bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 A Bacterial Expression Vector Archive (BEVA) for flexible modular
2 assembly of Golden Gate-compatible vectors
3
4
5 Barney A. Geddes*, Marcela A. Mendoza-Suárez*, Philip S. Poole#
6
7 Department of Plant Sciences, University of Oxford, Oxford, UK.
8
9
10 Running Head: Modular assembly of bacterial vectors
11
12 *These authors contributed equally to this work
13 # Address correspondence to: Philip Poole, [email protected]
14
15
1 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
16 ABSTRACT We present a Bacterial Expression Vector Archive (BEVA) for the
17 modular assembly of bacterial vectors compatible with both traditional and
18 Golden Gate cloning, utilizing the Type IIS restriction enzyme Esp3I. Ideal for
19 synthetic biology and other applications, this modular system allows a rapid, low-
20 cost assembly of new vectors tailored to specific tasks. To demonstrate the
21 potential of the system three example vectors were constructed and tested. Golden
22 Gate level 1 vectors; pOGG024, with a broad-host range and high copy number
23 was used for gene expression in laboratory-cultured Rhizobium leguminosarum,
24 and pOGG026, with a broad-host range a lower copy number and excellent
25 stability, even in the absence of antibiotic selection. The application of pOGG026
26 is demonstrated in environmental samples by bacterial gene expression in
27 nitrogen-fixing nodules on pea plants roots formed by R. leguminosarum. Finally,
28 the level 2 cloning vector pOGG216 is a broad-host range, medium copy number,
29 for which we demonstrate an application by constructing a dual reporter plasmid
30 expressing green and red fluorescent proteins.
31
32 IMPORTANCE Modular assembly is powerful as it allows easy combining of
33 different components from a library of parts. In designing a modular vector
34 assembly system, the key constituent parts (and modules) are; an origin of
35 plasmid replication, antibiotic resistance marker(s), cloning site(s), together with
36 additional accessory modules as required. In an ideal vector, the size of each
37 module would be minimized, and this we have addressed. We have designed such
38 a vector assembly system by utilizing the Type IIS restriction enzyme Esp3I and
2 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
39 have demonstrated its use for Golden Gate cloning in Escherichia coli. An
40 important attribute of this modular vector assembly is that using the principles
41 outlined here, new modules for specific applications, e.g. origin of replication for
42 plasmids in other bacteria, can easily be designed. It is hoped that this vector
43 construction system will be expanded by the scientific community over time by
44 creation of novel modules through an open source approach.
45
46 KEYWORDS Golden Gate, level 1, level 2, modular assembly, cloning vector,
47 shuttle vector, broad host-range plasmid, open source, plasmid design.
3 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
48 Over the last decade, synthetic biology has emerged as a powerful tool for
49 biotechnology and basic science research (1). Coupled with rapidly improving
50 DNA synthesis technologies, one of the key advances that has potentiated the
51 rapid expansion of synthetic biology is new DNA assembly technologies (2). The
52 ability for synthetic biologists to rapidly assemble and test new designs at low
53 cost is invaluable to progress in a wide-range of life sciences research.
54 Applications for this range from investigating new antibody production with
55 higher success rates, to increased food production minimizing the carbon footprint
56 with the effective transfer of nitrogen fixation between bacterial species (3).
57 Golden Gate cloning is a DNA assembly technology that utilizes type IIS
58 restriction enzymes to assemble multiple fragments of DNA in a linear order (4).
59 Since type IIS restriction endonucleases cleave outside of their recognition site,
60 the nucleotides in the cut-site of the enzyme are not discriminated and can be
61 tailored to suit. This permits assembly of multiple fragments of DNA in a
62 directional, linear order by using unique cut/ligation sites between each fragment,
63 all of which can be cut by the same type IIS restriction enzyme. The two most
64 commonly used Golden Gate enzymes are BsaI and BpiI, each has a 6 base-pair
65 (bp) recognition site and a 4 bp sticky-end cut site (4) . The ability of these
66 enzymes to cleave outside of their recognition site and careful design of
67 compatible overhanging sequences allows repeated rounds of cutting followed by
68 ligation to proceed towards a stable assembly product which remains undigested
69 as it lacks enzyme recognition sites (due to the inward orientation of the type IIS
70 recognition sites at the far 5’ and 3’ ends of modules) (5). This approach has
4 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
71 given a massive improvement in the efficiency of assembly compared to
72 traditional rounds of restriction/ligation cloning and has been used to assemble at
73 least nine fragments in linear order, with 90% of transformed bacterial colonies
74 containing correct products (5).
75 Golden Gate cloning platforms have been developed for plants, fungi and
76 the bacterium Escherichia coli (6–9). However, in a wide-range of bacteria,
77 vectors for cloning using Golden Gate tools are not available. The ability to use
78 the most up-to-date molecular tools is crucially important for agricultural
79 biotechnology. Here we describe the development of a system for modular
80 assembly of Golden Gate-compatible cloning broad-host range vectors from a
81 library of vector parts. As these vectors are able to replicate in E. coli, this
82 facilitates easy genetic manipulation since following plasmid construction, as the
83 plasmids constructed can be transferred easily to other bacterial species. We
84 demonstrate the efficacy of this system by constructing several vectors, analogous
85 to useful traditional cloning broad-host range vectors but that are now Golden
86 Gate-compatible: level 1 cloning broad-host range vectors pOGG024, a medium
87 copy plasmid for gene expression for in vitro grown bacteria, and pOGG026, a
88 low copy number stable vectors for stable environmental gene expression in
89 environmental samples where no antibiotic selection is applied. We also describe
90 the construction through this modular vector system of a level 2 broad-host range
91 vector pOGG216.
92
93 RESULTS AND DISCUSSION
5 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
94 Modular vector assembly. A new standardized system for vector assembly was
95 designed based on Golden Gate cloning and the MoClo system described by
96 Weber et al. 2011 (4). We have designed a bacterial vector assembly system with
97 a series of discrete key modules. In order to do this we took advantage of the
98 modularization and miniaturization of bacterial vector modules in the Standard
99 European Vector Archive (SEVA) (10, 11). In SEVA these modules are arranged
100 in a predefined order and assembled using standard restriction enzymes and
101 standard restriction/ligation reactions. We have conserved this organization in the
102 modular vector assembly system: position 1 is the cloning site(s), position 2 is the
103 antibiotic resistance cassette, position 3 is origins of replication and transfer.
