DOCSLIB.ORG

Mouse Baiap2 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Baiap2 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Baiap2 Knockout Project (CRISPR/Cas9) Objective: To create a Baiap2 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Baiap2 gene (NCBI Reference Sequence: NM_130862 ; Ensembl: ENSMUSG00000025372 ) is located on Mouse chromosome 11. 14 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 14 (Transcript: ENSMUST00000075180). Exon 2~3 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygotes for a knock-out allele show mid to late gestation lethality, developmental delay, oligodactyly, subcutaneous edema, and severely impaired cardiac and placental development. Adult homozygotes fail to regulate synaptic plasticity and exhibit hippocampus-associated learning deficits. Exon 2 starts from about 3.51% of the coding region. Exon 2~3 covers 10.41% of the coding region. The size of effective KO region: ~3142 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 14 Legends Exon of mouse Baiap2 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 3 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(17.9% 358) | C(26.5% 530) | T(29.35% 587) | G(26.25% 525) Note: The 2000 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(23.25% 465) | C(23.55% 471) | T(29.1% 582) | G(24.1% 482) Note: The 2000 bp section downstream of Exon 3 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr11 + 119955103 119957102 2000 browser details YourSeq 23 647 669 2000 100.0% chr2 + 59817904 59817926 23 browser details YourSeq 22 816 837 2000 100.0% chrY + 10680671 10680692 22 browser details YourSeq 21 756 776 2000 100.0% chr1 + 110002634 110002654 21 browser details YourSeq 20 1980 1999 2000 100.0% chr1 + 21485421 21485440 20 Note: The 2000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr11 + 119960245 119962244 2000 browser details YourSeq 79 878 994 2000 85.1% chr10 - 60499446 60499561 116 browser details YourSeq 78 883 1008 2000 83.7% chr15 - 81545728 81545846 119 browser details YourSeq 76 883 993 2000 82.5% chr16 - 94263865 94263973 109 browser details YourSeq 76 880 1009 2000 88.8% chr14 + 50901964 50902094 131 browser details YourSeq 74 883 993 2000 84.9% chr10 - 20218429 20218538 110 browser details YourSeq 73 899 993 2000 89.5% chr11 - 50117356 50357172 239817 browser details YourSeq 72 883 993 2000 85.3% chr15 - 55026522 55026631 110 browser details YourSeq 72 880 993 2000 81.6% chr1 + 21301175 21301288 114 browser details YourSeq 71 883 993 2000 83.2% chr11 - 114898540 114898653 114 browser details YourSeq 71 879 1008 2000 85.9% chr11 - 94948123 94948247 125 browser details YourSeq 71 883 993 2000 82.0% chr16 + 34060170 34060280 111 browser details YourSeq 71 883 1013 2000 83.4% chr13 + 93317092 93317221 130 browser details YourSeq 71 883 1011 2000 81.0% chr11 + 46187357 46187483 127 browser details YourSeq 69 883 1009 2000 74.4% chr10 - 117820240 117820360 121 browser details YourSeq 69 880 1008 2000 83.2% chr15 + 8540595 8540718 124 browser details YourSeq 68 883 1007 2000 82.3% chr18 - 60758205 60758327 123 browser details YourSeq 68 883 1010 2000 89.6% chr13 - 62768133 62768261 129 browser details YourSeq 68 883 1008 2000 83.0% chr10 + 108471451 108471574 124 browser details YourSeq 67 885 1008 2000 85.3% chr1 + 87297359 87297481 123 Note: The 2000 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Baiap2 brain-specific angiogenesis inhibitor 1-associated protein 2 [ Mus musculus (house mouse) ] Gene ID: 108100, updated on 12-Aug-2019 Gene summary Official Symbol Baiap2 provided by MGI Official Full Name brain-specific angiogenesis inhibitor 1-associated protein 2 provided by MGI Primary source MGI:MGI:2137336 See related Ensembl:ENSMUSG00000025372 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as IRSp53; R75030 Expression Ubiquitous expression in frontal lobe adult (RPKM 31.0), cortex adult (RPKM 30.6) and 27 other tissues See more Orthologs human all Genomic context Location: 11; 11 E2 See Baiap2 in Genome Data Viewer Exon count: 16 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 11 NC_000077.6 (119939916..120006782) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 11 NC_000077.5 (119804406..119868096) Chromosome 