT mice treated with PA, capsaicin and/or AICAR (n=3). The data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, compared between HFD and ND (A), between PA and vehicle (B-D, H), between capsaicin and vehicle (E, F) or between AICAR and vehicle (G); #P<0.05, ##P<0.01, ###P<0.001, compared between CD and ND (A) or between other treatments and their individual controls (B-H).

205x246mm (300 x 300 DPI) Diabetes Page 54 of 63

Figure 7. Knockout of SIRT3 blocks the inhibitory effect of capsaicin on age-related whitening of BAT. (A) Changes of BW in young or aged wild-type (WT) or SIRT3 knockout (SIRT3-KO) mice fed with normal diet (ND) or capsaicin diet (CD) for 12 weeks (n = 6). (B) Photographs showing the whole appearance of mice in indicated group at the end of experiment. Each figure was 19 cm (length) × 7 cm (width). (C) Food intake of young or aged WT or SIRT3-KO mice fed with ND or CD for 8 days at the end of intervention (n = 6). The cumulative amounts are shown on the right. (D) The blood glucose levels during IPGTT (2 g/kg) performed on mice in indicated groups (n = 6). (E) The BAT weight of young or aged WT or SIRT3-KO mice fed with ND or CD (n = 6). (F) Representative H&E staining images of BAT of mice in indicated groups. Bar represents 50 μm. (G) The size (left) and number (right) of lipid droplets in BAT of mice in indicated groups (n = 18). Each point represents the statistical average of a single slice. (H) Oxygen consumption, Carbon dioxide production, and Energy expenditure of young or aged WT and SIRT3-KO mice on ND or HFCD, detected by the Comprehensive Laboratory Animal Monitoring System (CLAMS) (n = 6). (I) Representative western blots of SIRT3, MCU, p-AMPK, AMPK and PGC-1α in in BAT of young or aged WT or SIRT3-KO mice on ND or CD. Results shown are representative of three blots. GAPDH served as a loading control. (J) Relative Page 55 of 63 Diabetes

mitochondrial Ca2+ uptake in primary brown adipocytes from indicated groups. The quantitative results are shown on the right (n=3 independent experiments). (K) The working model of the study: HFD or aging induces mitochondrial Ca2+ overload, which results in the whitening of BAT, by inhibition of AMPK/SIRT3 pathway and increasing the acetylation level of histone 3 on Mcu promoter. Capsaicin antagonizes these changes by activation of AMPK/SIRT3 pathway and SIRT3 is required for the inhibitory effect of capsaicin on mitochondrial Ca2+ overload. The pointed arrow represents activation and the flat arrow represents suppression. The data are presented as the mean ± SD, accompanied by scatter points in some figures. *P<0.05, **P<0.01, ***P<0.001, compared with young ND group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT group.

211x304mm (300 x 300 DPI) Diabetes Page 56 of 63

Supplementary materials

Supplemental figures and legends

Figure S1. Capsaicin inhibits high fat diet-induced obesity in a TRPV1-dependent manner. (A, B)

The mRNA (A) and protein expression level (B) of SIRT3 in eWAT of mice fed with normal diet

(ND) or high fat diet (HFD) (n = 6). Western blot results shown in B are representative of six blots.

GAPDH served as a loading control. (C) Changes of body weight in wild-type (WT) or TRPV1 knockout (TRPV1-KO) mice fed with ND, HFD or high fat plus capsaicin diet (HFCD) for 32 weeks

(n = 6-7). (D) Food intake of WT or TRPV1-KO mice fed with ND, HFD or HFCD for 8 days at Page 57 of 63 Diabetes

the end of intervention (n = 6). (E) The eWAT weight (left) and the ratio of eWAT to body weight

(right) of WT or TRPV1-KO mice fed with ND, HFD or HFCD (n = 6). (F) Food intake of WT or

SIRT3-KO mice fed with ND, HFD or HFCD for 8 days from the 10th day of intervention (n = 6).

(G) The BAT weight of WT or TRPV1-KO mice fed with ND, HFD or HFCD (n = 6). (H)

Representative H&E staining images of eWAT (left) and iWAT (right) of mice in indicated groups.