104 Three more positions (4 to 6) have been reserved for additional accessory
105 modules for specific applications. Endlinkers containing terminators (ELT) are
106 used to circularize the plasmid by connecting the final position used to position 1
107 (Fig. 1A). We incorporated Golden Gate level 1 and level 2 cloning sites into
108 position 1 to make them compatible with the MoClo Golden Gate cloning system
109 (Fig. 1B). Each vector construction module is flanked with inward-facing
110 recognition sites for the type IIS restriction enzyme Esp3I and the cut sites, giving
111 overhangs with sequences specific for each module (fusion sites shown in Table
112 1), allow directional linear assembly in a one-pot reaction such as used in Golden
113 Gate cloning (4).
114
115 Vector module design. We assigned modules a universal position for linear
116 assembly based on function; position 1 - cloning site(s), position 2 - antibiotic
6 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
117 resistance, position 3 - origins of replication and transfer, with positions 4 - 6
118 reserved for accessory modules (Fig 1, Table 1). Modules at each position (1 to 6
119 and Endlinkers, Table 1) have inward-facing Esp3I sites which on digestion give
120 4 bp-overhangs. These overhangs are able to anneal with those from neighbouring
121 modules in a linear fashion and, on vector assembly, give 4 bp motifs which
122 remain at the join between modules (all motifs for each junction are listed in
123 Table 1, Fig. 1). An advantage of modular assembly is the ability to utilize
124 minimal parts which exclude any non-functional DNA. This allows construction
125 of vectors with the same key features as those currently widely adopted, but the
126 resulting plasmid is significantly smaller in size. The reduced size enhances the
127 ease of DNA manipulation and allows accommodation of larger cloned inserts. To
128 this end, several modules (positions 2 and 3) used the minimal units of antibiotic-
129 resistance modules and origins of replication/transfer previously defined by
130 SEVA (10, 11) (Table 1).
131 Most parts were constructed by DNA synthesis by Invitrogen and supplied in the
132 GeneArt cloning vector pMS (Invitrogen, Thermo Fisher Scientific Inc.). As an
133 alternative some vector modules were constructed by PCR amplification from
134 commonly used vectors (see Table 3). In several cases, this was a cheaper and
135 faster option than the synthesis of the DNA fragments. Modules synthesized by
136 Invitrogen were domesticated prior to DNA synthesis by removal of BsaI, BpiI,
137 DraIII and Esp3I (Golden Gate cloning restriction enzyme sites) by altering a
138 single nucleotide in the recognition site. In an open reading frame (ORF) a neutral
7 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
139 change was made in the wobble base of a codon, such that the same amino acid
140 was encoded. Outside of an ORF, a transition mutation was introduced.
141 The position 1 modules we designed are based on level 1 and level 2 cloning sites
142 pL1F-1 and pL2V-1 from the MoClo system of Weber et al. (4) (Table 1). The
143 level 1 cloning site in pOGG004 contains a lacZα fragment that is replaced
144 following Golden Gate cloning following the MoClo system, resulting in blue to
145 white colony colour selection when plated on appropriate media. Since lacZα still
146 contains a polylinker, vectors constructed with the level 1 Golden Gate cloning
147 site are also flexiblefor use in traditional cloning utilizing unique restriction sites
148 in the polylinker and blue-white selection. The level 2 golden gate cloning site
149 encodes a canthaxanthin biosynthesis operon that is replaced upon successful
150 level 2 cloning resulting in a transition from an orange colony colour to white or
151 blue. Both position 1 modules include a rho-independent T0 lambda phage
152 transcription terminator (12) included at their 3’-end.
153 We note that since the level 1 Golden Gate cloning site part (pOGG004) is
154 maintained in a high copy number vector backbone, it can be cloned into directly
155 using BsaI as described here and utilized as a high copy plasmid for recombinant
156 protein expression in E. coli. We synthesised (pOGG005), with an Ampicillin
157 resistant backbone for this purpose, to be compatible with traditional systems for
158 recombinant protein production.
159 For position 2 (antibiotic resistance), gentamicin- and neomycin-resistance
160 modules were based on the minimal resistance cassettes from SEVA(11). The 5’-
161 end SwaI and 3’-end PshAI sites that flanked the SEVA modules were replaced
8 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
162 with inward-facing Esp3I sites. We found that the SEVA constitutive tetA gene
163 conferred insufficient levels of tetracycline resistance to our organisms of interest
164 (data not shown), therefore we designed a more robust tetracycline-resistance
165 module based on the tetAR resistance module from pJP2 (13). To preserve a
166 minimal size, only DNA between the stop codons of the divergently transcribed
167 tetA and tetR was used and their orientation conserved (Fig. 1B). In position 3
168 (origins of replication and transfer), modules containing pBBR1 and RK2 origins
169 of replication were designed based on SEVA modules (11), but with inward-
170 facing Esp3I sites replacing PshAI and AscI sites. An origin of transfer (oriT), to
171 permit conjugation from E. coli into target strains, was included at the 5’-end. At
172 position 4, an accessory module for stable plasmid maintenance in the absence of
173 antibiotic selection was designed. Based on the par locus from pJP2, which has
174 previously been shown to render stable plasmid maintenance in the absence of
175 antibiotic selection (13), parABCDE, as well as 107 bp downstream of parE (at
176 5’-end) and 139 bp downstream of parA (at 3’-end) (Fig 1B) was oriented such
177 that the parE was transcribed towards position 3, while parA was at the 3’-end,
178 transcribed towards position 1 (Fig. 1B).
179 Endlinker (ELT) modules were designed to complete assembly by circularizing
180 the plasmid, either by linking position 3 (origin of replication), or accessory
181 modules at positions 4, 5 or 6 to position 1 (cloning sites). Endlinker modules
182 contain the E. coli T1 rrnBT1 terminator to help buffer any transcription effects
183 from the cloning site (12).
9 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
184 Design and construction of level 0 open reading frame parts. Golden Gate
185 cloning is often used in a hierarchical assembly where level 0 parts (genetic
186 features controlling a gene’s transcription, translation and the termination of
187 transcription) are assembled in a single one-pot reaction (referred to as level 1
188 assembly) (4). In order to test the vectors that we constructed, we adapted several
189 parts that are routinely used in our lab, including promoters with ribosome
190 binding sites (PU modules), ORFs (SC modules) and a terminator (T module).
191 These parts were synthesized as described for vector construction modules, except
192 that they were assembled with inward-facing BsaI sites that cut appropriate
193 sequences for level 1 assembly (Table 3).
194 We adapted several promoters routinely used for gene expression in rhizobia or E.
195 coli for use as PU modules (Table 3). These are the constitutive neomycin cassette
196 promoter (pNptII) (14), T7RNAP promoter repressible by LacI (pT7lacO,)(15),
197 the Lac promoter from E. coli (pLac) (16), the taurine-inducible promoter of S.
198 meliloti (pTau) (17) and the symbiosis-induced nifH promoter from Rhizobium
199 leguminosarum biovar vicia 3841 (Rlv3841pNifH) (18). For all promoters, the
200 nucleotide immediately upstream of the ATG was domesticated to an A to
201 construct the 5’-AATG-3’ cut-site such that the ATG encodes the start codon of
202 the ORF to be expressed.
203 For SC modules (Table 3), we utilized several different reporter genes to
204 demonstrate vector function. These include genes encoding superfolder green
205 fluorescent protein (sfGFP) (19), E. coli β-glucoronidase (gusA) and Pyrococcus
206 furiosus thermostable β-glucosidase/ β-galactosidase (celB) (20, 21).
10 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
207 Domestication and gene synthesis were used to produce SC modules of sfGFP
208 and celB, and gusA. All SC modules were constructed flanked by inward facing
209 BsaI restriction site cutting 5’-AATG-3’ at the 5’ end and GCTT at the 3’ end. In
210 all cases the final three nucleotides of the AATG scar encode the start codon for
211 the ORF and the GCTT scar immediately follows the stop codon.
