Abundant and Dynamically Expressed Mirnas, Pirnas, and Other Small Rnas in the Vertebrate Xenopus Tropicalis

Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Letter Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis

Javier Armisen,1,2,3 Michael J. Gilchrist,1,3 Anna Wilczynska,2 Nancy Standart,2 and Eric A. Miska1,2,4 1Wellcome Trust Cancer Research UK Gurdon Institute, University of Cambridge, The Henry Wellcome Building of Cancer and Developmental Biology, Cambridge CB2 1QN, United Kingdom; 2Department of Biochemistry, University of Cambridge, Cambridge CB2 1GA, United Kingdom

Small regulatory RNAs have recently emerged as key regulators of eukaryotic gene expression. Here we used high- throughput sequencing to determine small RNA populations in the germline and soma of the African clawed frog Xenopus tropicalis. We identified a number of miRNAs that were expressed in the female germline. miRNA expression profiling revealed that miR-202-5p is an oocyte-enriched miRNA. We identified two novel miRNAs that were expressed in the soma. In addition, we sequenced large numbers of Piwi-associated RNAs (piRNAs) and other endogenous small RNAs, likely representing endogenous siRNAs (endo-siRNAs). Of these, only piRNAs were restricted to the germline, suggesting that endo-siRNAs are an abundant class of small RNAs in the vertebrate soma. In the germline, both endogenous small RNAs and piRNAs mapped to many high copy number loci. Furthermore, endogenous small RNAs mapped to the same specific subsets of repetitive elements in both the soma and the germline, suggesting that these RNAs might act to silence repetitive elements in both compartments. Data presented here suggest a conserved role for miRNAs in the vertebrate germline. Furthermore, this study provides a basis for the functional analysis of small regulatory RNAs in an important vertebrate model system. [Supplemental material is available online at http://www.genome.org.Short read sequence data from this study have been submitted to NCBI Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) under series accession no. GSE14952.]

Short RNAs have recently emerged as abundant regulators of gene Lee 2004), Drosophila (Czech et al. 2008; Ghildiyal et al. 2008; expression in many eukaryotes, including plants, animals, and Kawamura et al. 2008; Okamura et al. 2008), and mouse oocytes fungi (Sharp 2009). The lin-4 and let-7 miRNAs were the first type (Tam et al. 2008; Watanabe et al. 2008). endo-siRNAs are enriched of endogenous short regulatory RNAs to be identified in eukaryotes in the germline of animals and map to various genomic loci (Lee et al. 1993; Reinhart et al. 2000); since then many functional including repetitive elements, pseudogenes, palindromes, and small RNAs have been identified in organisms as diverse as regions where both strands are transcribed. Like miRNAs, endo- roundworms, flies, fish, frogs, mammals, flowering plants, mosses, siRNAs interact with Argonaute proteins. endo-siRNAs likely anemones, sponges, and even viruses, using genetics, molecular have roles in silencing of transposable elements or pseudogenes cloning, and predictions from bioinformatics (Lagos-Quintana (Okamura et al. 2008). et al. 2001; Lau et al. 2001; Lee and Ambros 2001; Llave et al. 2002; A third class of 25–30 nt RNAs has been identified in Dro- Reinhart et al. 2002; Lim et al. 2003; Pfeffer et al. 2004; Arazi et al. sophila, zebrafish, mice, rats, anemones, and sponges and has been 2005; Axtell and Bartel 2005; Watanabe et al. 2005; Grimson et al. named Piwi-associated RNAs or piRNAs (Grimson et al. 2008; 2008). In cells, miRNAs are tightly bound by proteins of the Ago Klattenhoff and Theurkauf 2008). By definition piRNAs interact clade of the Argonaute superfamily of RNA-binding proteins with proteins of the Piwi clade of the Argonaute superfamily. (Cerutti et al. 2000). miRNAs are thought to inhibit efficient piRNA populations are complex; there are hundreds of thousands translation of target mRNAs or to control mRNA decay. of unique piRNAs in mammals. Piwi and piRNAs are required for Another class of small RNAs, 21–24 nucleotides (nt) endoge- transposon silencing: for example, in Drosophila the piRNAs of the nous siRNAs, was first discovered in plants in response to viral flamenco locus control the gypsy retrotransposon (Desset et al. infection (Hamilton and Baulcombe 1999; Llave et al. 2002). These 2003; Brennecke et al. 2007). The piRNAs of C. elegans are unique RNAs are thought to represent endogenous instances of short in- in that they are 21 nt short RNAs with distinct genomic organi- terfering RNAs (siRNAs), the mediators of RNAi (Fire et al. 1998; zation and biogenesis, but a conserved role in transposon silencing Tuschl et al. 1999; Zamore et al. 2000). More recently, endo-siRNAs (Ruby et al. 2006; Batista et al. 2008; Das et al. 2008; Wang and have also been identified in Caenorhabditis elegans (Ambros and Reinke 2008). Previously, small RNAs have also been grouped together based on their genomic location as repeat-associated small RNAs 3These authors contributed equally to this work. (rasiRNAs) in plants, fungi, Drosophila, and zebrafish (Llave et al. 4 Corresponding author. 2002; Reinhart et al. 2002; Aravin et al. 2003; Chen et al. 2005b). E-mail [email protected]; fax 44-1223-767225. Article published online before print. Article and publication date are at These can now be reclassified as endo-siRNAs or piRNAs based http://www.genome.org/cgi/doi/10.1101/gr.093054.109. on their size, biogenesis, and associated Argonaute superfamily

1766 Genome Research 19:1766–1775 Ó 2009 by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/09; www.genome.org www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Xenopus small RNAs proteins (Okamura et al. 2008; Malone and Hannon 2009). Al- though endo-siRNA and piRNA pathways are distinct, in animals, endo-siRNAs and piRNAs are 29O-methylated at the 39 end (Horwich et al. 2007; Tam et al. 2008; Watanabe et al. 2008). While the function of this modification remains unclear in animals, in plants, 29O-methylation stabilizes miRNAs and endo-siRNAs (Yang et al. 2006). Xenopus laevis has been used widely as a model system for the study of oocyte development and maturation, including the regulation of gene expression at the level of translation and RNA localization. Xenopus oogenesis is subdivided into six stages (I–VI) based on features such as diameter, pigmentation color, and the amount of yolk in the cytoplasm. Stage VI oocytes are arrested in first meiotic prophase, and can be matured into eggs, arrested in MII metaphase, by progesterone. While previous work in Xenopus has identified a number of miRNAs through cloning and comparative genomic approaches, little is know about small RNAs population during Xenopus oogenesis. Microarrays, North- ern blotting, and in situ hybridization have been used to determine miRNA expression during embryogenesis and adult frog (Watanabe et al. 2005; Hikosaka et al. 2007; Michalak and Malone 2008; Tang and Maxwell 2008; Walker and Harland 2008). How- ever, recent advances in sequencing technology have allowed the more complete assessment of small RNA species in animals, plants, and fungi. Here we applied Illumina sequencing (formerly known as Solexa sequencing) to determine the expression of small RNAs in the Xenopus tropicalis germline and somatic tissues. This work represents the first example of small RNA high-throughput sequencing in an amphibian. Using this approach we identify abundant populations of miRNAs, piRNAs, and other small RNAs in the germline and soma of X. tropicalis. We hope that these data might set the stage for the biochemical analysis of small RNA pathways in a powerful model system, the Xenopus oocyte.