Bar represents 100 μm. (I, J) The size and number of lipid droplets in eWAT (I) or iWAT (J) of

mice in indicated groups (n = 18). Each point represents the statistical average of a single slice. The

data are presented as the mean ± SD, accompanied by scatter points in some figures. *P<0.05,

**P<0.01, ***P<0.001, compared with ND group; #P<0.05, ##P<0.01, ###P<0.001, compared with

WT group. Diabetes Page 58 of 63

Figure S2. Deficiency of SIRT3 blocks the beneficial effects of capsaicin on metabolism. (A)

Representative images showing the changes of O2 consumption, CO2 production, Respiratory exchange ratio (RER) and Energy expenditure (EE) during 24 hours of WT and SIRT3-KO mice on Page 59 of 63 Diabetes

ND, HFD or HFCD (n = 6 per group). The grey part represents nighttime. (B, C) Oxygen

consumption, Carbon dioxide production, RER and EE on the daytime (B) and nighttime (C) of WT

and SIRT3-KO mice on ND, HSD or HFCD, detected by the Comprehensive Laboratory Animal

Monitoring System (CLAMS) (n = 6). (D) The physical activity on the daytime (top) and nighttime

(bottom) of of WT and SIRT3-KO mice on ND, HSD or HFCD (n = 6). (E) The quantitative results

of western blots of SIRT3, PRDM16, PGC-1α in BAT of WT or SIRT3-KO mice on ND, CD, HFD

or HFCD (n = 3). The data are presented as the mean ± SD, accompanied by scatter points in B-E.

*P<0.05, **P<0.01, ***P<0.001, compared with ND group; #P<0.05, ##P<0.01, ###P<0.001,

compared with WT group. Diabetes Page 60 of 63

Figure S3. SIRT3 inhibits palmitic acid-induced ROS generation in brown adipocytes. (A) The protein (top) and mRNA expression levels (bottom) of SIRT3 in primary brown adipocytes from

WT mice, treated by palmitic acid (PA), si-Sirt3 or capsaicin (n=3). (B) Thapsigargin-induced SR

Ca2+ release and Ca2+ uptake via store operated channels (SOCs) after SR Ca2+ depletion in primary brown adipocytes from indicated groups. The quantitative results of SOC-induced Ca2+ uptake is shown on the right (n=3 independent experiments). (C) Representative western blots of p-CaMKII,

CaMKII in primary brown adipocytes from WT mice, treated by palmitic acid (PA), si-Sirt3 or capsaicin (n=3). GAPDH served as a loading control. (D) Routine, CI LEAK (proton leak), CI

OXPHOS (oxidative phosphorylation), CI+II OXPHOS, CI+II ETS (electron transfer system), CII Page 61 of 63 Diabetes

ETS and Residential oxygen consumption of primary brown adipocytes from WT mice, treated by

palmitic acid (PA), si-Sirt3 or capsaicin (n=6). (E) The protein (top) and mRNA expression levels

(bottom) of SIRT3 in primary brown adipocytes from WT mice, treated by palmitic acid (PA), Ad-

GFP or Ad-SIRT3 (n=3). (F) The quantitative results of Cytosolic ROS measured by

dihydroethidium (DHE) (left) and mitochondrial ROS measured by MitoSOX Red (right) in primary

brown adipocytes from WT mice, treated by PA or si-sirt3 (n = 6). (G) The quantitative results of

Cytosolic ROS measured by dihydroethidium (DHE) (left) and mitochondrial ROS measured by

MitoSOX Red (right) in primary brown adipocytes from WT mice, treated by PA or Ad-SIRT3 (n

= 6). The data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, compared between

PA and vehicle; #P<0.05, ##P<0.01, ###P<0.001, compared between si-sirt3 and si-con group (A-D,

F) or between Ad-SIRT3 and Ad-GFP group (E, G). Diabetes Page 62 of 63

Figure S4. Interference of Mcu blocks the promotional effect of SIRT3 knockdown on ROS generation in brown adipocytes. (A) The protein (left) and mRNA expression levels (right) of MCU and SIRT3 in primary brown adipocytes from WT or SIRT3-KO mice, treated by si-con or si-Mcu Page 63 of 63 Diabetes

(n = 3). (B) The protein (left) and mRNA expression levels (right) of MCU and SIRT3 in primary

brown adipocytes from WT mice, treated by si-Sirt3 and/or si-Mcu (n = 3). (C) The quantitative

results of Cytosolic ROS measured by dihydroethidium (DHE) (left) and mitochondrial ROS

measured by MitoSOX Red (right) in primary brown adipocytes from WT or SIRT3-KO mice,

treated by si-con or si-Mcu (n = 6). (D) The quantitative results of Cytosolic ROS measured by

dihydroethidium (DHE) (left) and mitochondrial ROS measured by MitoSOX Red (right) in primary

brown adipocytes from WT mice, treated by si-Sirt3 and/or si-Mcu (n = 6). (E) Routine, CI LEAK