212 For use as a transcriptional terminator, the rrnBT1 transcriptional terminator with
213 flanking regions from pLMB509 (17) (9 bp upstream and 84 bp downstream)
214 were synthesised and flanked by BsaI sites cutting GCTT and CGCT on the 5’
215 and 3’ of the open reading frame. All the novel BEVA parts, vectors and
216 plasmids are available through Addgene (http://www.addgene.org/ Addgene ID is
217 shown in Table 2).
218
219 Vectors for Golden Gate level 1 cloning in bacteria. Vector assembly reactions
220 were performed by selecting appropriate modules in each position (Fig. 1,
221 summary of the sequences used to combine the modules which remain at their
222 junctions and fusion sites are given in Table 1).
223 To demonstrate the flexibility of the system, two vectors for level 1 cloning,
224 analogous to those used for traditional cloning and DNA manipulation in Gram-
225 negative bacteria, were constructed. Plasmid pOGG024 (Fig. 2A, Table 2), a 3.4
226 kb level 1-compatible vector for bacterial gene expression, was made by adding
227 the following plasmids (listed in Table 3) to a one-pot reaction (digestion with
228 Esp3I and ligation) to combine the following modules: position 1; level 1 cloning
229 site from pOGG004, position 2; gentamicin resistance cassette from pOGG009,
11 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
230 position 3; pBBR1-based origin of replication from pOGG011 and the appropriate
231 Endlinker (ELT3) from pOGG013 (Table 1).
232 Plasmid pOGG026 (6.6 kb, Fig. 3A, Table 2) was constructed by combining the
233 following modules (Table 3) in a one-pot reaction (digestion with Esp3I and
234 ligation): position 1; level 1 cloning site from pOGG004, position 2; neomycin
235 resistance gene from pOGG008, position 3; RK2-based origin of replication from
236 pOGG010, position 4; parABCDE genes which confer stability in the absence of
237 antibiotics from pOGG012 and the appropriate Endlinker (ELT4) from pOGG014
238 (Table 1).
239
240 Gene expression using vector pOGG024. In previous work we described the
241 construction of pLMB509 (17), a plasmid which has a taurine-inducible promoter
242 upstream of a gene encoding GFP (gfpmut3.1).To evaluate the performance of
243 vector pOGG024 through comparison with the fully-characterized pLMB509, we
244 assembled plasmid pOPS0359 by cloning a taurine-inducible promoter upstream
245 of superfolder GFP (sfGFP) to create a functionally analogous plasmid i.e.
246 taurine-inducible expression of GFP (Fig. 2B). To do this, a Golden Gate level 1
247 cloning reaction was performed with components (listed in Table 3) in a one-pot
248 reaction (digestion with BsaI and ligation); vector; pOGG024, PU module;
249 Sinorhizobium meliloti taurine promoter from pOGG041, SC module; sfGFP from
250 pOGG037, T module; rrnBT1 terminator from pOGG003 to create pOPS0359.
251 Taurine-dependent GFP expression of plasmids pOPS0359 and pLMB509 in a
252 Rlv3841 background is shown in Fig. 2C-D. Under conditions of 0 to 40 mM
12 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
253 taurine they showed similar growth (Fig 2E-F) and gave fluorescence profiles
254 indicating induction of GFP throughout the exponential phase. Although similar
255 GFP induction profiles were seen, pOPS0359 showed significantly higher levels
256 of overall fluorescence, especially at 10 and 40 mM taurine. As the plasmids
257 share the same origin of replication (pBBR1) there are two factors that are likely
258 to have had an influence on this; the brighter fluorescence of sfGFP (19)
259 (pOPS0359) compared to that of GFPmut3.1 (pLMB509), and the reduced size of
260 pOPS0359 (5.5kb) compared to pLMB509 (6.8kb) perhaps leading to an
261 increased plasmid copy number.
262 Gene expression using pOGG026. To demonstrate the flexibility of BEVA we
263 constructed a relatively low copy number, stable plasmid pOGG026, suitable for
264 experiments in environments where there is no antibiotic selection present.
265 To demonstrate the stability of pOGG026, and therefore its use for experiments
266 carried out in many different environments, it was used to construct plasmids
267 pOPS0253 (Fig. 2B), pOPS0254 (Fig. 2C) and pOPS0379 by Golden Gate
268 cloning. Using a level 1 one-pot reaction (BsaI and ligation), pOPS0253 was
269 constructed from the following (listed in Table 4): vector; pOGG026, PU module;
270 Rlv3841pNifH from pOGG082, SC module; gusA from pOGG083; T module;
271 rrnBT1 terminator from pOGG003. Plasmids pOPS0254 and pOPS0379 are
272 identical to pOPS0253, except that the SC modules are celB from pOGG050 and
273 sfGFP from pOGG037, rather than gusA. Positive controls were constructed with
274 the constitutive neomycin cassette promoter (pNptII) from pOGG001 (PU)
13 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
275 instead of the Rlv3841pNifH from pOGG082 resulting in the plasmids
276 pOSP0750, pOPS0314 and pOPS0377.
277 Plasmids pOPS0253, pOPS0254 and pOPS0379 were then conjugated into R.
278 leguminosarum Rlv3841 and used to inoculate peas. Plasmid pOPS0254 was also
279 conjugated into R. tropici CIAT 899 (22) and used to inoculate bean plants.
280 The expression of the chromogenic marker genes in plasmids pOPS0253 and
281 pOPS0254 can be followed by staining either pink (gusA) or blue (celB) when the
282 appropriate substrate is supplied (20). Stained pea nodules are shown in Fig. 2E-F
283 and stained bean nodules are shown in Fig. 2G. Even when all mature nodules
284 showed correct staining, to further verify plasmid stability, at least three nodules
285 were crushed from each plant, and eight independent colonies from those obtained
286 were screened for antibiotic resistance. All colonies showed neomycin resistance,
287 consistent with stable maintenance of plasmids derived from vector pOGG026.
288 The inducible expression of sfGFP can be observed when nodules reach mature
289 stage and just in the nitrogen fixing zone (Fig. 2H).
290 We have developed a plasmid-based system that can be utilized for assessing
291 competitiveness between rhizobia which is similar to the chromosomally-encoded
292 strategy described by Sánchez-Cañizares & Palacios (21). Using pOPS0379 we
293 now have a non-invasive symbiosis-induced screening system which can be used
294 to recover live rhizobia from nodules for further analysis.
295
296 Golden Gate Level 2 cloning vectors. In the MoClo system, multigene
297 constructs are constructed by assembling transcriptional units by Golden Gate
14 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
298 level 1 cloning reaction into level 1 shuttle vectors that dictate the final position in
299 a level 2 construct. Transcriptional units are then combined using a Golden Gate
300 level 2 cloning reaction with BpiI (4). To demonstrate the flexibility of the
301 assembly system we have designed and constructed a level 2 destination vector,
302 pOGG216 (Fig. 4A). Vector pOGG2016 was made by a one-pot reaction for
303 vector assembly (Esp3I and ligase) with the following modules (listed in Table 3):
304 position 1; level 2 cloning site from pOGG006, position 2; tetracycline-resistance
305 module from pOGG042, position 3; pBBR1 origin from pOGG011 and an
306 appropriate Endlinker (ELT3) from pOGG013.