11 - NC_000077.6 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 9 transcripts Gene: Baiap2 ENSMUSG00000025372 Description brain-specific angiogenesis inhibitor 1-associated protein 2 [Source:MGI Symbol;Acc:MGI:2137336] Gene Synonyms IRSp53 Location Chromosome 11: 119,942,763-120,006,782 forward strand. GRCm38:CM001004.2 About this gene This gene has 9 transcripts (splice variants), 247 orthologues, 2 paralogues, is a member of 1 Ensembl protein family and is associated with 11 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Baiap2- ENSMUST00000075180.11 3518 522aa ENSMUSP00000074674.5 Protein CCDS25724 Q3UKP6 TSL:1 202 coding Q8BKX1 GENCODE basic APPRIS ALT1 Baiap2- ENSMUST00000103021.9 3398 482aa ENSMUSP00000099310.3 Protein CCDS25723 Q8BKX1 TSL:1 203 coding GENCODE basic Baiap2- ENSMUST00000026436.9 2394 535aa ENSMUSP00000026436.3 Protein CCDS25722 Q8BKX1 TSL:1 201 coding GENCODE basic APPRIS P4 Baiap2- ENSMUST00000106231.7 4005 513aa ENSMUSP00000101838.1 Protein - Q8BKX1 TSL:1 204 coding GENCODE basic Baiap2- ENSMUST00000106233.1 2442 521aa ENSMUSP00000101840.1 Protein - B1AZ46 TSL:5 205 coding GENCODE basic APPRIS ALT1 Baiap2- ENSMUST00000152523.7 585 No - lncRNA - - TSL:2 209 protein Baiap2- ENSMUST00000146566.1 433 No - lncRNA - - TSL:3 207 protein Baiap2- ENSMUST00000131580.1 360 No - lncRNA - - TSL:5 206 protein Baiap2- ENSMUST00000146960.1 276 No - lncRNA - - TSL:5 208 protein Page 7 of 9 https://www.alphaknockout.com 84.02 kb Forward strand 119.94Mb 119.96Mb 119.98Mb 120.00Mb Genes (Comprehensive set... Gm11766-201 >lncRNA Baiap2-208 >lncRNA Baiap2-206 >lncRNA Baiap2-205 >protein coding Baiap2-203 >protein coding Mir3065-201 >miRNA Baiap2-202 >protein coding Baiap2-204 >protein coding Baiap2-201 >protein coding Baiap2-209 >lncRNA Baiap2-207 >lncRNA Contigs AL929234.9 > AL953913.5 > Genes < Gm11767-201lncRNA < Aatk-201protein coding (Comprehensive set... < Aatk-202protein coding < Aatk-203protein coding < Aatk-209lncRNA < Aatk-208lncRNA < Mir338-201miRNA < Aatk-207lncRNA < Aatk-205lncRNA < Aatk-204lncRNA < Aatk-206lncRNA Regulatory Build 119.94Mb 119.96Mb 119.98Mb 120.00Mb Reverse strand 84.02 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding RNA gene Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000075180 59.86 kb Forward strand Baiap2-202 >protein coding ENSMUSP00000074... MobiDB lite Low complexity (Seg) Superfamily AH/BAR domain superfamily SH3-like domain superfamily SMART SH3 domain Pfam IMD/I-BAR domain SH3 domain PROSITE profiles IMD/I-BAR domain SH3 domain PANTHER I-BAR domain containing protein IRSp53 I-BAR domain containing protein IRSp53/IRTKS/Pinkbar Gene3D AH/BAR domain superfamily 2.30.30.40 CDD cd07646 IRSp53, SH3 domain All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend synonymous variant Scale bar 0 60 120 180 240 300 360 420 522 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 9 of 9.
Load more

Recommended publications
  • Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins.
    [Show full text]
  • 1 Running Head
    medRxiv preprint doi: https://doi.org/10.1101/2020.09.16.20194639; this version posted August 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . RUNNING HEAD: Alcohol use disorder dual methylation study Dual methylation and hydroxymethylation study of alcohol use disorder Shaunna L. Clark1, Robin F. Chan2, Min Zhao2, Lin Y. Xie2, William E. Copeland3, Brenda W.J.H. Penninx3, Karolina A. Aberg2, Edwin J.C.G. van den Oord2 1Department of Psychiatry, Texas A&M University 2Center for Biomarker Research and Precision Medicine, Virginia Commonwealth University 3 Department of Psychiatry, University of Vermont 4 Department of Psychiatry, Amsterdam UMC, Vrije Universiteit, Amsterdam, The Netherlands Corresponding Author: Shaunna L. Clark, Email: [email protected]; Address: 8441 Riverside Parkway, Bryan, TX, 77807; Phone: (979) 436-0179 NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.09.16.20194639; this version posted August 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . ABSTRACT Using an integrative, multi-tissue design we sought to characterize methylation and hydroxymethylation changes in blood and brain associated with alcohol use disorder (AUD).