Results Figure 1. Expression of small RNAs and core protein components in X. tropicalis.(A) Total RNA was isolated from X. tropicalis adult liver and stage The Xenopus female germline expresses different classes I and stage II oocytes. RNA was size-selected using the miRVana kit. Ten of small RNAs micrograms of this RNA was subjected to b-elimination or not as indicated and analyzed on a denaturing gel after 59 end-labeling. Arrows indicate We first isolated total RNA from oocytes of Xenopus tropicalis and RNA that likely represent miRNAs, siRNAs, and piRNAs. (B,C ) The ex- Xenopus laevis at different stages of oogenesis. Small RNAs were pression of core components of small RNA pathways in Xenopus oocytes, eggs, and somatic tissues was assayed using RT-PCR and qRT-PCR. For size-selected and resolved on polyacrylamide gels (Supplemental each experiment equivalent oocyte total RNA was reverse transcribed. E, Fig. S1). We observed a strikingly similar pattern of small RNAs in egg; L, liver; I, intestine; N.D., not done. (B) RT-PCR experiment. Control the different oogenic stages in X. tropicalis and X. laevis, where experiment without the addition of reverse transcriptase. RT-PCR primers short ;22, ;24, and ;30 nt RNAs were most abundant. Given are listed in Supplemental material, Armisen_SupData4.xls. (C ) qRT-PCR for the four Piwi-related genes described in X. tropicalis. the known sizes of microRNAs (miRNAs), endogenous siRNAs (endo-siRNAs), and Piwi-interacting RNAs (piRNAs) in other species we suspected that these bands could represent miRNAs, endo- siRNAs, and piRNAs in X. tropicalis and X. laevis, respectively. To contrast, in RNA from stage I and stage II oocytes, two small test this hypothesis, we took advantage of the fact that in mouse RNA bands did not shift mobility after b-elimination, which was and Drosophila melanogaster endo-siRNAs and piRNAs are 29O- consistent with 29O-methylation of the 39-most nucleotide. Based methyl-modified at the 39-most nucleotide, while miRNAs are on these observations we concluded that the most abun- not (Horwich et al. 2007). We purified small RNA fractions from dant small RNAs in adult liver were miRNAs, whereas the most X. tropicalis stage I and stage II oocytes and adult liver and sub- abundant small RNAs in oocytes likely were endo-siRNAs and jected these to b-elimination, a reaction that removes the 39-most piRNAs. nucleotide of RNA if this nucleotide is not 29O-methyl-modified (Horwich et al. 2007). We then 59 end-labeled control untreated The Xenopus female germline expresses key small RNA RNA and RNA after b-elimination and separated them on a de- pathway genes naturing polyacrylamide gel (Fig. 1A). The small, ;22 nt RNA band from adult liver shifted about 2 nt in mobility after b-elimi- We next tested if genes required for small RNA biogenesis and nation, suggesting that this RNA was not 29O-methyl-modified. In function are expressed in the germline or the soma of X. tropicalis.

Genome Research 1767 www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Armisen et al.

We designed specific reverse transcription RNA polymerase chain reaction (RT-PCR) assays to detect the expression of RNase en- zymes required for miRNA biogenesis (dicer1, rnasen), Ago family Argonaute proteins (eif2c2, eif2c4), and Piwi family Argonaute proteins. We then assayed their expression during oogenesis, in eggs, adult liver, and adult intestine. As shown in Figure 1B, we detected expression of all four genes thought to be involved in miRNA biogenesis and function (dicer1, rnasen, eif2c2, eif2c4) in all tissues tested. We recently demonstrated that at least two Argonaute proteins of the Piwi family, piwil1.1/piwil1.2 (also known as Xiwi1a/Xiwi1b), and piwil2 (also known as Xili), are present in Xenopus oocytes (Wilczynska et al. 2009). We detected piwil1.2 and piwil2 mRNA in both the germline and the soma; however, no Piwi proteins were detected in the soma (Supple- mental Fig. S2). We also confirmed expression of the Piwi family Argonaute proteins using quantitative RT-PCR (qRT-PCR) (Fig. 1C) and by searching X. tropicalis EST libraries (data not shown).