307 Gene expression using vector pOGG216. To validate the performance of vector
308 pOGG216, a level 2 cloning reaction was performed (one-pot reaction with BpiI
309 and ligase) to construct pOPS0754 (Fig. 4B), a dual reporter plasmid, using the
310 following parts: level 2 vector pOGG216, forward position 1 from pOGG202,
311 forward position 2 from pOGG203 and level 2 Endlinker ELB-2 from pOGG056.
312 Plasmid pOGG202 (clone of a level 1 unit which encodes IPTG-inducible sfGFP)
313 was constructed by combining the following in a one-pot reaction (BsaI and
314 ligase): forward position 1 shuttle vector pL1V-F1 pOGG021, PU module pLac
315 from pOGG031, SC module sfGFP from pOGG037 together with T module
316 rrnBT1 from pOGG003.
317 Plasmid pOGG203 (clone of a level 1 unit which encodes a constitutively-
318 expressed mCherry) was assembled by combining the following in a one-pot
319 reaction (BsaI and ligase): forward position 2 shuttle vector pL1V-F2 pOGG054,
15 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
320 PU module pNeo from pOGG001, SC module mCherry from EC15071 and T
321 module rrnBT1 from pOGG003.
322 Assembly in E. coli of the final dual reporter plasmid pOPS0754 was very
323 efficient (>90% correct constructs, same as in Weber et al. 2011 (4)). Plasmid
324 pOPS0754 was conjugated into Rlv3841 and green and red fluorescence from this
325 dual reporter plasmid is shown in Fig. 4.C-D.
326
327 In conclusion, the BEVA system we describe has proved to be robust and flexible
328 for creating new bacterial vectors. The modular vectors we constructed with this
329 system behaved consistently well in the Gram-negative bacteria tested (E. coli and
330 R. leguminosarum), and demonstrated stability in the environments tested
331 (rhizosphere and nitrogen-fixing root nodules formed by symbiotic bacteria) when
332 engineered to contain the stability accessory module (par genes). The BEVA
333 vectors for use in Golden Gate cloning (level 1: pOGG005, pOGG024 and
334 pOGG026, and level 2: pOGG216) have been made available through Addgene
335 (Table 2). While these vectors are useful for cloning and gene expression in R.
336 leguminosarum, the major advantage of the modular system described here is its
337 flexibility. The ability to rapidly assemble BEVA vectors with unique features,
338 specifically suited to a specific purpose, e.g. alternative antibiotic resistance
339 modules to avoid conflict with other markers, or to alter the origin of replication
340 to avoid plasmid incompatibility has enormous applications for those working in
341 many different areas. Rapid assembly of new BEVA vectors from such a bank of
342 parts in this way offers a quick and economical option for construction of new
16 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
343 vectors, not only for bacteria, as the system could be expanded to include parts for
344 plant transformation or replication and maintenance in fungi.
345
346 MATERIALS AND METHODS
347 Bacterial media and growth conditions Bacterial strains and plasmids used in
348 this study are listed in Table 2. E. coli strains were grown in liquid or on solid
349 Luria–Bertani (LB) medium (23) at 37°C, supplemented with antibiotics at the
350 following concentrations: tetracycline (10 μg ml−1), gentamicin (10 μg ml−1),
351 kanomycin (20 μg ml−1) or spectinomycin (100 μg ml−1). Rhizobial strains were
352 grown on tryptone yeast (TY) agar or broth (24) or universal minimal salts
353 (UMS)(25) at 28°C. Antibiotics were added to TY when necessary at the
354 following concentrations: streptomycin (500 μg ml−1), tetracycline (5 μg ml−1),
355 gentamicin (20 μg ml−1), rifampicin (50 μg ml−1), and neomycin (40 μg ml−1).
356 Plasmids were transferred into wild-type (Rlv3841 and R. tropici
357 CIAT899 backgrounds by triparental mating according to Figurski and Helinski
358 (1979) (26)
359 Golden Gate Vector Assembly, level 1 and level 2 cloning. Vector assembly
360 was performed in a thermocycler in 15 uL total volume, containing 40 fmols of
361 each cloned module (position or ELT) (which equates to approx. 1 uL of 4 Kb
362 plasmid at 100 ng/uL), 1.5 uL Bovine Serum Albumin (1 mg/mL), 1 uL Esp3I FD
363 (Thermo Scientific), 1 uL concentrated T4 DNA Ligase (New England Biolabs),
364 1.5 uL T4 DNA Ligase buffer (New England Biolabs) with water to 15 uL. Tubes
365 were prepared on ice before 25 cycles: 3 min at 37oC then 4 min at 16oC,
17 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
366 followed by 5 min at 50oC and 5 min at 80oC. Samples were cooled on ice and 1
367 uL was transformed into 10 uL of E. coli competent cells (Bioline Gold) by heat
368 shock for 1 min at 42oC (27). and plated onto LB with appropriate antibiotics (for
369 pOGG024 selection was for gentamicin-resistance, for pOGG026 for kanamycin
370 resistance and for pOGG216 for tetracycline resistance) and X-gal at 40 ug/mL.
371 Several colonies showing the correct colour, i.e. blue for pOGG024 and
372 pOGG026 (level 1) vector assembly (colour is conferred by the presence of lacZα
373 in the cloning site) and orange for pOGG216 (level 2) (conferred by a
374 canthaxanthin biosynthesis cluster in the cloning site) (4), were screened by
375 plasmid restriction digest and sequencing to verify correct constructs. Correct
376 plasmid assembly was observed at very high frequencies and comparable to those
377 described for Golden Gate cloning reactions (4).
378 Level 1 cloning was performed as described above, except BsaI FD (Thermo
379 Scientific) replaced Esp3I. For level 2 cloning, BpiI (Thermo Scientific) was used
380 instead of Esp3I. Transformation was performed as described above and colonies
381 showing the correct colour based on the replacement of modules in the vector
382 cloning sites (blue to white for level 1 and orange to blue or white for level 2)
383 were screened by plasmid restriction digest and sequencing to verify correct
384 constructs.
385 Plant growth Pisum sativum (pea) and Phaseolus vulgaris (bean) seeds were
386 surface sterilized by immersion in 95% ethanol for 0.5 min, followed by washing
387 with sterile water. Seeds were then immersed in 2% Sodium hypochlorite for 5
388 min. After washing the seeds five times with sterile water, they were placed onto
18 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
389 1% agar (DWA) plates in the dark at room temperature for 4-5 days to allow
390 germination. Pea seedlings were placed in sterile 1-litre pots with medium
391 vermiculite and supplied with 400 ml nitrogen-free rooting solution (28). In the
392 case of beans, seedlings were placed in sterile 2-litre pots with fine vermiculite
393 and supplied with 800 ml nitrogen-free rooting solution, (29) Inoculation was at
394 approx. 107 cfu of rhizobia per pot. Plants without inoculation were grown as a
395 control. Plants were grown (random positioning of pots) in a controlled growth
396 chamber at 21°C, 16-h/8-h day/night cycle.
