D D!"#$ D%$&%$' %(&)D%* *&+,
&(
P !" #$%&'% ( P !"#$% $&#$'()(*+,&(+(&
(-./0.%12304"5673088-. 967:68-.0%;72<0.=2>?
i
ii
B !" #$%& '!()&%*(+,
@7676%956.6>52A%907:68B.B4PNF%FPNA%!7U26
CD5-70E%FGF4HIHJIJKH%L%HHMNJFFJA%(6OE%HIHJMHMPA%04/628E<3XYBYR0.70>R27Z
D.-QR%9R%$52//0%S-TU6 )-R%1"DL 1230%"5673088-. D6>0E%HFRJRHFJN
% % (&+ V&+D%9,%$' %1!" %"'#)" WW&+
! "#$"%&'( )#i*('+i,- i+ .&//i,,(0 ,& (1.(%%(#.( i# '(+("'.2 "#0 ,(".2i#$3 42( +,"55 "#0 +,60(#,+ "'( &6' "++(,+3 42( )#i*('+i,- *i(7+ (".2 &#( &5 i,+ ".,i*i,i(+ "+ "# i#*(+,/(#, ,2", 2(%8+ i# ".2i(*i#$ i,+ &9:(.,i*(+3
4 2( 6%,i/",( $&"% &5 ,2( )#i*('+i,-; "+ %"i0 0&7# 9- ,2( )#i*('+i,- ='"#,+ <&//i++i&#; i+ ,& i/8'&*( "."0(/i. 8('5&'/"#.( "#0 "i/ 5&' (1.(%%(#.(3 42( =&%0(# >69i%(( *&%6/( &# “A !"#$%&'" (#)"$A* &$ +,&'$,'- i+ "# ",,(/8, i# ,2i+ 0i'(.,i 42( *&%6/( 2"+ .&#,'i96,i&#+ ,& " .6,,i#$ A(0$( "'(" 5'&/ '(+("'.2('+ 7i,2i# ?#0i"3 ? 6#0('+,"#0 ,2", ,2i+ =&%0(# >69i%(( *&%6/( .&#,"i#+ .&/8i%(0 "#0 '(*i(7(0 8"8('+ &# *"'i&6+ 5".(,+ &5 !i&%&$- .&*('i#$ /i.'&9i&%&$-; 8%"#, 9i&,(.2#&%&$-; /&%(.6%"' (#,&/&%&$- "#0 (.&%&$-3 ? .&/8%i/(#, ,2( (0i,&'i"% ,("/ &5 @i:#"#" !2"'",2i 5&' 2"*i#$ .&/( 68 7i,2 ,2i+ *&%6/( "#0 2&8( ,2", ,2( '("0('+ 5'&/ 7i,2i# &6' )#i*('+i,- "#0 &6,+i0( 9(#(5i, 5'&/ ,2i+3
1,.:;#<,#5;#=7 %%*#>.?4$
@ 2*#C7$+2*--.,
5$+/$-.,*#A+ B*,( !"
C !"#C$%&'()#C*+!,$-#C.--*/*#C$%&'(0#1$-$2*#3.$40#5*+/$-','CDE8#88F# 617.+*)#898CGGGFFHIG0##J$K)#GGGFL8DGM
#
iii
i*
.&($A$A /0A"A%0&
!"#$"%&'( )#i*('+i,- >&6'#"% &5 B.i(#.( A C 9iA"##6"% 8('i&0i."%3
&++$123451688:
;<=>?@?@MNEON?FD
( #)"$A* &$!#"PA%&#$
!"#$"%&'( )#i*('+i,-; !"#$"%&'(; 2"+ i#,'&06.(0 ‘%B< +O? %QR'+ #! A"%&,*'+ C',i.%(+ 869%i+2(0 i# .?SFEFE=BEJE@B? (#.&/8"++ " 9'&"0 '"#$( &5 '(+("'.2 ,&8i.+ i# !i&%&$- B-+,(/",i.+ "#0 Ji*('+i,-; K&'82&%&$-L C#",&/- "#0 M2-+i&%&$- "/&#$ 8%"#, "#0 "#i/"% Ii#$0&/+; <(%% "#0 K&%(.6%"' 9i&%&$-; N*&%6,i&#"'- 9i&%&$- "#0 N.&%&$-; =(#(,i.+; J(*(%&8/(#,"% 9i&%&$-; M"'"+i,&%&$- "#0 M",2&%&$-; !i&A.2(/i+,'-; ?//6#&%&$-; !i&i#5&'/",i.+; !i&(,2i.+ (,.3; M2-+i.+ =(#('"% M2-+i.+; ='"*i,",i&# "#0 C+,'&82-+i.+; N%(/(#,"'- M"',i.%(+ "#0 Oi(%0+; P6.%("' "#0 Q"0'&#i. M2-+i.+; C,&/i.; K&%(.6%"'; "#0 <2(/i."% M2-+i.+; R8,i."% M2-+i.+; O%6i0 "#0 M%"+/" M2-+i.+; B,",i+,i."% "#0 P&#%i#("' M2-+i.+; <�(#+(0 K",,(' M2-+i.+; <'&++ Ji+.i8%i#"'- M2-+i.+S !i&%&$i."% M2-+i.+; T6"#,6/ ?#5&'/",i&# (,.3; <2(/i+,'- S R'$"#i.; ?#&'$"#i.; M2-+i."%; C#"%-,i."%; !i&%&$i."%; M2"'/".(6,i."%; ?#06+,'i"%; N#*i'&#/(#,"%; C$'i.6%,6'"% U B&i%; M(,'&%(6/; M&%-/('+; P"#&,(.2#&%&$-; ='((# <2(/i+,'-; O&'(#+i.; M2&,&.2(/i+,'-; B-#,2(,i. J'6$+; <&/86,",i&#"%; "+ 7(%% "+ <2(/i."% M2-+i.+ "#0 <2(/i."% N#$i#(('i#$3 K",2(/",i.+ C#"%-,i. #6/9(' ,2(&'-; O6#.,i&#"% "#"%-+i+ "#0 &8('",&' ,2(&'-; V("% "#0 2"'/&#i. "#"%-+i+; <&/8%(1 "#"%-+i+; P6/('i."% "#"%-+i+; C88%i(0 /",2(/",i.+; M"',i"% 0i55('(#,i"% (W6",i&#+; J-#"/i."% +-+,(/+; <&#,'&% "#0 R8,i/iX",i&#; M'&9"9i%i,-; K",2(/",i."% 9i&%&$-; <&/9i#",&'i.+; K",2(/",i."% 82-+i.+ N"',2 "#0 C,/&+82('i. B.i(#.(+ C,/&+82('i. +.i(#.(+; =(&.2(/i+,'-; =(&%&$-; Ki#('"%&$- "#0 M(,'&%&$-; =(&82-+i.+; Q-0'&%&$-; R.("#&$'"82-; <%i/",( .2"#$(; $(&$'"82- "#0 $(&i#5&'/",i.+ <&/86,(' B.i(#.(+ C%$&'i,2/ "#0 .&/86,",i&#"% .&/8%(1i,-; <&/86,(' "'.2i,(.,6'( "#0 2i$2 8('5&'/"#.( .&/86,i#$; Ji+,'i96,(0 "#0 $'i0 .&/86,i#$; Q6/"#A.&/86,(' i#,('".,i&#; * ?#5&'/",i&# +(.6'i,-; M",,('# '(.&$#i,i&# "#0 i/"$( 8'&.(++i#$; @YB? 0(+i$# "#0 ,(+,i#$; C',i5i.i"% i#,(%%i$(#.(; J(8(#0"9%( .&/86,i#$ "#0 "#- &,2(' "%%i(0 /6%,i0i+.i8%i#"'- "',i.%(+342( "6,2&'+ "'( (#.&6'"$(0 ,& .&#,"., ,2( +69:(., (0i,&' &' N0i,&'Ai#A<2i(5 i5 ,2('( "'( "#- .%"'i5i.",i&#+ '($"'0i#$ ,2( +6i,"9i%i,- &5 ,2(i' /"#6+.'i8, i# .?SFEFE=BEJE@B?N 42( :&6'#"% 7i%% "..(8, /"#6+.'i8,+ i# ,2( 5&'/ &5 '(+("'.2 "',i.%(+; '(*i(7 "',i.%(+; ,(.2#i."% '(8&',+ "#0 +,60(#, "',i.%(+3 "<> " % +@KU " C%% /"#6+.'i8,+ "'( '(*i(7(0 9- W6"%i5i(0 (1,('#"% '(*i(7('+ "#0 L&' 9- N0i,&' "#0 K(/9('+ &5 ,2( N0i,&'i"% !&"'03 J(.i+i&#+ 7i%% 9( /"0( "+ '"8i0%- "+ 8&++i9%(; "#0 ,2( :&6'#"% +,'i*(+ ,& '(,6'# '(*i(7('+ .&//(#,+ ,& "6,2&'+ 8'&/8,%-3 42( N0i,&'i"% 9&"'0 7i%% '(A'(*i(7 /"#6+.'i8,+ ,2", "'( "..(8,(0 8(#0i#$ '(*i+i ?, i+ ,2( $&"% &5 ,2( .?SFEFE =BEJE@B? ,& 869%i+2 /"#6+.'i8,+ +2&',%- "5,(' +69/i++i RJIIV> EFU " N%(.,'&#i. 8'&&5+ 7i%% 9( +(#, G*i" (A/"i% ",,".2/(#,H ,& ,2( .&''(+8�i#$ "6,2&' "+ " MJO 5i%(3 M"$( 8'&&5+ "'( .&#+i0('(0 ,& 9( ,2( 5i#"% *('+i&# &5 ,2( /"#6+.'i8,3 Zi,2 ,2( (1.(8,i&# &5 ,-8&$'"82i."% &' /i#&' .%('i."% (''&'+; #& .2"#$(+ 7i%% 9( /"0( i# ,2( /"#6+.'i8, ", ,2( 8'&&5 +,"$(3 !(."6+(; .?SFEFE=BEJE@B? 7i%% 9( 869%i+2(0 5'((%- &#%i#(L8'i#, ,& ",,'"., " 7i0( '("0('+3 C6,2&'+ 7i%% 2"*( &8(# "..(++ ,& ,2( 56%% ,(1, Gi# 9&,2 Q4KY "#0 MJOH &5 ,2( "',i.%(3 C6,2&'+ ."# 5'((%- 0&7#%&"0 ,2( MJO 5i%( 5'&/ 72i.2 ,2(- ."# 8'i#, 6#%i/i,(0 .&8i(+ &5 ,2(i' "',i.%(+3 , ICMJ?GB@ B69/i++i&# &5 " /"#6+.'i8, i/8%i(+S ,2", ,2( 7&'I 0(+.'i9(0 2"+ #&, 9((# 869%i+2(0 9(5&'( G(1.(8, i# ,2( 5&'/ &5 "# "9+,'"., &' "+ 8"', &5 " 869%i+2(0 %(.,6'(; &' ,2(+i+H ,2", i, i+ #&, 6#0(' .&#+i0('",i&# 5&' 869%i.",i&# (%+(72('([ ,2", i5 "#0 72(# ,2( /"#6+.'i8, i+ "..(8,(0 5&' 869%i.",i&#; ,2( "6,2&'+ "$'(( ,& "6,&/",i. ,'"#+5(' &5 ,2( .&8-'i$2, ,& ,2( 869%i+2('3 *i ' W&%#"&A* /#A"W RJIVN 0NRNRK@@EJESK J(8"',/(#, &5 Yi5( B.i(#.( N0i,&' i# <2i(5 !"#$"%&'( )#i*('+i,-; !"#$" %&'( N/"i% i0 S (0*i$#"#"92"'",2i\$ /"i%3.&/ WJN +EMEFU?C PKXB WJN + +EYCE@B ZKYEJ J(8"',/(#, &5 N.&%&$ - "#0 !(2"*i&'"% B.i(#.( C++&.i",( N0i,&' ?#0i"# ?#+,i,6,( &5 B.i(#.(; !"#$"%&'( N/"i% ?J S +"/]_I6/"'\$/"i%3.&/ N0i,&'i"% !&"'0 RJIVN +BEJE@B AFEF@BEYKJ@BM J(8"',/(#, &5 M2-+i.+ K(/9(' !"#$"%&'( )#i*('+i,-; ! "#$"%&'( N/"i% i0 S "+2"'",2\$/"i%3.&/ RJIVN A>BE W N/"i% i0 S +"/9(3"+2"0(*i\$/"i%3.&/ RJIVN RJEU< RJIVN ,BEFUJECCE J(8"',/(#, &5 <2 (/i+,'- K(/9(' !"#$"%&'( )#i*('+i,-; !"# $"%&'( N/"i% i0 S $,.2"#0'"88"\-"2&&3 .&3i# RJIVN % RJIVN /N,N RJE=BEXEJ J(8"',/(#, &5 =(&%& $- K(/9(' !"#$"%&'( )#i*('+i,-; !" #$"%&'( N/"i% i0 S9.8'"92"I"'\'(0i55/"i%3.&/ RJIVN 0EFKYEF@BECCE J(8"',/(#, &5 <&/86, (' C88%i.",i&# K(/9(' !"#$"%&'( )#i*('+i,-; !"#$"%&'( N/"i% i0 S 2"#6bFd_\9693('#(,3i# *ii 'U?@IJ?EH CIH?OM .&[$A$A/0A"A%0&\ ,2( 9iA"##6"% +.i(#.( :&6'#"% &5 !"#$"%&'( )#i*('+i,- "i/+ ,& 869%i+2 2i$2W6"%i,- "',i.%(+ '(%(*"#, ,& "%% ,2&+( i#,('(+,(0 i# M2-+i."%; /",2(/",i."% "#0 .&/86,(' +.i(#.(+; <2(/i."% B.i(#.(; !i&%&$i."% +.i(#.(+; N"',2 "#0 C,/&+82('i. B.i(#.(+3 42i+ 8(('A'(*i(7(0; +(/iA"##6"% :&6'#"%; 869%i+2(0 9- M'"+"'"#$" !"#$"%&'( )#i*('+i,- i# N#$%i+2; G?BBP #6/9('S eEdDAb]]_H 7i%% .&#+i0(' &'i$i#"% +.i(#,i5i. "#0 #&#A+.i(#,i5i. .&#,'i96,i&#+ 5&' 869%i.",i&# i# "# R8(# "..(++ 5&'/",3 V(+("'.2 "',i.%(+; V(*i(7 "',i.%(+; '(8&',+; "#0 R8i#i&# "',i.%(+ i# ,2( "'("+ &5 M2-+i.+; <2(/i+,'-; K",2(/",i.+; <&/86,(' +.i(#.(; !i&%&$- "#0 N"',2 "#0 C,/&+82('i. +.i(#.( 7i%% 9( .&#+i0('(03 ?, i+ 869%i+2(0 9iA"##6"% "#0 +('*(+ ,2( #((0 &5 +.i(#,i5i. "#0 #&#A+.i(#,i5i. 8('+&#"%+ i#*&%*(0Li#,('(+,(0 i# $"i#i#$ I#&7%(0$(3 &FU<]?FGA ?#0(1i#$ i+ 6#0(' 8'&.(++ 5&' ?#0(1 <&8('#i.6+; JRC> GJi'(.,&'- &5 R8(# C..(++ >&6'#"%+H; B.&86+ "#0 N!B & F>@JKO@?IF> @I AK@BIJ> 42( +69/i++i&# &5 /"#6+.'i8,+ i+ +,'&#$%- (#.&6'"$(0; 8'&*i0(0 ,2", ,2( ,(1,; ,"9%(+; "#0 5i$6'(+ "'( i#.%60(0 i# " +i#$%( Ki.'&+&5, Z&'0 5i%( G8'(5('"9%- i# 4i/(+ P(7 V&/"#; D_ 5&#,+ 7i,2 0&69%( +8".(H3 B69/i, /"#6+.'i8,+ "+ (A/"i% ",,".2/(#, ,& ,2( N0i,&'i"% &55i.( ",S (0*i$#"#"92"'",2i\$/"i%3.&/3 4 2( .&*(' %(,,(' +2&6%0 i#0i.",( ,2( .&''(+8�i#$ "6,2&'f+ 56%% "00'(++ "#0 ,(%(82&#(L5"1 #6/9('+ "#0 +2&6%0 9( i# "# (A/"i% /(++"$( +(#, ,& ,2( N0i,&'; 7i,2 ,2( 5i%(; 72&+( #"/( +2&6%0 9($i# 7i,2 ,2( 5i'+, "6,2&'f+ +6'#"/(; "+ "# ",,".2/(#,3 42( "6,2&'+ /"- "%+& +6$$(+, ,7& ,& 5&6' '(*i(7('+ 5&' ,2( /"#6+.'i8,3 V($6%"' "',i.%(+ 42(+( +2&6%0 #&, (1.((0 geee 7&'0+; b 0i+8%"- i,(/+ G,"9%(+ "#0 5i$6'(+H; +2&6%0 0(+.'i9( #(7 "#0 ."'(56%%- .i'/(0 5i#0i#$+; "#0 (18('i/(#,"% 8'&.(06'(+ +2&6%0 9( $i*(# i# +655i.i(#, 0(,"i% 5&' &,2('+ ,& *('i5- ,2( 7&'I3 42( %(#$,2 &5 " 56%% 8"8(' +2&6%0 9( ,2( /i#i/6/ '(W6i'(0 ,& 0(+.'i9( "#0 i#,('8'(, ,2( 7&'I .%("'%-3 V (*i(7 "',i.%(+ 42( '(*i(7 "',i.%(+ +2&6%0 #&, (1.((0 beee 7&'0+ "#0 .i,(0 '(5('(#.(+ ,& 9( %i/i,(0 ,& "9&6, Dee i# #6/9('3 42( "',i.%( i+ (18(.,(0 ,& +6'*(- "#0 0i+.6++ .6''(#,0(*(%&8/(#,+ i# " 5i(%03 42(- +2&6%0 9( 7(%% 5&.6+(0 "#0 &'$"#iX(0; "#0 "*&i0 " $(#('"% ‘,(1,9&&I +,-%(3 ] B2&', <&//6#i.",i&#+ G4(.2#i."% "#0 B,60(#, C',i.%(+H C B2&', <&//6#i.",i&# i+ +6i,"9%( 5&' '(.&'0i#$ ,2( '(+6%,+ &5 .&/8%(,( +/"%% i#*(+,i$",i&#+ &' $i*i#$ 0(,"i%+ &5 #(7 /&0(%+ &' 2-8&,2(+(+; i##&*",i*( /(,2&0+; ,(.2#iW6(+ &' "88"'",6+3 B2&6%0 9( %(++ ,2"# DFee 7&'0+ "#0 _ 0i+8%"- i,(/+ +('*( ,& '"8i0%- .&//6#i.",( i/8&',"#, #(7 5i#0i#$+3 <&#,'i96,i&#+ 0("%i#$ 7i,2 ,(.2#i."% "0*"#.(+ &' "0*"#.(+ i# i#+,'6/(#,",i&# /"- 9( 869%i+2(0 "+ 4(.2#i."% #&,(+3 PEFK>OJ?C@ RJ K"#6+.'i8,+ +2&6%0 9( ,-8(0 G4i/(+ P(7 V&/"# 5&#, D_H "#0 0&69%(A+8".(03 42( 8"$(+ +2&6%0 9( #6/9('(0 .&#+(.6,i*(%-; +,"',i#$ 7i,2 ,2( ,i,%( 8"$( "#0 ,2'&6$2 ,2( ,(1,; '(5('(#.( %i+,; ,"9%(+ "#0 5i$6'( %($(#0+3 #JU D3 4i,%( 8"$(; _3 C9+,'".,; h3 i(- 7&'0+; g3 4(1,; F3 C.I#&7%(0$(/(#,+; b3 V(5('(#.(+; d3 4"9%(+; ]3 Oi$6'(+; E3 Y($(#0+ G&# +(8"'",( 8"$( 8'(.(0i#$ ,2( 5i'+, 5i$6'(H; %?@H< CEG A =>@JEO@A 42( C9+,'"., +2&6%0 9( i#5&'/",i*( "#0 .&/8%(,(%- +(%5A(18%"#",&'-; 9'i(5%- 8'(+(#, ,2( 4&8i.+; +,",( ,2( +.&8( &5 ,2( (18('i/(#,+; i#0i.",( +i$#i5i."#, 0","; "#0 8&i#, &6, /":&' 5i#0i#$+ "#0 .&#.%6+i&#+3 P& %i,('",6'( +2&6%0 9( .i,(03 C99'(*i",i&#+ +2&6%0 9( "*&i0(0 "+ /6.2 "+ 8&++i9%(3 42( C9+,'"., +2&6%0 9( Dee ,& hee 7&'0+ i# %(#$,23 Z % <]@A C%% 8"8('+ +2&6%0 2"*( " 9'i(5 i#,'&06.,i 42( ,(1, +2&6%0 9( i#,(%%i$i9%( ,& '("0('+ i#0i55('(#, 0i+.i8%i#(+ "#0 ,(.2#i."% ,('/+ +2&6%0 9( 0(5i#(03 4"9%(+ "#0 5i$6'(+ +2&6%0 9( '(5(''(0 ,& i# #6/('i."% &'0('3 C%% +-/9&%+ "#0 "99'(*i",i&#+ /6+, 9( 0(5i#(0; "#0 6+(0 &#%- 72(# #(.(++"'-3 B68('+.'i8,+; +69+.'i8,+ "#0 "/9i$6&6+ .2"'".,('+ +2&6%0 9( .%("'%- i#0i.",(03 )#i,+ &5 /("+6'( +2&6%0 9( /(,'i. &'; 8'(5('"9%-; B?3 E AOXFITH ?3 )#0(' V(5('(#.(S V(5('(#.(+ .i,",i&# +2&6%0 9( +68('+.'i8,(0 i# ,2( ,(1, N13 GiH!!!!!! "'( ,2( 8i&#(('+ i# ,2( 5i(%0 &5 9i&+.i(#.(+D N13 GiiH Ki+'" "#0 P"2"_ 2"*( i0(#,i5i(+ ,7& ,-8(+ &5 +8(.i(+ N13 GiiiH!!!!!! Deee +W3 I/ "'(" 2"+ 9((# &..68i(0 9- ,2(+( +8(.i(+h3 42( "9&*( +68('+.'i8,(0 .i,",i&#+ 2"*( ,& 9( #6/9('(0 U +2&7# i# ,2( '(5('(#.( %i+, "+ 5&%%&7+S GN1!H D3 =&I2"%(3 V3!; M",i%3 C3! "#0 @i#((,3 K3 GDE]eH +&/( +"%i(#, 5(",6'(+ &5 !!!!>&6'#"% &5 C88%i(0 B.i(#.(+; *&%3_3883hbAhE3 _3 Ki+,'"; B3i3 "#0 P"2"3 V3!3 GDEEgH !!!!!!33 h3 C'"*i#0; i3!3; B6#i%3 B3B3; B2"'/"3 i343; "#0 i6/"'3 B3i3GDEEFH g3 (, "%3 " +2&6%0 9( 6#i5&'/%- /"i#,"i#(0 i# ,2( ,(1,3 ??3 =(#('"% GiH @i$#"#"92"'",2i " B2&6%0 9( @i:#"#" !2"'",2i G42i+ +2&6%0 9( .2"#$(0 "..&'0i#$%- i# ,2( .&*(' 8"$(; "+ 7(%% "+ i# ,2( (#,i'( *&%6/(H GiiH =i*( +8".( 9(,7((# @i:#"#" !2"'",2i i# "%% ,2( 8"$(+ &5 *&%6/(3 GiiiH 42( 9&,,&/ %i#( i# (".2 8"$( i+ ,& 9( ,2i##(03 ???3 M2&,&+LOi$6'(+ (,.3 GiH N1.(8, Oi$6'(+ L 82&,&$'"82+ L 0'"7i#$+ L $'"82+ 8(',"i#i#$ ,& "',i.%(+; "%% &,2(' 5(",6'(+ +2&6%0 9( i# 9%".I "#0 72i,(3 Oi$6'(+ L 82&,&+L 0'"7i#$+L $'"82+ ."# "%+& 9( i# 9%".I "#0 72i,( i5 #(.(++"'-3 GiiH Q&7(*('; .&*(' 8"$( 7i%% 9( i# .&%&6'3 O&' "%% /"#6+.'i8, +69/i++i&#+ "#0 W6('i(+ 8%("+( .&#,".,S W JN 0NRNR)%%A"A()\ 42( N0i,&'; @i:#"#"92"'",2i M'&5(++&' "#0 <2"i'/"#; J(8"',/(#, &5 Yi5( +.i(#.(+ ! "#$"%&'( )#i*('+i,-; !"#$"%&'(AFbeeFb; ?#0i" 4(%3S jED ]e __EbDE_h[ N/"i%S (0*i$#"#"92"'",2i\$/"i%3.&/ De 1i 1ii VIJNANABHARATHI-A frontier journal in SCIENCE Vol. 1 | No.1 |01 - 07 | STUDIES ON INDOOR AIRBORNE FUNGAL SPORES OF ANIMAL March | 2016 REARING HOUSES AT HESSARAGHATTA VILLAGE, BANGALORE Pavan R* and Manjunath K Department of Microbiology and Biotechnology, Bangalore University, Bangalore-56, India. ISSN : 0971-6882 ABSTRACT: ISSN-L : 0377-8487 Air pollution is one of the most serious problems to human health. Fungi are the causal agents for CODEN : VBHAD6 different diseases in animals, plants, and human beings. In rural areas of India a large number of people are occupationally involved with different types of animal sheds. In these sheds, a wide range of fungal growth substrates like moldy livestock foods, moldy hay, bedding of animals and their excreta are present, which could provide a huge airborne fungal spore load making these places unhygienic for the animal workers. The present study was carried out to investigate the indoor airborne fungi of four animal Corresponding author: rearing houses viz., rabbit house, cow shed, poultry farm and swine house in Hessaraghatta village, PAVAN R. Bangalore city. The samples was carried out by Andersen two stage sampler using an Malt Extract Agar Dept of Microbiology and Biotechnology, (MEA) media were collected from January 2013 to December 2013. In our study, a total indoor airborne 3 3 3 Bangalore University, fungi of rabbit house (9682.79 CFU/m ), cow shed (7808.36 CFU/m ), poultry farm (8062.52 CFU/m ) Bangalore-560 056, and swine house (6911.74 CFU/m3) was recorded. The present investigation of four indoor animal Karnataka, India rearing house would help in the finding out cause of fungal spores related problem affecting human [email protected] health of animal rearing house workers. This article is to be cited as: Pavan R. and Manjunath K. Studies on indoor airborne fungal spores of animal rearing houses at Hessaraghatta village, Bangalore; Vijnanabharathi, 1 (1): 1-7, 2016. INTRODUCTION Key words: Airborne, Aerobiology is a scientific discipline focusing on the study of the passive transport of Andersen organisms and particles of biological origin in the atmosphere (Isard and Gage, 2001). Air is an Air Sampler, Animal, essential and important component of the ecosystem. Humans are in continuous exposure to air Fungi, environment either outdoor or indoor, hence the air environment is a crucial factor that affects MEA human health.Air mainly acts as dispersal or transport medium for the microorganisms. Air quality has been a concern for more than 100 years and started around 1850 during the hygienic revolution, followed by outdoor environmental issues (Spengler et al., 2000). The air breathed in Received on: 14 December 2015 most often comes from the enclosed buildings; good indoor air quality is therefore very essential Accepted on: and critical to human health. The airborne microbial quantity and quality vary with time of day, 18 January 2016 year and location (Lighthart, 2000).In recent years public interest has increasingly focused on released particulate matter from animal production facilities. This assumption is mainly based on experiences cited in occupational health studies, in which persons have been exposed to bioaerosols with subsequent deterioration of their health status (Douwes et al., 2003). During the ©2016 Vijnanabharathi present investigation, the aeromycological studies in indoor environments of four animal houses All rights reserved which would help in understanding the pattern of exposure to airborne fungi by the workers of various animal houses. 1 44 VIJNANABHARATHI, 1 (1): 1-7, 2016 MATERIALS AND METHODS The present study was carried out to investigate the indoor airborne fungi in rabbit house, cow shed, poultry farm and swine house in Hessaraghatta village, Bangalore. Sampling was carried out from the period January 2013 to December 2013 on each month fortnightly sampling in indoor animal rearing houses. Anderson two stage sampler was placed in the center of the animal house at 1.5 meter above the ground level. Malt Extract Agar (MEA) was used as sampling medium. Air flow was 28.3 L/min during the sampling and the sampling time was limited to 5 minutes (Andersen, 1958). Treatment of samples plates were placed in an incubator at 26C and incubated for 5 days, then the colony count was recorded and the colony count was recorded again in 7 days. The results for each stage of the sampler were expressed as colony forming units per cubic meter of air (CFU/m3) and total concentration was obtained by adding the CFU/m3 from each plate. Identification of fungal colonies was based on morphological characteristics and microscopic observations with the help of Agarkar Research Institute, Pune (India). The data collected were statistically analyzed by one way and two way ANOVA and data was expressed in CFU/m3. RESULTS The rabbit house, cow shed, poultry farm and swine house were situated at Hessaraghatta village, 10 km away from Bangalore city was selected as the site for sampling indoor air fungal samples. Sampling was carried out fortnightly for a period of 12 months from January 2013 to December 2013 and total fungal spores were recorded were shown in Table 1. RABBIT HOUSE: The study period of rabbit house from indoor environment a total number of 9682.79 CFU/m3 (colony forming units per cubic meter air) of fungal was isolated. Altogether 31 species belonging to 14 genera along with unidentified fungi were isolated, Among the total number of isolated fungal species of the rabbit house Penicillium (4.46%) was represented by 6 species viz., P. nigricans, P. griseofulvum, P. lilacinum, P. canescens, P. expansum and P. daleae followed by 6 species of Aspergillus (5.17%) viz., A. carbonarius, A. flavus, A. fumigatus, A. niger, A. terreus and A. versicolor, 3 species of Cladosporium (73.37%) viz., C. herbarum, C. macrocarpum and C. cladosporioides, 3 species of Fusarium (6.3%) viz., F. moniliforme, F. oxysporum and F. chlamydosoporum along with Absidia spp., (0.1%), Acremonium spp., (0.25%), Alternaria alternata (0.47%), Bipolaris spp., (0.21%), Curvularia spp., (0.32%), Mucor spp., (3.79%), Rhizopus spp., (0.25%), Phoma spp., (0.14%), Scopulariopsis spp., (0.07%) and Trichoderma spp., (0.69%). Dominant fungal species in indoor environment of rabbit house were Cladosporium herbarum (30.55%), Cladosporium spp., (17.24%), C. macrocarpum (15.67%), C. cladosporioides (9.91%) and Fusarium spp., (3.17%) contributed more but Absidia spp., (0.1%) and Bipolaris spp., (0.21%) were recorded less. The monthly variation of total fungal spores in the indoor environment of rabbit house showed maximum spore distribution in January (1606.15 CFU/m3) followed by December (1104.89 CFU/m3), June (1073.12 CFU/m3) and March (1051.94 CFU/m3) were isolated. Stastical analysis by Two-Way ANOVA for CFU and month of rabbit house were presented in Table 2. Studies on indoor airborne fungal spores 2 Pavan R and Manjunath K VIJNANABHARATHI, 1 (1): 1-7, 2016 Table 1: Total fungal spores (CFU/m3) recorded from January 2013 to December 2013 Sl. No. Rabbit Poultry Swine Genera and Species Cow Shed House Farm House 1 Absidia sp. 10.59 - - - 2 Acremonium sp. 24.71 162.38 - 49.42 3 Alternaria sp. - - 525.97 444.78 4 Alternaria alternata 45.89 430.66 - 201.21 5 Ascomycetes sp. - 67.07 - - 6 Aspergillus sp. 45.89 501.26 60.01 342.41 7 A. carbonarius 95.31 - - - 8 A. flavus 74.13 462.43 60.01 264.75 9 A. fumigatus 105.9 98.84 88.25 423.6 10 A. niger 81.19 476.55 162.38 120.02 11 A. oryzae - 328.29 - - 12 A. ochraceus - 49.42 - - 13 A. terreus 42.36 222.39 98.84 - 14 A. versicolor 60.01 - - - 15 Bipolaris sp. 21.18 - - - 16 Botrytis sp. - - - 14.12 17 Cladosporium sp. 1669.69 635.4 1683.81 1503.78 18 C. acremonium - 134.14 - - 19 C. herbarum 2958.14 257.69 - 356.53 20 C. macrocarpum 1517.9 - - - 21 C. cladosporioides 960.16 395.36 1274.33 296.52 22 Fusarium sp. 307.11 338.88 737.77 617.75 23 F. moniliforme 67.07 271.81 201.21 70.6 24 F. solani - 268.28 - - 25 F. oxysporum 158.85 208.27 261.22 127.08 26 F. chlamydosoporum 77.66 - - - 27 Helminthosporium sp. - - 144.73 - 28 Curvularia sp. 31.77 218.86 134.14 116.49 29 C. lunata - 169.44 98.84 183.56 30 Mucor sp. 367.12 208.27 77.66 120.02 31 Neurospora sp. - 56.48 70.6 - 32 Nigrospora sp. - - - 42.36 33 Penicillium sp. - 335.35 967.22 875.44 34 P. chrysogenum - - 268.28 - 35 P. versicolor - 257.69 - - 36 P. citrinum - 250.63 - - 37 P. nigricans 84.72 183.56 - 67.07 38 P. griseofulvum 74.13 - 180.03 - 39 P. lilacinum 84.72 - - - 40 P. canescens 56.48 - - - 41 P. expansum 77.66 - - - 42 P. daleae 56.48 - - - 43 Rhizopus sp. 24.71 317.7 112.96 38.83 44 Rhizopus oryzae - - - 45.89 45 Phoma sp. 14.12 - 144.73 45.89 46 Scopulariopsis sp. 7.06 31.77 - 21.18 47 Trichoderma sp. 67.07 250.63 420.07 165.91 48 Unidentified 413.01 218.86 289.46 356.53 Total 9682.79 7808.36 8062.52 6911.74 Studies on indoor airborne fungal spores 3 Pavan R and Manjunath K VIJNANABHARATHI, 1 (1): 1-7, 2016 Table 2: Two-Way ANOVA for CFU and month of rabbit house Two-Way Sum of Degrees of Mean F-Ratio p-Value ANOVA Squares Freedom Squares Colony 0.89 1 0.89 0.14 0.72 Month 88.52 11 8.05 1.24 0.36 Error 71.42 11 6.49 Total 160.84 23 COW SHED: During the present study period of cow shed contributed to 7808.36 CFU/m3 of fungal colonies from indoor environment. Altogether 29 species belonging to 13 genera with other unidentified fungi were isolated. Among the total number of isolated fungal species from indoor environment of the cow shed Aspergillus (27.36%) was represented by 6 species viz., A. flavus, A. niger, A. oryzae, A. ochraceus, A. fumigates and A. terreus followed by 3 species of Cladosporium (18.2%) viz., C. cladosporioides, C. herbarium and C. acremonium, 3 species of Fusarium (13.9%) viz., F. oxysporum, F. moniliforme and F. solani,, 3 species of Penicillium (13.14%) viz., P. versicolor, P. citrinum and P. nigricans, 1 species of Curvularia (4.07%) viz., C. lunata along with Acremonium spp., (2.07%), Alternaria alternata (5.51%), Ascomycetes spp., (0.85%), Mucor spp., (2.66%), Neurospora spp., (0.72%), Rhizopus spp., (4.06%), Scopulariopsis spp., (0.4%) and Trichoderma spp., (3.2%) were isolated. Based on comparative analysis, dominant fungal species in indoor environment of the cow shed were Cladosporium (8.13%), Aspergillus (6.41%) and Aspergillus niger (6.1%) but Scopulariopsis (0.4%) and Aspergillus ochraceus (0.63%) were least recorded. Monthly variation of total fungal spores in the indoor environment of the cow shed showed maximum fungal spores distribution in May (780.13 CFU/m3) followed by February (773.07 CFU/m3) and January (755.42 CFU/m3). One-Way ANOVA for CFU’s of the cow shed between variation and within variation was not statistically significant in CFU’s for both groups when subjected to same conditions for the entire year as shown in Table 3. Table 3: One-Way ANOVA for CFU of the cow shed One-Way Sum of Degrees of Mean F-Ratio p-Value ANOVA Table Squares Freedom Squares Between Variation 0.16 1 0.16 0.18 0.67 Within Variation 19.55 22 0.88 Total Variation 19.72 23 POULTRY FARM: Air sampling studies in poultry farm revealed a total number of 8062.52 CFU/m3 of fungal species isolated from indoor environment. The qualitative analysis showed altogether 22 fungal species belonging to 12 genera with other unidentified fungi. Among the total number of isolated fungal species from indoor environment of poultry farm Aspergillus (5.80%) was represented by 4 species viz., A. flavus, A. fumigatus, A. niger and A. terreus followed by 2 species of Fusarium (14.87%) viz., F. moniliforme and F. oxysporum, 2 species of Penicillium (17.54%) viz., P. chrysogenum and P. griseofulvum, 1 species of Cladosporium (36.68%) viz., C. cladosporioides, 1 species of Curvularia (2.88%) viz., C. lunata along with Alternaria spp., (6.52%), Helminthosporium spp., (1.79%), Mucor spp., (0.96%), Neurospora spp., (0.87%), Phoma spp., (1.79%), Rhizopus spp., (1.4%) and Trichoderma species. The dominant fungal species in indoor environment of the poultry farm were Cladosporium spp., (20.88%), C. cladosporioides (15.8%) and Penicillium spp., (11.99%) but Aspergillus spp., (0.74%), A. flavus (0.74%), Neurospora spp., (0.87%) and Mucor spp., (0.96%) were least recorded. Monthly incidence in the indoor environment of the poultry farm Studies on indoor airborne fungal spores 4 Pavan R and Manjunath K VIJNANABHARATHI, 1 (1): 1-7, 2016 maximum spore distribution in May (886.03 CFU/m3) followed by February (741.3 CFU/m3) and November (702.47 CFU/m3) were isolated. Based on the Two-Way ANOVA for colony and month of the poultry farm were shown in Table 