(proton leak), CI OXPHOS (oxidative phosphorylation), CI+II OXPHOS, CI+II ETS (electron

transfer system), CII ETS and Residential oxygen consumption of primary brown adipocytes from

WT mice, treated by si-Sirt3 and/or si-Mcu (n = 6). (F) Parameters of mitochondrial respiratory

activity of primary brown adipocytes from WT mice, treated by si-Mcu (left) or Ru360 (right) (n =

6). The data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, compared between

# ## ### si-Mcu and si-con, or Ru360 and vehicle; P<0.05, P<0.01, P<0.001, compared between SIRT3-

KO and WT group (A, C) or between si-sirt3 and si-con group (B, D, E). Diabetes Page 64 of 63

Figure S5. Overexpression of MCU blocks the promotional effect of Ad-SIRT3 on mitochondrial respiration. (A) The protein (left) and mRNA expression levels (right) of MCU and SIRT3 in primary brown adipocytes from WT mice, treated by palmitic acid (PA), Ad-GFP, Ad-SIRT3 and/or

Ad-MCU (n = 3). (B) Routine, CI LEAK (proton leak), CI OXPHOS (oxidative phosphorylation),

CI+II OXPHOS, CI+II ETS (electron transfer system), CII ETS and Residential oxygen consumption of primary brown adipocytes from WT mice, treated by palmitic acid (PA), Ad-GFP,

Ad-SIRT3 and/or Ad-MCU (n = 6). The data are presented as the mean ± SD, accompanied by scatter points in B. *P<0.05, **P<0.01, ***P<0.001, compared with Ad-GFP vehicle group;

#P<0.05, ##P<0.01, ###P<0.001, compared with Ad-GFP PA group. Page 65 of 63 Diabetes Diabetes Page 66 of 63

Figure S6. Knockout of SIRT3 increases MCU transcription in an epigenetic manner. (A) ChIP- qPCR results of the relative binding level of IgG, c-fos or c-jun on Mcu or Micu1 promoter in primary brown adipocytes of indicated groups (n=3). (B) ChIP-qPCR results of the relative binding level of IgG, c-fos or c-jun on Mcu or Micu1 promoter in primary brown adipocytes of WT mice treated with capsaicin or vehicle (n=3). (C) ChIP-qPCR results of the relative binding level of IgG,

H3K27ac or H3K27me3 on Micu1 promoter in primary brown adipocytes of indicated groups (n=3).

(D) ChIP-qPCR results of the relative binding level of IgG, H3K27ac or H3K27me3 on Micu1 promoter in primary brown adipocytes of WT mice treated with capsaicin or vehicle (n=3). (E)

Relative mRNA expression levels of Mcu and Micu1 in primary brown adipocytes of WT mice treated with pcDNA3.1-p300 and/or capsaicin (n = 3). (F) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with pcDNA3.1-p300 and/or capsaicin (n = 3). (G) Relative mRNA expression levels of Mcu and

Micu1 in primary brown adipocytes of WT mice treated with capsaicin and/or compound C (n = 3).

(H) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with capsaicin and/or compound C (n = 3). (I)

Relative mRNA expression levels of Mcu and Micu1 in primary brown adipocytes of WT mice treated with capsaicin and/or si-AMPKα1/2 (n = 3). (J) ChIP-qPCR results of the relative binding level of H3K27ac or H3K27me3 on Mcu promoter in primary brown adipocytes of WT mice treated with capsaicin and/or si-AMPKα1/2 (n = 3).The data are presented as the mean ± SD. *P<0.05,

**P<0.01, ***P<0.001, compared with si-con (A, C), WT (A, C) or vehicle (B, D-J) group; #P<0.05,

##P<0.01, ###P<0.001, compared with vehicle group (E-J). Page 67 of 63 Diabetes

Figure S7. Capsaicin increases SIRT3 expression by activating AMPK/PGC-1α pathway. (A) The

quantitative results of p-AMPK/t-AMPK ratio in primary brown adipocytes of WT mice, treated

by AICAR or PA (n = 3). (B) The quantitative results of PGC-1α in primary brown adipocytes of