397 Enzyme activity in nodules Pea plants were harvested 21 dpi and bean plants
398 42dpi. Roots were stained with Magenta-glcA (5-bromo-6-chloro-3-indolyl-β-D-
399 glucuronide acid, 200 μg/ml) for plants nodulated with strain
400 Rlv3841[pOPS0253] containing the ß-glucuronidase gene (gusA). For plants
401 nodulated with rhizobial strains Rlv3841[pOPS0254] and CIAT 899[pOPS0254]
402 containing ß-glucosidase gene (celB), roots were stained with X-gal (5-bromo-4-
403 chloro-3-indolyl- β-D-galactopyranoside, 250 μg/ml) after thermal treatment at
404 70°C for 30 minutes to destroy endogenous β-galactosidases (20).
405 Measurement of bacterial growth and GFP assays Bacterial growth OD595 and
406 GFP fluorescence (excitation 485 nm and emission 520 nm) were performed with
407 a FLUOstar OMEGA (Lite). Rhizobia were grown on TY agar slopes with
408 appropriate antibiotics for three days, washed with UMS and resuspended in UMS
409 with 30 mM pyruvate and 10 mM NH4Cl (as carbon and nitrogen sources) at an
o 410 OD595 of 0.1 at the start of the assay. Cells were incubated at 28 C with orbital
19 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
411 shaking at 500 RPM for 48 hours with measurement of optical density and
412 fluorescence every 30 min.
413 Microscopy
414 Photographs were taken using a dissecting microscope (Leica M165 FC) with a
415 Leica DFC310 FX digital camera accompanying software (LAS v4.5). Visible
416 light filter and a GFP filter were used.
417 Image Acquisition for green and red fluorescence expression
418 NightOWL camera (Berthold Technologies). Each CCD image consisted of an
419 array 1,024 by 1,024 pixels, and after acquisition, images were postprocessed for
420 cosmic suppression and background correction. Fluorescence CCD images were
421 acquired with a Ring-light epi illumination accessory exposed for one second and
422 special filters have to be used. Filter used for GFP quantification at excitation
423 wavelength 475/20 and emission wavelength 520/10 nm. Filter used for mCherry
424 quantification at excitation wavelength 550/10 and emission wavelength 620/10
425 nm. Images were analysed with the imaging software IndiGO (Berthold
426 Technologies).
427 SUPPLEMENTAL MATERIAL
428
429
430 ACKNOWLEDGEMENTS
431 We thank Chris Rogers from Giles’s lab. Kyle Grant and Beatriz Jorrín.
432 Carmen Sánchez-Cañizares for training MMS in the use of gusA and celB marker
433 genes and Alison East for her critical revision of the manuscript.
20 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
434 This work was supported by the Biotechnology and Biological Sciences Research
435 Council [grant number BB/L011484/1] and CONACYT-I2T2 Nuevo León (grant
436 code 266954 / 399852) awarded to MMS.
437
438 REFERENCES
439 1. Church GM, Elowitz MB, Smolke CD, Voigt CA, Weiss R. 2014.
440 Realizing the potential of synthetic biology. Nat Rev Mol Cell Biol
441 15:289–294.
442 2. Kosuri S, Church GM. 2014. Large-scale de novo DNA synthesis:
443 technologies and applications. Nat Methods 11:499–507.
444 3. Smanski MJ, Bhatia S, Zhao D, Park Y, Woodruff LBA, Giannoukos G,
445 Ciulla D, Busby M, Calderon J, Nicol R. 2014. Functional optimization of
446 gene clusters by combinatorial design and assembly. Nat Biotechnol
447 32:1241–1249.
448 4. Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. 2011. A
449 modular cloning system for standardized assembly of multigene constructs.
450 PLoS One 6:e16765.
451 5. Engler C, Gruetzner R, Kandzia R, Marillonnet S, Duguay A. 2009.
452 Golden gate shuffling: a one-pot DNA shuffling method based on type IIs
453 restriction enzymes. PLoS One 4:e5553.
454 6. Moore SJ, Lai H-E, Kelwick RJR, Chee SM, Bell DJ, Polizzi KM,
455 Freemont PS. 2016. EcoFlex: A Multifunctional MoClo Kit for E. coli
456 Synthetic Biology. ACS Synth Biol 5:1059–1069.
21 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
457 7. Terfrüchte M, Joehnk B, Fajardo-Somera R, Braus GH, Riquelme M,
458 Schipper K, Feldbrügge M. 2014. Establishing a versatile Golden Gate
459 cloning system for genetic engineering in fungi. Fungal Genet Biol 62:1–
460 10.
461 8. Engler C, Youles M, Gruetzner R, Ehnert T-MM, Werner S, Jones JDG,
462 Patron NJ, Marillonnet S. 2014. A Golden Gate modular cloning toolbox
463 for plants. ACS Synth Biol 3:839–843.
464 9. Agmon N, Mitchell LA, Cai Y, Ikushima S, Chuang J, Zheng A, Choi W-J,
465 Martin JA, Caravelli K, Stracquadanio G, Boeke JD. 2015. Yeast Golden
466 Gate (yGG) for the Efficient Assembly of S. cerevisiae Transcription Units.
467 ACS Synth Biol 4:853–859.
468 10. Martínez-Garćía E, Aparicio T, Goñi-Moreno A, Fraile S, De Lorenzo V.
469 2015. SEVA 2.0: An update of the Standard European Vector Architecture
470 for de-/re-construction of bacterial functionalities. Nucleic Acids Res
471 43:D1183–D1189.
472 11. Silva-Rocha R, Martínez-García E, Calles B, Chavarría M, Arce-Rodríguez
473 A, De Las Heras A, Páez-Espino AD, Durante-Rodríguez G, Kim J, Nikel
474 PI, Platero R, De Lorenzo V. 2013. The Standard European Vector
475 Architecture (SEVA): A coherent platform for the analysis and deployment
476 of complex prokaryotic phenotypes. Nucleic Acids Res 41:D666–D675.
477 12. Lutz R, Bujard H. 1997. Independent and tight regulation of transcriptional
478 units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2
479 regulatory elements. Nucleic Acids Res 25:1203–1210.
22 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
480 13. Prell J, Boesten B, Poole PS, Priefer UB. 2002. The Rhizobium
481 leguminosarum bv. viciae VF39 γ-aminobutyrate (GABA)
482 aminotransferase gene (gabT) is induced by GABA and highly expressed in
483 bacteroids. Microbiology 148:615–623.
484 14. Frederix M, Edwards A, Swiderska A, Stanger A, Karunakaran R,
485 Williams A, Abbruscato P, Sanchez‐Contreras M, Poole PS, Downie JA.
486 2014. Mutation of praR in Rhizobium leguminosarum enhances root
487 biofilms, improving nodulation competitiveness by increased expression of
488 attachment proteins. Mol Microbiol 93:464–478.
489 15. Berrow NS, Alderton D, Owens RJ. 2009. The precise engineering of
490 expression vectors using high-throughput In-FusionTM PCR cloning. High
491 Throughput Protein Expr Purif Methods Protoc 75–90.
492 16. Keen NT, Tamaki S, Kobayashi D, Trollinger D. 1988. Improved broad-
493 host-range plasmids for DNA cloning in Gram-negative bacteria. Gene
494 70:191–197.
495 17. Tett AJ, Rudder SJ, Bourdès A, Karunakaran R, Poole PS. 2012.