4. Table 4: Two-Way ANOVA for colony and month of the poultry farm Two-Way Sum of Degrees of Mean F-Ratio p-Value ANOVA Squares Freedom Squares Colony 2.58 1 2.58 1.78 0.21 Month 11.29 11 1.03 0.71 0.71 Error 15.96 11 1.45 Total 29.84 23 SWINE HOUSE: In swine house a total number of 6911.74 CFU/m3 of fungal species were contributed from indoor environment. A total 25 fungal species belonging to 15 genera with other unidentified fungal form were isolated. Among the total number of isolated fungal species from indoor environment of swine house Aspergillus (16.63%) was represented by 3 species viz., A. flavus, A. fumigatus and A. niger followed by 3 species of Cladosporium (31.19%) viz., C. cladosporioides, C. herbarum and C. lunata, 2 species of Fusarium (11.78%) viz., F. moniliforme and F. oxysporum, 1 species of Alternaria (9.34%) viz., Alternaria alternata, 1 species of Penicillium (13.63%) viz., P. nigricans, 1 species of Rhizopus (1.22%) viz., R. oryzae along with Acremonium spp., (0.71%), Botrytis spp., (0.2%), Mucor spp., (1.73%), Curvularia spp., (1.68%), Nigrospora spp., (0.61%), Phoma spp., (0.66%), Scopulariopsis spp., (0.3%) and Trichoderma spp., (2.4%) were recorded. Monthly incidence of total fungal spores in the indoor environment showed maximum spore distribution in May followed by January 893.09 CFU/m3, December 861.32 CFU/m3 and February 840.14 CFU/m3 compared to other months of year. Dominant fungal species with their contribution in indoor environment of the swine house were Cladosporium spp., (21.75%) and Penicillium (12.66%) which contributed maximum but Botrytis spp., (0.2%) and Scopulariopsis spp., (0.3%) were least recorded. The statistically data were analyzed by Two-Way ANOVA for colony and month of the swine house were presented in Table 5. Table 5: Two-Way ANOVA for colony and month of the swine house Sum of Degrees of Mean F-Ratio p-Value Two-Way ANOVA Table Squares Freedom Squares Colony 0.79 1 0.79 1.11 0.32 Month 91.67 11 8.33 11.76 0.00 Error 7.80 11 0.71 Total 100.25 23 DISCUSSION There are many reports available on the airborne fungal spores of animal houses conducted in rabbit house (Wang et al., 2007 and Miao et al., 2010), cow shed (Adhikari et al., 2004 and Ajoudanifar et al., 2011), poultry farm (Doris et al., 2005 and Hameed et al., 2010) and swine house (Martin et al., 1996; Black et al., 2001 and Milicevic et al., 2010). There are numerous reports of contamination of indoor air with fungal spore levels well in excess (Shelton et al., 2002 and Curtis et al., 2000). In India, indoor fungal concentrations are high in different occupational indoor environments as reported by Jain (2000) and Srikanth et al., (2008). Fungi aerosol which is procreated continually in animal raising house is not only endangered to the feeders and domestic animals, but also cause environment pollution (Yu and Che, 1998). Indoor air quality is imperative to Studies on indoor airborne fungal spores 5 Pavan R and Manjunath K VIJNANABHARATHI, 1 (1): 1-7, 2016 maintain the health and productivity of farm workers and animals. There are many reports regarding health of farm workers coinciding with rapid changes from traditional farm to large intensive live stock operation. The present study was carried out to identify the fungal contaminants present in the air inside selected animal rearing houses. Good indoor air quality depends on animal house management, feeding and manure handling, the ventilation system, as well as overall cleanliness of the animal house and type of animals kept. The animal houses showed 46 fungal types belonging to 18 genera. There are many allergenic fungi like Aspergillus flavus, A. fumigatus, A. niger, Alternaria sp., Cladosporium acremonium, Fusarium moniliforme, Mucor and Rhizopus species. Some of these fungal spores are immunotoxic and show adjuvant effects on humans. They cause many infections, diseases, allergies and some are opportunistic pathogens. The workers in animal rearing houses showed high prevalence of allergies like rhinitis, wheezing, skin rash, watering of eyes, cough and other related allergic symptoms. The study has shown that the animal rearing houses are contaminated with high concentrations of Cladosporium followed by Aspergillus, Penicillium and Fusarium. Some veterinarians and feeders are very easily infected with fungal aerosol leading to respiratory diseases; 13% veterinarians are reported to be infected in this way (Che and Yu, 1998). Caretakers and sampling sites have prolonged exposure to such environment which result in occult infection or develop to chronic nosomycosis and lead to predisposition to other diseases. At present, there are no safe levels of airborne fungi concentration in indoor environments, but high concentration would result in threats to the health of human beings and animals. CONCLUSION This study was carried out in the animal rearing houses; it clearly revealed the concentration of different fungal species in the environment. The data of fungal spore content in indoor environment helped us to prepare the fungal spore calendar on this region and prediction model will be helpful to forecast the allergenic fungal spore load in the air of Hessaraghatta village. Respiratory allergic problems and hospital admission with relevant diseases of that zone are related to the presence of airborne allergenic fungal spores. The results of the present study could be incorporated while taking suitable measures to prevent health hazards of animals and workers, living or working in such infectious environments. ACKNOWLEDGEMENT This study was supported by the Department of Microbiology and Biotechnology, Bangalore University, Bangalore. The authors are grateful to University Grants Commission - Basic Science Research Fellowship, New Delhi, for financial support of this research. The authors appreciate the animal rearing houses workers for providing invaluable support and technical assistance during the sampling time. Studies on indoor airborne fungal spores 6 Pavan R and Manjunath K VIJNANABHARATHI, 1 (1): 1-7, 2016 REFERENCES 1. Adhikari, A., Sen, M. M., Gupta Bhattacharya, S., & Chanda, S. 2004. Volumetric assessment of airborne fungi in two sections of rural indoor dairy cattle shed. Environment International. 29: 1071-1078. 2. Ajoudanifar, H., Hedayati, M. T., Mayahi, S., Khosravi, A., & Mousavi, B. 2011. Volumetric assessment of airborne indoor and outdoor fungi at poultry and cattle houses in the Mazandaran Province, Iran. 62: 243-248. 3. Andersen, A. A. 1958. New sampler for the collection, sizing and enumeration of viable airborne particles. Journal of Bacteriology. 76: 471-484. 4. Black, J. L., Giles, L. R., Wynn, P. C., Knowles, A. G., Kerr, C. A., Jone, M. R., Gallagher, N. L., & Eamens, G. J. 2001. A Review Factors Limiting the Performance of Growing Pigs in Commercial Environments. In manipulating pig production 8th. Adelaide, Australia. Editor, Cranwell, P. D. 9-36. 5. Che, F. X., & Yu, X. H. 1998. Principle, Technique Application of Sampling and Detection of Air Microbes. Chinese Encyclopedia Press. 1-15. 6. Curtis, L., Ross, M., & Persky, V. 2000. Bioaerosol concentrations in the Quad Cities one year after the 1993 Mississippi river floods. Indoor Built Environment. 9: 35-43. 7. Doris, H., Josefa, P., Susanne, S., Gilda, W., Wolf, S., Gebhard, F., Egon, M., Franz, F., & Reinthaler. 2005. A case study of airborne culturable microorganisms in a poultry slaughterhouse in Styria, Austria. Aerobiologia. 21: 193-201. 8. Douwes, J., Thorne, P., Pearce, N., & Heederik, D. 2003. Bioaerosol health effects and exposure assessment: Progress and prospects. Annals of Occupational Hygiene. 47: 187-200. 9. Hameed, A. A., Awad, T. H., Elmorsy, P. M., Tarwater, C. F., Green., Shawn, G., & Gibbs. 2010. Air biocontamination in a variety of agricultural industry environments in Egypt: a pilot study. Aerobiologia. 26: 223-232. 10. Isard, S. A., & Gage, S. H. 2001. Flow of Life in the Atmosphere: An Airscape Approach to Understanding Invasive Organisms. East Lansing, Michigan State University Press. 11. Jain, A. K. 2000. Survey of bioaerosol in different indoor working environments in central India. Aerobiologia. 16: 221–225. 12. Lighthart, B. 2000. Mini-review of the concentration variation found in the alfresco atmospheric bacterial populations. Aerobiologia. 16: 7-16. 13. Martin, W. T., Zhang, Y., Willson, P., Archer, P. T., Kinahan, C., & Barber, M. E. 1996. Bacterial and fungal flora of dust deposits in a pig building. Occupational Environment Medicine. 53: 484-487. 14. Miao, Z., Chai, T., Qi, C., Cai, Y., Liu, J., Yuan, W., & Yao, M. 2010. Composition and variability of airborne fungi in an enclosed rabbit house in China. Aerobiologia. 26: 135-140. 15. Milicevic, D., Niksic, M., Baltic, T., Vranic, D., Stefanovic, S., & Jankovic, S. 2010. A Survey of occurrence of toxogenic fungi and mycotoxins in pig feed samples: Use in evaluation of risk assessment. Veterinary World. 3(7): 305-311. 16. Shelton, B. G., Kimberly, H., Kirkland, W., Flanders, D., & Morris, G. K. 2002. Profiles of airborne fungi in buildings and outdoor environments in the United States. Applied Environmental Microbiology. 68: 1743-1753. 17. Spengler, J. D., Samet, J. M., & McCarthy, J. F. 2000. Indoor air quality handbook. In H. A. Burge (Ed.), the fungi. NY: McGraw-Hill Companies. 45-16. 18. Srikanth, P., Sudharsanan, S., & Steinberg, R. 2008. Bioaerosols in indoor environment: Composition, health effects and analysis. Indian Journal Medical Microbiology. 26: 302–312. 19. Wang, Y., Lu, G., Chai, T., Song, C., & Yao, M. 2007. The airborne fungi from indoor air of animal houses. ISAH-Tartu, Estonia. 571-577. 20. Yu, X. H., & Che, F. X. 1998. Modern Technique of Sampling and Detection of Air-Microbes. Bejing: Military Medicine Science Press. 1-10, 341, 319. Studies on indoor airborne fungal spores 7 Pavan R and Manjunath K VIJNANABHARATHI-A frontier journal in SCIENCE A COMPARATIVE STUDY OF FRESH WATER FISH DIVERSITY OF Vol. 1 | No.1 |08 - 15| UPSTREAM, MIDDLE STREAM AND DOWNSTREAM OF BEDTI RIVER March | 2016 OF WESTERN GHATS REGION OF KARNATAKA 1Sooryanarayan S. Bhat* and 2A. K. Hegde 1Department of Zoology, 2 Department of Biotechnology M.M.Arts & Science College, SIRSI-581402, Uttara Kannada, Karnataka, India ISSN : 0971-6882 ABSTRACT: ISSN-L : 0377-8487 The present report describes the status of fish diversity in river Bedti of Western Ghats CODEN : VBHAD6 region of Karnataka. Fresh water offers very common and suitable habitats of the Biosphere. It has characteristic features in chemical, physical properties and hosts a large biodiversity which have adapted to dynamic environment. It has a well-defined food chain and food web through Corresponding author: which energy is channelized and community. The present work was carried from June 2013 to SOORYANARAYAN S. June 2014. Fishes were caught with the gill net, cast net & drag net of suitable dimensions. The BHAT fishes were soon preserved and sent to the ZSI Kokatta for identification. The identified fishes Department of Zoology were classified up to families. Highest fish diversity was recorded in downstream of the river M.M.Arts & Science . College This article is to be cited as: Sirsi-581402 Sooryanarayan S. Bhat and A. K. Hegde. A comparative study of fresh water fish diversity of Karnataka, India upstream, middle stream and downstream of Bedti River of Western Ghats region of Karnataka; [email protected] Vijnanabharathi, 1 (1): 8-15, 2016. INTRODUCTION Key words: The study area is mainly located in Uttara Kannada district. Uttara Kannada district of Fresh water, 2 Fish diversity, Karnataka state has a geographic area of 10,291sq m and situated strategically in the middle of Major tributaries, the Western Ghats. It is located between 130 55’ to 150 32’ N latitude and 740 05’ to 750 05’ E Taxonomy, longitude (Yy et. al., 1998). It has a typical tropical climate with well-defined seasons and Puntius, Gara sp. receives rainfall on an average 2500mm annually. The entire district is enriched in varied varieties of flora & fauna. The abundance of flora & fauna is mainly because of the four major rivers flowing in the district. The major rivers are 1) Bedti 2) Kali 3) Aghanashini and 4) Sharavati. Bedti is one of the west flowing rivers that originate in the Moist Deciduous forest Received on: areas of Dharwad district. The river is the outcome of hundreds of tributary streams which 22 December 2015 merge and become limited number of tributaries. The streams have their catchments covered Accepted on: 20 January 2016 with various types of Landscape element types ranging from dense forest to agricultural areas, scrubs and wasteland. The places selected for the present studies in upstream are Tamboor and Bedti bridge, in middle stream Gullapura and Kelase, in downstream are Hosakambi and Kallehwar. The objective of the present work is to reveal the fish species diversity with respect to the main three streams of river Bedthi. ©2016 Vijnanabharathi All rights reserved 44 8 VIJNANABHARATHI, 1 (1): 8-15, 2016 MATERIALS AND METHODS Fish sampling is the major fieldwork at all the specified locations. Fish sampling were made two times a year i.e. Pre monsoon & Post monsoon. For collecting the fish Gill nets, Cast Nets and Dragnets of different mesh size were used. The net fishing is one of the most popular fishing methods. The fishes caught alive and preserved in 4%Formaldehyde for the identification. The fishes caught in the net were immediately separated from the net and the numbers of fishes caught were counted and representative sample of every specimen were preserved in plastic jars using 4% formaldehyde solution. All colors, color patterns, spots blotches number and design of the fishes were carefully noted in the field note book and for identification different morphological characters were considered. RESULTS Species richness or diversity depends less on the characteristics of a single ecosystem than on the interactions between ecosystems, e.g. transport of living animals across the different gradient zones in the water body (Daniels, 2003; Sreekantha et al., 2007). Fish is captured in natural lakes, reservoirs, streams, tributaries, rivers and oceans. The worlds estimated total catches of fish is about seven million metric tons per annum. In many Asian countries inland catch make up 40 – 70 per cent of the total fish production (FAO, 1986). However, few species in spite of their great commercial interest have been comprehensively less studied to establish the importance of their distribution for their successful management (Daniels, 2003b). It is in this context, this study assumes importance reflecting the fish species diversity in river ecosystem. The up Stream of Bedti River recorded 19 species under 6 families (Table-1). Among the families Cyprinidae dominated with 12 species, family Bagridae recorded 2 species, family Siluridae 2 species, family Claridae 1 species, family Ambassidae 1 species and family Aplocheilidiae 1 species. The upstream of Bedti documented a total of 476 individuals. The family Cyprinidae with 286 individuals contributed 60 per cent of the total fish catch. The high value was due to the abundance of Garra gotyla stenorhynchus, Pseudoambasis ranga, Ompok bimaculatus (Bloch ) Salmostoma boopis (Day), Puntius jerdoni and Puntius amphibius. The genus Puntius appeared to be less abundant compared to other zones with only 65 individuals, which was estimated to be about 13to14 per cent of the total catch . The family Bagridae with 43 individuals contributed 9 per cent of the total catch. The family Ambassidae with 62 individuals contributed13 percent of the catch, Siluridae with 51 individuals contributed 11 percent of the total catch, Claridae with 32 individuals contributed 7 percent and Aplocheilidae with 2 individuals contributed very least per cent of the total catch. The dominant family Cyprinidae with 12 species classified under 8genera. The Puntius was the largest genus with 4 species. The genus Gara with 2 species and all other genera Labeo, Devario, Tor, Salmostoma, Danio, and Rasbora recorded only one species. The next family was Bagridae with 2 species under one genera. Two species of Mystus were recorded under family Bagridae. The family Siluridae was recorded 2 genera with one species each. All other families listed only one species each (Table –1). The middle stream of Bedti River recorded 14 species under 6 families (Table-I). Among the families Cyprinidae dominated with 9 species. The family Belonidae, Aplocheilidae, Ambassidae, Gobiidae and Cichlidae recorded one species each. The middle stream of Bedti documented a total of 440 individuals. The family Cyprinidae with 339 individuals contributed 77 per cent of the total fish catch. The high value was due to the abundance of Salmostoma boopis (Day), Rasbora rasbora, Gara gotyla stenorhynhos, Puntius chola, Garra garra and Puntius Fresh water fish diversity-Western Ghats 9 Sooryanarayan and Hegde VIJNANABHARATHI, 1 (1): 8-15, 2016 amphibeus. The genus Puntius appeared to be more abundant compared to upstream zones with 93 individuals, which was estimated to be about 22 per cent of the total catch. The family Belonidae with 49 individuals contributed 11 per cent of the total catch. The family Cichlidae with 23 individuals contributed 5 percent of the total catch, Ambassidae with 15 individuals contributed 4 percent, Gobiidae with 8 individuals contributed 2 percent of the total catch and Aplocheilidae with 6 individuals contributed one per cent of the total catch. The dominant family Cyprinidae with 9 species classified under 4 genera. The Puntius was the largest genus with 5species. The genus Gara with 2 species and all other genera, Salmostoma, and Rasbora recorded only one species. All other families listed only one species each (Table –1). The downstream of Bedti River recorded 18 species under 10 families (Table-1). Among the families Cyprinidae dominated with 9 species. All other families listed only one species each. The downstream of Bedti documented a total of 765 individuals. The family Cyprinidae with 621 individuals contributed 81 per cent of the total fish catch. The high value was due to the abundance of Puntius amphibeus, Rasbora rasbora (Hamilton-Buchanan), Puntius filamentosus, Gara gotyla stenorhynhos, Salmostoma boopis (Day) and Puntius jerdoni (Day).The genus Puntius appeared to be more abundant compared to other two zones with 396 individuals, which was estimated to be about 55 per cent of the total catch. The Puntiius amphibeus was dominating among the Puntius genus which was estimated about 37 percent of the total catch .The family Mugilidae with 84 individuals contributed 11 per cent of the total catch. The family Gobiidae with 18 individuals contributed 2 percent of the total catch, Balitridae with 9 individuals, Aplocheilida with 8 individuals, Syngnathidae with 8 individuals, Claridae with 5 individuals, Bagridae ,Belonidae with 4 individuals and Cichlidae with 4 individuals contributed one percent each of the total catch. The dominant family Cyprinidae with 9 species classified under 4 genera. The Puntius was the largest genus with 5 species.The genus Gara with 2 species and all other genera, Salmostoma, and Rasbora recorded only one species. All other families listed only one species each (Table1). The predominant fish fauna in south Asia belongs to the carp family (Cyprinidae) (Bhat and Anurahda, 2000; Jayaram et al., 1976). The carp family alone in the river was prominent with Puntius as major genus. In summary the Bedti river, the upstream recorded a total 19 species classified under 6 families with 476 individuals, while in the middle stream of the same river was noted that 6 families with 14 species and 440 individuals. The downstream was documented 18 species under 10 families and 765 individuals. The middle stream is less diversified with less species richness, but abundance was very high. The upstream stream showed more species richness but the abundance was poor and diversity of families was at par with middle stream. The fish abundance was less in downstream, but more than middle stream and upstream. The diversity of family was more than up and middle stream. It has been further argued that the increase in the number of species indicates less anthropogenic pressure Ajit and Mittal, 1993; Jayaram, 1981; Jayaram 1999). The diversity of family Cyprinidae was same in middle stream and downstream, while it was slight more in upstream. Family Cyprinidae and aplocheilidae were represented in all the streams. Ambassidae species were not found in downstream. Balitridae, Syngnathidae and Mugilidae families were exclusively found in downstream, while Siluridae family was unique to up stream. Claridae and Bagridae families were not found in middle stream. Gobidae, Belonidae and Cichlidae families were not recorded in upstream. There is slight variation in the number of families among the different streams of Bedti river, while species richness showed ascending order from middle stream to downstream to up stream. The upstream recorded the maximum species diversity with 19 species among the other two streams. Fresh water fish diversity-Western Ghats 10 Sooryanarayan and Hegde VIJNANABHARATHI, 1 (1): 8-15, 2016 Table 1: Distribution of fishes in three streams of Bedti River Sl.No. Order and Family Species Upstream Middle Down Total stream stream ORD-CYPRINIFORMES I Family-Cyprinidae 1 Rasbora rasbora (Hamilton-Buchanan) 15 68 140 223 2 Puntius jerdoni (Day) 26 8 14 48 3 Puntius chola 0 41 9 50 4 Puntius filamentosus(Valenciennnes) 0 0 90 90 5 Puntius amphibeus 22 30 280 332 6 Puntius narayani (Hora) 1 7 3 11 7 Puntius ticto ticto (Hamilton-Buchanan) 16 8 0 24 8 Salmostoma boopis (Day) 29 95 28 152 9 Danio aequipinnatus 8 0 0 8 10 Tor tor (Hamilton-Buchanan) 4 0 0 4 11 Garra mulya 7 0 8 15 12 Labeo fimbratus 12 0 0 12 13 Garra garra 0 28 0 28 14 Gara gotyla stenorhynhos 132 54 49 235 15 Devario regina (Fowler) 14 0 0 14 II Family- Balitoridae 16 Nemacheilus semiarmatus (Day) 0 0 9 9 ORD-MUGILIFORMES III Family-Mugilidae 17 Mugil cephalus 0 0 84 84 ORD-SILURIFORMES IV Family-Bagridae 18 Mystus cavasius (Hamilton-Buchanan) 18 0 0 19 Mystus malabaricus (Jerdon) 25 0 4 47 V Family-Claridae 20 Clarias dussumieri (Valenciennnes) 32 0 5 37 VI Family- Siluridae 21 Wallago attu 14 0 0 22 Ompok bimaculatus (Bloch ) 37 0 0 51 Fresh water fish diversity-Western Ghats 11 Sooryanarayan and Hegde VIJNANABHARATHI, 1 (1): 8-15, 2016 ORD- BELONIFORMES VII Family- Belonidae 23 Xenentodon cancila (Hamilton-Buchanan) 0 49 4 53 ORD- CYPRINODONTIFORMES VIII Family- Aplocheilidiae 24 Aplocheilus lineatus (Valenciennnes) 2 6 8 16 ORD-PERCIFORMES IX Family- Ambassidae 25 Pseudoambasis ranga(Hamilton-Buchanan) 62 15 0 77 X Family- Gobiidae 26 Glossogobius giuris giuris (Hamilton- 0 8 18 26 Buchanan) XI Family- Cichlidae 27 Etroplus suratensis ( Bloch ) 0 23 4 27 ORD- GASTEROSTEIFORMES XII Family- Syngnathidae 28 Ichthyocampus carce 0 0 8 8 476 440 765 1681 Figure 1- Distribution of fish families Percent in three streams of Bedti Fresh water fish diversity-Western Ghats 12 Sooryanarayan and Hegde VIJNANABHARATHI, 1 (1): 8-15, 2016 Species Richness in three streams of Bedti River: The main streams of River Bedti of Uttara Kannada district recorded a total of 12 families and 28 species and 1681 individuals (Table-1 and Figure 1). Here also family Cyprinidae contributed major share to species richness and abundance with 15 species and 1246 individuals, which was almost 53 per cent of species richness and 74 per cent of total individuals. The family Bagridae was the next major family with 2 species and 47 individuals which accounted about 7 per cent of the species richness and 3 per cent of the abundance. In Bedti river the Siluridae family was also recorded 2 species and 51 individuals which was about 7 per cent of the species richness, but contributed only 3 per cent to the abundance. The families Mugilidae, Claridae