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]
  • Indications of Linkage and Association of Gilles De La Tourette Syndrome in Two Independent Family Samples: 17Q25 Is a Putative Susceptibility Region P
    Am. J. Hum. Genet. 75:545–560, 2004 Indications of Linkage and Association of Gilles de la Tourette Syndrome in Two Independent Family Samples: 17q25 Is a Putative Susceptibility Region P. Paschou,1 Y. Feng,2 A. J. Pakstis,1 W. C. Speed,1 M. M. DeMille,1 J. R. Kidd,1 B. Jaghori,2 R. Kurlan,5 D. L. Pauls,6 P. Sandor,2,3 C. L. Barr,2,4 and K. K. Kidd1 1Department of Genetics, Yale University School of Medicine, New Haven; 2Toronto Western Research Institute, University Health Network, 3Department of Psychiatry, University of Toronto, and 4Department of Psychiatry, Brain and Behaviour Programme, The Hospital for Sick Children, Toronto; 5Cognitive and Behavioral Neurology Unit, Department of Neurology, University of Rochester School of Medicine, Rochester, NY; and 6Psychiatric and Neurodevelopmental Genetics Unit, Department of Psychiatry, Massachusetts General Hospital, Harvard Medical School, Charlestown, MA Gilles de la Tourette syndrome (GTS) is characterized by multiple motor and phonic tics and high comorbidity rates with other neurobehavioral disorders. It is hypothesized that frontal-subcortical pathways and a complex genetic background are involved in the etiopathogenesis of the disorder. The genetic basis of GTS remains elusive. However, several genomic regions have been implicated. Among them, 17q25 appears to be of special interest, as suggested by various independent investigators. In the present study, we explored the possibility that 17q25 con- tributes to the genetic component of GTS. The initial scan of chromosome 17 performed on two large pedigrees provided a nonparametric LOD score of 2.41 near D17S928. Fine mapping with 17 additional microsatellite markers increased the peak to 2.61 (P p .002 ).
    [Show full text]
  • Rho Gtpase Cdc42 Controls Invariant Chain Processing and MHC II Loading in Dendritic Cells
    Aus dem Institut für Immunologie der Ludwig-Maximilians-Universität München Vorstand: Prof. Dr. Thomas Brocker Rho GTPase Cdc42 controls invariant chain processing and MHC II loading in Dendritic Cells Dissertation zum Erwerb des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) an der Medizinischen Fakultät der Ludwig-Maximilians-Universität München vorgelegt von Anna Schulz, geb. Wähe aus Darmstadt 2013 Gedruckt mit Genehmigung der Medizinischen Fakultät der Ludwig-Maximilians-Universität München Betreuer: Prof. Dr. Thomas Brocker Zweitgutachter: Prof. Dr. Patrick A. Baeuerle Dekan: Prof. Dr. med Dr.h.c. Maximilian Reiser, FACR, FRCR Tag der mündlichen Prüfung: 06.11.2013 ii AUTHOR’S DECLARATION Ich versichere hiermit ehrenwörtlich, dass die vorgelegte Dissertation „Rho GTPase Cdc42 controls invariant chain processing and MHC II loading in Dendritic Cells“ von mir selbständig und ohne unerlaubte Hilfe angefertigt wurde. Ich habe mich dabei keiner anderen als der von mir ausdrücklich bezeichneten Hilfen und Quellen bedient. Die Dissertation wurde in der jetzigen oder ähnlichen Form bei keiner anderen Hochschule eingereicht und hat auch noch keinen anderen Prüfungszwecken gedient. Anna Schulz iii This work contains results presented in the following publication: Schulz, A. et al. Rho GTPase Cdc42 controls invariant chain processing and MHC II loading in Dendritic Cells. Manuscript in preparation. This publication was also achieved and will be cited as “Paper I”: Luckashenak, N.*, Wähe, A.*, Breit, K., Brakebusch, C., Brocker, T. 2013. Rho- family GTPase Cdc42 controls migration of Langerhans cells in vivo. J Immunol. 190:27-35. *equal contribution iv ABBREVIATIONS ABBREVIATIONS SI Units were applied as described elsewhere. APC 1. antigen presenting cell 2.