High-throughput sequencing identifies abundant miRNAs, piRNAs, and other small RNAs in X. tropicalis Next, we prepared RNA from oocytes of different stages of oogenesis (stages I/II, III/IV, and V/VI) and from adult liver and skin for high-throughput sequencing of small RNAs as described previously (Das et al. 2008; Supplemental material). Small RNA libraries were subjected to high-throughput sequencing using the Illumina platform. As shown in Supplemental Table S1, we obtained over six million primary reads for each sample. After stripping off of adaptor sequences, 758,445–3,641,616 of these reads mapped perfectly to at least one locus in the current release of the X. tropicalis genome sequence (JGI v4.1, http://www.jgi.doe. Figure 2. (A,B) Length distributions of filtered short RNA sequences in gov/). All reads that did not match perfectly to the available ge- oocyte and somatic cell libraries. (A) Counting total reads per library at nome sequence were discarded. All sequencing data were sub- each length. (B) Counting unique tags per library at each length. mitted to the GEO database at NCBI (www.ncbi.nlm.nih.gov/geo/) and are freely accessible (see Supplemental material for accession numbers). We termed all primary reads that perfectly matched the somatic and germline libraries contained 20–24 nt complex pop- genome ‘‘reads’’ and after collapsing identical reads termed unique ulations, indicative of endo-siRNAs. reads ‘‘tags.’’ We then analyzed the size distribution of reads and To separate small RNAs into distinct groups we compared all tags in all five small RNA libraries. As shown in Figure 2, the size reads to known RNA species using the Rfam database and the distributions of the germline libraries (oocyte stages I/II, III/IV, and miRNA registry (Griffiths-Jones 2004; Griffiths-Jones et al. 2006, V/VI) and the somatic libraries (liver, skin) were more similar 2008; Gardner et al. 2009). In Figure 3A–D we summarize these within these groups than between the groups. Focusing on the data by grouping all oocyte libraries together as a germline group length distributions of reads (Fig. 2A) we found that the most and the liver and skin libraries as a somatic group. Small RNAs that abundant reads in the two somatic libraries were ;22 nt long, did not match any known RNA species were grouped according to which is consistent with the size distribution expected for miRNAs local small RNA density in the X. tropicalis genome, i.e., by oc- (Griffiths-Jones 2004; Griffiths-Jones et al. 2006, 2008). Indeed, currence in ‘‘blocks’’ of neighboring tags. Blocks were defined by this peak disappeared in the length distributions of tags (Fig. 2B), groups of tags of a given type with no gaps between neighbors which is to be expected for miRNAs, as miRNA genes produce greater than 200 bases, as used previously in plants (Fig. 3E; identical reads with high accuracy that collapsed into few tags. Mosher et al. 2008). However, this definition was irrespective of Conversely, we found that the most abundant reads in the three read length and included putative endo-siRNAs or piRNAs. Tag germline libraries were 25–30 nt long, which is consistent with the types used were single locus tags, tags with 10+ loci, and all tags, size distribution expected for piRNAs (Fig. 2A). Indeed, the broad defining low copy number, high copy number, and mixed blocks, 25–30 nt peaks in read length distributions were matched by respectively. Tags not in blocks were termed isolated. This termi- similar peaks observed for tag length distributions (Fig. 2B). These nology seemed to us particularly useful to analyze endo-siRNAs observations were consistent with the hypothesis that these peaks and piRNAs, which are highly complex populations and often are indeed represented piRNAs as piRNA populations were found to be found in groups and often map to repeat elements (Okamura et al. highly complex in D. melanogaster and mouse oocytes (Okamura 2008). As shown in Figure 3, we found that most reads from so- and Lai 2008; Malone and Hannon 2009). However, although the matic libraries were miRNAs, as expected. However, we also found size distributions of germline and somatic libraries were clearly substantial numbers of small RNAs in high, mixed, or low copy distinct, we also observed some similarities. Indeed, germline li- number blocks, indicative of endo-siRNAs or piRNAs. We then braries also contained abundant reads of ;22 nt RNAs that were analyzed the length distribution of these somatic RNAs that occur reduced in the tag length distributions, indicative of miRNAs. Both in blocks and found these to peak at 21 nt (Supplemental Fig. S3).

1768 Genome Research www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Xenopus small RNAs

parison to somatic small RNAs, miRNAs were underrepresented in germline small RNAs.

miR-202-5p is a germline-enriched miRNA Next, we focused our analysis on miRNAs. We were able to match both somatic and germline small RNA libraries to known miRNAs of X. tropicalis using the miRNA registry (Griffiths-Jones 2004; Griffiths- Jones et al. 2006, 2008). The most frequently sequenced miRNAs from germline and somatic libraries are shown in Table 1 and Supplemental Table S2, respectively. A full list of all read matches to known miRNAs is shown in the Supple- mental material Armisen_SupData1. Al- though it is currently not clear how well high-throughput sequencing library read frequency is correlated with small RNA concentration in the sample analyzed, it is likely that these two values did corre- late in our data, as we showed for selected miRNAs and piRNAs below. The miRNA with the most abundant reads from the liver library was miR-122, a miRNA that had previously been shown to be highly expressed in liver in vertebrates and mammals (Jopling et al. 2005). The most highly represented miRNA in the skin library was miR-451, previously found enriched in zebrafish erythrocytes (Pase et al. 2009), mouse red blood cells (Rathjen et al. 2006), and mouse lung stem cells (Qian et al. 2008). As expected from our global analysis of small RNA reads from germline libraries in Figure 2, Figure 3. (A–D) Distribution of small RNA (sRNA) types in oocytes (A,B) and somatic cells (C,D), by we also identified a number of reads rep- unique tag (A,C) and by read (B,D) count. Filtered tags were identified either by BLAST similarity to resenting known miRNAs in the germline known RNA types (miRNA, tRNA, rRNA, other noncoding RNA [oncRNA]), or otherwise by occurrence in libraries (Table 1; Supplemental Data 1). ‘‘blocks’’ of neighboring tags, or not. Blocks were defined by groups of tags of a given type with no gaps All three oocyte libraries showed similar between neighbors greater than a fixed value (200 bases). Tag types used were single locus tags, tags miRNA read profiles, although there were with 10+ loci, and all tags, defining low copy number, high copy number, and mixed blocks, respectively. Tags not in blocks were termed isolated. (E, top) Schematic view of general method for differences in the ranking of individual defining short RNA blocks. (E, bottom) Different families of blocks are made using only unique mapping miRNA reads. In addition to known tags (low copy number), tags with ten or more loci (high copy number), and all tags. miRNAs we also identified a number of candidate novel miRNAs in X. tropicalis (Supplemental Table S3). To identify These size distributions were consistent with endo-siRNAs, but not miRNA candidates we mapped all tags to the genome, extracted piRNAs and we postulated that the vertebrate Xenopus does con- surrounding sequence information, and used RNAfold (Hofacker tain somatic endo-siRNAs. In contrast, we found that the majority and Stadler 2006) to predict local secondary structure. From these of small RNAs in germline libraries were in high, mixed, or low candidates and based on the rules for miRNA secondary structure copy number blocks (Fig. 3). We again analyzed the size distribu- (Ambros et al. 2003) and miR and miR* reads in our library, we tion of the germline small RNAs found in blocks. As shown in confidently identified two new miRNAs in X. tropicalis in the soma, Supplemental Figure S3 we observed distinct length distributions xtr-miR-2184 and xtr-miR-2188, which have been submitted to for small RNAs in blocks: Low copy and mixed copy number blocks the miRNA registry (Griffiths-Jones 2004; Griffiths-Jones et al. showed a single peak at 25–30 nt, consistent with the length 2006, 2008; Supplemental Table S3). distributions of piRNAs. In contrast, high copy number blocks We next aimed to validate the expression of miRNAs in the contained reads with peak lengths of 21 and 25–30 nt. These germline of X. tropicalis. We selected three miRNAs that were data suggested that high copy number blocks were distinct in highly represented in the germline small RNA libraries (miR-148a, that they contained abundant endo-siRNAs and piRNAs. In com- miR-101, and miR-202-5p) and performed Northern blotting to

Genome Research 1769 www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Armisen et al.