and Balitridae were recorded one species each with 84, 37, and 9 individuals respectively. The species richness of all families was 3 percent. But the percentages of abundance of the above families were 5 percent, 2percent and 1 percent respectively. The families Ambassidae, Belonidae, Cichlidae, Gobiidae, Aplocheilidae and Syngnathidae were recorded 77, 53, 27, 26, 16 and 8 individuals respectively. The species richness of all families was 4 percent. But the percentage of abundance of the above families was 5 percent, 3 percent, 2 percent, 2 percent, 1 percent and less than 1 percent respectively. All families except Cyprinidae, Bagridae and Siluridae were recorded only one species. Therefore the studies were reflected that the family Cyprinidae was dominating followed by the families Bagridae and Siluridae (Figure-2 and 3). Figure 2: Histogram showing abundance of various families of fishes & their species in three streams of Bedti. Figure 3: Family wise species richness in three different streams of Bedti River. Fresh water fish diversity-Western Ghats 13 Sooryanarayan and Hegde VIJNANABHARATHI, 1 (1): 8-15, 2016 Study of diversity indices of fishes: It is necessary to mention in this context that Shannon and wiener’s diversity value is high in upstream compared to middle and downstream streams. The middle and downstream have almost same value. The Simpson’s diversity value is also high in upstream and middle stream as compared to the downstream where as the Simpson’s dominance value is high in downstream than the up and middle streams. These are depicted in figure 4. Figure 4: Histogram showing diversity indices & species richness of fishes of 3 different streams of Bedti River The Bedthi River has different ecological characteristics, which has abundantly influenced the fish population. It has natural course of water without any dams and pollution. However in recent times Bedti River has been reported as polluted through urban sewage water flow. Moreover, the fishes have proved that they have the evolutionary flexibility to produce species to fill the spectrum of niches presented. They can be very big or very small, inhabit open waters or stay close to the bottom and they are present at every consumer trophic level in both the grazing and decomposer chains. For example Garra species is very well adapted to torrential water flow which has a suction cup on the ventral region, just below the mouth, can adhere to rocks, thus protects itself from torrential flow of water. Diversity of fish species is determined generally by several physical factors, size, depth, quality of stream and biotic conditions such as food, vegetation and substratum (Bhat and Anuradha, 2000; Arunachalam, 2000). Habitat destruction due to deforestation results in increased erosion and suspended matter and deposition of fine sediments resulting in habitat loss and destruction of spawning grounds and species extermination (Jayaram, 1981; Jayaram 1977). Different river systems are known to harbor some species exclusive to the system. As per the present study family richness was more in downstream as compared to other two streams CONCLUSION This study was carried out in the animal rearing houses; it clearly revealed the concentration of different fungal species in the environment. The data of fungal spore content in indoor environment helped us to prepare the fungal spore calendar on this region and prediction model will be helpful to forecast the allergenic fungal spore Fresh water fish diversity-Western Ghats 14 Sooryanarayan and Hegde VIJNANABHARATHI, 1 (1): 8-15, 2016 load in the air of Hessaraghatta village. Respiratory allergic problems and hospital admission with relevant diseases of that zone are related to the presence of airborne allergenic fungal spores. The results of the present study could be incorporated while taking suitable measures to prevent health hazards of animals and workers, living or working in such infectious environments. ACKNOWLEDGEMENT We would like to acknowledge University Grants Commission New Delhi and SWRO Bangalore for funding this research work. We also thank to The CDC, Karnataka University Dharwad and Principal of our college for providing the infra-structure facilities to conduct this study. REFERENCES 1. Arunachalam. M. Assemblage Structure of stream fishes in Western Ghats (India). Hydrobiologia, 2000, 430, 1 -30. 2. Ajit Kumar C.R. and Mittal D.D. (1993). Habitat preference of fishes in wetland in relation to aquatic vegetation and water Chemistry. Journal, Bombay Natural Hist. Society, Vol. 90. 3. Bhat, Anuradha., Book Review-Freshwater fishes of India, Current Science. India. August 10, 2000. 79(3), 382-383 4. Daniels, R. J. R... Biodiversity of Western Ghats: An Overview. In Wildlife and Protected areas, Conservation of rain Forests in India. ENVIS Bulletin, 2003, Vol. 4. pp. 25 – 40. 5. Daniels, R.J.R. 2003. Biodiversity of the Western Ghats: An overview. In ENVIS Bulletin: Wildlife and Protected Areas, Conservation of Rainforests in India, A.K. Gupta, Ajith Kumar and V Ramakantha (editors), Vol. 4, No. 1, 25 – 40 6. Jayaram.K.C. 1981. The Freshwater Fishes of India, Pakistan, Bangladesh, Burma and Shri Lanka. Hand Book Zoological survey of India. Xii + 475pp. 7. Jayaram, K. C. 1977a. Zoogeography of Indian freshwater fishes. Proc. Indian. Acad. Sci. 86 B (4): 265-274. 8. Jayaram, K. C., Indra, T. J. and Sunder Singh, M. 1976. On a collection of fish from the Cardamom Hills, South India. Madras J. Fish., 7:1-7. 9. Jayaram, K.C. (1981), Freshwater fishes of India, Pakistan, Bangladesh, Burma and Srilanka: a handbook, Zoological Survey of India, Calcutta. 10. Jayaram, K.C. (1999), Freshwater fishes of the Indian region, Narendra Publishing House, Delhi. 11. Sreekantha. et.al. Fish diversity in relation to landscape and Vegetation in Central western Ghats, India. Current Science, Vol. 92, No. 11, 10 June 2007. 12. Subhas Chandran M.D. et al. 2001. Investigation and Conservation of Myristica swamps of Uttara Kannada. Final report submitted to Forest research and Training Institute, Western Ghats Forestry project. Bangalore Fresh water fish diversity-Western Ghats 15 Sooryanarayan and Hegde VIJNANABHARATHI-A frontier journal in SCIENCE Vol. 1 | No.1 | 16 -19 | WOLBACHIA ASSOCIATION AND ITS PHYLOGENETIC AFFILIATION March | 2016 OF BRUGIA MALAYI PARASITES FROM INDIA Ravikumar H, Surendra N S, Prakash B M and Puttaraju H P. Department of Biological Sciences, School of Natural Science, Jnanabharathi campus, Bangalore University, Bangalore- 560056, India.. ISSN : 0971-6882 ABSTRACT: ISSN-L : 0377-8487 Wolbachia have established a mutualistic association with filarial nematodes and has a CODEN : VBHAD6 phenomenal implication in its normal development, reproduction and survival. Elimination of Wolbachia by tetracycline class of antibiotic compounds have been suggested and successfully implemented for the treatment of lymphatic filarial parasites. Thereby, is necessary to assess the prevalence of the Wolbachia in B. malayi before such new strategies are employed, across the Corresponding author: world. In the present communication, the presence of Wolbachia and phylogenetic affiliation in RAVI KUMAR. H, B. malayi collected from Sevagram, Maharashtra, India, has been addressed. Department of Biological This article is to be cited as: Sciences, Ravikumar H, Surendra N S, Prakash B M and Puttaraju H P. Wolbachia association and its Jnanabharathi Campus, phylogenetic affiliation of Brugia malayi parasites from India; Vijnanabharathi, 1 (1): 16-19, 2016. Bangalore University, Bangalore 560 056. Karnataka, India. INTRODUCTION [email protected] Filarial nematodes like Brugia malayi, Wuchereria bancrofti and Onchocerca volvulus cause several important human diseases across tropics and subtropics. They belong to the order Spirurida and family Onchocercidae, have been reported to harbour the Wolbachia endosymbionts Key words: Wolbachia, (Casiraghi et al., 2001). These bacteria have been implicated not only in establishing a mutualistic Brugia malayi , association with filarial nematodes but also in the pathogenesis of filarial disease (Bandi et al., Phylogeny, 2001). Wolbachia acts on the host immune system and accelerates the rate of inflammation. During Filarial nematodes, pathogenesis the β cell proliferation of the host is directed specifically towards Wolbachia surface Mutualism antigens which strengthen the possible role of Wolbachia in filarial pathogenesis (Lamb et al., 2004). After the death of the nematodes, the host respond to Wolbachia by releasing stimulatory and modulatory factors from neutrophils and monocytes (Hise et al., 2004). The typical immunological response of the host in producing mimics of lipopolysaccharide and Received on: activation of Toll like receptor-4 (TLR4) are known to be induced by Wolbachia (Tylor et al., 2000a; 26 December 2015 Andre et al., 2002). The regulation of Th1 and Th2 cytokines, which are the potential targets for Accepted on: filarial pathogenesis, is known to be governed by TLR4 (Tylor et al., 2000b). The strategies of 25 January 2016 combating filarial nematodes through Wolbachia by tetracycline class of antibiotic compounds directly hinder their proliferation and manage their pathogenesis (Hoti et al., 2003). In view of the importance of Wolbachia for the survival, developmental stages, reproduction and pathogenesis, it ©2016 Vijnanabharathi All rights reserved is necessary to assess the prevalence of Wolbachia in B. malayi from different geographical locations in India. However, earlier research by Hoti, et al., (2003) and Gayen, et al., (2010) identifies the occurrence of Wolbachia only in W. bancrofti collected from various geographical locations in India. The present study is an attempt to screen for the presence of Wolbachia in B. malayi (Bm-I) collected from the Jamnalal Bajaj Tropical Disease Research Centre at Mahatma Gandhi Institute of Medical Sciences, Sevagram, Maharashtra, India and to fill this impending gap. 44 16 VIJNANABHARATHI, 1 (1): 16-19, 2016 MATERIALS AND METHODS Genomic DNA was extracted from microfilariae (approximately 1500 in number) by Column based Animal tissue kit (Chromous BiotechTM Pvt, Ltd, Bangalore, India) with manufacturer’s protocol. DNA was quantified through Bio-photometer (Eppendorf AG, Hamburg, Germany). A polymerase chain reaction (PCR) assay was done through thermocycler (Eppendorf AG, Hamburg, Germany), with the reaction mixture containing 10 μl 10X buffer (5 Prime Eppendorf), 3 μl 25 mM MgCl2, 1.25 μl dNTPs (10 mM each), 1 μl 10 pmoles of both forward and reverse primers, 1.5 unit of Taq DNA polymerase(5 Prime Eppendorf) and template DNA. The PCR conditions followed for each step included 3 min at 950C for the initial denaturation step followed by 35 cycles of 45 s at 940C (denaturation), 1 min at 510C (annealing), 1min at 720C (primer extension) and 7 min at 720C for the final extension. For amplication filarial-specific 28 S rRNA, Wolbachia 16 S rRNA and Wolbachia surface protein (wsp) gene primers (Gayen et al., 2010; Smith and Rajan, 2000; Bazzocchi et al., 2000). PCR products were resolved in 1.2% agarose gel and stained with green view dye (Chromous BiotechTM Pvt, Ltd, Bangalore, India). The amplicons were observed and recorded in a gel documentation unit (Alpha Imager (R) EP, Canada).The size of the PCR product was determined using a 1-kb ladder (GeNeiTM, Bangalore, India). The PCR product of wsp gene were purified using Chromous PCR Clean-up kit (Chromous BiotechTM, Bangalore, India) and directly sequenced with respective primers using an automated sequencer (3130 Genetic Analyzer, ABI, Foster city, California, USA). The sequences obtained have been deposited in GenBank under the accession number JX506736. Phylogenetic analysis of the wsp gene sequence was done at BLAST-x program at NCBI. Multiple sequence alignment was done by using CLUSTAL W program. The phylogenetic trees were constructed using Kimura-2-distances and the Neighbor-Joining algorithm was computed using MEGA 4 program (Tamura et al., 2007). RESULTS AND DISCUSSION PCR amplification was carried out with Wolbachia- specific 16S rRNA and wsp gene primers to confirm the presence of Wolbachia infection in B. malayi. 16S rRNA gene amplified at 207 bp and wsp gene amplified around 590 bp fragments, whereas filarial-specific 28S rRNA primers was used confirming the quality of template DNA and authenticity of the experimental protocol yielded distinct band at 150 bp as shown in the figure-1. The evolutionary history of Wolbachia lineages in the B. malayi of Indian populations was investigated by phylogenetic analysis performed with Neighbour-Joining algorithm using Kimura-2-distance. Direct sequencing of the PCR products gave only one sequence without double peaks, indicating the presence of only one strain in the Bm-I. These sequences have been submitted to the Genbank database and phylogenetic tree based wsp gene was constructed. B. malayi grouped in D supergroup as shown in the figure 2. The wsp gene sequences of Wolbachia from Bm-I strain showed highly homology with the previously reported B. malayi strain Bm-1, proving they belonged to the same strain. Wolbachia association in Brugia malayi 17 Ravi Kumar and Puttaraju VIJNANABHARATHI, 1 (1): 16-19, 2016 Figure 1: PCR amplification of B. malayi (Bm-I) using filarial 28S rRNA-specific primers (Lane 1), Wolbachia- specific 16S rRNA primers (Lane 2), Wolbachia surface protein-specific primers (Lane 3) and Lane M is the migration pattern of the 1 kd DNA ladder. The study investigated the presence and phylogenetic affiliation of Wolbachia in B. malayi (Bm-I) from India. The presence of Wolbachia in W. Bancrofti has been well documented in India by Hoti et al (2003) and Gayen et al (2010). B. malayi is considered to be high endemic to several states of India since decades. But there is a lack of information on Indian strain Bm-I. Thus, the current preliminary study has shown that Wolbachia is present in B. malayi (Bm-I) and the phylogenetic analysis shows the sequence similarity with members of Bm-1 strain of D super group and correlated well with the earlier works of Bazzocchi et al (2000) and Casiraghi et al (2001). Wolbachia has displayed a mutualistic relationship with nematodes, and therefore elimination of Wolbachia by tetracycline class of antibiotic compounds decreases the host fitness and ultimately leads to its mortality (Smith and Rajan, 2000). The prevalence of Wolbachia in B. malayi from various geographical areas across India, and the extent of mutualism, its application in filarial management programmes is an interesting proposition for future studies Figure 2: Phylogenetic tree of Wolbachia based on the wsp sequences, constructed from Kimura-2-distance and the Neighbour-Joining algorithm. The numbers near the node indicate percentage of 1000 bootstrap replicates. Names correspond to host species. The GenBank accession numbers are also mentioned. Wolbachia association in Brugia malayi 18 Ravi Kumar and Puttaraju VIJNANABHARATHI, 1 (1): 16-19, 2016 ACKNOWLEDGEMENT Authors would like to thank DR. M. V. R. Reddy Dept. of Biochemistry, Jamnalal Bajaj Tropical Disease Research Centre at Mahatma Gandhi Institute of Medical Sciences, Sevagram, Maharashtra, India for providing B. malayi sample and highly thankful to the ICMR (No.5/8-7(309)V-2011/ECD-II, Vector Science Forum) for Research Associate position. REFERENCES 1. Casiraghi M, Anderson TJ, Bandi C, Bazzocchi C, Genchi C. (2001). A phylogenetic analysis of filarial nematodes: Comparison with the phylogeny of Wolbachia endosymbionts. Parasitology, 122, 93–103. 2. Bandi, C, Trees S, Brattig N. (2001). Wolbachia in filarial nematodes: Evolutionary aspects and implications for the pathogenesis and treatment of filarial disease. Veterinary Parasitology, 98, 215–238. 3. Lamb TJ, Le Goff L, Kurniawan A, Guiliano DB, Fenn K , Blaxter ML, Read AF, Allen JE. (2004). Most of the response elicited against Wolbachia surface protein in filarial nematode infection is due to the infective larval stage. Journal of Infectious Diseases, 189, 120–127. 4. Hise AG, Gillette-Ferguson I, Pearlman E. (2004). The role of endosymbiotic Wolbachia bacteria in filarial disease. Cell Microbiology, 6 (2), 97–104. 5. Taylor MJ, Cross HF, Bilo K. (2000a). Inflammatory responses induced by the filarial nematode Brugia malayi are mediated by lipopolysaccharide like activity from endosymbiotic Wolbachia bacteria. Journal of Experimental Medicine, 191, 1429– 1436. 6. Andre A, Blackwell NM, Hall LR, Hoerauf A, Brattig NW, Volkmann L, Taylor MJ, Ford L, Hise AG, Lass JH, Diaconu E, Pearlman E. (2002). The role of endosymbiotic Wolbachia bacteria in the pathogenesis of river blindness. Science, 295, 1892–1895. 7. Taylor MJ, Bandi C, Hoerauf AM, Lazdins J. (2000b). Wolbachia bacteria of filarial nematodes: A target for control?. Parasitology Today, 16, 179–180. 8. Hoti SL, Sridhar A, Das PK. (2003). Presence of Wolbachia endosymbionts in microfilariae of Wuchereria bancrofti (Spirurida: Onchocercidae) from different geographical regions in India. Memórias do Instituto Oswaldo Cruz, 98(8),1017- 1019. 9. Gayen P, Maitra S, Datta S, Babu SP. (2010). Evidence for Wolbachia symbiosis in microfilariae of Wuchereria bancrofti from West Bengal, India. Journal of Bioscience, 35(1),73-7. 10. Smith HL, Rajan TV. (2000). Tetracycline inhibits development of the infective-stage larva of filarial nematodes in vitro. Experimental Parasitology, 95, 265–270. 11. Bazzocchi C, Jamnongluk W, O’Neill S, Anderson TJC, Genchim C, Bandi C. (2000). Wsp gene sequences from the Wolbachia of filarial nematodes. Cell Microbiology, 41, 96–100. 12. Tamura K, Dudley J, Nei M, Kumar S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24,1596-1599 Wolbachia association in Brugia malayi 19 Ravi Kumar and Puttaraju VIJNANABHARATHI-A frontier journal in SCIENCE Vol. 1 | No.1 | 20- 27 | IN-VITRO STUDIES IN CALAMUS PRASINUS, C. THWAITESSI AND March | 2016 C. VATTAYILA D.H. Tejavathi1*, H.R. Raveesha1, R. Nijagunaiah1, A.C. Lakshmana2 and R.V. Madhusudhan1 1 Department of Botany, Jnanabharathi, Bangalore University, Bangalore – 560 056, India. 2 Principal Secretary (Retd.), Forest and Environment Govt. of Karnataka, Bangalore – 560 001, India. ISSN : 0971-6882 ABSTRACT: ISSN-L : 0377-8487 Calamus prasinus, C.vattayila and C. thwaitessi are economically important rattans in CODEN : VBHAD6 furniture industry. The need for propagation of rattans is considered as most urgent on priority basis since over exploitation and deforestation have resulted in the depletion of the germplasms of Calamus species. In vitro micropropagation is an alternative strategy to mass propagate such threatened taxa. Shoot tips of C.prasinus, C. thwaitessi and C. vattayila were inoculated on Corresponding author: Murashige and Skoog’s and Phillips and Collins media supplemented with various hormones to D.H. TEJAVATHI study their morphogenetic potential. Multiple shoots were obtained from the cultures of all the Department of Botany, selected taxa on Phillips and Collins medium supplemented with anxins and cytokinins. Among Jnanabharathi campus, Bangalore University, the combinations tried, NAA and BAP combinations favoured the induction of maximum Bangalore – 560 056, India multiple shoots. Thus obtained shoots were rooted on auxin supplemented media. The plantlets [email protected], were acclimatized on vermiculate + perlite before transferring them to pots containing soil:sand:manure in 1:1:1 ratio. About 30% of survival of plantlets was recorded. This article is to be cited as: D.H. Tejavathi, H.R. Raveesha, R. Nijagunaiah, A.C. Lakshmana and R.V. Madhusudhan. In vitro studies in Calamus prasinus, C. thwaitessi and C. vattayila; Vijnanabharathi, 1 (1):20-27, 2016. Key words: INTRODUCTION Rattans, Overexploitation, Calamus species commonly known as rattans are mostly trailing or climbing spiny palms Deforestation, in vitro propagation, with characteristic scaly fruits, classified under the sub family Calamoideae of the family C.prasinus, Arecaceae. They constitute one of the most important non timber forest products particularly in C. thwaitessi, South East Asia. They are known for their strength, durability, elasticity, lightness, lustrous C. vattayila. brown colour and bending strength which confer them the title of “Green Gold” (Mohan Ram and Tandon, 1997). The rattan stem is extensively used for cane furniture industry and play an Received on: important role in the socio-economy of the people of South East Asian Countries (Dransfield, 22 January 2015 1979, Dransfield and Manokaran, 1993 and Singh et al., 2004). There is an extensive demand Accepted on: 12 Febuary 2016 for both raw and processed canes. Rattans generate employment for more than half a million people of Southeast Asia. According to Phillippines Business report (2004) the world demand for rattan furniture is about US $6.5 billion per year. The mass scale harvest of rattans before flowering and fruiting has resulted in the depletion of the germplasms. Vegetative propagation through suckers also has certain limitations as the survival rate of sucker is not significant. At this juncture, plant tissue culture plays an important role in mass multiplication of threatened ©2016 Vijnanabharathi species. This technology has established as an alternate strategy for production of large All rights reserved quantities of planting material of genetically uniform stock. 