    [Show full text]
  • Moyamoya Disease: a Review of Histopathology, Biochemistry, and Genetics
    Neurosurg Focus 30 (6):E20, 2011 Moyamoya disease: a review of histopathology, biochemistry, and genetics DAVID G. WEINBERG, B.S., OMAR M. ARNAOUT, M.D., RUDY J. RAHME, M.D., SALAH G. AOUN, M.D., H. HUNT BATJER, M.D., AND BERNARD R. BENdoK, M.D. Department of Neurological Surgery, Feinberg School of Medicine, and McGaw Medical Center, Northwestern University, Chicago, Illinois Object. Moyamoya disease (MMD) is a rare cerebrovascular disorder involving stenosis of the major vessels of the circle of Willis and proximal portions of its principal branches. Despite concerted investigation, the pathophysiol- ogy of the disorder has not been fully elucidated. Currently, the major proteins believed to play an active role in the pathogenesis include vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), hepatocyte growth factor (HGF), transforming growth factor–b1 (TGFb1), and granulocyte colony-stimulating factor (G-CSF). In terms of the genetics, recent literature suggests a low penetrance autosomal dominant or polygenic mode of transmis- sion involving chromosomes 3, 6, 8, 12, and 17 for familial MMD. This review summarizes the current knowledge on the histopathology, pathophysiology and genetics of MMD. Methods. A PubMed/Medline systematic study of the literature was performed, from which 45 articles regarding MMD pathophysiology were identified and analyzed. Conclusions. Moyamoya disease is characterized by the intimal thickening and media attenuation of the proximal vessels of the circle of Willis as well as the development of an aberrant distal vascular network. The primary proteins that are currently implicated in the pathophysiology of MMD include VEGF, bFGF, HGF, TGFb1, and G-CSF.
    [Show full text]
  • Effect of Myoferlin Depletion on Breast Cancer Cell Motility THESIS
    Effect of Myoferlin Depletion on Breast Cancer Cell Motility THESIS Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University By Leonithas Ioannis Volakis Graduate Program in Biomedical Engineering The Ohio State University 2011 Master's Examination Committee: Professor Douglas A. Kniss, Advisor Professor Samir N. Ghadiali Professor Heather M. Powell Copyright by Leonithas Ioannis Volakis 2011 Abstract Cancer metastasis requires tumor cell invasion, migration, and proliferation. Cell migration involves a complex series of processes that extend membrane protrusions to form substrate adhesions that cause cytoskeleton contraction within the cell. Further, cell migration is central to tissue repair, regeneration, development, cancer, and inflammation. The ferlins, an evolutionary conserved protein family, have been implicated as critical to maintaining plasma membranes. Specifically, myoferlin (MYOF), a mammalian ferlin, has been shown as responsible for membrane exocytosis/endocytosis and myoblast fusion. More recent studies have demonstrated that MYOF affects the anti-angiogenic response of endothelial cells and impacts the invasive ability of MDA-MB-231 breast cancer cells. It has also been noted that ablating MYOF using RNAi strategies results in consistent cell proliferation rates and a mesenchymal to epithelial phenotypic transformation. In this study, we present quantified 2D morphologic and migration differences in MDA-MB-231 wild-type (231WT) and RNAi-mediated MYOF-deficient (231MYOFKD) human breast adenocarcinoma (MDA-MB-231) cells. Morphometrics found that MYOF deficiency led to significant differences in lamellipodia number and surface area, filopodia length, and cell surface area. These marked changes could suggest that MYOF plays a role in regulating cytoskeletal arrangement in breast cancer cells.