Table 1. Most frequently sequenced known miRNAs from oocyte oocytes. Furthermore, b-elimination did not affect the mobility of libraries either piRNA, whereas it did affect the mobility of two control Number miRNAs (Fig. 5A,B; Supplemental Fig. S6), indicating that piR-1 Library miRNA Most common tag of reads and piR-2 were 29O-methylated at the 39-most nucleotide. We also analyzed the expression of piR-1 in different tissues of X. tropicalis Stage I/II miR-10b TACCCTGTAGAACCGAATTTGT 642 (Fig. 5C). We detected piR-1 expression throughout oogenesis, but miR-202-5p TTCCTATGCATATACCTCTTT 336 not in muscle, heart, brain, intestine, or liver (Supplemental Fig. miR-101 TACAGTACTGTGATAACTGAAG 237 S6). Moreover, we were able to specifically immunoprecipitate miR-148a TCAGTGCACTACAGAACTTTGT 182 miR-30e CTTTCAGTCGGATGTTTACAGC 155 piR-1 using an anti-piwil1.1/piwil1.2 antibody (Fig. 5D). Next, we examined our small RNA libraries for other features of piRNAs. As Stage III/IV miR-10b TACCCTGTAGAACCGAATTTGT 378 miR-202-5p TTCCTATGCATATACCTCTTT 205 shown in Figure 6A, small RNAs of 25–30 nt (piRNAs) preferen- miR-146b TGAGAACTGAATTCCATGGACT 186 tially had uracil as the first base in germline libraries, but not in miR-148a TCAGTGCACTACAGAACTTTGT 114 somatic libraries (data not shown). We also detect a bias for a 10 miR-30e CTTTCAGTCGGATGTTTACAGC 111 base overlap of 59 ends of piRNAs of opposite strands (Fig. 6B), Stage V/VI miR-148a TCAGTGCACTACAGAACTTTGT 209 indicative of ping-pong amplification. In addition to their en- miR-10b TACCCTGTAGAACCGAATTTGT 191 richment in the germline, piRNAs also differed from other small miR-202-5p TTCCTATGCATATACCTCTTT 188 miR-101 TACAGTACTGTGATAACTGAAG 120 RNAs in their genomic location. As shown in Supplemental Figure miR-146b TGAGAACTGAATTCCATGGACT 117 S3, piRNAs were found in low, mixed, and high copy number blocks in the germline. In contrast, germline endo-siRNAs were mostly enriched in high copy number blocks. piRNAs from the three different oocyte libraries (stages I/II, III/IV, and V/VI) showed assess the expression of the miRNAs in oocytes at different stages of largely overlapping piRNA populations (Fig. 6C). Defining piRNA oogenesis and in eggs (Fig. 4A–C). As expected from our high- clusters analogous to blocks (see above), but only considering 25– throughput sequencing data, we found that all three miRNAs were 30 nt RNAs, we found that the piRNA clusters of X. tropicalis are expressed in oocytes. Interestingly, we observed distinct expres- highly strand-biased (Supplemental Table S4). Of 19,657 total sion patterns for miR-202-5p and the other two miRNAs. miR-202- piRNA clusters analyzed 2338 matched at least one repeat se- 5p was most highly expressed in the early stages of oogenesis and quence as annotated in Repbase (Table 2; Jurka et al. 2005). Forty- was not detected in eggs. In contrast, miR-148a and miR-101 were seven percent of piRNA clusters overlapped with protein-coding strongly expressed in eggs. The expression of a set of miRNAs in the genes (Fig. 6D). female germline of Xenopus was surprising and to exclude the possibility of any somatic contamination, we compared the ex- Other small RNAs of the germline and soma pression of all three miRNAs in oocytes with their expression in As we showed in Figure 2 and Supplemental Figure S3, many short follicular cells, the only possible source of somatic contamination during oocyte preparation. As shown in Supplemental Figure S4 endogenous small RNAs map to blocks of varying copy numbers in the germline and the soma. These 20–24 nt RNAs likely repre- for miR-148a, we do not detect this miRNA in follicular cells. We obtained the same results for the other two miRNAs (data sented endo-siRNAs. In support of this hypothesis, we found that not shown). We also confirmed expression of all three miRNAs in oocytes of X. laevis (Supplemental Fig. S5). Next, we assayed the expression of miR-148a, miR-101, and miR-202-5p in somatic tissues. While miR-148a and miR-101 were expressed in a number of adult somatic tissues including muscle, heart, brain, and liver, miR-202-5p was not detected in these tissues (Fig. 4D–F). These data were consistent with the high-throughput sequencing data we obtained for liver and skin (Supplemental Table S2; Armisen_ SupData1). We concluded that miR-202-5p is a germline-enriched miRNA in Xenopus.

Xenopus piRNAs One major difference between the germline and somatic small RNA libraries was the abundance of longer (25–30 nt) RNAs, which were prominent in germline libraries, but were underrepresented in somatic libraries (Fig. 2). These 25–30 nt RNAs likely were piRNAs. First, these RNAs were of the same size as piRNAs from D. melanogaster, zebrafish, and mice (Klattenhoff and 9 Theurkauf 2008). Second, these RNAs were 2 O-methyl-modified Figure 4. (A–C ) Expression of three miRNAs (miR-101, miR-202-5p, at the 39-most nucleotide (Fig. 1A). Third, we previously demon- and miR-148a) was assessed during oogenesis and in eggs. Stages I and II, strated that one Piwi protein of X. tropicalis, piwil1.1/piwil1.2, III and IV, and V and VI were pooled. One hundred and fifty oocytes were associated specifically with ;30 nt RNAs in Xenopus oocytes used for each experiment. (D–F ) The expression of the same three miRNAs was assessed in early stage oocytes (stages I and II) and a number of adult (Wilczynska et al. 2009). Next, we validated two of these candidate somatic tissues using Northern blotting. Ten micrograms of total RNA piRNAs, named piR-1 and piR-2, using Northern blotting. As were used for each lane. EDC was used to crosslink small RNAs to the shown in Figure 5, piR-1 and piR-2 were both expressed in stage I/II membrane prior to hybridization. 5S rRNA is shown as a loading control.

1770 Genome Research www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Xenopus small RNAs

suggested that small RNA pathways might have similar functions in the silencing of repeat elements in the germline and the soma. In both cases small RNAs matched to abundant classes of repetitive elements in the X. tropicalis genome, including DNA transposons of the Harbinger, hAT, and piggyBac super- families. However, the repeat elements that were the source of the largest number of reads in germline and somatic libraries were DNA transposons of the Polinton family, which are not among the abundant repeat elements in X. tropicalis. Similarly, a LTR retrotransposon of the ERV family was overrepresented in these data (Supplemental Table S5).