44 20 VIJNANABHARATHI, 1 (1): 20-27, 2016 Calamus prasinus Lakshmana and Renuka, commonly known as ‘Onte betta’, is a solitary and high climbing cane (Fig.1A). It is endemic to Western ghat regions of Karnataka. It is one of the most sought after cane for furniture making. It can be grown as an intercrop in rubber plantations. Except its distribution and taxonomic studies, it is totally underexploited. Calamus thwaitessi Becc & HK.f., a robust high climbing clustered rattan is commonly known as “Handibetta”and extensively used for furniture making (Fig.1B). As a result of continuous deforestation, most of the populations are fragmented and also is rapidly decreasing due to overexploitation by cane industries (Sreekumar and Renuka, 2006). Though in vitro studies were initiated earlier in this taxon, micropropagation studies are needed to develop an efficient protocol for mass multiplication (Valsala and Muralidharan, 1999; Hemanthakumar et al.,2013, 2014). Calamus vattayila Renuka, an high climbing solitary cane, is commonly known as “Devarubetta” and considered as good cane for furniture making (Fig.1C). It is an endemic and endangered rattan of the Western ghats where a development of a protocol for their ex-situ conservation is needed (Jacob and Decruse, 2015). Except seed germination studies, cryopreservation and its taxonomic description, no other studies have been carried out in this taxon (Renuka, 1992 ,Tejavathi et al., 2013 & Jacob&Decruse,2015). With this background, the present study is an attempt to mass propagate the above selected taxa by employing shoot tip cultures. MATERIALS AND METHODS Frequent visits were made to Western ghats to collect the seeds and seedlings. Seedlings are maintained in the departmental garden, Bangalore University, Bangalore – 560 056. a. Surface sterilization of the explants Shoot tips (0.5 cms) were excised from one year old healthy seedlings. They were thoroughly washed with tween-20 in running water for 30 min and then surface sterilized with Bevastin, a fungicide (0.1%) for 30 min. Explants were then washed in tap water to remove the traces of Bevastin for 30 min followed by treatment with mercuric chloride (1.0%) for not more than 2 min. After the treatment, the explants were thoroughly washed with sterile double distilled water for five times to remove the traces of sterilients. b. Culture medium and conditions Murashige and Skoog’s (MS, 1962) and Phillips and Collins (L2, 1979) were supplemented with auxins like 2, 4-D, IAA, IBA and NAA and cytokinins such as BAP, Kin, 2-ip, AS and TDZ either alone or in combinations at various concentrations. Sucrose (3%) and Bacteriological grade agar agar (0.8%) were used as carbon source and gelling agent respectively. PH of the medium was adjusted to 5.6 – 5.8 and autoclaved for 15 min at 108 kpa. The cultures were incubated at 25±20C under florescent tube lights with 16:8h light and dark regime at the intensity of 25µ mol m -2s1 . c. Rooting and acclimatization of regenerated plants. The multiple shoots obtained thorough in vitro culture were transferred to rooting medium containing either IAA or NAA at various concentrations. After 45 to 50 days the rooted plantlets were transferred to plastic cups containing vermiculate and kept in polyhouse for acclimatization. Thus hardened plantlets were transferred to pots containing soil: sand: manure in 1:1:1 ratio. Three month old seedlings were transferred to field. d. Data analysis The results were recorded once in 30 days and represented as ± standard error based on ten replications. The data was analysed by One way ANOVA and significant ‘F’ ratios between the groups were further subjected to DMRT using SPSS version 1.5. Probability values <0.05 were considered as significant.. In vitro studies in Calamus 21 Tejavathi et al., VIJNANABHARATHI, 1 (1): 20-27, 2016 Figure1: Plants in their natural habitat (1A: Calamus prasinus, 1B: Calamus thwaitessi, 1C: Calamus vattayila) RESULTS Among the two media tried, L2 medium supplemented with growth regulators was found to be more suitable for the cultures to respond. Hence L2 medium was used for further studies. The responses that are mentioned below are common to all the three species studied. Specific response from a particular species is mentioned wherever it is needed. The explants fail to show any response on the basal medium, hence the basal medium was supplemented with auxins, cytokinins and their combinations to study their effect on morphogenesis. Effect of auxins Shoot tip explants were inoculated onto L2 medium supplemented with various auxins like 2, 4-D, IAA, IBA and NAA at different concentrations to study their morphogenetic effect. When the explants were inoculated on 2, 4-D at 9.05-18.1 µM, a friable white callus was initiated from the explants of C.vattayila after two weeks of culture. Even after several subcultures to same hormone or different hormones, the callus remained non-morphogenetic. However, proliferation of the callus was observed when it was sub-cultured to 2, 4-D supplemented medium. NAA, IAA and IBA supplemented media have no effect on the explants of C.vattayila, explants remained green even after 8 weeks of culture. However, explants of C. prasinus and C thwaitessi have grown into single shoot without the formation of multiple shoots on all the auxin supplemented media (Fig.2A). Effect of cytokinins Shoot tip explants were inoculated onto L2 media supplemented with various cytokinins like Kin, BAP, AS, TDZ and 2-ip at different concentration either alone or in combinations. Single shoot is formed when the explants were cultured on all cytokinin supplemented media (Fig.2B). Then they were sub-cultured to combinations of cytokinins for multiple shoot induction. However, multiple shoots were not formed though the growth of the single shoot was observed on all the combinations of cytokinins. In vitro studies in Calamus 22 Tejavathi et al., VIJNANABHARATHI, 1 (1): 20-27, 2016 Effect of auxins and cytokinins Shoot tips of the three taxa selected for the present study were inoculated onto L2 medium supplemented with various combinations of auxins and cytokinins (Table 1). Kin, BAP and 2-ip were supplemented with 2, 4-D, IAA, IBA and NAA at various concentrations to study their synergistic effect on morphogenesis. Among the combinations, NAA with BAP favoured the induction of multiple shoots from the cultures. The explants of C.prasinus produced white friable callus on L2+IAA (5.71µM) + BAP (8.87µM) after 2 weeks of culture. Rhizogenesis was recorded from callus after 6 weeks of culture. However, NAA +BAP promoted the formation of brownish nodulated callus from the explants after 4 weeks of culture. Thick whitish roots and green shoot buds started initiating from the callus after 8 weeks of culture on L2+NAA (10.74µM) + BAP (17.74µM) (Fig.2C). Lower concentrations however favoured the proliferation of the callus without any morphogenesis. The explants of C. thwaitessi responded better on the media supplemented with higher concentration of cytokinins. On L2 + NAA (5.37µM) + BAP (8.87µM), the explant has produced only 2- 3 shoots per culture, while on L2+ NAA (10.74µM) + BAP (17.74µM), the shoot has proliferated into 10-12 shoots ( Fig.2D) with basal callusing. The explants have failed to show any morphogenetic effect on the medium supplemented with 2-ip, Kin with auxins. When the explants of C. vattayila were inoculated on L2 medium supplemented with NAA (2.69µM) + BAP (8.87µM), the shoot apex proliferated into 4-5 shoots per culture with basal cullusing. Whereas on L2 + NAA (5.37µM) + BAP (17.74µM), 9-11 shoots were formed from the explant which were healthy and elongated (Fig.2E). Figure 2: Effect of auxins and cytokinins on morphogenesis 2A: Single shoot regeneration from the shoot tip cultures of C.thwaitessi on L2+NAA (10.74µM) 2B: Single shoot regeneration from the shoot tip culture of C. prasinus on L2+BAP (8.87µM) 2C: Induction of nodulated callus and shoot buds from the shoot tip cultures of C.prasinus on L2+NAA (10.74µM) +BAP (17.74µM) 2D: Multiple shoot induction from the shoot tip culture of C. thwaitessi on L2+NAA (10.74µM) + BAP (17.74µM) 2E: Multiple shoot regeneration from the shoot tip cultures of C.vattayila on L2+NAA (5.37µM) + BAP (17.74µM) 2F: Acclimatization of regenerated plantlet on vermiculate In vitro studies in Calamus 23 Tejavathi et al., VIJNANABHARATHI, 1 (1): 20-27, 2016 Rooting and acclimatization of regenerated plantlets Thus obtained shoots from both direct and indirect organogenesis were transferred to L2 media supplemented with auxins for induction of roots. NAA at 10.74µM and IAA at 28.54µM were able to induce 4- 5 healthy roots from the basal part of the shoots without any callus formation. Then the young plantlets were removed from the culture bottle and washed thoroughly to remove the adherent medium. They were transferred to plastic cups containing vermiculate and perlite (Fig.1F). After one month of hardening they were transferred to the pots containing soil:sand;manure in 1;1;1; ratio. Three months old seedlings were planted in the field. Nearly 30% of survival was recorded. Table 1: Effect of Plant growth regulators on multiple shoot induction from shoot tip cultures of Calamus prasinus, C. thwaitessi and C. vattayila. Media + PGRs C. prasinus C. thwaitessi C. vattayila L2+ NAA(2.69 µg/l)+ BAP (4.44 µg/l) 2.00±0.67fi 1.80±0.79d 2.40±0.52de L2+ NAA(2.69 µg/l)+ BAP (8.87 µg/l) 2.20±0.42f 2.50±0.53cd 5.10±1.73b L2+ NAA(5.37 µg/l)+ BAP (8.87µg/l) 5.00±1.72b 2.60±0.52c 2.80±1.03d L2+ NAA(5.37 µg/l)+ BAP (17.74 µg/l) 3.90±0.74c 4.70±0.82b 9.00±1.76a L2+ NAA(10.74µg/l)+ BAP (8.87 µg/l) 2.70±0.82e 3.90±0.56bc 3.00±0.82c L2+ NAA(10.74 µg/l)+ BAP (17.74 µg/l) 12.00±2.37a 10.70±1.57a 2.70±0.82cd Values are Mean ± SD, each with 10 replicates. Mean followed by the same letter are not significantly different at P= 0.05 according to Duncan’s Multiple Range Tests DISCUSSION Though Calamus species produce abundant fruits during the season, there is a difficulty in supplying high quality of seeds of desired species to the cultivators. The mass scale harvest of rattans has led to a situation of inadequate number of mature plants to produce flowers and fruits. Further inaccessibility of the mature plants in thick forest is another reason for non availability of the required seeds. In this context, tissue culture technology plays an important role in supplying large quantities of seedlings to raise the plantations that is the need of the hour. The most favoured explant in tissue culture of Rattans is embryo (Barba et al., 1985, Dekkers and Rao, 1989, Yusoff and Manokaran 1985, Goh et al., 2001, Hemanthakumar et al., 2013). However, shoot tips are considered as best explants to get genetically identical clones. Based on the two level polymorphism between the genotypes of Calamus thwaitessi using ISSR markers, Hemanth Kumar et al., (2014) have concluded that the plantlets regenerated from sucker derived shoot tip cultures are likely to be genetically true to their mother plants. Extensive research has been carried out in respect of taxonomy and conservation of genetic resources of Rattans (Griffith, 1844, Cook, 1901-1908, Gamble, 1915-1936, Dransfield, 1979, Basu, 1985, 1995, Bhat et al., 1989, Renuka, 1992, 1993a, 1993b, 1997, 1999, Lakshmana, 1993, Mohan Ram & Tandon, 1997, Singh et al., 2004, & Lalnuntluanga et.al., 2010) since the publication of floras during late 19 & 20th century. Keeping in view of gradual depletion of genetic resources of rattans, tissue culture studies were initiated during 1980s. Umali-Garcia (1985) cultured the shoot apices of 11 species of Rattans and two of Daemonorops on MS medium supplemented with various hormones. Multiple shoots were initiated from the callus on BA and 2, 4-D In vitro studies in Calamus 24 Tejavathi et al., VIJNANABHARATHI, 1 (1): 20-27, 2016 supplemented medium in three species of Calamus. Calamus thwaitessi and C. vatayila are most seriously affected economically important species in Western ghats inspite of their wide distribution by deforestation and indiscrimination exploitation (Hemanthakumar et al., 2013). In the present study, the multiple shoots have proliferated from shoot tip explants on L2 supplemented with NAA and BAP. In C. flagellum, however shoot tip callus derived from 2, 4-D medium has produced multiple shoots on NAA + BAP combinations (Kundu and Sett, 1999). Tejavathi et al., (2013, 2015) have reported multiple shoot induction from the shoot tip callus of C. nagabettai and C.huegilianus on NAA + BAP combinations. However Krishna Kumar et al., (2012a, b) have obtained multiple shoots from the shoot tip cultures of C. travancoricus and C.nagabettai on MS supplemented with BAP alone. The efficiency of BAP in inducing shoot buds in in vitro cultures is well established (Reinert & Bajaj,1979 & Bhojwani & Razdan, 1996). It has been suggested that efficacy of BAP in promoting organogenesis is due to its ability to induce the production of natural hormones such as Zeatin. Embryoids were obtained from the embryo derived callus of C. thwaitessi on BA and NAA supplemented medium (Hemanthakumar et al., 2013). However multiple shoots were obtained from the shoot tip cultures of C. thwaitessi in presence of BAP and NAA along with TDZ (Hemathakumar et al. 2014). Hormones play an important role in controlling the morphogenetic response of the cultures. Endogenous growth regulator content is known to differ from one meristematic centre to another (Norton, 1986). Balance between the endogenous and exogenously supplied hormones determine the morphogenetic response. In the present study, explants produced only single shoot in presence of single hormones in the medium. Multiple shoots were formed on the media supplemented with auxins and cytokinins. Both auxins and cytokinins readily form conjugates in plants. Thus the conjugation may be a way of prescribing the biological activity of the plant growth regulators (Skoog & Miller, 1957). Kin along with 2, 4-D induced multiple shoot induction from embryo explants of C. latifolius on onWPM (Meitram & Sharma,2006). Shoot tip of C. vattayila, a solitary cane, had proliferated into 10-12 multiple shoots on L2 medium supplemented with auxins and cytokinins. Whereas multiple shoots were formed from nodulated callus derived from shoot tip cultures of C.prasinus which is also a solitary cane, on NAA+BAP supplemented media. Goh et al., (1999) were able to induce somatic embryos from the root callus of C.manan, a solitary cane, on MS medium supplemented with picloram. Yusoff (1989) was succeeded in inducing multiple shoots from the collar region of in vitro raised seedlings of C. manan on MS supplemented with BAP/Kin. Thus solitary canes in nature can be made to produce shoots in in vitro by manipulation of hormones in the culture media. Thus obtained shoots from direct and indirect organogenesis were transferred to media containing IAA/IBA/NAA at various concentrations for root induction. IBA is the most favoured auxin for induction of roots in many species (Arya et al., 1999). However, in the present study, IBA was not efficient in inducing roots from the shoots. NAA and IAA had promoted the formation of roots from the basal parts of the shoots. In C.flagellum NAA had promoted maximal number of roots than IAA and IBA (Kundu and Sett, 1999). The rooted plantlets were removed carefully from the medium and washed thoroughly to remove the traces of media and transferred to plastic cups containing vermiculate and perlite. After 30 days of hardening, plantlets were transferred to pots containing soil: sand: manure at 1:1:1 ratio before planting them in field. Nearly 30% of survival was recorded. MS medium was used in the earlier studies to raise the cultures of Rattans. However, in the present study, L2 medium was found to be suitable to raise the cultures and to obtain multiple shoots. L2 medium was first formulated by Phillips and Collins (1979) to initiate callus and suspension cultures of red clovers. Subsequently, it is being used for other species also. L2 medium contains lower levels of ammonium salts and higher levels of Ca and Mg compared to MS medium. In vitro studies in Calamus 25 Tejavathi et al., VIJNANABHARATHI, 1 (1): 20-27, 2016 CONCLUSION It can be concluded from the aforesaid data that shoot tip cultures can be employed to micropropagate these taxa to meet the demand to raise the plantations either for in situ or ex situ conservation programmes. ACKNOWLEDGEMENT The authors are thankful to the Department of Science and Technology (DST), New Delhi for funding this investigation. REFERENCES 1. Arya,S.,Sharma.,S., Kaur., & Dev Arya, I., (1999). Micropropagation of Dendrocalamus asper shoot proliferation using seeds. Plant Cell Rep.18:879-882. 2. Barba, R.C., Patena, L.J., Mercado, M.M., & Lorico, L., (1985). Tissue culture of Rattan (Calamus manillensis H. Wendl). Paper presented at the second Natl. Symp. On Tissue culture of Rattan. University Pertanian, Malaysia. 3. Basu, S.K., (1985). The present status of Rattans palms in India – An overview. In: Proc. Rattan seminar, Wong, K.M., & Manokaran, N. (eds.), Rattan inf. Centre, For. Res. Inst. Kepong, Kuala Lumpur, Malaysia, pp. 77-94. 4. Basu, S.K., (1995). Rattans canes in India: A Monographic Revision, Rattan information centre, Malaysia, FRIM, Kuala Lumpur, Malaysia. 5. Bhat, K. M., Renuka, C., Seethalakshmi, K.K., Muraleedharan, P.K.& Mohanan, C., (1989).Management and Utilization of rattan resources in India. In: Recent Research on Rattans, Rao, A.N.,&Vongkuang,, I.,(eds.), Proceedings of international Seminar on rattans,Kasetsert University, Thailand and IDRC, Canada, Thailand, pp33-41. 6. Bhojwani, S.S., & Razdan, M.K., (1996). Plant tissue culture: Theory and practice, Panime Publ. Crop. North Holland. 7. Cooke, T., (1901-1908). The Flora of Presidency of Bombay, Vol I & II, London, Reprinted in 3 vols. 1958, Calcutta. 8. Dekkars, A.J., & Rao, A.N., (1989). Some observations on in vitro culture of Calamus trachycoleus. In: Proce. Seminar on tissue culture of forest species, Rao, A.N., &Yusoff, A.M. (eds.) Forest Research Institute, Malaysia and International Development Research Centre. Singapore. 9. Dransfield. J., (1979). A manual of the Rattans of the Malay Peninsnla, Malayan Forest Records 29, Kuala Lumpur, Malaysia. 10. Dransfield. J., & Manokaran, N., (1993). Rattans. Plant resources of South-east Asia,Pudoc Scientific Publishers, Wageninyen. 11. Gamble, J.S. (1915-1936). Flora of the Presidency of Madras. Vol 3. London, pp. 1553-1568. 12. Goh, D.K.S., Michaux-Ferriere, N., Montenuuis, O., & Bon, M.C., (1999). Evidences of somatic embryogenesis from root tip explants of Rattan Calamus manan. In vitro cell. Dev. Biol., 35: 424-427. 13. Goh,D.K.S., Bon, M.C., Aliotti,F., Escoute,J. Ferriere,N.,Ferriere,N., & Monteuuis, O., (2001). In vitro somatic embryogenesis in two rattan species: Calamus merrillii and Calamus subinermis. In vitro cell. Dev.Biol., 37:375-381. 14. Griffith, W., (1844). Palms of British East India. Calculta, J. Nat. Hist. 5: 1-103. 15. Hemanthakumar, A.S., Preetha, T.S., Krishnan, P.N., & Seeni, S. (2013). Utilization of zygotic embryos of an economic rattan palm Calamus thwaitessi Becc. (Arecaceae) for somaplant regeneration and cryobanking. 3 Biotech, 3: 195-203. 16. Hemanthakumar, A.S., Preetha, T.S., Pillai, P.P., Krishnan, P.N., & Seeni, S. (2014). Micro-cloning of an economic rattan palm Calamus thwaitessi for eco-restoration programme. Biologia, 69: 618-624. 17. Jacob, J., & Decruse, S.W., (2015). Zygotic embryo cryopreservation of Calamus vattayilaRenuka, an endangered Rattan palm of India as influenced by seed maturity. Cryo letters, 36: 299-307. 18. Krishna Kumar, H.N., Preeti, S.D., & Chauhan, J.B., (2012a). Studies on the in vitro propagation of Calamus travancoricus. Asian J. Plant Sci. Res. 2: 173-179. 19. Krishna Kumar, H.N., Chandana, E., & Chauhan, J.B., (2012b). In vitro propagation of Calamus nagabettai: An endangered plants. J. Microbiol. Biotech. Res. 2: 270-275. In vitro studies in Calamus 26 Tejavathi et al., VIJNANABHARATHI, 1 (1): 20-27, 2016 20. Kundu, M., & Sett, R. (1999). Regeneration through organogenesis in rattan. Plant Cell. Tiss. Org. Cul. 59: 219-222. 21. Lakshmana, A.C., (1993). Rattans of South India. Evergreen publishers, Bangalore. 22. Lalnuntluanga, Jha, L.K., & Lalramnghinglova, H. (2010 ). Status of research on rattans: a review. Sci. Vis. 10: 51-56. 23. Meitram, B., & Sharma, G.J., (2006). In vitro zygotic embryo germination of Calamus latifolius Roxb. and Calamus tenuis Roxb. J. Food, Agri. Environ. 4: 306-309. 24. Mohan Ram, H.Y., & Tandon, R., (1997). Bamboos and Rattans: From riches to rags. Proc.Indian Natl.Sci.Acad., 63:245-267. 25. Murashige, T., & Skoog, F. (1962). A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol, Plant. 15: 473-497. 26. Norton, M.E., (1986). Explant origin on a determinate of in vitro shoot proliferation in Prunus and Spirea. J. Hort. Sci. 61: 43-48. 27. Phillips, G.C., & Collins, G.B. (1979). In vitro tissue culture of selected legumes and plant regeneration from callus of Red clovers. Crop Sciences, 19: 59-64. 28. Reinert, J., & Bajaj, Y.P.S., (1979). Plant Cell tissue and organ culture, Springer-Verlag, Berlin, Hcidel Berg. 29. Renuka, C., (1992). Rattans of Western ghats. A Taxonomic Manual, KPRI, Peechi, Kerala. 30. Renuka,C.(1993a). Rattans,their diversity in habit and habitat. In: Rattan management and utilization, Chand Basha,S.,& Bhat,K.M.,(eds.), Proceedings of the Rattan (Cane) Seminar, Trichur,KFRI,Peechi and IDRC,Canada,pp. 82-85. 31. Renuka,C.(1993b). Taxonomy of South Indian Rattans. In: Rattan management and utilization, Chand Basha,S.,& Bhat,K.M.,(eds.), Proceeding of the Rattan (Cane) Seminar, Trichur,KFRI,Peechi and IDRC, Canada, pp.76-79 . 32. Renuka, C. (1997).Distribution and Rattan resources in India. In: Rattan Taxonomy, Ecology, Silviculture, Conservation, Genetic improvement and Biotechnology, Rao,A.N.,& Ramanatha Rao,V.,(eds.). Proceedings of Training Course cum Workshop, Sarawak,Sebah,IPGRI-APO Serdang, Malaysia,pp 55-64. 33. Renuka, C., (1999). Indian Rattan distribution- an up-date. Indian Forester, 125:591-598. 34. Skoog, F., & Miller.C.O., (1957). Chemical regulation of growth and organ formation in plant tissue cultured in vitro. Symposia of the Society for Experimental Biology,11:118-131. 35. Sreekumar V.B., & C. Renuka, C., (2006). Assessment of genetic diversity in Calamus thwaitessi BECC. (Arecaceae) using RAPD markers. Biochemical Systematics and Ecology, 34:397-405. 36. Singh, B.H., Puni,L., Jain, A., Singh,R.S., & Rao, P.G.,(2004) Status, utility, threats and conservation options for rattan resources in Manipur. Curr. Sci.87; 90-94. 37. Tejavathi, D.H., Raveesha, H.R., Nijagunaiah, R., Lakshmana, A.C., &Madusudhan, R.V. (2013). Enhancing the germination potential of seeds of selected rattans of Western Ghats. International J. Biol.Pharma. and Allied Sci., 2:602-609. 38. Tejavathi, D.H., Raveesha, H.R., Nijagunaiah, R., Lakshmana, A.C., &Madusudhan, R.V. (2013). An efficient protocol for micropropagation of Calamus nagabettai. Indian, J. Biotech. Allied fields, 1: 507-518. 39. Tejavathi, D.H., Raveesha, H.R., Nijagunaiah, R., Lakshmana, A.C., &Madhusudhan, R.V., (2015). Efficient protocol for micropropagation of Calamus huegilianus – an endangered taxon. International J Curr. Microbiol. Applied Sci., 4: 436-440. 40. Umali-Garcia, M., (1985). Tissue cultures of some rattan species. In: Proc Rattan seminar, Kuala Lumpur, Wong, K.M., & Manokaran, N. (eds.), Rattan inf. Center, For. Res. Inst, Kepong, Malaysia, PP 23-31. 41. Valsala, K., & Muralidharan, E.M., (1999). In vitro regeneration in three species of rattan(Calamus spp.). In: Plant tissue culture and Biotechnology : emerging trends, P.B. Kavi Kishore (ed.), Universities Press (India) Private Ltd.,Hyderabad, India, pp118- 122 42. Yusoff, A.M., (1989). Shoot formation in Calamus manan under in vitro. In: Proceedings of the seminar on tissue culture of forest species. Rao, A.N. & Yusoff A.M. (eds.), Forest Research Institute Malaysia and international Development Research Centre, Singapore. 43. Yusoff, A.M., & Manokaran, N., (1985) Seed and vegetative propagation of Rattans. In: Proceedings of the Rattan Seminar, Wong,K.M. & Manokaran,N (eds.) The Rattan Information Centre and Forest Research Institute, Malaysia, pp.13-22 In vitro studies in Calamus 27 Tejavathi et al., VIJNANABHARATHI-A frontier journal in SCIENCE Vol. 1 | No.1 | 28- 35 | March | 2016 CLIFF SWALLOWS ARE GOOD MANSIONS FOR THEIR OWN PLAN AND ARCHITECTURE OF NEST Chaya H C1, E Santosh2, and Channaveerappa H3* 1Department of Zoology, Maharani Science College for Women, Mysore-570005, India. 