    [Show full text]
  • Eps8 (NM 001271588) Mouse Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC229000 Eps8 (NM_001271588) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Eps8 (NM_001271588) Mouse Untagged Clone Tag: Tag Free Symbol: Eps8 Synonyms: AW261790 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Eps8 (NM_001271588) Mouse Untagged Clone – MC229000 Fully Sequenced ORF: >MC229000 representing NM_001271588 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAATGGTCATATGTCTAACCGCTCCAGTGGGTATGGAGTCTACCCTTCTCAACTGAATGGTTACGGAT CTTCACCACCCTATTCCCAGATGGACAGAGAACACAGCTCAAGAACAAGTGCAAAGGCCCTTTATGAACA AAGGAAGAACTATGCCCGAGACAGTGTCAGCAGTGTGTCGGACGTGTCCCAGTACCGCGTGGAACACTTG ACCACCTTCGTGCTGGATCGGAAAGATGCAATGATCACTGTCGAGGACGGAATAAGAAAGCTGAAGTTGC TGGATGCCAAGGGCAAAGTGTGGACTCAAGATATGATTCTCCAAGTGGATGACCGAGCTGTGAGCCTGAT TGACTTAGAGTCAAAGAATGAATTGGAGAATTTTCCTCTAAACACAATCTCGCATTGTCAAGCAGTGGTA CATGCATGCAGCTATGACTCCATTCTCGCCTTGGTATGCAAAGAGCCAACGCAGAGCAAGCCAGACCTTC ACCTTTTCCAGTGTGATGAGGTTAAGGCAAACCTAATTAGTGAAGATATCGAAAGTGCAATCAGTGACAG TAAAGGTGGGAAACAGAAGAGGCGGCCGGAGGCCCTGAGGATGATTGCCAAAGCAGATCCTGGCATCCCT
    [Show full text]
  • Synaptic Pathways Related to Shank3 and Its Interaction Partner Prosapip1
    International Graduate School in Molecular Medicine Ulm International PhD Programme in Molecular Medicine Synaptic pathways related to Shank3 and its interaction partner ProSAPiP1 Dissertation submitted in partial fulfilment of the requirements for the degree of „Doctor rerum naturalium” (Dr. rer. nat.) of the International Graduate School in Molecular Medicine Ulm Dominik Reim Born in Nürtingen, Germany Institute for Anatomy and Cell Biology, Head: Prof. Dr. Tobias M. Böckers 2016 1. Current dean / chairman of the Graduate School: Prof. Dr. Michael Kühl 2. Thesis Advisory Committee: - First supervisor: Prof. Dr. Tobias M. Böckers - Second supervisor: Prof. Dr. Thomas Wirth - Third supervisor: Dr. Chiara Verpelli 3. External reviewer: Prof. Dr. Matthias Kneussel 4. Day doctorate awarded: March 20, 2017 Results gained in my thesis have previously been published in the following publications: Reim, D., Distler, U., Halbedl, S., Verpelli, C., Sala, C., Bockmann, J., Tenzer, S., Boeckers, T.M., and Schmeisser, M.J. (2017). Proteomic analysis of postsynaptic density fractions from Shank3 mutant mice reveals brain region specific changes relevant to autism spectrum disorder. Front Mol Neurosci, doi: 10.3389/fnmol.2017.00026 Reim, D., Weis, T.M., Halbedl, S., Delling, J.P., Grabrucker, A.M., Boeckers, T.M., and Schmeisser, M.J. (2016). The Shank3 Interaction Partner ProSAPiP1 Regulates Postsynaptic SPAR Levels and the Maturation of Dendritic Spines in Hippocampal Neurons. Front Synaptic Neurosci 8, 13, doi: 10.3389/fnsyn.2016.00013 Vicidomini, C., Ponzoni, L., Lim, D., Schmeisser, M.J., Reim, D., Morello, N., Orellana, D., Tozzi, A., Durante, V., Scalmani, P., Mantegazza, M., Genazzani, A.A., Giustetto, M., Sala, M., Calabresi, P., Boeckers, T.M., Sala, C., and Verpelli, C.
    [Show full text]
  • Transposon Mutagenesis Identifies Genetic Drivers of Brafv600e Melanoma
    ARTICLES Transposon mutagenesis identifies genetic drivers of BrafV600E melanoma Michael B Mann1,2, Michael A Black3, Devin J Jones1, Jerrold M Ward2,12, Christopher Chin Kuan Yew2,12, Justin Y Newberg1, Adam J Dupuy4, Alistair G Rust5,12, Marcus W Bosenberg6,7, Martin McMahon8,9, Cristin G Print10,11, Neal G Copeland1,2,13 & Nancy A Jenkins1,2,13 Although nearly half of human melanomas harbor oncogenic BRAFV600E mutations, the genetic events that cooperate with these mutations to drive melanogenesis are still largely unknown. Here we show that Sleeping Beauty (SB) transposon-mediated mutagenesis drives melanoma progression in BrafV600E mutant mice and identify 1,232 recurrently mutated candidate cancer genes (CCGs) from 70 SB-driven melanomas. CCGs are enriched in Wnt, PI3K, MAPK and netrin signaling pathway components and are more highly connected to one another than predicted by chance, indicating that SB targets cooperative genetic networks in melanoma. Human orthologs of >500 CCGs are enriched for mutations in human melanoma or showed statistically significant clinical associations between RNA abundance and survival of patients with metastatic melanoma. We also functionally validate CEP350 as a new tumor-suppressor gene in human melanoma. SB mutagenesis has thus helped to catalog the cooperative molecular mechanisms driving BRAFV600E melanoma and discover new genes with potential clinical importance in human melanoma. Substantial sun exposure and numerous genetic factors, including including BrafV600E, recapitulate the genetic and histological hallmarks skin type and family history, are the most important melanoma risk of human melanoma. In these models, increased MEK-ERK signaling factors. Familial melanoma, which accounts for <10% of cases, is asso- initiates clonal expansion of melanocytes, which is limited by oncogene- ciated with mutations in CDKN2A1, MITF2 and POT1 (refs.
    [Show full text]
  • A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression
    Supplementary Materials A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression Table S1. Statistically significant DEGs (Adj. p-value < 0.01) derived from meta-analysis for samples irradiated with high doses of HZE particles, collected 6-24 h post-IR not common with any other meta- analysis group. This meta-analysis group consists of 3 DEG lists obtained from DGEA, using a total of 11 control and 11 irradiated samples [Data Series: E-MTAB-5761 and E-MTAB-5754]. Ensembl ID Gene Symbol Gene Description Up-Regulated Genes ↑ (2425) ENSG00000000938 FGR FGR proto-oncogene, Src family tyrosine kinase ENSG00000001036 FUCA2 alpha-L-fucosidase 2 ENSG00000001084 GCLC glutamate-cysteine ligase catalytic subunit ENSG00000001631 KRIT1 KRIT1 ankyrin repeat containing ENSG00000002079 MYH16 myosin heavy chain 16 pseudogene ENSG00000002587 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 ENSG00000003056 M6PR mannose-6-phosphate receptor, cation dependent ENSG00000004059 ARF5 ADP ribosylation factor 5 ENSG00000004777 ARHGAP33 Rho GTPase activating protein 33 ENSG00000004799 PDK4 pyruvate dehydrogenase kinase 4 ENSG00000004848 ARX aristaless related homeobox ENSG00000005022 SLC25A5 solute carrier family 25 member 5 ENSG00000005108 THSD7A thrombospondin type 1 domain containing 7A ENSG00000005194 CIAPIN1 cytokine induced apoptosis inhibitor 1 ENSG00000005381 MPO myeloperoxidase ENSG00000005486 RHBDD2 rhomboid domain containing 2 ENSG00000005884 ITGA3 integrin subunit alpha 3 ENSG00000006016 CRLF1 cytokine receptor like
    [Show full text]
  • Rho Gtpase Regulators and Effectors in Autism Spectrum Disorders
    cells Review Rho GTPase Regulators and Effectors in Autism Spectrum Disorders: Animal Models and Insights for Therapeutics Daji Guo , Xiaoman Yang and Lei Shi * JNU-HKUST Joint Laboratory for Neuroscience and Innovative Drug Research, College of Pharmacy, Jinan University, Guangzhou 510632, China; [email protected] (D.G.); [email protected] (X.Y.) * Correspondence: [email protected] or [email protected]; Tel.: +86-020-85222120 Received: 26 February 2020; Accepted: 26 March 2020; Published: 31 March 2020 Abstract: The Rho family GTPases are small G proteins that act as molecular switches shuttling between active and inactive forms. Rho GTPases are regulated by two classes of regulatory proteins, guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs). Rho GTPases transduce the upstream signals to downstream effectors, thus regulating diverse cellular processes, such as growth, migration, adhesion, and differentiation. In particular, Rho GTPases play essential roles in regulating neuronal morphology and function. Recent evidence suggests that dysfunction of Rho GTPase signaling contributes substantially to the pathogenesis of autism spectrum disorder (ASD). It has been found that 20 genes encoding Rho GTPase regulators and effectors are listed as ASD risk genes by Simons foundation autism research initiative (SFARI). This review summarizes the clinical evidence, protein structure, and protein expression pattern of these 20 genes. Moreover, ASD-related behavioral phenotypes in animal models of these genes are reviewed, and the therapeutic approaches that show successful treatment effects in these animal models are discussed. Keywords: Rho GTPase; autism spectrum disorder; guanine nuclear exchange factor; GTPase-activating protein; animal model; behavior 1.
    [Show full text]