496 Regulatable vectors for environmental gene expression in
497 Alphaproteobacteria. Appl Environ Microbiol 78:7137–7140.
498 18. Johnston AWB, Beringer JE. 1975. Identification of the rhizobium strains
499 in pea root nodules using genetic markers. J Gen Microbiol 87:343–50.
500 19. Pédelacq J-D, Cabantous S, Tran T, Terwilliger TC, Waldo GS. 2006.
501 Engineering and characterization of a superfolder green fluorescent protein.
502 Nat Biotechnol 24:79.
23 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
503 20. Sessitsch A, Wilson K, Akkermans A, de Vos W. 1996. Simultaneous
504 detection of different Rhizobium strains marked with either the Escherichia
505 coli gusA gene or the Pyrococcus furiosus celB gene. Appl Environ
506 Microbiol 62:4191–4194.
507 21. Sánchez-Cañizares C, Palacios J. 2013. Construction of a marker system
508 for the evaluation of competitiveness for legume nodulation in Rhizobium
509 strains. J Microbiol Methods 92:246–249.
510 22. Graham PH, Viteri SE, Mackie F, Vargas AT, Palacios A. 1982. Variation
511 in acid soil tolerance among strains of Rhizobium phaseoli. F Crop Res
512 5:121–128.
513 23. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory
514 manual. Cold Spring Harbor.
515 24. Beringer JE. 1974. R factor transfer in Rhizobium leguminosarum.
516 Microbiology 84:188–198.
517 25. Poole PS, Schofield N, Reid CJ, Drew EM, Walshaw DL. 1994.
518 Identification of chromosomal genes located downstream of dctD that
519 affect the requirement for calcium and the lipopolysaccharide layer of
520 Rhizobium leguminosarum. Microbiology 140:2797–809.
521 26. Figurski DH, Helinski DR. 1979. Replication of an origin-containing
522 derivative of plasmid RK2 dependent on a plasmid function provided in
523 trans. Proc Natl Acad Sci 76:1648–1652.
524 27. Engler C, Kandzia R, Marillonnet S. 2008. A one pot, one step, precision
525 cloning method with high throughput capability. PLoS One 3:e3647.
24 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
526 28. Poole PS, Schofiel NA, Reid CJ, Drew EM, Walshaw DL. 1994.
527 Identification of chromosomal genes located downstream of dctD that
528 affect the requirement for calcium and the lipopolysaccharide layer of
529 Rhizobium leguminosarum. Microbiology 140:2797–2809.
530 29. Broughton WJ, Dilworth MJ. 1971. Control of leghaemoglobin synthesis in
531 snake beans. Biochem J 125:1075–80.
532
533 Figure legends
534 FIG 1 Bacterial Expression Vector Archive (BEVA) system for the modular
535 assembly of bacterial vectors. (A) Vector modules are designated a ‘position’ and
536 combined in the vector construction as shown. Sequences (5’→ 3’) used to anneal
537 the fragments in order are shown (colour-coded) at junctions between modules
538 and remain in the final construct as a scar. (B) Modules at each position. Position
539 1: Cloning Sites - Golden Gate level 1 and Golden Gate level 2; position 2:
540 Antibiotic resistance – neomycin-, gentamicin- and tetracycline-resistance
541 cassettes; position 3: Origins of replication and transfer - RK2 with oriT and
542 pBBR1 with oriT; positions 4-6: Accessory modules - par locus for stable
543 plasmid maintenance in the absence of antibiotic selection. Endlinker modules
544 were designed to circularize the plasmid.
545
546 FIG 2 A) Schematic map of pOGG024 level 1 broad-host range, high copy
547 number vector constructed with BEVA for free-living gene expression in
548 laboratory. B) Schematic map of plasmid pOPS0359 containing a cloned gene sf-
25 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
549 GFP under the control of a taurine-inducible promoter from Sinorhizobium
550 meliloti into pOGG024. C-F) Evaluation of pOPS0359 performance as robust
551 free-living gene expression compared to the functionally analogous pLMB509
552 plasmid. C-D) Florescence detection from GFP expression and E- F) Fitness
553 performance by measurement of OD600 when grow without (0 mM) or with (0.5,
554 1.0, 10 or mM) taurine.
555
556 FIG 3 A) Schematic map of pOGG026 level 1 broad-host range, lower copy
557 number vector constructed with BEVA for stable environmental gene expression
558 in the absence of antibiotic selection. B-D) Schematic map of plasmids containing
559 a cloned B) gusA C) celB and D) sfGFP gene under the control of nifH gene
560 promoter (pNifH). E) Pea nodules formed by Rlv3841[pOPS253] stained
561 with Magenta-glc. Marker gene gusA is just expressed in nodules. F) Pea nodules
562 formed by Rlv3841[pOPS254] and G) bean nodules formed by
563 CIAT899[pOPS253] stained with X-gal after thermal treatment. Marker gene celB
564 is just expressed in nodules. H) Pea nodules formed by Rlv384[pOPS0379],
565 bright-field (top) and fluorescence (GFP filter) (bottom) images. GFP expression
566 is exclusively found in the nitrogen-fixing zone.
567
568 FIG 4 (A) Schematic map of pOGG216 level 2 broad-host range, medium copy
569 number vector constructed with BEVA for multi-gene expression. (B) Schematic
570 map of pOPS0754 dual reporter plasmid which encodes IPTG-inducible sfGFP
571 cloned in Forward Position 1 and constitutively mCherry cloned in Forward
26 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
572 Position 2. (C-D) Fluorescence of Rlv3841 and Rlv3841[pOPS0754] grown on
573 media containing 0.5 mM IPTG. (C) Green fluorescence from IPTG-inducible
574 sfGFP (scale, 3,000–30,000 cps). (D) Red fluorescence from constitutively
575 expressed mCherry (scale, 1,500–15,000 cps).
27 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
FIG 1 Bacterial Expression Vector Archive (BEVA) system for the modular assembly of bacterial vectors.
(A) Vector modules are designated a ‘position’ and combined in the vector construction as shown.
Sequences (5’→ 3’) used to anneal the fragments in order are shown (colour-coded) at junctions between
modules and remain in the final construct as a scar. (B) Modules at each position. Position 1: Cloning Sites -
Golden Gate level 1 and Golden Gate level 2; position 2: Antibiotic resistance – neomycin-, gentamicin- and
tetracycline-resistance cassettes; position 3: Origins of replication and transfer - RK2 with oriT and pBBR1
with oriT; positions 4-6: Accessory modules - par locus for stable plasmid maintenance in the absence of
antibiotic selection. Endlinker modules were designed to circularize the plasmid. 576
28 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
FIG 2 A) Schematic map of pOGG024 level 1 broad-host range, high copy number vector constructed with
BEVA for free-living gene expression in laboratory. B) Schematic map of plasmid pOPS0359 containing a
cloned gene sf-GFP under the control of a taurine-inducible promoter from Sinorhizobium meliloti into
pOGG024. C-F) Evaluation of pOPS0359 performance as robust free-living gene expression compared to
the functionally analogous pLMB509 plasmid. C-D) Florescence detection from GFP expression and E- F)
Fitness performance by measurement of OD600 when grow without (0 mM) or with (0.5, 1.0, 10 or mM)
577 taurine.