2Dept. of Computer Science and Engineering, Maharaja Institute of Technology Mysore, Mandya-571438, India 3Research Group, Govt. Home Science College, Holenarasipura-573211, India. ISSN : 0971-6882 ABSTRACT: ISSN-L : 0377-8487 Cliff swallows (Petrochelidon fluvicola) construct a gourd shaped mud nests below the cliff CODEN : VBHAD6 or extensions of the buildings. For constructions this bird draws a blue print of the nest designed to be completed. The bird uses the beak for construction. The material of the construction includes mud with consistency and organic materials. The mud is converted into pellets before Corresponding author: placing into organised shape. The entire process of arrangement is documented as well discussed using JPEG image process. These birds act as good mansion for their own design of CHANNAVEERAPPA H. Research Group, Govt. nest. Home Science College, Holenarasipura-573211, This article is to be cited as: Karnataka, India Chaya H C, E Santosh, and Channaveerappa H. Cliff Swallows are good mansions for their own plan channaveerappahdr@ and architecture of nest; Vijnanabharathi, 1 (1): 28-35, 2016. gmail.com INTRODUCTION Cliff swallows have a highly developed phenomenon of nesting. These birds are migratory Key words: usually build mud nest on cliffs, rock over hangs, beneath the bridges, sloping edges of Cliff, manmade construction. Four basic criteria are found to play a key role to establish colonial Mud Nest, Blue Print, nests by swallows such as a open habitat for foraging, suitable surface for nest attachment, mud Mason, of proper consistency to build nests and water body to supplement drinking water to these birds JPEG Image (Elmen 1954). Cliff swallow nests are gourd shaped enclosed structure with an entrance tunnel that opens downward. The tunnel is generally present but in a few cases it may be missing. The mud pellets used to build the nest consists of sand, smaller amount of slit and clay. The nest chamber is lined with grass, hair and feather (Kilgore Jr and Knudsen 1977, Chaya H C etal Received on: 24 December 2015 2013). Among cliff swallows nest building is a social activity. Construction and mud gathering Accepted on: is even initiated and assisted by unmated swallows. Mated swallows may build more than one 8 January 2016 nest and all the nest may not be used for breeding there by count of nest under construction will not describe the number of pairs in a colony. Both male and female cliff swallows construct the nest (Brown C R etal 2000). The building activity proceeds slowly to allow the mud dry. Depending upon the availability of mud and weather conditions the construction may take 1 to 2 weeks (Gorenzel and Salmon 1994, Chaya H C etal 2014) ©2016 Vijnanabharathi All rights reserved 44 28 VIJNANABHARATHI, 1 (1): 28-35, 2016 MATERIALS AND METHODS Material of the study comprises the colony of Cliff Swallows Petrochelidon fluvicola. The cliff swallows nest building activity is recorded by digital photography using “Sony Cyber-Shot DSC-HX7V” camera. Each step of the nest building is recorded on each day of nesting activity, starting from its blueprint marking of the nest till the complete guard shape with a tunnel is produced. Movement of swallows of both sex while building the nest is digitally recorded. The use of beak and its artistry is well documented both by still and videography. Girth measurement of pellets, girth of the nest, its length is recorded by either using scale or by measuring tape. The size of the cliff, the cliff forming area the vegetation around, the distance of the water body from the above cliff are recorded by using measuring tape. Graphical analysis of nest construction – procedure Tool Used for the design: Adobe Photoshop 7.0 (About the tool) : Adobe Photoshop is a graphics editing application popular for its extensive amount of features. Photoshop is also, currently, the leading graphics editing application. Photoshop is also image creation software as well as an editor. Photoshop can create any effect or style needed in a drawing or painting or layout. There are graphic software that can do specialized work faster and more efficient than Photoshop (such as painter for realistic paint effects), but Photo shop can do it all in one program. Photoshop works by altering individual pixels in an image as opposed to a vector drawing program that draws with points, lines and objects mathematically. Photoshop is best with images that have complex textures, blends and photo realism, but Photoshop is also very good at vector drawing as long as the image doesn't need to be scaled and you do not need specialized CAD drawing tools. Design process The JPEG (24 bits/pixel - 16 million colors) image “CurveShapedSphere.jpeg” which is showed in the fig.01 is used to represent the pellet as the basic component of the design in the canvas area, the area where the complete design takes place. The image was resized by selecting “Image Size” from the “Image” menu to almost 35%-40% of the original size and the resultant image was subjected to Stroke Layer Style effect by selecting “Add a layer style” button under “Image” menu on the highlighting that Layers of the image “CurveShapedSphere.jpeg” in Layers window with the color “red”. A single layer was made to hold a single pellet in it which was designed with above procedure i.e. a pellet in each layer. The words pellet and layer signifies same in our discussion, sometimes the name can be used interchangeably. By using the “MOVE” tool from the “Tool” window we can position the pellet at any position in the canvas. Using the oblique -“Marquee” tool from the “Tool” window we draw a dotted circle as to signify the base mark, which is used to guide the shape of nest construction. Now multiple the pellet by the duplication method by clicking the “Duplicate” button by right-clicking on the layer in the “Layer” Window. Once the multiple pellets have been created using the duplication process, place the pellet according to the design pattern using the “MOVE” tool for “Tool” window to design the complete nest. Once the complete nest is designed or partially nest design is done if you need to record/save the JEPG images go to “Settings,” select “JPEG” from the drop-down menu. Go to the dropdown menu with “JPEG High” displayed. There you can determine the quality of the image. Naturally, higher quality images will have a larger file size. It is not necessary that images be extremely high quality. Usually, “Medium” is a good setting to choose. To refine the quality of the image, use the “Quality” setting. Here, you can save the JPEG as a percentage of the original image’s quality. For example, 50% would be half the quality of the original image. When you are ready, click “Save” and save the image by giving it a file name. Cliff Swallows are good mansions 29 Chaya and Channaveerappa VIJNANABHARATHI, 1 (1): 28-35, 2016 OBSERVATIONS AND DISCUSSION Indian Cliff Swallows are also known as Streak Throated Swallows – Petrochelidon fluvicola are highly colonial. Indian Cliff Swallows are also known as Streak Throated Swallows – Petrochelidon fluvicola are highly colonial; weight about 10.6-15.0gm, migrant passerine birds. Cliff swallows exhibit no obvious sexual dimorphism and are sexually monochromatic with males and females essentially identical in all plumages. Within pairs the male may have larger patch on the head. They are diurnal, aerial insectivores, feeding exclusively on flying insects and can forage only when the weather conditions allow flying insects to be active. They build enclosed mud nests, gourd shaped that are approximately 15-20cm in diameter and have entrances that are 5-7cm wide. Individual nests in cliff swallow colonies are often densely packed and nesting is highly synchronous within colonies. Nest entrances are, an average approximately 25-30cm apart and nests often share walls. Most nests contain clutches ranging in size from 1-4 eggs clutches with more than 4 eggs are cases of intraspecific brood parasitism or egg transfer or extra pair fertilization occurs frequently noticed only in one case. Brood sizes generally rage from 1-4 eggs nestlings per nest. The Nest The nest is gourd like (Fig-15b) constructed using mud of suitable quality, the mud often mixed with grass for preparing the mud pellet for construction each of the steps observations are as below. The metric profile of the nest revealed that the girth of the nest 43.5±1.3cms with a length of 17.8±0.5cms. The width of the entrance 3.8cms. The depth of the nest ranged 9.5 to 12.3cms, with a diameter of 10.2cms, the girth of the mud wall of the nest was 1.2cms at the base 1.4cms in the middle and 1.5cms at the entrance (Chaya H C etal 2014). Each pair of birds construct the nest according to the blue print mark drawn earlier on the nesting surface. For construction the bird uses its beak (Fig-15a). Both the sexes are involved in construction. Interestingly a single pellet of soil is first placed at the exact half of the lower hemisphere of the nest marking (blue print) subsequently the birds alternatively carry mud pellets mix it well before aligning and the pellets are arranged on both the sides of this centrally placed pellet to form a platform. After partial completion of the lower basal lining the pellets are allowed to dry for 2-3 days. Consequence of this a hard basal lining of pellets is produced above this additional 2-3 layer arranged the sides the basal line were also extended by the arrangement of pellets. After this the days of rest ranged between 2-8 days to construct additional layers. Whenever the nest layers were constructed the proceedings were recorded both by still & video graphics. After completion of the lower half of the nest is the form of a semi lunar cup, the upper half was initiated. The initiation as usual started with the laying of a single pellet and subsequent arrangement on arch upper line marked earlier layer by layer and pellet by pellet arrangement done as the mason workers do, by each of the birds. This construction continued till a gourd shape in alignment with the lower half is produced. After the entrance construction was initiated here also same of alignment is followed. Around 1000 pellets are arranged to construct the nest. Process of construction The construction material majorly consists of mud from a selected site. During this process the mud is chewed well by the bird to mix with its saliva; and filled into the mouth carried to the nest site. The other partner which was on the nest waits each time for the arrival of the other with the contingent mud to be placed for construction. Even though the pellet alignment is completed by the bird compulsorily waited arrival of the partner as an act of safeguard to protect the nesting material that could be stolen by the neighbour in the colony. Cliff Swallows are good mansions 30 Chaya and Channaveerappa VIJNANABHARATHI, 1 (1): 28-35, 2016 Often the bird washes off its beak by dipping into the water below the cliff may be to clear off the mud struck or it may be an act of drinking water. Figure 1: CurveShapedSphere.jpeg Figure 2: Approximated marking on the cliff Figure 3: First pellet placed at the base of the Figure 4: Initial pellet and left or right or marking hybrid pellet pattern summarized flow. Figure 5: Flow diagram based on possible design pattern for the formation of Base Layer-1. Cliff Swallows are good mansions 31 Chaya and Channaveerappa VIJNANABHARATHI, 1 (1): 28-35, 2016 Figure 6: Front view Design of Layer1-3 with Figure 7: Side view Design of Layer1-3 with the left dominant pattern with pellet numbers the left dominant pattern with pellet numbers Figure 8: Front view Design pattern Figure 9: Side view Design pattern summarized for Layers1-3 with the hybrid summarized for Layers1-3 with the hybrid dominant pattern. dominant pattern. Figure 10: The pellet placed at layer above the Figure 11: The base upper layer pellets placed base layer as the rightmost pellet and leftmost to form the complete layer. pellet Cliff Swallows are good mansions 32 Chaya and Channaveerappa VIJNANABHARATHI, 1 (1): 28-35, 2016 Graphical analysis of nest construction The design of the nest construction at the initial stage starts from the making on the cliff as shown in the Fig.02, the marking is not exactly in the shape of circle or elliptical as shown but it is rough surfaced circle. The first pellet is placed on the marking approximately at the base, as the direct contact with the cliff with enough physical and chemical property in the sand to withstand the gravitational force as shown in the Fig.03. Then the preceding pellets can be placed as the neighbour pellets to the first pellet in any of the pattern shown in the Fig.05. The Fig.04 gives a graphical/pictorial representation of how the different flow of pattern can be observed in the sense of formation of first layer (B1 in Fig.06) of the base construction by different birds. Once the initial pellet (1: Initial) is placed at random position at the base of the marking the preceding pellets can be either to the left (2:1L) of the initial pellet or to the right (3:1R) of the initial pellet. Once the preceding second pellet is placed as the neighbour of initial pellet the pattern may be as 2:1L or 3:1R in the Fig.05. The other preceding pellets from the current 2-pellet pattern (P2) to the 3-pellet pattern (P3) can take a formation of the pattern 4:2L or 5:2R/3L or 6:3R depending upon the left dominant pattern or the right dominant pattern or the hybrid (combination of left & right) dominant pattern. The same design procedure is followed for the 4-pellet (P4), 5-pellet (P5) and 6-pellet (P6) pattern. In any pattern the design flows at the final stage of the base layer-1 formation the common pattern will be formed as shown in 16:Base Layer-1 in Fig.05 as the 7-pellet (P7) pattern. Here in our analysis we have taken 7-pellet pattern, i.e 1 as the initial pellet & 3 each pellet to the left & right of the initial pellet. But this is an example pellet pattern we have taken for the discussion; but in reality it may be the same 7-pellet pattern what we are discussing or it may 9-pellet pattern to 15-pellet pattern depending upon the architectural technique of the bird building the nest. The complete layer-1 design pattern with Initial pellet and left or right or hybrid pellet pattern can be summarized as shown in Fig.04. The same procedure will be followed for the formation of Base layer-2 and Base layer-3, but here we follow the left dominant pattern for the analysis and explanation of the nest design pattern. The front view of the nest once the three layers of the base are formed is shown in Fig.06 and this is main strategy of the architectural technique to withstand the complete nest against the gravitational force. Hence the base formation is of the nest is stressed and considered as the main part of our discussion. As mentioned we follow the left dominant pattern for the explanation and analysis as to support it and for the understanding purpose we have numbered each pellet in the design from 1 to 26. Here the 1 indicates the first pellet to be used for the design strategy, the preceding numbers after 1 again which indicates the preceding pellets after the first/main pellet respectively by what we follow the left dominant pattern. And a observation should be made while referring the number assigned to the pellets that there are few numbers missed out at 13 to 22 the reason with this is explained now. Once the B1 is formed by using 7-pellet design formation with the numbers representing 1 to 7, the layer B2 will be the next step of design strategy to act as the supportive withstand force to and with B1 for the gravitational force issues. The B2 as per our design is the next step as soon as the formation of B1 is done; hence it takes the next number from 8 to 12. Now the concern is that why the representation of number 13 to 22 is missing, the reason for this is that once the B2 is formed the next step of design is not B3 as we think but it is in the B1 as the second course i.e U2 in Fig.08 and in this graphical view we have named B1 even as U1, hence both indicates the same layer and can be used interchangeably. The pellets form 13 to 19 will be used to forms the B1-U2 layer and pellets numbered with 20 to 22 will be used to form the B2-U2 layer and this pellets 13 to 22 is not shown as the limitation of the 2-dimension plane. The same design issue will be related with the formation of horizontal layers (U2 & U3) formation as we have graphically represented in the Fig.08 with the Base Thick-2 and Base Thick-3, which represents the thickness of the base horizontally. The design pattern of Cliff Swallows are good mansions 33 Chaya and Channaveerappa VIJNANABHARATHI, 1 (1): 28-35, 2016 the front and the side view of the base formation of the nest construction which is shown in Fig.06 and Fig.07 can be summarized as shown in the Fig.08 and Fig.09 respectively, where the arrow indicates the flow strategy of the nest construction in the process of main pellet or the first pellet positioned and the phases to follow with the positioning of neighbour pellets. The dashed arrow is used in to represent the tracing back to the upper layer for the design pattern. Once the complete base formation is as per the architectural design of the bird. It has enough belief that the base will act and react to withhold the weight which will be formed as the construction of the nest moves towards the completion and the base is able to withstand the gravitational force. It is observed that layer B1 is has the enough strength to withstand the pressure of 25% of nest construction, but the further nesting build may be subjected to unhandled pressure and may collapse completely, hence for this reason with the intelligent move from the bird it has a design plan to build a three layer horizontal & vertical thickness to hold and handle the 100% pressure of the nest with combinational physical property of the base layers to withstanding the all the phases and stages of the construction. Figure 12: Approximate Centre convergence of upper layers for ~25% completion. Figure 13: The Approximate centre of convergence for the complication for upper layers . Figure 14: The Nest construction design with Circular Pattern (a) at 90% and (b) at extension of entrance Figure 15-a: The bird in nest construction Figure 15-b: Nest Cliff Swallows are good mansions 34 Chaya and Channaveerappa VIJNANABHARATHI, 1 (1): 28-35, 2016 Now let us move to the layer which will be formed on the base construction. From this phase the pellet will be placed above the base layer-1 (B1) on the marking as the leftmost pellet in the layer or the rightmost pellet in the same layer as shown in Fig.10. The preceding pellets will be placed in the layer from leftmost pellet or the rightmost pellet which may converge approximately at the centre pellet or it may convergence approximately at the leftmost pellet if the design flow is flown from the rightmost pellet towards the right most pellet and vice versa for the completion of the layer as shown in the Fig.11. In our discussion we take the convergence of centre approximation. The process explained and the pattern shown is followed with the same procedure for the formation of next stages of the construction, and we end up with the view of the nest as shown in the Fig.12. The further construction process will be carried out in the same fashion. The design pattern what we have discussed till the 80% can be summarized with the graphical view as shown in the Fig.13. Till the construction of around 80% the pattern follows as explained with the approximated centre convergence pattern and once this state is reached the bird goes with the circular pattern in an anticlockwise or clockwise direction or even the random circular point pattern. As shown in the Fig.14 (a) and extending its entrance as a narrow piped pattern as shown in Fig.14 (b). To conclude the nest construction process which initiates at the stage of placing a single pellet as the main pellet through the base construction follows to make the base strong enough to play a vital role to play against the gravitational force and withstand it with the holding the complete weight of the nest and evenly distributed over the leftmost and rightmost pellets in each upper layer formed on the base layer till the formation of entrance extended. The three basic patterns will be followed by the bird during the construction process of Base, Mid and final stages. At the base stage Left-, Right- or Hybrid-dominant stretch pattern will be followed, at the mid stage Leftmost, Rightmost or Random convergence pattern will be followed and the final stage the Clockwise or Anti-clockwise convergence pattern will be followed to form the entrance and the entrance extended. All these predictive analysis reveals the avian engineering skill imprinted through evolution in these birds. REFERENCES 1. Brown C R, M B Brown & E Danchin (2000) Breeding habitat selection in cliff swallows: the effect of conspecific reproductiove success on colony choice, Journal of Animal Ecology 69, 133-142. 2. Chaya H C, Mahesha G and Channaveerappa H (2013) COMPOSITION ANALYSIS OF TWO SWALLOWS NESTS – Petrochelidonfluvicola AND Hirundorustica, IJCR, Vol. 5, Issue, 11, pp.3335-3338, November, 2013 3. Chaya H C, E Santosh, Mahesha G, and Channaveerappa H (2014) Architectural Mechanism Developed By Cliff Swallow for Nest Construction, IJERA, Vol. 4, Issue 3( Version 1), March 2014, pp. 4. Delbert L Kilgore Jr and Kathy L Knudsen (1977) Analysis of material in cliff and Barn swallow nets: Relationship between mud selection and nest architecture, The Wilson bulletin 89:No.4:562-571. 5. Elmen J T Jr (1954) Territory, nest building and Pair formation in liff swallow. AUK. 71; 16-35. 6. http://getit.rutgers.edu/tutorials/photoshop7/media/photoshop7.pdf 7. Photoshop Elements-Introductory Reference Guide, Dolores Brzycki, 8-18-02 8. W Paul Gorenzel and Torrel P Salmon 1994. Swallows Prevention and control of wildlife damage; co-operative division- University Of Nebraska, Licoln Cliff Swallows are good mansions 35 Chaya and Channaveerappa VIJNANABHARATHI-A frontier journal in SCIENCE SURVEY ON OUTDOOR AIRBORNE FUNGAL SPORES OF BANGALORE Vol. 1 | No.1 | 36-43| CITY AND CORRELATION WITH METEOROLOGICAL DATA March | 2016 Pavan R1*, Narendra Babu S2, Manjunath K1 and Nagendra Prakash B.S2 1Department of Microbiology and Biotechnology, Bangalore University, Bangalore–56, India 2Department of Civil Engineering, UVCE, Bangalore University, Bangalore–56, India. ISSN : 0971-6882 ABSTRACT: ISSN-L : 0377-8487 Air is vital for the survival of human life as well as other organisms. Air pollution seems to CODEN : VBHAD6 be continuously increasing both in an industrialized and in developing parts of the world. There are several identified reasons for this upsurge in air pollution, the main influencing factors being an increasing number of vehicles, factories, power stations, etc., that emit various pollutants typical of urban and industrial sources. The air that we breathe not only comprises nitrogen, Corresponding author: oxygen and carbon dioxide but also traces of other gases, inorganic particles and particles of PAVAN R. biological origin. Adversative health effects of exposure to airborne particles have been Dept of Microbiology and described in many epidemiological studies. The present research on outdoor airborne fungal Biotechnology, Bangalore University, spores of Bangalore city and correlation with meteorological data was done. Samples were Bangalore-560 056, collected on each month fortnightly in duplicates from May 2013 to August 2013 by using Karnataka, India Andersen two stage air sampler. Petri plates containing Malt Extract Agar media are used as [email protected] sampling medium and exposed for 5 minutes. Altogether, 17 species were recorded from outdoor; the dominant fungal species identified were Cladosporium (78.60%), Rhizopus (3.83%), A. niger (3.82%), Mucor (2.47%) and Rhizopus (2.63%). An attempt has been made to forecast outdoor airborne fungal spores of Bangalore city. This article is to be cited as: Pavan R, Narendra Babu S, Manjunath K and Nagendra Prakash B.S. Survey On Outdoor Airborne Fungal Spores Of Bangalore City And Correlation With Meteorological Data; Vijnanabharathi, 1 (1): Key words: 36-43, 2016. Airborne, Andersen Air Sampler, INTRODUCTION Bioaerosol, Meteorological Data Airborne particles are present all through the environment. Despite the fact that atmospheric air does not favour growth of microorganisms due to lack of nutrients, the microorganisms are present in aerosol form or suspended in the air (Eduard, 2009). The basic sources of microbes are soil, water, animals and humans and they originate in many different forms and affect visibility, climate, human health and the quality of life (Ruzer and Harley, 2005). Airborne microbial quantity and quality vary with time of day, year and location (Lighthart, 2000). Received on: 8 December 2015 Airborne particles may consist of pathogenic or non-pathogenic live or dead bacteria, fungi, Accepted on: viruses, high molecular weight allergens, bacterial endotoxins, mycotoxins, peptidoglycans, 18 January 2016 pollen, plant fibres, etc. Airborne particles derived from microbial, plant or animal origin that is often used synonymously with organic dust is known as bioaerosols (Douwes et al., 2003). ©2016 Vijnanabharathi All rights reserved 36 44 VIJNANABHARATHI, 1 (1): 36-43, 2016 Airborne fungi have much attention from medical researchers as well as environmentalists (Zhao and Yang, 2007 & O’Gorman, 2011). Several investigations have shown that exposure to fungi and their materials may be connected with