Discussion

Here we report the first unbiased analysis of small RNA populations of X. tropicalis using a high-throughput sequencing approach. Historically, the majority of work in frogs has been carried out using X. laevis, but this species is allo-tetra- ploid,andits smallerdiploidcousin,X.tro- Figure 5. (A) piRNA piR-1 (59-TGAAGACGGACAGAAGATGGGTTAATTATTT-39) expression was vali- picalis, has been adopted by the Xenopus dated using Northern blotting of early stage oocytes (stages I and II). One hundred and fifty oocyte community as a more useful genomic and equivalents were used to analyze small RNA expression. A miR-101 probe was used as a control. genetic model. The current X. tropicalis b-Elimination was performed to assay for 29O-methyl-modified 39 nucleotides. EDC was used to crosslink small RNAs to the membrane prior to hybridization. (B) Experiments were performed as in A, genome assembly (JGI v4.1, http://www. but with probes for piR-2 (59-TGAATTGTAGAACAATGTACAGGTACACCAT-39) and miR-202-5p. (C ) jgi.doe.gov/) has an estimated cover- Expression of piR-1 and miR-148a was assessed in a number of adult somatic tissues and early stage age of over 90% in 19,759 scaffolds, and oocytes (stages I and II) using Northern blotting. Ten micrograms of total RNA were used for each lane. although not yet fully assembled into 5S rRNA is shown as a loading control. (D) Northern blot analysis of immunoprecipitated piRNAs using piwil1.1/piwil1.2 specific antibody (PI: pre-immune). chromosomes, has become a powerful tool for functional sequence mining and comparative genomics. Furthermore, as high-throughput RNA sequencing, un- these RNAs were resistant to b-elimination as a population (Fig. 1A) like microarray approaches, is independent of the known genome and individually, as shown for a single somatic small RNA (Fig. 6E). sequence, the data presented here will remain suitable for further The 20–24 nt RNAs lack a 59 U bias, suggesting that these are un- analysis as the X. tropicalis assembly improves. likely to be degradation products of piRNAs (Fig. 6A). Many 20–24 In this study we identify miR-202-5p as a miRNA enriched in nt RNAs mapping to opposite strands overlap, which is consistent Xenopus oocytes, raising the possibility that this miRNA might with these RNAs being Dicer products, but there was no apparent function as a regulator of gene expression in the female germline of peak of 2 nt overhangs (Supplemental Fig. S7). It had previously Xenopus. Previous analysis of miRNA expression in Xenopus been shown that many endo-siRNAs and piRNAs map to repetitive oocytes found many miRNAs to be absent from oocytes, but found elements (Okamura et al. 2008). We therefore asked if small RNAs an enrichment of some miRNA precursors (Tang and Maxwell from somatic and germline libraries mapped together to repetitive 2008), which raised the possibility that the miRNA pathway might elements in the X. tropicalis genome sequence. We analyzed the not be functional in the oocyte. Indeed, it was reported that pre- overlap between instances of all repeats in the genome and small miRNAs injected into stage VI oocytes are inefficiently processed RNA (endo-siRNA and piRNA) loci. We summarized these data for (Lund et al. 2004; Lund and Dahlberg 2006). Our northern data germline and somatic small RNAs in Supplemental Tables S5 and indicate that fully processed miRNAs are present in Xenopus S6, respectively. The complete data are available as Armisen_ oocytes. Although analysis of embryos derived from dicer1 mutant SupData2 (germline) and Armisen_SupData3 (somatic), respec- germline clones suggested that miRNAs are not essential for early tively. The overall number of small RNAs mapping to repeat ele- development in the zebrafish, miRNAs have been identified in ments in the genome was much higher in the germline than the oocytes of Drosophila and mice (Hatfield et al. 2005; Tang et al. soma, as we expected from our analysis of high copy number 2007; Tam et al. 2008). Moreover, maternal miRNAs are essential blocks (Fig. 3). Nevertheless, the overall pattern of repeat elements for zygotic development in the mouse (Murchison et al. 2007; Tang that matched small RNAs in the germline and the soma was sim- et al. 2007). miR-202-5p is a vertebrate-specific miRNA and is ilar. Seventy-five percent of blocks of all mapped tags found in the highly expressed in mouse oocytes, ovary, and testis, but not in somatic libraries overlapped with those found in the oocyte li- other adult tissues (Ro et al. 2007; Tam et al. 2008). Despite the braries (30% when only considering unique tags). These data fact that miR-202-5p is the most conserved part of the miR-202

Genome Research 1771 www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Armisen et al.

published functional data on this miRNA in any vertebrate system, it is tempting to speculate that miR-202-5p has a conserved role in germline development in vertebrates. This study identifies abundant piRNAs and putative endo- siRNAs in the germline of X. tropicalis. Interestingly, both classes of small RNAs often map to high copy number blocks or highly repetitive elements within the genome (Fig. 3). Previous work has demonstrated a role for piRNAs in the silencing of repeat elements (Klattenhoff and Theurkauf 2008). In the case of endo-siRNAs, such a role has at least been proposed (Okamura and Lai 2008; Malone and Hannon 2009). Our data suggests that endo-siRNA and piRNA pathways in Xenopus might be closely linked, raising the question of the relationship between these two pathways. In C. elegans, piRNAs act upstream of an endo-siRNA pathway (Das et al. 2008). In contrast, it has been proposed that in Drosophila and mammals endo-siRNAs and piRNAs act redundantly in the female germline (Okamura and Lai 2008; Malone and Hannon 2009). Our data does not distinguish between these two possibilities. How- ever, we have found a strong overlap between endo-siRNAs in the germline and the soma of Xenopus. In both cases, endo-siRNAs mapped to a similar subset of repeat elements (Supplemental Tables S5 and S6). With piRNAs either absent or strongly underrepresented in somatic tissues (Fig. 2), we postulate that in the soma endo-siRNAs might be sufficient to provide protection against transposable elements. Work in Drosophila has demonstrated a role for piRNAs in the silencing of DNA transposons and retrotransposons (Klattenhoff and Theurkauf 2008). However, we observe a strong underrep- resentation of small RNAs that map to retrotransposons (Supple- mental Tables S5 and S6) with regard to the abundance of these elements in the genome of X. tropicalis. Indeed, the repeat element with most small RNA read matches in germline and soma is a newly discovered type of DNA transposon called Polintons (Kapitonov and Jurka 2006). Polintons are the most complex DNA transposons discovered so far, encoding at least four distinct