WT mice, treated by Ad-PGC-1α or PA (n = 3). (C) The quantitative results of PGC-1α in primary

brown adipocytes of WT mice, treated by si-Pgc-1α or capsaicin (n = 3). (D) The quantitative

results of p-AMPK/t-AMPK ratio in primary brown adipocytes of WT mice, treated by compound

C or capsaicin (n = 3). The data are presented as the mean ± SD. *P<0.05, ***P<0.001, compared

between PA or capsaicin and vehicle; #P<0.05, ##P<0.01, ###P<0.001, compared between other

treatments and their individual controls. Diabetes Page 68 of 63

Figure S8. Knockout of SIRT3 blocks the inhibitory effect of capsaicin on age-reduced metabolic rate. (A) Representative images showing the changes of O2 consumption, CO2 production,

Respiratory exchange ratio (RER) and Energy expenditure (EE) during 24 hours of young or aged

WT and SIRT3-KO mice on ND or CD (n = 6 per group). The grey part represents nighttime. (B)

The RER of young or aged WT and SIRT3-KO mice on ND or CD (n = 6 per group). (C, D) Oxygen consumption, Carbon dioxide production, RER and EE on the daytime (C) and nighttime (D) of young or aged WT and SIRT3-KO mice on ND or CD, detected by the Comprehensive Laboratory Page 69 of 63 Diabetes

Animal Monitoring System (CLAMS) (n = 6). The data are presented as the mean ± SD,

accompanied by scatter points in B-D. *P<0.05, **P<0.01, ***P<0.001, compared with young ND

group; #P<0.05, ##P<0.01, compared with WT group.

Figure S9. The quantitative results of western blots of SIRT3, MCU, p-AMPK, AMPK and PGC-

1α in in BAT of young or aged WT or SIRT3-KO mice on ND or CD (n = 3). The data are presented

as the mean ± SD, accompanied by scatter points in some figures. *P<0.05, **P<0.01, ***P<0.001,

compared with young ND group; #P<0.05, ##P<0.01, ###P<0.001, compared with WT group. Diabetes Page 70 of 63

Supplemental Tables

Table S1, Related to Experimental Procedures.

Primer sequences applied in Real-time PCR and ChIP-qPCR

Accession Gene number Sequences (5’-3’) Length Amplicon (Genbank) NM_0080 for CATGGCCTTCCGTGTTCCTA 20bp Mouse Gapdh 104bp 84 rev CCTGCTTCACCACCTTCTTGAT 22bp NM_0224 for CCACGACAAGGAGCTGCTTCTG 22bp Mouse Sirt3 183bp 33.2 rev ACCCTGTCCGCCATCACATCA 21bp NM_0010 for TCTCTGACTCAGTCGGCGTGTT 22bp Mouse Mcu 134bp 33259.4 rev GTCATCGAGGAGCAGGAGGTCT 22bp NM_1448 for GATTGATGCTGGTGGCGTTCCT 22bp Mouse Micu1 170bp 22.3 rev CCTTCCTTCACGGCTGGACACT 22bp NM_0257 for CGGAGCAGGCAGTTTCTTCAGT 12bp Mouse Mcub 168bp 79.3 rev CTTCTCGCTGGCTTCCTCTCCT 22bp NM_0286 for CAGGATGCACCGAGGCTTATGG 22bp Mouse Micu2 112bp 43.3 rev GGCTTGTTGTCTCCAGGCTTCC 22bp Mouse Mcu for CTCGGAACAAGCTCTGCACAGG 22bp NC_0000 promoter AP-1 181bp 76.6 rev TTCGGGCTGTCTGTCACTTCCA 22bp binding site Mouse Micu1 for GAGGCACAGGAGAGGTGGACTT 22bp NC_0000 promoter AP-1 111bp 76.6 rev TGCCACGCCCTCGCTGTTTA 20bp binding site Mouse Sirt3 for GCCATACCAGGAGCCGTGTATC 22bp NC_0000 promoter PGC-1α 101bp 73.6 rev GTCGGCAGTACAAGGCGAACAG 22bp binding site

All primer sets worked under identical quantitative PCR cycling conditions with similar efficiencies to obtain simultaneous amplification in the same run. Sequences were taken from

GenBank and all accession numbers are denoted.