acute toxic effects, allergies and asthma (Lee et al., 2006.). In addition, concentrations of fungal spores in the air was linked to seasonal variations and meteorological parameters such as temperature, wind speed, humidity and rainfall, that affects numbers and types of airborne fungi (Di Giorgio et al., 1996). Various factors, such as the type of collection medium, identification process, period of the day in which the collection of fungi takes place, sampling frequency and duration, influence the airborne fungi monitoring (Takahashi, 1997). The present work is confined to quantitative and qualitative determination of culturable airborne fungi present in air from the outdoor environments of Bangalore city. MATERIALS AND METHODS Sampling Site: The airborne fungal sampling sites were selected at Bangalore city as indicated. The ten different types of areas selected were Banasawadi and Khaji Sonnanahalli (Residential area), Victoria Road and Central Silk Board (Commercial area), Indira Gandhi Institute of child health (Sensitive area), Jnana Bharathi campus and RV College (Silent area), International machine tools of Peenya, Graphite India Limited of Whitefield and KHB industrial area of Yelahanka (Industrial area). Sampling Period: This study was conducted from May 2013 to August 2013; outdoor airborne fungal samples were collected fortnightly in duplicates. Sampling Instrument: Andersen two stage viable air sampler was used (Andersen, 1958). Standard 90 mm petridish with Malt Extract Agar media are used as collecting surfaces on each stage and sampling time was limited to 5 minutes. Treatment of Samples: The air sampled plates were incubated for 5 to 7 days at room temperature between 250C to 300C and colony morphological characteristics were observed microscopically with strain determination by using manuals and reference slides (Lacey et al., 2006 & Gherbawy et al., 2010). The results for each stage of the sampler were expressed as Colony Forming Units per cubic meter of air (CFU/m3). Meteorological Data: Meteorological data recorded from May 2013 to August 2013 was collected from the Indian Meteorological Department, Bangalore. RESULTS Jnana Bharathi campus: In this location major fungal species identified were Cladosporium (83.82%), Rhizopus (2.9%), A. niger (2.3%), Alternaria (2.2%), Pencillium (2.2%) and Fusarium (2.06%). Monthly variation of maximum fungal count was recorded in June (1526) followed by August (1431), May (756) and least in July (700). In the month of May, Cladosporium showed maximum average monthly distribution (71%) followed by A. niger (6%), Alternaria (6%), Rhizopus (3%) and Pencillium (3%). In the month of June, Cladosporium showed maximum avg. monthly distribution (91%) followed by Rhizopus (2%), Fusarium (1%), Pencillium (1%), A. niger (1%) and Alternaria (1%). In the month of July, Cladosporium showed maximum average monthly distribution 78% Airborne Fungal Spores Of Bangalore 37 Pavan et al., VIJNANABHARATHI, 1 (1): 36-43, 2016 followed by Pencillium (6%), Rhizopus (4%), Mucor (4%) and Alternaria (3%). In the month of August, Cladosporium showed maximum avg. monthly distribution 87% followed by Fusarium (3%), Rhizopus (3%), A. niger (2%) and Mucor (1%). International machine tools, Peenya: In this location Cladosporium was the major fungi with (79.3%) followed by A. niger (5.5%), Rhizopus (3.36%), Fusarium (1.95%) and Mucor (1.77%). Fungal count of June has recorded the highest count (1256), followed by July (1230), August (1050) and May (420). In the month of May, Cladosporium was the dominant fungi with avg. monthly distribution of (43%), A. niger (21%), Rhizopus (7%), A. fumigatus (5%) and Fusarium (4%). In the month of June Cladosporium was the dominant with avg. monthly distribution of (87%), A. niger (4%), Rhizopus (2%), Alternaria (2%) and Pencillium (1%). In the month of July, Cladosporium was the dominant fungi with average monthly distribution of (80%), A. niger (5%), Fusarium (3%), Rhizopus (3%) and Trichoderma (3%). In the month of August, Cladosporium was the dominant fungi with avg. monthly distribution of (82%), Rhizopus (4%), Mucor (3%), Alternaria (2%) and A. niger (2%). RV College: Dominant fungal species in this area were Cladosporium (75.7%), A. niger (4.5%), Rhizopus (3.4%), Alternaria (2.7%) and Penicillium (2.3%). Fungal count was high in July (964) followed by August (938), June (794) and least in May (639). In the month of May, Cladosporium was dominant with avg. monthly distribution (63%) followed by A. niger (14%), Pencillium (5%), A. ochracious (4%) and Rhizopus (3%). In the month of June, Cladosporium was dominant with avg. monthly distribution (75%) followed by Rhizopus (4%), Alternaria (4%), A. niger (3%) and A. flavus (2%). In the month of July, Cladosporium was dominant with avg. monthly distribution (82%) followed by A. fumigatus (4%), A. niger (3%), Penicillium (2%) and Alternaria (2%). In the month of August, Cladosporium was dominant with avg. monthly distribution (78%) followed by Rhizopus (6%), Alternaria (3%), Fusarium (2%) and Curvularia (1%). Victoria Road: Dominant fungal species in this area were Cladosporium (72.6%) followed by Rhizopus (5.65%), A. niger (5.17%), Penicillium (3%) and Alternaria (2.4%). Fungal count was high in August (815) followed by June (812), July (767) and least in May (518). In the month of May, Cladosporium was dominant with avg. monthly distribution (46%) followed by A. niger (18%), Alternaria (7%), Penicillium (6%) and A. flavus (6%). In the month of June, Cladosporium was dominant with avg. monthly distribution (79%) followed by Rhizopus (4%), A. niger (4%), Fusarium (2%) and A. fumigatus (2%). In the month of July, Cladosporium was dominant with avg. monthly distribution (79%) followed by Rhizopus (6%), A. niger (3%), A. fumigatus (3%) and Penicillium (2%). In the month of August, Cladosporium was dominant with avg. monthly distribution (76%) followed by Rhizopus 97%), Penicillium (4%), Mucor (4%) and A. fumigatus (2%). Indira Gandhi Institute of Child Health: In this location major fungal species identified were Cladosporium (78.44%) followed by A. niger (6%), Mucor (3.08%), Rhizopus (2.76%) and A. ochraceus (1.7%). Fungal count was high in August (1204) followed by June (1144), July (1034) and least in May (935). In the month of May, Cladosporium was dominant with avg. monthly distribution (63%) followed by A. niger (16%), A. ochracious (4%), Mucor (3%) and Fusarium (3%). In the month of June, Cladosporium was dominant with avg. monthly distribution (84%) followed by A. niger (4%), Mucor (2%), Alternaria (2%) and Penicillium (1%). In the month of July, Cladosporium was dominant with avg. monthly distribution (79%) followed by A. niger (4%), Rhizopus (3%), A. fumigatus (3%) Airborne Fungal Spores Of Bangalore 38 Pavan et al., VIJNANABHARATHI, 1 (1): 36-43, 2016 and Mucor (2%). In the month of August, Cladosporium was dominant with avg. monthly distribution (85%0 followed by Rhizopus (3%), A. niger (2%), Trichoderma (2%) and Fusarium (1%). Graphite India Limited, Whitefield: In this location Cladosporium was the major fungi with (75.30%) followed by Rhizopus (4.99%), A. niger (4.3%), Fusarium (3.96%) and Penicillium (3.11%). Fungal count was high in June (1260) followed by July (1029), August (941) and least in May (479). In the month of May, Cladosporium was dominant with avg. monthly distribution 64% followed by A. niger (9%), Fusarium (7%), Rhizopus (5%) and Penicillium (5%). In the month of June, Cladosporium was dominant with avg. monthly distribution (78%) followed by Rhizopus (5%), A. niger (5%), Fusarium (3%) and Mucor (2%). In the month of July, Cladosporium was dominant with avg. monthly distribution (84%) followed by Rhizopus (6%), Mucor (4%), Fusarium (2%) and A. fumigatus (1%). In the month of August, Cladosporium was dominant with avg. monthly distribution (69%) followed by Penicillium (6%), A. niger (6%), Rhizopus (4%) and Alternaria (3%). KHB Industrial Area, Yelahanka: In this location Cladosporium was the major fungi with (81.69%) followed by Mucor (3.4%), Fusarium (3.39%), Rhizopus (3%) and Penicillium (2.1%). Fungal count was high in June (1449) followed by August (858), July (778) and least in May (532). In the month of May, Cladosporium was dominant with avg. monthly distribution (77%) followed by Rhizopus (6%), Mucor (4%), Penicillium (2%) and A. niger (2%0. In the month of June, Cladosporium was dominant with avg. monthly distribution (85%) followed by Rhizopus (3%), Mucor (2%), Penicillium (2%) and Alternaria (1%). In the month of July, Cladosporium was dominant with avg. monthly distribution (81%) followed by Mucor (5%), Fusarium (5%), Penicillium (3%) and A. niger (1%). In the month of August, Cladosporium was dominant with avg. monthly distribution (81%) followed by Fusarium (4%), Mucor (3%), Rhizopus (3%) and Alternaria (1%). Banasawadi Police Station: In this location major fungal species were Cladosporium (78.63%), Rhizopus (4.54%), A. niger (3.23%), Mucor (3.02%) Pencillium (3.02%) and Fusarium (2.42%). Maximum fungal count recorded in June (1131), followed by August (938), May (609), and least in July (795). In the month of May, Cladosporium showed maximum avg. monthly distribution (72%), followed by Rhizopus (8%), Penicillium (5%), A. niger (4%) and Alternaria (3%). In the month of June, Cladosporium showed maximum avg. monthly distribution (81%) followed by Rhizopus (5%), Fusarium (3%), A. niger (3%) and Mucor (2%). In the month of July, Cladosporium showed maximum avg. monthly distribution (74%) followed by Pencillium (6%), Rhizopus (5%), Mucor (4%) and A. niger (3%). In the month of August, Cladosporium showed maximum avg. monthly distribution (83%) followed by A. niger (3%), Mucor (3%), Fusarium (2%) and Penicillium (2%). Khaji Sonnanahalli, Hoskote Road: Dominant fungal species in this area were Cladosporium (78.38%), Rhizopus (5.82%), Mucor (2.85%), A. niger (2.74%) and Penicillium (2.63%). Fungal count was high in June (1012) followed by May (781), August (739) and least in July (658). In the month of May, Cladosporium was dominant with avg. monthly distribution (77%) followed by Rhizopus (6%), A. niger (4%), Penicillium (4%) and Fusarium (3%). In the month of June, Cladosporium was dominant with avg. monthly distribution (84%) followed by Rhizopus (4%), Alternaria (3%), Mucor (3%) and Penicillium (2%). In the month of July, Cladosporium was dominant with avg. monthly distribution (78%) followed by Mucor (7%), Rhizopus (3%), Fusarium (3%) and A. fumigatus (2%). In the month of August, Cladosporium was dominant with avg. monthly distribution (73%) followed by Rhizopus (10%), A. niger (6%), Penicillium (2%) and Alternaria (1%). Airborne Fungal Spores Of Bangalore 39 Pavan et al., VIJNANABHARATHI, 1 (1): 36-43, 2016 Central Silk Board, Hosur Road: Dominant fungal species in this area were Cladosporium (78.81%), Penicillium (3.30%), Mucor (3.02%), A. niger (2.83%) and Rhizopus (2.63%). Fungal count was high in June (1054) followed by August (1050), July (942) and least in May (665). In the month of May, Cladosporium was dominant with avg. monthly distribution (72%) followed by Rhizopus (6%), A. niger (5%), Penicillium (4%) and Mucor (3%). In the month of June, Cladosporium was dominant with avg. monthly distribution (85%) followed by Mucor (4%), Rhizopus (2%), Penicillium (2%) and Fusarium (2%). In the month of July, Cladosporium was dominant with avg. monthly distribution (81%) followed by Rhizopus (4%), Fusarium (3%), Mucor (3%) and Alternaria (2%). In the month of August, Cladosporium was dominant with avg. monthly distribution (79%) followed by Penicillium (6%), A. niger (4%), Fusarium 93%) and Rhizopus (1%). DISCUSSION In the present study, Alternaria, Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aspergillus ochraceus, Aspergillus terreus, Cladosporium, Curvularia, Fusarium, Helminthosporium, Mucor, Neurospora, Nigrospora, Pencillium, Rhizopus, Sporulariosis Candida and Trichoderma were observed from outdoor environment of Bangalore. Fungal entities are common in outdoor environment, and approximately 10% of global persons have fungal allergy (Burge, 2001). Report also advocates that >6.5 million people have severe asthma with fungal sensitizations (SAFS), nearly 50% of mature asthmatics appearing secondary care have fungal sensitization, and an estimated 4.8 million adults have allergic bronchopulmonary aspergillosis. Researcher believed that, more than 80 genera of fungi are associated with symptoms of respiratory tract allergies (Horner et al., 1995). Among the sampling stations (Table 1), Jnana Bharathi Campus showed highest fungal count (8828), following Indira Gandhi Institute of Child Health (8638), International machine tools (7914), Graphite India ltd, Whitefield (7421), Central silk board (7420), KHB Industrial area, Yelahanka (7232), Banasawadi Police station (6944), RV College (6672), Khaji Sonnanahalli (6377) and Victoria road (5826). The important atmospheric airborne fungal spore counts in outdoor and indoor air vary and depend on various environmental and other factors. The main reason for variation of the fungal counts was due to the strength and availability of organic matter, as Jnana Bharathi campus is an open area and covered by plants and trees. In such large amount of decay and decomposition of leaves which induces the survival of fungi and their dispersal in to the air. In Indira Gandhi Institute of child health the main source was the improper disposal of waste generated by hospital. Victoria road had less count due to less availability of organic matter In all the locations dominant fungal species were Cladosporium (78.60%), Rhizopus (3.83%), A. niger (3.82%), Mucor (2.47%) and Rhizopus (2.63%). It was clear that Cladosporium, Pencillium, Mucor, Fusarium A.niger, Rhizopus, Alternaria and A. fumigatus were ubiquitous and their dominance in other parts of the world has been well documented. Numerous studies have shown that exposure to fungi may be associated with acute toxic effects, allergies and asthma (Bush and Portnoy, 2001). Over 100 species of fungi were involved with serious human and animal infections, whereas many other species caused serious plant diseases (Cvetnic and Pepeljnjak, 1997). The result of correlation analysis, reveals that there is a strong negative correlation between fungi and daily average temperature i.e. with decrease in temperature there is increase in fungal count (Table 2). There is a positive correlation between fungal count and relative humidity i.e. with increase in humidity the fungal count increases and there is a positive correlation between fungal count and rainfall i.e. with increase in rainfall the fungal count increases due to increased moisture content in air. Airborne Fungal Spores Of Bangalore 40 Pavan et al., VIJNANABHARATHI, 1 (1): 36-43, 2016 Table 1: Airborne fungal spores of all site samples collected from May 2013 to August 2013 Table 2: Karl Pearson Correlation coefficient for meteorological data and total fungal count Fungal Species Average Temperature Relative Humidity Rainfall Correlation coefficient -0.605 0.799* 0.257 *Correlation is significant at the 0.05 level (2-tailed); **Correlation is significant at the 0.01 level (2-tailed) The Correlation between individual fungal species and meteorological parameters, it is clear that not all the fungal species showed definite relationship with meteorological parameters only few of them showed. A. fumigatus, Cladosporium, Fusarium, Mucor, Neurospora, Nigrospora, Rhizopus and Trichoderma showed negative relationship with daily average temperature (Table 3). Whereas, Alternaria, A. flavus, A. niger and Penicillium showed positive relationship with daily average temperature. Alternaria, A. fumigatus, A.flavus and A. niger showed negative relationship with daily average relative humidity. Whereas, the Cladosporium, Mucor, Neurospora, Nigrospora, Penicillium and Rhizopus showed positive relationship with daily average relative humidity. A.flavus, Mucor, Penicillium, and Rhizopus showed negative relationship with daily average Rainfall. Alternaria, A. fumigatus, A. niger, Cladosporium and Fusarium showed positive relationship with daily average Rainfall. At present there are numerous studies highlighting seasonal variations in both outdoor and indoor environments, especially in buildings frequented by a large number of people, who may be exposed to this type of aeroallergen (Black et al., 2000; Meriggi et al., 1996 & Lim et al., 1998) and many authors indicated that the dominant fungi were Cladosporium, Alternaria, Penicillium and Aspergillus in the atmosphere and their concentration differed from place to place, because of local environmental variables, fungal substrates and human activities. Airborne Fungal Spores Of Bangalore 41 Pavan et al., VIJNANABHARATHI, 1 (1): 36-43, 2016 Table 3: Karl Pearson Correlation coefficient for meteorological data and fungal species Sl. Average Relative Genera and Species Rainfall No Temperature Humidity 1 Alternaria 0.412 -0.407 0.453 2 A. flavus 0.872** -0.629 -0.707* 3 A. fumigatus -0.199 -0.116 0.173 4 A. niger 0.980** -0.880* 0.144 5 A. ochracious 0.396 -0.452 -0.461 6 A. terrus 0.516 -0.588 0.560 7 Cladosporium -0.623 0.798* 0.235 8 Curvularia 0.165 0.303 0.279 9 Fusarium -0.428 0.312 0.259 10 Helmenthosporium 0.282 0.112 0.431 11 Mucor -0.829* 0.789* -0.506 12 Neurospora -0.464 0.134 0.167 13 Nigrospora -0.577 0.384 -0.227 14 Penicillium 0.206 0.010 -0.156 15 Rhizopus -0.320 0.320 -0.396 16 S. candida 0.001 0.286 0.575 17 Trichoderma -0.572 0.648 0.290 *Correlation is significant at the 0.05 level (2-tailed); **Correlation is significant at the 0.01 level (2-tailed) Reponen et al., (1996) reported that the deposition of fungal spores in lungs and their effects on human healthy not only depended on their composition and concentration but also size. The manifestation of a fungal allergy ranges from the common conjunctivitis, rhinitis and rhinoconjunctivitis to the more detrimental in ascending order of severity, i.e., sinusitis, asthma, bronchopulmonary mycoses, hypersensitivity pneumonitis and allergic alveolitis (Fink, 1998). From the studies it is clear that all the major fungi observed were potential allergens and some even pathogenic to human, plants and animals. The fungi spores can be main reason for allergy and bronchial problems in urban environments. CONCLUSION Aeromycological characteristics of outdoor are the largest in quantity, variety and importance to the urban environment. The present study was carried out using cultural method, which is dependent on the cultivability of the spores trapped and collection efficiency of the instrument used also the present method employed was discontinuous. Potential allergens include active spores, broken mycelial fragments and metabolites, which could be a valuable data for successful treatment of allergic diseases. Hence it is recommended to carryout continuous sampling method and evolves a method which can enumerate both culturable and nonculturable microorganisms with microbial fragments that could mimic the human respiratory system to maximum extent. ACKNOWLEDGEMENT This study was supported by Department of Microbiology and Biotechnology, Bangalore University, Bangalore-56, India. Airborne Fungal Spores Of Bangalore 42 Pavan et al., VIJNANABHARATHI, 1 (1): 36-43, 2016 REFERENCES 1. Andersen, A. A., (1958). New sampler for collection, sizing and enumeration of viable airborne particles. Journal of Bacteriology. 76: 471-484. 2. Black, P. N., Uday, A. A., & Brodie, S. M. (2000). Sensivity to fungal allergens is a risk factor for life-threatening asthma. Allergy 55(5): 501- 504. 3. Burge, H. A. (2001). Fungi: toxic killers or unavoidable nuisances. Annals of Allergy, Asthma and Immunology. 87(6), 52–56. 4. Bush, R. K., & Portnoy, J. M. (2001). The role and abatement of fungal allergens in allergic disease. Journal of Allergy and Clinical Immunology. 107(3):S430–S440. 5. Cvetnic, Z., & Pepeljnjak, S. 1997. Distribution and mycotoxin-producing ability of some fungal isolates from the air. Atmospheric Environment. 31: 491–5. 6. Di Giorgio, C., Krempff A., Guiraud H., Binder P., Tiret C., & Dumen˙ıl G. (1996). Atmospheric pollution by airborne microorganisms in the city of Marseilles. Atmos Environ 30(1). 155–160. 7. Douwes J., Thorne P., Pearce N., & Heederik D. (2003). Bioaerosol health effect and exposure assessment progress and prospects. British Occupational Hygiene Society, 47(3):187–200. 8. Eduard, W. (2009). Fungal spores: A critical review of the toxicological and epidemiological evidence as a basis for occupational exposure limits setting. Critical Review Toxicology 39(10):799-864. 9. Fink, J. N. (1998). Fungal allergy from asthma to alveolitis. Indoor air. International Journal of Indoor Air Quality and Climate Supplement, 50-55. 10. Gherbawy, Y., & Voigt, K. (2010). Molecular identification of fungi. Springer-Verlag Berlin, Germany. 11. Horner, W. E., Helbling, A., Salvaggio, J. E., &. Lehrer, S. B. (1995). Fungal Allergens. Clin. Microbiol. Rev., 8: 161–79. 12. Lacey, M. E., & West, J. S. (2006). The Air Spora: A manual for catching and identifying airborne biological particles. Springer. The Netherlands. 13. Lee, T., Grinshpun, S. A, Martuzevicius, D., Adhikari, A., Crawford, C. M., & Reponen, T. (2006). Culturability and concentration of indoor and outdoor airborne fungi in six single-family homes. Atmos Environ., 40(16): 2902–2910. 14. Lighthart, B. (2000). Mini-review of the concentration variation found in the alfresco atmospheric bacterial populations. Aerobiologia, 16: 7-16. 15. Lim, S. H., Chew, F. T., Mohd Dali, S. D.B., Tan, H. T. W., Lee, B. W., & Tan, T. K. (1998). Outdoor airborne fungal spores in Singapore. Grana 37: 246-252. 16. Meriggi, A., Ricci, S., Bruni, M., & Corsico, R. (1996) Aerobiological monitoring for fungal spores in a rehabilitation hospital in northern Italy. -Aerobiologia 12: 233-237. 17. O’Gorman, C. M. 2011. Airborne Aspergillus fumigatus conidia: a risk factor for aspergillosis. Fungal Biology Reviews 25:151- 157. 18. Reponen, T., Grishpun, S., Reponen A., & Ulevicius, V. (1996) Characteristics of exposure to fungal spores in indoor air. American Ind. Hyg. Assoc. J., 57: 279–84. 19. Ruzer L. S., & Harley N.H. (2005). Aerosols Handbook: Measurement, Dosimetry, and Health Effects, CRC Press, Florida, USA. 20. Takahashi, T. (1997). Airborne fungal colony-forming units in outdoor and indoor environments in Yokohama, Japan. Mycopathology. 139(1), 23–33. 21. Zhao, X., & Yang Z. (2007). Explore the relation to air fungi concentration between office buildings and sick buildings. Modern Medicine and Public Health, 23: 1409-1411. Airborne Fungal Spores Of Bangalore 43 Pavan et al., VIJNANABHARATHI-A frontier journal in SCIENCE IMPACT OF MUD PUDDLING ON REPRODUCTIVE SUCCESS OF Vol. 1 | No.1 | 44-48 | TALICADA NYSEUS L. (LEPIDOPTERA: LYCAENIDAE) HARBORING March | 2016 WOLBACHIA INFECTION Kunal Ankola and Puttaraju H.P.