Table 2. Repeat association of piRNA clusters

Repeat Type Clusters Hits

Figure 6. (A) Base composition at positions 1 and 10 was analyzed hAT-10 DTA 32 413 separately for piRNAs and 20–24 nt RNAs (siRNAs). (B) Analysis of 59 and 39 Harbinger-2 DTA 98 273 base overlap for unique tags. (C ) Overlap of piRNA populations cloned Harbinger-1 DTA 111 190 from different stages of oogenesis. We considered only unique tags with Kolobok-2 DTN 94 182 $10 reads. (D) Overlap between piRNA clusters and annotated genes. Helitron-N1A DTA 35 169 (E ) Identification of endo-siRNA in Xenopus tropicalis. The expression of Tc1-8 DTA 94 157 endo-siRNA1 (59-ACGGCCGGGGGCATTCGTATT-39) was validated using Polinton-2 DTN 54 118 Northern blotting after b-elimination, to assay for 29O-methyl-modified 39 hAT-9 DTA 59 100 nucleotides. miR-148a was used as a control for b-elimination as well as piggyBac-2 DTA 37 99 a loading control. Harbinger-5 DTA 58 88 Polinton-1 DTN 33 88 piggyBac-N2 DTA 31 77 Kolobok-1 DTN 23 72 pre-miRNA and that miR-202-5p has been cloned most frequently, hAT-N2 DTA 43 67 it was previously annotated as miR-202* in mirBase (and con- L1-55 LINE 45 67 versely miR-202-3p as miR-202) and has subsequently been missed TXZ19 DTA 38 66 Harbinger-N3 DTA 50 64 in a number of microarray studies. Although miR-202-5p appears DNA1 LTR 37 61 to be absent in eggs and a number of adult tissues, including liver, piggyBac-N1 DTA 30 61 skin, and intestine, our study is not sufficient to demonstrate that piggyBac-1 DTA 26 58 miR-202-5p is specific for oocytes. Indeed, previous work identi- À10 fied miR-202-5p as a miRNA highly expressed in Xenopus testis Repeat, name of repeat from GIRI data file; hits < 1 3 10 , number of matches in up to 20 scaffolds; clusters, number of clusters matching a re- (Michalak and Malone 2008). Interestingly, this study suggested peat; hits = number of distinct alignments within that group of clusters. that miR-202-5p expression levels differed in wild-type X. tropicalis DTN, DNA transposon nonautonomous; DTA, DNA transposon autono- testis and their sterile hybrids. Although there is currently no mous; LINE, long interspersed elements; and LTR, retrotransposon.

1772 Genome Research www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Xenopus small RNAs proteins. Their unique integration mechanism is thought to lead (Miska et al. 2004; Pall and Hamilton 2008). See Supplemental to the frequent formation of genomic palindromes. Palindromes material for more detail. were recently identified as a source of endo-siRNAs in the soma of Drosophila, and the large number of small RNAs matching RT-PCR and qRT-PCR Polintons in Xenopus suggest that Polinton-induced palindromes might be the source of these endo-siRNAs. Polintons in Xenopus Briefly, total RNA from oocyte equivalents was isolated and treated laevis were also recently described as a source of piRNAs (Kirino with RQ1 RNase-Free DNase, phenol/chloroform extracted and ethanol precipitated. Reverse transcription (RT) was performed et al. 2009). according to the Superscript II protocol using an oligo-dT primer. We find that the majority of non-miRNA small RNAs in the Two microliters of RT were used for standard PCR. qRT-PCR was germline and the soma of X. tropicalis map to multiple loci in the performed using Quantitect SYBR green PCR mix (see also Sup- genome. These observations are a direct consequence of the asso- plemental material). RT-PCR and qRT-PCR primer design was as ciation of small RNAs with repeat elements and consistent with described previously (Chen et al. 2005a). Sequences of oligonu- previous work in other organisms (Malone and Hannon 2009). cleotides used for qRT-PCR are listed in the Supplemental material Therefore, the precise origin of any of these small RNAs cannot be (Armisen_SupData4.xls). determined. Tags mapping to multiple loci often have a low read count and the full complexity of these tags might not have been captured in our small RNA libraries. While many blocks of small High-throughput sequencing RNAs show a stark strand bias consistent with an RNAi type For high-throughput sequencing small RNAs were enriched using mechanism (Supplemental Tables S5 and S6), in cases where strand the miRVana kit, resolved on a 15% denaturing polyacrylamide bias is lacking, this may be due to the superposition of small RNAs gel, and the size range corresponding to the bands indicated with from different loci. Furthermore, populations of repeat elements in an asterisk in Supplemental Figure S1 were isolated (;18–34 bases). the genome are highly heterogeneous, consisting of active and Small RNA libraries were cloned through ligation of 59 and 39 inactive elements, elements that are part of protein-coding genes adapters as described previously (Das et al. 2008). All libraries were and isolated elements. To understand how small RNAs contribute sequenced using an Illumina GA2 instrument (Illumina). Read to the regulation of these elements it will be important to identify length was 45 cycles. Detailed information on sequencing data analysis, block analysis, and prediction of miRNA candidates can the correct source of these RNAs. The analysis of longer RNA be found in the Supplemental material. Briefly, raw Illumina reads transcripts using high-throughput sequencing technology might were processed into unique tags after removing the adapters provide insights here. sequences and blasted against known RNA families: miRNAs, ri- A substantial number of reads in our libraries correspond to bosomal RNA, transfer RNAs, and other noncoding RNAs de- tRNAs, rRNAs, and other noncoding RNAs (Fig. 3). In addition, posited in Rfam, (Griffiths-Jones 2004; Griffiths-Jones et al. 2006, a number of reads match the sense strand of abundant mRNAs in 2008; Gardner et al. 2009). Groups of neighboring tags were clus- the corresponding tissues (data not shown). Similar to previous tered together in blocks for further analysis. For prediction of studies based on high-throughput sequencing of small RNAs, we miRNA candidates, tags were tested for potential miRNA precursor have disregarded these RNAs as likely RNA degradation products. folds using RNAfold (Hofacker and Stadler 2006). However, as it is currently impossible to separate initiators, effec- tors, and products of RNAi and related small RNA pathways, it Acknowledgments remains unclear if these other RNAs might not contain important information and deserve attention. For example, 5.8S RNA pro- We thank Jim Smith and David Simpson for providing materials cessing has recently been shown to generate a small RNA and to and technical support. We thank Partha Das for technical advice. involve a small RNA pathway gene, eri-1 (Gabel and Ruvkun 2008). We thank Leonard Goldstein for discussions on data analysis. We thank Nelson Lau for sharing unpublished observations. This work was supported by a grant from the Biotechnology and Biological Methods Sciences Research Council (UK) to N.S. and E.A.M., a Cancer Re- search UK Program Grant to E.A.M. (C13474), and core funding to RNA isolation the Wellcome Trust/Cancer Research UK Gurdon Institute pro- Ovarian lobes were removed from Xenopus tropicalis and Xenopus vided by the Wellcome Trust (UK) and Cancer Research UK. laevis females and collagenase treated for 3 h. Oocytes were staged and washed in modified Barth’s solution (8.8 mM NaCl, 1 mM KCl, References 330 mM Ca(NO3)2, 410 mM CaCl2, 820 mM MgSO4, 2.4 mM NaHCO3, 10 mM HEPES-NaOH pH 7.4). Total RNA was isolated Ambros V, Lee RC. 2004. Identification of microRNAs and other tiny from X. tropicalis and X. laevis staged oocytes, or from X. tropicalis noncoding RNAs by cDNA cloning. Methods Mol Biol 265: 131–158. laid eggs and adult tissues using TRIzol reagent (Invitrogen) and Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, Dreyfuss G, according to the manufacturer’s protocol. In all experiments, we Eddy SR, Griffiths-Jones S, Marshall M, et al. 2003. A uniform system for microRNA annotation. RNA 9: 277–279. pooled the same number of oocytes from different stages. Total Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, RNA extracted was enriched for small RNAs using the miRVana kit Gaasterland T, Meyer J, Tuschl T. 2003. The small RNA profile during (Ambion), resolved in a 15% denaturing polyacrylamide gel and Drosophila melanogaster development. Dev Cell 5: 337–350. stained using SYBR green (Invitrogen). Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC. 2005. Cloning and characterization of micro-RNAs from moss. Plant J 43: 837–848. Axtell MJ, Bartel DP. 2005. Antiquity of microRNAs and their targets in land b-Elimination, 59 end-labeling, and Northern blotting plants. Plant Cell 17: 1658–1673. b-Elimination and 59 end-labeling was performed essentially as Batista PJ, Ruby JG, Claycomb JM, Chiang R, Fahlgren N, Kasschau KD, Chaves DA, Gu W, Vasale JJ, Duan S, et al. 2008. PRG-1 and 21U-RNAs described previously (Horwich et al. 2007). Small RNA Northern interact to form the piRNA complex required for fertility in C. elegans. blotting using DNA probes was performed as described previously Mol Cell 31: 67–78.