29 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
FIG 3 A) Schematic map of pOGG026 level 1 broad-host range, lower copy number vector constructed with
BEVA for stable environmental gene expression in the absence of antibiotic selection. B-D) Schematic map
of plasmids containing a cloned B) gusA C) celB and D) sfGFP gene under the control of nifH gene
promoter (pNifH). E) Pea nodules formed by Rlv3841[pOPS253] stained with Magenta-glc. Marker gene
gusA is just expressed in nodules. F) Pea nodules formed by Rlv3841[pOPS254] and G) bean nodules
formed by CIAT899[pOPS253] stained with X-gal after thermal treatment. Marker gene celB is just
expressed in nodules. H) Pea nodules formed by Rlv384[pOPS0379], bright-field (top) and fluorescence
(GFP filter) (bottom) images. GFP expression is exclusively found in the nitrogen-fixing zone. 578
30 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
FIG 4 (A) Schematic map of pOGG216 level 2 broad-host range, medium copy number vector constructed
with BEVA for multi-gene expression. (B) Schematic map of pOPS0754 dual reporter plasmid which
encodes IPTG-inducible sfGFP cloned in Forward Position 1 and constitutively mCherry cloned in Forward
Position 2. (C-D) Fluorescence of Rlv3841 and Rlv3841[pOPS0754] grown on media containing 0.5 mM
IPTG. (C) Green fluorescence from IPTG-inducible sfGFP (scale, 3,000–30,000 cps). (D) Red fluorescence
from constitutively expressed mCherry (scale, 1,500–15,000 cps). 579
31 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
TABLE 1 Design of modules for vector construction
Module Cloned -side -side Module Description of module 5’ 3’ size (kb) module 5’ 3’ 5’ 3’ Position 1: Cloning sites TGCC GCAA
pLVC- P1-Lv1 Golden Gate Level 1 cloning site with cloned lacZ 2601 pOGG004
Golden Gate Level 1 cloning site 2420 pOGG005 pLVC- P1-Lv2 Golden Gate Level 2 cloning site 5729 pOGG006
Position 2: Antibiotic resistance GCAA ACTA
pLVC- P2-neo Neomycin/kanamycin-resistance 936 pOGG008
pLVC- P2-gent Gentamicin-resistance 813 pOGG009 pLVC- P2-tet Tetracycline-resistance 1964 pOGG042
Position 3: Origins of replication and transfer ACTA TTAC
RK2 (IncP) origin of replication for low copy number plasmid, oriT pLVC- P3-RK2 2485 pOGG010 from E. coli for plasmid transfer pBBR1 origin of replication for medium copy number plasmid, oriT pLVC- P3-pBBR1 1784 pOGG011 from E. coli for plasmid transfer Position 4: Accessory TTAC CAGA
pLVC- P4-par Partition genes (parABCDE) for plasmid stability in absence of 2408 pOGG012 antibiotic selection Position 5: Accessory CAGA TGTG
Position 6: Accessory TGTG GAGC
Endlinker
pLVC-ELT-3 Endlinker to circularize plasmid after position 3 113 pOGG013 TTAC TGCC pLVC-ELT-4 Endlinker to circularize plasmid after position 4 113 pOGG014 CAGA TGCC pLVC-ELT-5 Endlinker to circularize plasmid after position 5 113 pOGG015 TGTG TGCC pLVC-ELT-6 Endlinker to circularize plasmid after position 6 113 pOGG016 GAGC TGCC
bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
TABLE 2 Strains, plasmids and primers used in this study
Strain, plasmid Source or Description Addgene ID or primer reference Strain
E. coli strains
Competent cells. Genotype: F - deoR endA1 recA1 relA1 gyrA96 hsdR17(rk - , mk + ) α -Select Gold Bioline supE44 thi- phoA Δ lac)YA argF U Φ lac)ΔM λ - Competent cells. Genotype: F- Φ lac)ΔM Δ lac)YA-argF) U169 recA1 endA1 DH α Invitrogen hsdR17(rk-, mk+) phoA supE44 thi- gyrA relA λ- R. Johnston and leguminosarum Rhizobium leguminosarum bv. viciae, derivative of strain 300, Strr Beringer
bv. viciae 3841 (1975) Rhizobium tropici Graham et al., Rhizobium tropici,Rfr CIAT899 (1982) Plasmid
Prell et al., pJP2 pTR102 GUS with artificial MCS, Apr Tcr (2002) ENSA, supplied EC15071 pL0M- SC-mCherry. Level 0 SC module cloned in pMS, Spr by Invitrogen pMS Vector with ColE1 origin of replication in which modules are supplied from Invitrogen, Spr Invitrogen
Tett., et al pLMB509 Highly inducible His tag expression vector, Gmr. 40084 (2012) bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
pL0M- PU-pNeo, promoter 379 bp upstream from of the start codon of luxC from pIJ11268 pOGG001 This study 113978 of nptII for constitutive gene expression. Level 0 PU module cloned inpMS, Spr pOGG003 pL0M-T-pharma. Level 0 T module cloned in pMS, Spr Invitrogen
pLVC- P1-Lv1 (Golden Gate Level 1 cloning site with cloned lacZ ) position 1 module for pOGG004 This study 113979 vector construction cloned in pMS, Spr pL1V-Lv1-amp-ColE1, Level 1 cloning vector, high copy number used for protein pOGG005 This study 113980 expression in E. coli, Apr pLVC- P1-Lv2, Golden Gate Level 2 cloning site, position 1 module for vector construction pOGG006 This study 113981 cloned in pMS, Spr pLVC- P2-neo, neomycin-resistance gene, position 2 module for vector construction cloned pOGG008 This study 113982 in pMS, Spr Nmr/Kanr pLVC- P2-gent, gentamicin-resistance gene, position 2 module for vector construction pOGG009 This study 113983 cloned in pMS, Spr Gmr pLVC- P3-RK2, RK2 origin of replication and oriT from E.coli, position 3 module for vector pOGG010 This study 113984 construction cloned in pMS, Spr pLVC- P3-pBBR1, pBBR1 origin of replication and oriT from E.coli, position 3 module for pOGG011 This study 113985 vector construction cloned in pMS, Spr pLVC- P4-par, partition genes (parABCDE from pMS) for plasmid stability, position 4 pOGG012 This study 113986 module for vector construction cloned in pMS, Spr pLVC-ELT-3, connecting position 3 to position 1 to circulaise vector, endlinker module for pOGG013 This study 113987 vector construction cloned in pMS, Spr pLVC-ELT-4, connecting position 4 to position 1 to circulaise vector, endlinker module for pOGG014 This study 113988 vector construction cloned in pMS, Spr bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