* Department of Life Science Bangalore University, Bangalore-56, India. ABSTRACT: ISSN : 0971-6882 ISSN-L : 0377-8487 Puddling is an essential phenomenon exhibited by butterflies (imago) and have a significant CODEN : VBHAD6 role in their reproductive life. Puddling on various sources enable butterflies to gain mineral nutrition, which further helps them in their flight, oviposition and egg production. Till date, the importance of puddling is thoroughly studied in several butterfly species however limited information is available regarding the same with respect to small non migratory butterflies. In Corresponding author: the present study we investigated the impact of mud puddling on the reproductive success of PUTTARAJU H.P. Talicada nyseus which harbors Wolbachia and shows female biased sex ratio. The outcomes Dept of Life Science, revealed that the reproductive success of Talicada nyseus is independent of their puddling Bangalore University, Bangalore-560 056, activity with unaffected fecundity and longevity. This is in favor of Talicada nyseus infected Karnataka, India with Wolbachia. However direct correlation of Wolbachia with mud puddling behavior of [email protected] Talicada nyseus needs further investigation. This article is to be cited as: Kunal Ankola & Puttaraju H.P. Impact of mud puddling on reproductive success of Talicada nyseus L. (Lepidoptera: Lycaenidae) harboring Wolbachia infection; Vijnanabharathi, 1 (1):44-48, 2016. INTRODUCTION Key words: Talicada nyseus, The reproductive success of butterflies is regulated by two important parameters viz. adult Mud Puddling, feeding and mud puddling. Mud puddling is an important and unique behavior observed in Fecundity, Hatchability, butterflies and moths. Lepidopteran gather around wet clay or sands, edges of streams, carrion Longevity. and excreta to suck the dissolved nutrients present them (Adler, 1982; Beck, et al., 1999; Boggs & Jackson, 1991). Mud puddling is mainly carried out to gain essential minerals such as sodium (Beck, et al., 1999) or calcium phosphate (Lai-Fook, 1991) and proteins (Boggs & Dau, 2004). Received on: During mating, the mineral nutrients acquired by males are transferred to females through 22 january 2016 spermatophores (Sculley & Boggs, 1996; Molleman, et al., 2005; Boggs & Jackson, 1991). This Accepted on: 12 February 2016 further facilitate the reproductive success of the females in several means (Boggs & Jackson, 1991; Pivnick & McNeil, 1987; Adler & Pearson, 1982). Moreover, sodium supports the neuromuscular events in both males and females during their flight (Molleman, et al., 2005). The mud puddling activity in imago is the response to the limited availability of sodium during their developmental stages. The presence of sodium and other minerals is limited in both foliage of host plants as well as in nectar. Generally, puddling is done by both male and female ©2016 Vijnanabharathi imago (Boggs & Jackson, 1991), however it is much more predominant in young males than old All rights reserved males and female (Adler, 1982; Adler & Pearson, 1982; Boggs & Jackson, 1991; Sculley & Boggs, 1996). 44 44 VIJNANABHARATHI, 1 (1): 44-48, 2016 Talicada nyseus G. (Lepidoptera:Lycaenidae) is a common butterfly found in India and Sri Lanka (Karunaratne, et al., 2002). Like any other butterflies, Talicada nyseus feeds on nectar but also known to feed on lichens (Karunaratne, et al., 2002). Recent studies revealed that the butterfly harboring an endosymbiotic α- proteobactreia, Wolbachia (Ankola, et al., 2011; Salunke, et al., 2012) and shows female biased sex ratio (Ankola, et al., 2011). The biased sex ratio is expected to be due to Wolbachia induced feminization (Rousset, et al., 1992; Hiroki, et al., 2002) or male-killing (Fialho & Stevens, 1997; Fialho & Stevens, 2000; Hurst, et al., 1999; Hurst & Jiggins, 2000). In both the cases, the biased sex ratio influencing the reproductive success of this butterfly by reducing the male population. On the contrary, Talicada nyseus is a small butterfly with less flying ability and hence always found near their host plant. It is obvious that the butterfly will experience the scarcity of nutrition which will further influence on their reproductive success. In addition, a very limited information is available on the puddling activity and its role in the life history of this butterfly. On this rationale, the present study was conducted to investigate the role of mud puddling on reproductive success of Wolbachia infected population of Talicada nyseus. MATERIALS AND METHODS The imagos were collected from the Butterfly Park, Bannerughatta Biological Park Bangalore India and transferred to the Insectaria, Division of Biological Sciences, Bangalore University. Adult butterflies were transferred to a butterfly rearing cage which further maintained as stock population cage. The butterflies were allowed to reproduce in the stock population cage and the eggs were separately reared in the aerated box. The young larvae were fed with fresh leaves of their host plants and maintained in the aerated boxes till it metamorphoses into pupae to adult. Experimental setup: Two experimental setup viz. HPEX01 and HPEX02 were created to study the influence of mud puddling on the reproductive success of Talicada nyseus. Newly eclosed imago were used for the experiments. The butterflies in both HPEX01 and HPEX02 were allowed to reproduce and compete their lifecycle with and without mud puddling respectively. Both the experimental setups were maintained at 27.14 ± 1.360C and provided with a host plant and 10% sucrose solution in the cotton pad. The data regarding the fecundity, hatchability and adult longevity were collected and were analyzed through one way ANOVA 7.5. RESULTS AND DISCUSSION Although, being one of the essential phenomenon in butterflies, Talicada nyseus shows less affinity towards puddling activity. In butterflies, mud puddling is evolved as a family and species specific behavior (Boggs & Dau, 2004). The necessity and availability of adult nutrition directly influence on the performance of mud puddling. During puddling, the priority is often given to inorganic mineral ions however there are few instances where butterflies prefer protein (Boggs & Dau, 2004; Beck, et al., 1999). The mineral ions (especially sodium) plays a vital role in the neuromuscular events and hence assist the butterflies in their flight. Since Talicada nyseus is a small butterfly with less flying ability, they involve less in the puddling activity. Both male and female Talicada nyseus are actively involved in the puddling activity. In most of the families, puddling behavior is predominantly observed in males than in females (Molleman, et al., 2005). The mineral nutrients gained by males during puddling are transported to female through spermatophores as a “nuptial gift” (Molleman, et al., 2005). Females further utilize these mineral nutrients for several activities associated with reproduction like ovipositioning. Impact of mud puddling ….. Talicada nyseus 45 Kunal and Puttaraju VIJNANABHARATHI, 1 (1): 44-48, 2016 The fecundity (Table 1a), hatchability (Table 1b) and adult longevity (Figure 1) of Talicada nyseus is independent of their puddling activity. The minerals and other nutrition gained through mud puddling (or as nuptial gift) by females helps them in the production of eggs (Boggs & Jackson, 1991; Pivnick & McNeil, 1987; Adler & Pearson, 1982). The unaffected fecundity of Talicada nyseus in both the experimental setup eliminate the possibility of interference of puddling in egg production. Table 1: Influence of mud puddling on reproductive success of the butterfly Talicada nyseus: The mud puddling has no influence on the (a) fecundity and (b) hatchability of Talicada nyseus. The mating pairs of experimental setup HPEX01 were given mud puddling source whereas HPEX02 were devoid of mud puddling. (a) Experimental Setups HPEX01 HPEX02 Mating pairs 07 06 Wolbachia infection Status + + Fecundity 72.714 ± 10.90 71.166 ± 11.51 F value 0.057* 0.057* Df Between groups 1 1 Within groups 11 11 (b) Experimental Setups HPEX01 HPEX02 Mating pairs 07 06 Wolbachia infection Status + + Hatchability 69.571± 9.09 67.333± 10.40 F value 0.157* 0.157* Df Between groups 1 1 Within groups 11 11 *. The mean differences are not significant at 0.05 (P>0.05). Figure 1: No significant variation has been observed in the longevity of both male and female T. nyseus with and without mud puddling. The male longevity is less than the female in the respective experimental setups Impact of mud puddling ….. Talicada nyseus 46 Kunal and Puttaraju VIJNANABHARATHI, 1 (1): 44-48, 2016 It is also worth notice that the members of family Lycaenidae prefers protein resources more during puddling (Beck, et al., 1999). They use olfactory signals released by the decaying organic matters to search nitrogenous resources. Like sodium, these nitrogenous sources also help to increase the reproductive success of the butterflies (Beck, et al., 1999). The negligible impact of puddling on Talicada nyseus also reveals poor influence of nitrogenous source on the reproductive success of this butterfly. However, the response of Talicada nyseus towards puddling source contain specific nitrogen compound is not verified in the present study. Nevertheless, the nitrogenous source might act as supplementary entity which increases the reproductive performance in this butterfly, but not necessarily. Further, the unaffected fecundity and hatchability of Talicada nyseus is may be due to Wolbachia infection. Wolbachia is an endosymbiontic bacteria, known to enhance fecundity in their insect hosts (Dedeine, et al., 2001). This is to compensate the effect of reproductive anomalies caused by Wolbachia. Enhancing the fecundity is beneficial for both host and its endosymbiont to survive in their natural habitat. The adult longevity of Talicada nyseus is also found to be independent of their puddling activity. The adult longevity is another factor which determines the reproductive success of the butterflies. The life time fecundity of females and mating success of males are regulated by their longevity. The male longevity plays a crucial role in those butterflies where Wolbachia induced female biased sex ratio is predominant. Talicada nyseus infected with Wolbachia (super group B) and shows female biased sex ratio (Ankola, et al., 2011). The sex ratio distortion in this butterfly is might be due to Wolbachia infection. However, it is still unclear that the biased sex ratio is whether because of male-killing or feminization. However, the fecundity and hatchability data provide few clues which strengthen the probability of feminization. The presence of female biased sex ratio reduces the male population and hence increase the competition among the females to mate with existing males. This facilitate the existing males to mate with females several times and hence fertilize more number of eggs. This interns become a real challenge to the mating success of individual males and is depend on their longevity. Conversely nitrogenous sources like amino acids can increase the longevity and reproductive success of the butterflies (Gilbert, 1972). Generally, the amino acid is the dietary entity but is also supplemented by puddling in butterflies. Sucrose was the only food source used in the present investigation and hence the only probability of getting amino acid was through mud puddling. However, it is very unlikely that the puddling source used for the present experiment could have any amino acid content in them. These outcomes clear that the reproductive biology of Talicada nyseus is independent of mud puddling. However, the association of Wolbachia induced anomalies with mud puddling in this butterfly needs further investigation REFERENCES 1. Adler, P.H. (1982). Soil and Puddle-visiting habitat of moths. Journal of the Lepidopteran Society. 36, 161-173. 2. Adler, P.H., & Pearson, D.L. (1982). Why do male butterflies visit mud puddles? Canadian Journal of Zoology. 60, 322-325. 3. Ankola, K., Brueckner, D., & Puttaraju, H.P. (2011). Wolbachia endosymbiont infection in two Indian butterflies and female- biased sex ratio in the Red Pierrot, Talicada nyseus. Journal of Bioscience. 36(5), 845-850. 4. Beck, J., Muhlenberg, E., & Fiedler, K. (1999). Mud-puddling behavior in tropical butterflies: in search of proteins or mineral? Oecologia. 119:140-148. 5. Boggs, C.L., & Jackson, L.A. (1991). Mud puddling by butterflies is not a simple matter. Ecological Entomology. 16, 123-127. 6. Boggs, C.L., & Dau, B. (2004). Resource Specialization in Puddling Lepidoptera. Environmental Entomology. 33 (4),1020-1024. Impact of mud puddling ….. Talicada nyseus 47 Kunal and Puttaraju VIJNANABHARATHI, 1 (1): 44-48, 2016 7. Dedeine, F., Vavre, F., Fleury, F., Loppin, B., Hochberg, M., & Bouletreau, M. (2001). Removing symbiotic Wolbachia bacteria specifically inhibit oogenesis in a parasitic wasp. Proceedings of the National Academy of Sciences USA. 98, 6247-6252. 8. Fialho, R.F., & Stevens, L. (1997). Molecular evidence for single Wolbachia infections among geographic strains of the flour beetle Tribolium confusum. Proceeding of the Royal Society London B Biological Science. 264,1065–1068 9. Fialho, R.F., & Stevens, L. (2000). Male-killing Wolbachia in a flour beetle. Proceeding of the Royal Society London B Biological Science. 267, 1469–1474 10. Gilbert, L.E. (1972). Pollen feeding and reproductive biology of Heliconius butterflies. Proceedings of the National Academy of Sciences USA. 69,1403-1407. 11. Hiroki, M., Kato, Y., Kamito, T., & Miura, K. (2002). Feminization of genetic males by a symbiotic bacterium in a butterfly, Eurema hecabe (Lepidoptera: Pieridae). Naturwissenschaften. 89,167–170. 12. Hurst, G.D.D., Jiggins, F.M., Von der Schulenburg, J.H.G., Bertrand, D., West, S.A., Goriacheva, I.I., Zakhrov, I.A., Werren, J.H., Stouthamer, R., & Majerus, M.E.N. (1999). Male-killing Wolbachia in two species of insect. Proceeding of the Royal Society London B Biological Science. 266,735–740. 13. Hurst, G.D.D., & Jiggins, F.M. (2000). Male-killing bacteria in insects: mechanisms, incidence, and implications. Emerging Infectious Diseases. 6, 329–336. 14. Karunaratne, V., Bombuwela, K., Kathirgamanathar, S., Kumar, V., Nedra Karunaratne, D., Ranawana, K.B., Wijesundara, D.S.A., Weerasooriya, A., & De Silva, E.D. 2002. An association between the butterfly Talicada nyseus and the lichen Leproloma sipmanianum as evidenced from chemical studies. Current Science. 83, 741-745. 15. Lai-Fook, J. (1991). Absorption of phosphorus from the sperm-atophore through the cuticule of the bursa copularix of the butterfly, Calpodes ethlius. Tissue Cell. 23, 247-259. 16. Molleman, F., Grunsven, R.H.A., Liefting, M., Zwaan, B.J., & Brakefield, P.M. (2005). Is male puddling behaviour of tropical butterflies targeted at sodium for nuptial gifts or activity? Biological Journal of the Linnean Society. 86(3), 345–361. 17. Pivnick, K.A., & McNeil, J.N. (1987). Puddling in Butterflies: Sodium affects reproductive success in Thymelicus lineola. Physiological Entomology. 12, 461-472. 18. Rousset, F., Bouchon, D., Pintureau, B., Juchault, P., & Solignac, M. (1992). Wolbachia endosymbionts responsible for various alterations of sexuality in arthropods. Proceeding of the Royal Society London B Biological Science. 250, 91– 98. 19. Salunke, B.K., Salunkhe, R.C., Dhotre, D.P., Walujkar, S.A., Khandagale, A.B., Chaudhari, R., Chandode, R.K., Ghate, H.V., Patole, M.S., Werren, J.H., & Shouche, Y.S. (2012). Determination of Wolbachia diversity in butterflies from Western Ghats, India, by a Multigene approach. Applied and environmental microbiology. 4458-4467. 20. Sculley, C.E., & Boggs, C.L. (1996). Mating systems and sexual division of foraging effort affect puddling behaviour by butterflies. Ecological Entomology. 21 (2), 193–197. Impact of mud puddling ….. Talicada nyseus 48 Kunal and Puttaraju VIJNANABHARATHI-A frontier journal in SCIENCE EVALUATION OF ENDOPHYTIC FUNGAL SPP. FOR BIODIESEL Vol. 1 | No.1 | 49-57 | PRODUCTION March | 2016 Ravi kumar K, B.R. Mrunalini and S.T. Girisha* Department of Microbiology and Biotechnology, Bangalore University, Bangalore-56, India. ABSTRACT: ISSN : 0971-6882 Due to the environmental concern and limited resources of fossil fuel, the demand for ISSN-L : 0377-8487 CODEN : VBHAD6 biodiesel has increased. Production of biodiesel using microorganisms has been considered as a promising alternative for biodiesel production. In the present study, Aspergillus spp. Penicillium spp. Alternaria spp. Colletotrichum spp. Cladosporium spp. Bipolaris spp. Fusarium spp. Mycelia sterilia were isolated from Jatropha plant parts. About 20 percent of Aspergillus species were noticed among the fungal population.The isolated fungal lipids were screened Corresponding author: qualitatively by Sudan black B staining and quantitatively by various lipid extraction methods GIRISHA. S.T. such as Folch method, Bligh and Dyer method, Isopropanol: hexane extraction, Soxhlet Dept of Microbiology and Biotechnology, extraction. The efficient lipid producing fungal isolate JGK – 12 was identified as Aspergillus Bangalore University, niger based on the 18s rDNA sequencing, with sequence similarity of 100% in phylogeny as Bangalore-560 056, compared with other Aspergillus counterparts, yielding 257.8±9.59 mg of lipid per gram of dry Karnataka, India [email protected] fungal biomass by Folch method. This article is to be cited as: Ravi kumar K, B.R. Mrunalini and S.T. Girisha. Evaluation of endophytic fungal spp. for Biodiesel production; Vijnanabharathi, 1 (1): 49-57, 2016. Key words: INTRODUCTION Jatropha, Aspergillus, Continued use of petroleum sourced fuels is now widely recognized as unsustainable because Sudan Black B, Lipids, of depleting supplies and the contribution of these fuels to the green house effect.Due to Biodiesel population growth and industrialization, the demand for energy has increased rapidly in recent years, and the world energy consumption is projected to increase by 49% from 2007 to 2035 (http://www.eia.doe.gov/oiaf/ieo/highlights.html). Renewable, carbon neutral, transport fuels are necessary for environmental and economic sustainability. Biodiesel derived from oil seeds is a potential renewable and carbon neutral alternative to petroleum fuels. Unfortunately, biodiesel Received on: 22 January 2016 from oil crops, waste cooking oil and animal fat cannot realistically satisfy even a small fraction Accepted on: of the existing demand for transport fuels. 9 February 2016 Oil obtained from microorganisms has been considered as single cell oil (SCO) because it synthesizes the oils with high purification and is less expensive than agricultural and animal sources (Certik and Shimizu, 1999; Cohen and Ratledge, 2005). Lipid producing organisms have been known for many years. Oleaginous microorganisms are defined as organisms that contain more than 20 to 25% of their dry biomass in the form of lipids (Ratledge, 1988, Dyal and Narine, 2005).When organisms are grown in N2 limitation medium, beyond 70% oil accumulation is observed in oleaginous fungus whereas non-oleaginous fungus do not accumulate lipid. An Active lipid synthesizing apparatus makes oleaginous microorganism attractive oil source with high growth rate on wide varieties of substrates including various waste substrates. 44 49 VIJNANABHARATHI, 1 (1): 49-57, 2016 The ability to accumulate high amounts of lipid depend mostly on the regulation of the biosynthetic pathway, supply of the precursors (Acetyl co A, MalonylcoA and Glycerol -3-phosphate) and the cofactor (NADPH). Yeasts and fungi (especially molds) are considered as favorable oleaginous microorganisms since 1980s (Abraham and Srinivasan, 1984). A filamentous fungus – Mortierella alliacea Strain YN-15, accumulated arachidonic acid (AA, C20:4n-6) mainly in the form of triglyceride in its mycelia.Use of Sudan Black B for staining and direct observation under the microscope enables the rapid observation of qualitative status of lipid production in the cells, change in color of stain from dark to light blue observed during the course of fermentation has been found to be related to a change in extent of unsaturation of lipids (Thakur et al., 1988).. MATERIALS AND METHODS Collection of plant samples Jatropha curcas, non-edible oil seed plant was collected from Gandhi Krishi Vignana Kendra, University of Agricultural Science, Bangalore for isolating oleaginous fungi. Isolation of fungal spp. Different aerial parts of fresh healthy plant samples were cut into small pieces (5mm × 2mm) using a sterile blade, the smaller pieces are surface sterilized by exposing them to 4 % sodium hypochlorite solution for 90s followed by 70% ethanol for 5s and thoroughly washed with distilled water (Suryanarayanan and Thennarasan, 2004). The surface sterilized samples are placed on Potato Dextrose Agar. After incubation at 30°C for 7 to 14 days, purity of the cultures was determined by colony morphology (Suthepwiyakrutta et al., 2004). These isolates were used for further research work and pure cultures of Mortierella alpina (MTCC no.6344) and Mortierella hyalina (MTCC no.6301) were procured from Microbial Type Culture Centre (MTCC) Chandigarh for comparitive studies. Identification of fungal spp. The filamentous fungal isolates were identified in the laboratory by morphological studies. Identification was based on macroscopic observation of the colonies and examination of the micro structural characteristics using universal identification keys for fungi (Klich, 2002; Gilman, 1998; Barnet and Hunter,1988). Identified isolates were maintained on PDA slants and stored at 4ºC, sub-culturing was carried out every fortnight throughout this study. Screening for lipid production by Sudan black B staining method Selected fungal strains were stained with Sudan black B as described by Burdon et al., (1946) and Thakur et al., (1989). Presence of blue or grayish oil globules within the mycelium were observed under oil immersion microscope. Extraction of total lipids Four different methods were followed, (1) Folch method (2) Bligh and Dyer method (3) Isopropanol: hexane extraction (4) Soxhlet extraction. One gram of dried fungal mycelial mat was taken for lipid extraction in each method. Folch method Fungal lipid was extracted with 3 ml of chloroform: methanol (2:1,v/v) (Folch et al., 1957) by vortexing (1 min) and centrifugation at 2000rpm for 15 min at room temperature, supernatants were collected and Endophytic fungal spp. for Biodiesel 50 Ravi Kumar and Girish VIJNANABHARATHI, 1 (1): 49-57, 2016 residues re extracted thrice. The lower organic phases were collected and evaporated to dryness under nitrogen and total lipid content was determined gravimetrically. Bligh and Dyer method Lipids were extracted with 3ml of chloroform: methanol (1:2, v/v) (Bligh and Dyer, 1959) by vortexing and centrifugation as described for previous method. Lower organic phases were collected after centrifugation at 2000rpm for 5 min. at room temperature, evaporated to dryness under nitrogen and total lipid contents were determined gravimetrically. Isopropanol: hexane extraction The dry biomass was extracted for total lipids in Isopropanol: hexane (3:1) mixture (Somashekar et al., 2002). Soxhlet extraction Hexane was used as the solvent for the extraction of total lipid; the dried fungal biomass was fixed in soxhlet apparatus, run for six hours at 65⁰C. The extracted lipid in the organic solvent was dried in rotary evaporator at 600C (Somashekar et al., 2002). Characterization of oleaginous fungus Genomic DNA of fungal isolate was extracted according to the method of Moller et al., (1992). Partial region of small subunit (SSU) of rDNA was amplified by PCR using universal fungal primers,ITS1:5’- TCCGTAGGTGAACCTGCGG-3’,ITS4:5’- TCCTCCGCTTATTGATATGC3’ (White et al., 1990). The 18s sequence obtained was aligned using BLAST algorithm to find matches within the non-redundant database at NCBI (National Centre for Biotechnology Information; http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Zheng et al., 2000). Sequence data were submitted to Gen Bank through submission tool BankIt of NCBI. Scanning Electron Microscopy Scanning electron microscopy analysis was carried out at the central instrumentation facility of Indian Institute of Science, Bengaluru to study the microscopic characteristics under Stereoscan 440, LEO/Leica, Cambridge, UK as per Partha and Natarajan, 2008. Statistical analysis Data obtained from three independent analysis was expressed as mean Standard deviation. Experimental data was subjected to analysis of variance and Duncan’s multiple range test (p <0.05) using the Statistical Analysis System (Duncan’s, 1965).. RESULTS Enumeration of fungal spp. In the present study, a total of 46 different endophytic fungal species associated with stem, leaf and seeds parts of Jathropa curcas were isolated (Figure 1.1). The