Genome Research 1773 www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Armisen et al.

Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, Lau NC, Lim LP, Weinstein EG, Bartel DP. 2001. An abundant class of tiny Hannon GJ. 2007. Discrete small RNA-generating loci as master RNAs with probable regulatory roles in Caenorhabditis elegans. Science regulators of transposon activity in Drosophila. Cell 128: 1089–1103. 294: 858–862. Cerutti L, Mian N, Bateman A. 2000. Domains in gene silencing and cell Lee RC, Ambros VR. 2001. An extensive class of small RNAs in Caenorhabditis differentiation proteins: The novel PAZ domain and redefinition of the elegans. Science 294: 862–864. Piwi domain. Trends Biochem Sci 25: 481–482. Lee RC, Feinbaum RL, Ambros VR. 1993. The C. elegans heterochronic gene Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell NL, Mahuvakar VR, Andersen MR, et al. 2005a. Real-time quantification 75: 843–854. of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33: e179. doi: Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP. 2003. Vertebrate 10.1093/nar/gni178. microRNA genes. Science 299: 1540. doi: 10.1126/science.1080372. Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, Llave C, Kasschau KD, Rector MA, Carrington JC. 2002. Endogenous and John B, Marks DS, Gaidatzis D, et al. 2005b. The developmental miRNA silencing-associated small RNAs in plants. Plant Cell 14: 1605–1619. profiles of zebrafish as determined by small RNA cloning. Genes & Dev Lund E, Dahlberg JE. 2006. Substrate selectivity of exportin 5 and Dicer in 19: 1288–1293. the biogenesis of microRNAs. Cold Spring Harb Symp Quant Biol 71: Czech B, Malone CD, Zhou R, Stark A, Schlingeheyde C, Dus M, Perrimon N, 59–66. Kellis M, Wohlschlegel JA, Sachidanandam R, et al. 2008. An Lund E, Guttinger S, Calado A, Dahlberg JE, Kutay U. 2004. Nuclear export endogenous small interfering RNA pathway in Drosophila. Nature 453: of microRNA precursors. Science 303: 95–98. 798–802. Malone CD, Hannon GJ. 2009. Small RNAs as guardians of the genome. Cell Das PP, Bagijn MP, Goldstein LD, Woolford JR, Lehrbach NJ, Sapetschnig A, 136: 656–668. Buhecha HR, Gilchrist MJ, Howe KL, Stark R, et al. 2008. Piwi and Michalak P, Malone JH. 2008. Testis-derived microRNA profiles of piRNAs act upstream of an endogenous siRNA pathway to suppress Tc3 African clawed frogs (Xenopus) and their sterile hybrids. Genomics 91: transposon mobility in the Caenorhabditis elegans germline. Mol Cell 31: 158–164. 79–90. Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Desset S, Meignin C, Dastugue B, Vaury C. 2003. COM, a heterochromatic Constantine-Paton M, Horvitz HR. 2004. Microarray analysis of locus governing the control of independent endogenous retroviruses microRNA expression in the developing mammalian brain. Genome Biol from Drosophila melanogaster. Genetics 164: 501–509. 5: R68. doi: 10.1186/gb-2004-5-9-r68. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998. Potent Mosher RA, Schwach F, Studholme D, Baulcombe DC. 2008. PolIVb and specific genetic interference by double-stranded RNA in influences RNA-directed DNA methylation independently of its role in Caenorhabditis elegans. Nature 391: 806–811. siRNA biogenesis. Proc Natl Acad Sci 105: 3145–3150. Gabel HW, Ruvkun G. 2008. The exonuclease ERI-1 has a conserved Murchison EP, Stein P, Xuan Z, Pan H, Zhang MQ , Schultz RM, Hannon GJ. dual role in 5.8S rRNA processing and RNAi. Nat Struct Mol Biol 15: 2007. Critical roles for Dicer in the female germline. Genes & Dev 21: 531–533. 682–693. Gardner PP, Daub J, Tate JG, Nawrocki EP, Kolbe DL, Lindgreen S, Wilkinson Okamura K, Lai EC. 2008. Endogenous small interfering RNAs in animals. AC, Finn RD, Griffiths-Jones S, Eddy SR, et al. 2009. Rfam: Updates to the Nat Rev Mol Cell Biol 9: 673–678. RNA families database. Nucleic Acids Res 37: D136–D140. Okamura K, Balla S, Martin R, Liu N, Lai EC. 2008. Two distinct mechanisms Ghildiyal M, Seitz H, Horwich MD, Li C, Du T, Lee S, Xu J, Kittler EL, Zapp generate endogenous siRNAs from bidirectional transcription in ML, Weng Z, et al. 2008. Endogenous siRNAs derived from transposons Drosophila melanogaster. Nat Struct Mol Biol 15: 581–590. and mRNAs in Drosophila somatic cells. Science 320: 1023–1024. Pall GS, Hamilton AJ. 2008. Improved northern blot method for enhanced Griffiths-Jones S. 2004. The microRNA registry. Nucleic Acids Res 32: detection of small RNA. Nat Protocols 3: 1077–1084. D109–D111. Pase L, Layton JE, Kloosterman WP, Carradice D, Waterhouse PM, Lieschke Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. 2006. GJ. 2009. miR-451 regulates zebrafish erythroid maturation in vivo via miRBase: MicroRNA sequences, targets and gene nomenclature. Nucleic its target gata2. Blood 113: 1794–1804. Acids Res 34: D140–D144. Pfeffer S, Zavolan M, Gra¨sser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. 2008. miRBase: Tools Marks D, Sander C, et al. 2004. Identification of virus-encoded for microRNA genomics. Nucleic Acids Res 36: D154–D158. microRNAs. Science 304: 734–736. Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Qian S, Ding JY, Xie R, An JH, Ao XJ, Zhao ZG, Sun JG, Duan YZ, Chen ZT, Degnan BM, Rokhsar DS, Bartel DP. 2008. Early origins and evolution of Zhu B. 2008. MicroRNA expression profile of bronchioalveolar stem microRNAs and Piwi-interacting RNAs in animals. Nature 455: cells from mouse lung. Biochem Biophys Res Commun 377: 668–673. 1193–1197. Rathjen T, Nicol C, McConkey G, Dalmay T. 2006. Analysis of short RNAs in Hamilton AJ, Baulcombe DC. 1999. A species of small antisense RNA in the malaria parasite and its red blood cell host. FEBS Lett 580: posttranscriptional gene silencing in plants. Science 286: 950–952. 5185–5188. Hatfield SD, Shcherbata HR, Fischer KA, Nakahara K, Carthew RW, Ruohola- Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Baker H. 2005. Stem cell division is regulated by the microRNA pathway. Horvitz HR, Ruvkun G. 2000. The 21-nucleotide let-7 RNA regulates Nature 435: 974–978. developmental timing in Caenorhabditis elegans. Nature 403: Hikosaka A, Takaya K, Jinno M, Kawahara A. 2007. Identification and 901–906. expression-profiling of Xenopus tropicalis miRNAs including plant Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP. 2002. miRNA-like RNAs at metamorphosis. FEBS Lett 581: 3013–3018. MicroRNAs in plants. Genes & Dev 16: 1616–1626. Hofacker IL, Stadler PF. 2006. Memory efficient folding algorithms for Ro S, Song R, Park C, Zheng H, Sanders KM, Yan W. 2007. Cloning and circular RNA secondary structures. Bioinformatics 22: 1172–1176. expression profiling of small RNAs expressed in the mouse ovary. RNA Horwich MD, Li C, Matranga C, Vagin V,Farley G, Wang P,Zamore PD. 2007. 13: 2366–2380. The Drosophila RNA methyltransferase, DmHen1, modifies germline Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP. piRNAs and single-stranded siRNAs in RISC. Curr Biol 17: 1265–1272. 2006. Large-scale sequencing reveals 21U-RNAs and additional Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P. 2005. Modulation of microRNAs and endogenous siRNAs in C. elegans. Cell 127: 1193–1207. hepatitis C virus RNA abundance by a liver-specific microRNA. Science Sharp PA. 2009. The centrality of RNA. Cell 136: 577–580. 309: 1577–1581. Tam OH, Aravin AA, Stein P, Girard A, Murchison EP, Cheloufi S, Hodges E, Jurka J, Kapitonov VV, Pavlicek A, Klonowski P, Kohany O, Walichiewicz J. Anger M, Sachidanandam R, Schultz RM, et al. 2008. Pseudogene- 2005. Repbase Update, a database of eukaryotic repetitive elements. derived small interfering RNAs regulate gene expression in mouse Cytogenet Genome Res 110: 462–467. oocytes. Nature 453: 534–538. Kapitonov VV, Jurka J. 2006. Self-synthesizing DNA transposons in Tang GQ , Maxwell ES. 2008. Xenopus microRNA genes are predominantly eukaryotes. Proc Natl Acad Sci 103: 4540–4545. located within introns and are differentially expressed in adult frog Kawamura Y, Saito K, Kin T, Ono Y, Asai K, Sunohara T, Okada TN, Siomi MC, tissues via post-transcriptional regulation. Genome Res 18: 104–112. Siomi H. 2008. Drosophila endogenous small RNAs bind to Argonaute 2 Tang F, Kaneda M, O’Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, in somatic cells. Nature 453: 793–797. Tarakhovsky A, Lao K, Surani MA. 2007. Maternal microRNAs are Kirino Y, Kim N, de Planell-Saguer M, Khandros E, Chiorean S, Klein PS, essential for mouse zygotic development. Genes & Dev 21: 644–648. Rigoutsos I, Jongens TA, Mourelatos Z. 2009. Arginine methylation of Tuschl T, Zamore PD, Lehmann R, Bartel DP,Sharp PA. 1999. Targeted mRNA Piwi proteins catalysed by dPRMT5 is required for Ago3 and Aub degradation by double-stranded RNA in vitro. Genes & Dev 13: stability. Nat Cell Biol 11: 652–658. 3191–3197. Klattenhoff C, Theurkauf W. 2008. Biogenesis and germline functions of Walker JC, Harland RM. 2008. Expression of microRNAs during embryonic piRNAs. Development 135: 3–9. development of Xenopus tropicalis. Gene Expr Patterns 8: 452–456. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. 2001. Identification of Wang G, Reinke V. 2008. A C. elegans Piwi, PRG-1, regulates 21U-RNAs novel genes coding for small expressed RNAs. Science 294: 853–858. during spermatogenesis. Curr Biol 18: 861–867.