pLVC-ELT-5, connecting position 5 to position 1 to circulaise vector, endlinker module for pOGG015 This study 113989 vector construction cloned in pMS, Spr pLVC-ELT-6, connecting position 6 to position 1 to circulaise vector, endlinker module for pOGG016 This study 113990 vector construction cloned in pMS, Spr Weber., et al pOGG021 Destination vector for pL1V-F1, Apr (2011) pL1V-Lv1-gent-pBBR1-ELT3, 3.4 kb, medium copy, broad-host range Level 1 cloning pOGG024 This study 113991 vector, Gmr pL1V-Lv1-neo-RK2-par-ELT4, 6.6 kb, low copy, environmentally-stable, broad-host range pOGG026 This study 113992 Level 1 cloning vector, Nmr/Kanr pL0M- PU-pT7lacO, IPTG-inducible T7RNAP promoter 88 bp promoter and RBS driving pOGG030 recombinant protein expression in the pET and pOPIN vectors. Level 0 PU module cloned This study 113993 in pMS, Spr pL0M- PU-pLac, IPTG-inducible promoter 250 bp immediately upstream of the lacZ alpha pOGG031 This study 113994 fragment start codon in pRK415. Level 0 PU module cloned in pMS, Spr pOGG037 pL0M- SC-sfGFP, pMSX Level 0 SC module cloned in pMS, Spr This study 113995 pOGG039 pL0M-T-T7. Level 0 T module cloned in pMS, Spr This study 113996 pL0M- PU-pTau, Taurine-inducible promoter for Alphaproteobacteria, Level 0 PU module pOGG041 This study 113997 cloned in pMS, Spr pLVC- P2-tet, tetracycline-resistance gene (tetAR) from pJP2. Made by PCR using oxp0734 pOGG042 This study. 113998 and oxp0735 primers in position 2 module for vector construction cloned in pMS, Spr Tetr pOGG050 pL0M- SC-celB. Level 0 SC module cloned in pMS, Spr This study 113999 Weber., et al pOGG054 Destination vector for pL1V-F2, Apr (2011) bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Weber., et al pOGG056 Destination vector for Level 2 Endlinker ELB-2 , Apr (2011) Weber., et al pOGG068 Destination vector for pL0V-PU, Spr (2011) Weber., et al pOGG072 Destination vector for pL0V-SC, Spr (2011) pL0M- PU-pNifH, promoter 714 bp upstream of the ATG of nifH for nodule-specific gene pOGG082 expression in R. leguminosarum. Made by PCR using oxp0474 and oxp0475 primers and This study. 114000 cloned in destination vector pOGG068, Spr pL0M- SC-gusA, gusA gene from pJP2. Made by PCR using oxp0376 and oxp0377 primers pOGG083 This study. 114001 and cloned in destination vector pOGG072. Spr pOGG202 pL1M- F1-plac (pOGG031), sfGFP (pOGG037) and T-pharma (pOGG003), Apr This study. 115503 pOGG203 pL1M- F2-pNeo (pOGG001), mCherry (EC15071) and T-pharma (pOGG003), Apr This study. 115504 pL2V- L2-tet-pBBR-ELT3, 9.5kb, medium copy, broad-host range. Level 2 cloning vector, pOGG216 This study 114002 Tetr Reporter plasmid constructed with Rlv3841pNifH (pOGG082), gusA (pOGG083) and T- pOPS0253 This study pharma (pOGG003) assembled in pOGG026, Nmr/Kanr 115505 Reporter plasmid constructed with Rlv3841pNifH (pOGG082) celB (pOGG050) and T- pOPS0254 This study pharma (pOGG003) assembled in pOGG026, Nmr/Kanr 115506 Reporter Plasmid constructed with constitutive promoter pNeo (pOGG001) celB pOPS0314 This study (pOGG050) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr 115507 Reporter plasmid constructed with pTau (pOGG041), sfGFP (pOGG037) and T-pharma pOPS0359 This study (pOGG003) assembled in pOGG024, Nmr/Kanr 115508 bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Reporter Plasmid constructed with constitutive promoter pNeo (pOGG001) sfGFP pOPS0377 This study (pOGG037) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr 115509 Reporter plasmid constructed with Rlv3841pNifH(pOGG082) sfGFP (pOGG037) and T- pOPS0379 This study pharma (pOGG003) assembled in pOGG026, Nmr/Kanr 115510 Reporter Plasmid constructed with constitutive promoter pNeo (pOGG001) gusA pOSP0750 This study (pOGG083) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr 115511 Dual reporter plasmid. Forward position 1 pOGG202, forward position 2 pOGG203 and pOPS0754 This study level 2 Endlinker ELB-2 (pOGG056) assembled in pOGG216, Tetr 115512 Primer
Forward primer for amplification of gusA gene for SC module. Sequence: This study oxp0376 CACTCTGTGGTCTCAAATGGTCCGTCCTGTAG Reverse primer for amplification of gusA gene for SC module. Sequence: This study oxp0377 CACTTCGTGGTCTCAAAGCTCATTGTTTGCCTCCC Forward primer for amplification of tetracycline-resistance gene (tetAR) from pJP2. Used in position 2 module for vector construction. Sequence: This study
oxp0734 TTTTGAAGACAAGAATACAGTCATAAGTGCGGC Reverse primer for amplification of tetracycline-resistance gene (tetAR) from pJP2. Used in position 2 module for vector construction. Sequence: This study
oxp0735 TTTTTGAAGACAATGCCGGTCTCCATAACCGGA Forward primer for amplification of pNifH region of Rlv3841 plasmid pRL10 for PU This study oxp0474 module. Sequence: CACTCTGTGGTCTCAGGAGTCGATGCTGACCGCCT Reverse primer for amplification of pNifH region of Rlv3841 plasmid pRL10 for PU module. This study oxp0475 Sequence: CACTTCGTGGTCTCACATTTTTGGCGTTCCTTCATGTGT bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Ampr, ampicillin resistance; Gmr, gentamicin resistance; Kanr, kanamycin resistance; Nmr, neomycin resistance; Rfr , rifampicin resistance, Tetr, tetracycline resistance. bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
TABLE 3 Le el odules fo lo i g i a Le el e to
Module Clo ed 5’-side 3’-side Module Des riptio of odule size p odule 5’ → 3’ 5’ → 3’
PU odules: pro oters with riboso e-bi di g sites GGAG AATG pL M-PU-pNeo P o ote upst ea of ptII fo o stituti e ge e e p essio pOGG pL M-PU-pT la O IPTG-i du i le T RNAP p o ote pOGG pL M-PU-pLa IPTG-i du i le p o ote pOGG pL M-PU-pTau Tau i e-i du i le p o ote fo Alphap oteo a te ia pOGG pL M-PU-pNifH P o ote upst ea of ifH fo odule-spe ifi ge e e p essio i R. pOGG
legu i osaru SC odules: ORFs AATG GCTT pL M-SC- Che Red fluo es e e p otei Che , epo te of ge e e p essio EC pL M-SC-sfGFP Supe folde GFP, sta le a d ight epo te of ge e e p essio pOGG pL M-SC- elB The osta le eta-gala tosidase, epo te of ge e e p essio pOGG pL M-SC-gusA Beta-glu osidase ge e, epo te of ge e e p essio pOGG T odules: ter i ators GCTT CGCT pL M-T-pha a Pha a ia te i ato I it oge pOGG pL M-T-T Te i ato fo T RNAP pOGG
All odules e e supplied lo ed i Sp plas id pMS e ept fo pOGG a d pOGG . Follo i g BsaI digestio of lo ed odules a d a Le el e to , the esulti g o e ha gs a e used to a eal the f ag e ts i a li ea fashio a d the se ue es sho e ai et ee odules upo ligatio .
bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/392423; this version posted August 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.