isolated fungi were identified as Aspergillus spp., Penicillium spp., Alternaria spp., Colletotrichum spp., Cladosporium spp., Bipolaris spp., Fusarium spp. and Mycelia sterilia isolates. Whereas, Ihejirika et al., (2014) have isolated Fusarium oxysporum, Septoria apii, Rhizoctonia spp. and Aspergillus spp. from seeds and leaves of J. curcas, Susheel and Nutan, (2013) have also reported endophytic fungi in the leaves of Jatropha curcas, which were identified as Colletotrichum truncatum, Nigrospora oryzae, Fusarium proliferatum, Guignardia cammillae, Alternaria destruens and Chaetomium spp. Endophytic fungal spp. for Biodiesel 51 Ravi Kumar and Girish VIJNANABHARATHI, 1 (1): 49-57, 2016 In our study the isolates were coded as JGK (J: Jatropha, GK: GKVK, Bangalore) and numbered from 1 to 46 respectively. Figure 1.1: Endophytic fungal isolates from Jatropha curcas Qualitative screening of fungal spp. by Sudan black B staining method The lipids were found to be accumulated in cell membrane and intracellularly as well. Among the 46 fungal isolates, 19 fungal isolates were found to be accumulating significantly higher lipids. The results revealed that, the isolates JGK – 1, 2, 5, 7, 11,12, 13, 14, 15,17, 23, 24, 29,30, 39, 40, 46, MTCC 6344 and MTCC 6301 were deeply stained, which indicates the occurrence of more number of lipid globules, followed by JGK - 6, 16 and 22 which were moderately stained corresponding to lesser lipid globules. The remaining isolates, JGK – 3, 4, 8, 9, 10, 18, 19, 20, 21, 25, 26, 27, 28, 31, 32, 33, 34, 35, 36, 37, 38, 41, 42, 43, 44 and 45 were found to be poorly stained, depicting their lesser accumulation of lipid globules. The staining results are well in agreement with Thakur et al., 1989 and Mamatha, (2009), having applied similar methodology to screen oleaginous fungi (Mucor spp.) where similar results were also reported by Pan et al., (2009) in marine yeasts and fungi. Finally, only 19 deeply stained isolates were carried for further studies. Total lipid extraction by various methods Among the different extraction methods, Folch method (chloroform: methanol, 2:1), gave the best results as compared to other 3 methods and confirmed as the ideal solvent system for extracting total lipids from dry fungal biomass which are well in agreement with Somashekar et al., 2002 and Certic et al., 1996. The Folch method yields 257.8±9.59 mg of lipid per gram of dry fungal biomass, followed by Bligh and Dyer method (Chloroform: methanol, 1:2), resulting 222.9±7.93 mg/g of total lipids, in Hexane: Isopropanol (3:2) 198.83±6.53 mg/g of lipid yield and in Soxhlet method, it was 172.93±1.13 mg/g of lipid yield which is less among all the solvent systems (Figure 1.2). So, throughout the research work Folch et al., (1957) method was followed for further lipid extractions. Quantitative screening of oleaginous fungi by gravimetric method The results indicated (Fig 1.3) that, biomass (on dry weight basis) varied from a minimum of 1.85 ±0.17 g/L to maximum 7.93±0.05 g/L. Lowest biomass was observed in JGK - 29, Alternaria sp. (1.85 ± 0.17 g/L) and highest in JGK – 12, Aspergillus sp. (7.93 ± 0.05 g/L) cultures Total Lipid yield varied from 2.04±0.009 g/L in Aspergillus sp. JGK - 12 to 0.24 ± 0.009 g/L in Aspergillus sp. JGK – 14 and total lipid content was varied from a maximum in Aspergillus sp. JGK – 12 i.e., 25.63 ±0.04 % and minimum in Aspergillus sp. JGK – 14 i.e., 9.12 ±0.34 %. The standard cultures were found to have 1.4±0.002 g/L with 23.26±0.30% of lipid yield Endophytic fungal spp. for Biodiesel 52 Ravi Kumar and Girish VIJNANABHARATHI, 1 (1): 49-57, 2016 in Mortierella alpina (MTCC no.6344) and 0.96±0.007g/L with 19.36±0.17% of lipid yield in Mortierella hyalina (MTCC no.6301). According to the earlier reports, the fungi isolated from soil accounted to 17 % of lipid accumulation, which are explored for the production of special kind of lipids such as Docosahexaenoic acid, Gama linolenic acid and Eicosapentaenoic acid (Ma, 2006; Du Preez et al.,1997). Hence, among the 19 screened fungal isolates, the highest dry biomass, total lipid yield and lipid content giving Aspergillus sp. JGK – 12 strain was selected for further studies. The ability of microorganisms for lipid production in nitrogen limited media had been supported by Gema et al., 2002. Figure 1.2: Extraction of lipids with different organic solvents (Data are expressed as mean ± SD of three replicates) Figure 1.3: Gravimetric estimation of total lipids in Aspergillus isolates and MTCC cultures Dry biomass (g/L) 30 Total lipid yield (g/g) lipid content (%) 25 20 15 lipid lipid content (%) 10 5 Dry biomass Dry biomass (g/L), Total lipid (g/g),yield Total 0 Fungal Isolates (Values represent mean ± SD of three parallel experiments) Endophytic fungal spp. for Biodiesel 53 Ravi Kumar and Girish VIJNANABHARATHI, 1 (1): 49-57, 2016 Morphological features of isolated oleaginous fungus The genus Aspergillus has upright conidiophores, simple, terminating in a globose of clavate, welling, bearing phialides at the apex and radiating from the entire surface. The conidia are one celled, circular often varying in colors and mass. The observations were in confirmation with the findings of Barnette and Hunter, 1998 where the conidia were smooth or rough walled, basipetal arranged in chains, forming long dry chains which may be divergent (radiate) or aggregated in compact columns (Figure 1.4 and Figure 1.5). Figure 1.4 & 1.5: Aspergillus sp. Pure culture of Aspergillus sp. JGK- 12 Mycelia with sporangiospores Molecular identification of oleaginous fungus On the basis of ITS rDNA sequence and phylogenetic analysis, the culture was identified as Aspergillus niger and has been deposited in the NCBI GenBank database with the accession number KP201497. Six hundred and fifty seven (657) bases of Aspergillus sp. JGK – 12 was found to be 96% similar in sequence homology with Aspergillus niger. Various molecular approaches that target the 18s rDNA gene, mitochondrial DNA, the intergenic spacer region and the internal transcribed spacer (ITS) regions have been used previously for rapid detection of Aspergillus from environmental and clinical samples (Henry et al., 2000). In a recent study, species of Aspergillus were identified by comparing partial 18s rDNA sequences of other different fungal isolates, with the available ribosomal sequences using BLAST search (Oktay et al., 2011). Automated molecular techniques that would combine extraction of microbial DNA from clinical materials, DNA amplification and amplicon detection are currently under commercial development for identification of fungal pathogens (Loefler et al., 1997). Based on the Partial ITS rDNA sequence and phylogenetic analysis, the culture JGK – 12 was identified as Aspergillus niger strain (Figure 1.6). Scanning Electron Microscopy In SEM analysis, morphology and structural studies of Aspergillus niger JGK - 12 have been observed from fungal pellet. The pellets showed superficial hyphae (Figure 1.7), which have unclear holes representing lesser portion of total area, since there were no factual channels. The images depict large number of spores which are scattered around major section (Figure 1.8., 1.9 and 1.10). But, in normal culture systems, Aspergillus niger JGK – 12 cells consist of an outer shell of growing hyphae and an inner mass of non-growing mycelium. Researchers have suggested that the formation of pellets originated from the adherence of germinated spores to solid particles in medium (Troung et al., 2004). As per Nitin verma et al., (2011), the nutrient deficiency rate will determine the thickness of the outer growing layer of pellets. Endophytic fungal spp. for Biodiesel 54 Ravi Kumar and Girish VIJNANABHARATHI, 1 (1): 49-57, 2016 Figure 1.6: Phylogenetic tree of Aspergillus niger (JGK 12) Figure 1.7, 1.8, 1.9, 1.10: SEM photographs of Endophytic Aspergillus niger (JGK - 12) from Jatropha curcas Figure 1.7 Figure 1.8 Figure 1.9 Figure 1.10 . Endophytic fungal spp. for Biodiesel 55 Ravi Kumar and Girish VIJNANABHARATHI, 1 (1): 49-57, 2016 CONCLUSION Biodiesel (fatty acid methyl- or ethyl-esters) is considered a promising alternative fuel and it can be defined as the mono-alkylesters of long chain fatty acids. Fatty acid methyl esters (FAMEs) are the most- common constituents used for biodiesel preparation, which are derived from triacylglycerols (TAGs). Currently vegetable oils and animal fats are used as most common sources for the TAG, however biodiesel production from these sources has its limitations (availability of oil-seed, competition for food). On the contrary biodiesel production from microbial systems is receiving more attention due to lack of these limitations. Hence, Microbial lipids (single cell oils, SCOs) accumulated by oleaginous microorganisms viz., bacteria, algae and fungi are being considered as a source for sustainable/renewable fuel. High oil yielding plant Jatropha curcas known as biodiesel plant was selected for the isolation of endophytic fungi associated with it for screening in nutrient rich medium. Based on the external morphology and microscopic observations, the isolates were identified. These isolates were screened for their oleagenicity both qualitatively and quantitatively, staining with Sudan Black – B and gravimetric method respectively. The screened fungal isolates were cultivated on fat production medium to study the growth characteristics, lipid contents. The results indicated that the highest biomass, total lipid yield and lipid content were observed in Aspergillus niger JGK – 12 and can be exploited for biodiesel synthesis. ACKNOWLEDGEMENT The authors are thankful to University Grants Commission- Government of India for financial support to S T Girisha to carry out the Research work, Ministry of New and Renewable Energy - Government of India and Dept. of Microbiology and Biotechnology (funded by SAP, FIST and PURSE programme), Bangalore University for providing infrastructural facility. REFERENCES 1. Abraham M.J., R.A. Srinivasan (1984) Lipid and fatty acid composition of selected fungi grown on whey medium. J Food Sci. 49:950–61. 2. Barnett H. L. and B. B. Hunter (1998) Illustrated Genera of Imperfect Fungi. 4th Edition. 218 pp. APS Press, St. Paul Minnesota, USA. 3. Bligh E. C. and W.J. Dyer (1959) A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37: 911– 917. 4. Burdon K .L. (1946) Fatty material in bacteria and fungi revealed by staining dried, fixed slide preparation. J Bacteriol. 52: 665- 578. 5. Certik M. and S. Shimizu (1999) Kinetic analysis of oil biosynthesis by an arachidonic acid producing fungus, Mortierella alpina 1S-4. Appl Microbiol Biotechnol. 54: 224–230. 6. Certik M., J. Megova and R. Horenitzky (1996) Effect of nitrogen sources on the activities of lipogenic enzymes in oleaginous fungus Cunninghamella echinulata. J Gen Appl Microbiol. 45: 289-293. 7. Cohen Z. and Ratledge C. (2005) Single Cell Oils, American Oil Chemists’ Society. Champaign. IL, USA. 8. Du Preez J.C, M. Immelman, J.L.K. Kock and S.G. Kilian (1997) The effect of acetic acid concentration on the growth and production of gamma-linolenic acid by Mucorcircinelloides CBS 203.28 in fed-batch culture. World J Microbiol Biotech. 13: 81- 86. 9. Duncan D.B. (1965) A Bayesian approaches to multiple comparisons. Technometrics.7: 171 - 222. 10. Dyal S .D and S.Narine (2005) Implications for the use of Mortierella fungi in the industrial production of essential fatty acids. Food Res Inter.38: 445–467. Endophytic fungal spp. for Biodiesel 56 Ravi Kumar and Girish VIJNANABHARATHI, 1 (1): 49-57, 2016 11. Folch J., M. Lees and G. Sloane-Stanley (1957) A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem. 199: 833–841. 12. Gema H., A. Kavadia, D. Dimou, V. Tsagou, M. Komaitis and G.Aggelis (2002) Production of gama-linolenic acid by Cunninghamella ehinulata cultivated on glucose and orange peel. Appl Microbiol Biotechnol. 58: 303–307. 13. Gilman C. J. (1998) Manual Soil Fungi. Biotech Books. Delhi (India). 14. Henry T., P.C.Iwen and S.H. Hinrichs (2000) Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38:1510-1515. 15. Klich M.A. (2002) Identification of common Aspergillus species. Utrecht, Netherlands: Centraal bureauvoor Schimmel cultures. 16. Loeffler J., H. Hebart, U. Schumacher, H. Reitze and H. Einsele (1997) Comparison of different methods for extraction of DNA of fungal pathogens from cultures and blood. J. Clin. Microbiol. 35:3311-3312. 17. Ma Y.L. (2006) Microbial oils and its research advance. China J Bioprocess Eng. 4: 7-11. 18. Mamatha (2009) Ph.D Thesis, University of Mysore, Mysore, India. 19. Moller E. M., G. Bahnweg, H. Sandermann and H. H. Geiger (1992) A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies and infected plant tissues. Nucleic Acids Res. 20: 6115–6116. 20. Nitin Verma, C. Mukesh Bansal and Vivek Kumar (2011) Scanning Electron Microscopic analysis of Aspergillus niger pellets and biofilms under various process conditions, International Journal of Microbiological Research 2: 08-11 21. Oktay H. Imge, Heperkan, Dilek, Yelboga, Emrah, Karaguler and NevinGul (2011) Aspergillus flavus — primary causative agent of aflatoxins in dried figs. Mycotaxon. 115: 425-433. 22. Pan L.X., D. Yang, W. Shaol, Li, G-G. Chen and Q-Z. Liang (2009) Isolation of the Oleaginous yeasts from the soil and studies of their lipid-producing capacities. Yeasts Food Technol Biotechnol. 47: 215-220. 23. Partha Patra and K.A. Natarajan (2008) Microbially-induced separation of chalcopyrite and galena. Miner. Eng. 21: 691–698. 24. Ratledge C. (1988) Biochemistry, stoichiometry, substrates and economics. In Single cell oil. Moreton. R. S., Ed. Harlow, Longmans: 33-70. 25. Somashekar D., G. Venkateshwaran, K. Sambaiah and B. R. Lokesh (2002) Effect of culture conditions on lipid and gamma- linolenic acid production by mucoraceous fungi. Process Biochem. 38: 1719-1724. 26. Suryanarayanan T.S. and S. Thennarasan (2004) Temporal variation in endophyte assemblages of Plumeriarubra leaves. Fungal Diversity. 15: 197-204. 27. Susheel Kumar and Nutan Kaushik (2013) Endophytic fungi isolated from oil-seed crop Jatropha curcas produces oil and exhibit antifungal activity PLoS One. 8: 8-13. 28. Suthep Wiyakrutta N., Sriubolmas, W. Panphut, N. Thonggon, Danwiset-kanjana, N. Ruangrungsi and V. Meevootisom (2004) Endophytic fungi with anti-microbial, anti-cancer and anti-malarial activities isolated from Thai medicinal plants. World J Micro Biot. 20:265-72. 29. Thakur M .S, S .G. Prapulla and N .G. Karanth (1988) microscopic observation of Sudan Black B staining to monitor lipid production by microbes. J. Chem. Tech. Biotechnol. 42: 129-134. 30. Thakur M., S.G. Prapulla and N.G. Karanth (1989) Estimation of intracellular lipids by the measurement of absorbance of yeast cells stained with Sudan Black B, Enzyme Microb. Technol.11: 252 – 254. 31. Troung Q.T., N. Miyata and K. Iwahori (2004) Growth of Aspergillus oryzae during treatment of cassava starch processing waste water with high contents of suspended solids. J. Bioscience and Bioengineering. 97: 329-335. 32. Zheng Z., S. Schwartz, L. Wagner and W. Miller (2000) A greedy algorithm for aligning DNA sequences. J Comput Biol. 7:203– 214.. Endophytic fungal spp. for Biodiesel 57 Ravi Kumar and Girish INSTRUCTIONS TO THE AUTHORS Editorial policy VIGNANABHARATHI, the bi-annual science journal of Bangalore University aims to publish high quality articles relevant to all those interested in Physical, mathematical and computer sciences, Chemical Science, Biological sciences, Earth and Atmospheric Sciences. This peer-reviewed, semi-annual journal, published by Prasaranga Bangalore University in English, (ISSN number: 0971-6882) will consider original scientific and non-scientific contributions for publication in an Open access format. Research articles, Review articles, reports, and Opinion articles in the areas of Physics, Chemistry, Mathematics, Computer science, Biology and Earth and Atmospheric science will be considered. It is published bi-annual and serves the need of scientific and non-scientific personals involved/interested in gaining knowledge. Indexing: Indexing is under process for Index Copernicus, DOAJ (Directory of Open Access Journals), Scopus and EBSCO, CAS (Chemical Abstracts Service, USA), Open J-Gate, Journal Seek, Science Central, Google Scholar. Instructions to Authors The submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Times New Roman, 12 fonts with double space). Submit manuscripts as e-mail attachment to the Editorial office at: [email protected]. The cover letter should indicate the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. The authors may also suggest two to four reviewers for the manuscript. Regular articles These should not exceed 4000 words, 6 display items (tables and figures), should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Review articles The review articles should not exceed 6000 words and cited references to be limited to about 100 in number. The article is expected to survey and discuss current developments in a field. They should be well focused and organized, and avoid a general ‘textbook’ style. [iv] Short Communications (Technical and Student Articles) A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. Should be less than 1500 words and 2 display items serve to rapidly communicate important new findings. Contributions dealing with technical advances or advances in instrumentation may be published as Technical notes. Manuscript Preparation Manuscripts should be typed (Times New Roman font 12) and double-spaced. The pages should be numbered consecutively, starting with the title page and through the text, reference list, tables and figure legends. Order of manuscript 1. Title page, 2. Abstract, 3. Key words, 4. Text, 5. Acknowledgements, 6. References, 7. Tables, 8. Figures, 9. Legends (on separate page preceding the first figure), Title page: The Title should be a brief phrase (capitalize first letter of each word in the title). The Title Page should include the authors' full names and affiliations, the name of the corresponding Author along with phone, fax and E-mail information. Abstract: The Abstract should be informative and completely self-explanatory, briefly present the Topics, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. No literature should be cited. Abbreviations should be avoided as much as possible. The Abstract should be 100 to 300 words in length. Key words (2-6) should be provided below the Abstract to assist with indexing of the article. Text: All papers should have a brief introduction. The text should be intelligible to readers in different disciplines and technical terms should be defined. Tables and figures should be referred to in numerical order. All symbols and abbreviations must be defined, and used only when necessary. Superscripts, subscripts and ambiguous characters should be clearly indicated. Units of measure should be metric or, preferably, SI. Acknowledgements should be as brief as possible. [v] References should be numbered in superscript, serially in the order in which they appear, first through the text and then through table and figure legends. References should not include unpublished source materials. References List Should be APA Style/ The list of References at the end of the text should be in the following format. The References page lists all of the sources you used in your paper and is placed at the end of the paper on a new numbered page. The sources listed on this page and the ones you cite within the text must align exactly. Authors: All authors' names are written last name, comma, first initial, and then a period. Balente, J. If there is more than one author, include a comma and an ampersand (&) between the names. Balente, J., & Everett, G. Dates of Publication: Dates of publication should be placed in parentheses after the author. For most sources, just a year is sufficient, but for newspaper and magazine articles, days and months should be listed after a comma following the year. (2006). Titles: Titles should be formatted in either italics or plain text, and the use of capital letters varies. See the APA title formatting rules here. Editors: If the editor or editors are listed in addition to an author, use the abbreviation (Ed.) or (Eds.) in parentheses after the last editor's name. T. R. Smith (Ed.). Volume and Issue Numbers: Volume and issue numbers are required for journal article. List them with numeral only, no abbreviations. Volume numbers should be italicized and issue numbers are placed in parentheses. An article from volume 53, issue 7 of a journal would be 53(7), Page Numbers: Page numbers are written with numerals only, no abbreviations, on the reference list.67-72. Places: Places of publication for books are listed city, state: using the two-letter state abbreviation. List the first place given on the title page. Boston, MA: Urbana, IL: Publishers: Write the name of the publisher given on the title page. You may shorten the publisher, for example, using "Knopf" for Alfred A. Knopf, Inc. Knopf.McGraw-Hill. DOI: For journal articles, write the DOI (Digital Object Identifier) with the prefix doi: doi: 10.1037/0278-6133.27.3.379 Retrieval Dates: For Web sources, a retrieval date is required. Write the word Retrieved followed by the date Month Day, Year. Retrieved March 10, 2010 Web Addresses: To write a Web address, or URL, include the http://. If you need to break the address to fit it on more than one line, do so after a punctuation mark, such as A slash or a period. Do not add a period at the end. Do not allow your computer to turn the address into a hyperlink in blue underlined type. In-text Citation to References: When citing a reference from your reference list, please use the following conventions. Put in parentheses the author(s) last names, the year, and optionally the page number(s) separated by commas. For one author, use the author's last name and year separated by a comma. For example: (Walters, 1994) or (Austin, 1996).For two to five authors, use their last names [vi] separated by commas and with an ampersand "&" before the very last name in the list, then the year separated by a comma. For example: (Li & Crane, 1993) (Charniak, Riesbeck, McDermott & Meehan, 1994).For more than five authors use the first author's last name and "et al." For example: (Walters, et al., 1992).For the date, use the year. If there are two references by the same author(s) for the same year, use letters after the year: (Walters, 1993b).If you include the author's name(s) in the text of a sentence in the paper, you may omit their names from the parentheses as follows: "Austin (1996) includes valuable references. Figures: Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or PowerPoint before pasting in the Microsoft Word manuscript file. Tables: Tables should be prepared in Microsoft Word. Use numerals to designate figures and upper case letters for their parts (Figure 1) and (Table 1). Publication Charges: This journal does not ordinarily have publication charges; However Colour illustrations in print should be used only in cases where there is a clear need. The additional costs for printing illustrations must be borne in full by the respective authors and their institutions, and must be paid before an accepted article is sent for production. Authors desiring colour in print, and willing and able to pay the associated charges, should indicate their request, preferably upon submission, and indicate which figures are intended for colour in print. The charge is Rs. 500 for a single colour figure in print and Rs 250 for each additional colour figure in the print version of the article. For all manuscript submissions and queries please contact: Dr. H.P.PUTTARAJU, The Editor, Vignanabharathi Professor and Chairman, Department of Life sciences Bangalore University, Bangalore-560056, India Tel.: +91 80 22961923; Email: [email protected]. Website: http://bangaloreuniversity.ac.in/ [vii]