1774 Genome Research www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Xenopus small RNAs

Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H. 2005. Yang Z, Ebright YW, Yu B, Chen X. 2006. HEN1 recognizes 21–24 nt small Stage-specific expression of microRNAs during Xenopus development. RNA duplexes and deposits a methyl group onto the 29 OH of the 39 FEBS Lett 579: 318–324. terminal nucleotide. Nucleic Acids Res 34: 667–675. Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi-Miyagawa S, Obata Zamore PD, Tuschl T, Sharp PA, Bartel DP. 2000. RNAi: Double-stranded RNA Y, Chiba H, Kohara Y, Kono T, Nakano T, et al. 2008. Endogenous siRNAs directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide from naturally formed dsRNAs regulate transcripts in mouse oocytes. intervals. Cell 101: 25–33. Nature 453: 539–543. Wilczynska A, Minshall N, Armisen J, Miska EA, Standart N. 2009. Two Piwi proteins, Xiwi and Xili, are expressed in the Xenopus female germline. RNA 15: 337–345. Received March 3, 2009; accepted in revised form July 14, 2009.

Genome Research 1775 www.genome.org Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press

Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis

Javier Armisen, Michael J. Gilchrist, Anna Wilczynska, et al.

Genome Res. 2009 19: 1766-1775 originally published online July 23, 2009 Access the most recent version at doi:10.1101/gr.093054.109

Supplemental http://genome.cshlp.org/content/suppl/2009/09/02/gr.093054.109.DC1 Material

References This article cites 68 articles, 26 of which can be accessed free at: http://genome.cshlp.org/content/19/10/1766.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.

To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions