Regulation of Myt1 3363

Journal of Cell Science 112, 3361-3371 (1999) 3361 Printed in Great Britain © The Company of Biologists Limited 1999 JCS0474 The C-terminal domain of the Cdc2 inhibitory kinase Myt1 interacts with Cdc2 complexes and is required for inhibition of G2/M progression Nicholas J. Wells1,*,‡, Nobumoto Watanabe2, Tsuyoshi Tokusumi2, Wei Jiang1, Mark A. Verdecia1 and Tony Hunter1,‡ 1Molecular Biology and Virology Laboratory, The Salk Institute, 10010 North Torrey Pines Road, La Jolla, California 92037, USA 2Tsukuba Life Science Center, The Institute of Physical and Chemical Research (RIKEN), 3-1-1 Koyadai, Tsukuba, Ibaraki 305- 0074, Japan *Present address: Division of Yeast Genetics, National Institute for Medical Research, The Ridgeway, Mill Hill, London, NW7 1AA, UK ‡Authors for correspondence Accepted 16 July; published on WWW 22 September 1999 SUMMARY Activation of Cdc2, is the universal event controlling the dependent manner. Truncation of the C-terminal domain onset of mitosis. In higher eukaryotes, Cdc2 activity is in of Myt1 prevented its ability to induce G2/M phase arrest part regulated by inhibitory phosphorylation of Thr14 and in overexpression studies in human cells and dramatically Tyr15, catalyzed by Wee1 and Myt1, which prevents reduced its ability to phosphorylate Cdc2 in vitro. We catastrophic premature entry into mitosis. In this study we demonstrate that the C-terminal domain of Myt1 was defined the function of Myt1 by overexpression studies in required for recruitment of Cdc2, and we infer that this both S. pombe and a human osteosarcoma cell line. Similar domain lies in the cytoplasm because it can interact with to Wee1, overexpression of human Myt1 prevented entry and is phosphorylated by Cdc2. In conclusion, we propose into mitosis in both cell types; however, Myt1 catalytic that Myt1 can negatively regulate Cdc2/cyclin B1 and activity was not essential for the cell cycle delay observed inhibit G2/M progression by two means, both of which with human cells. Myt1 expression was restricted to require the C-terminal domain; first, Myt1 can bind and proliferating cells. Furthermore, we detected no major sequester Cdc2/cyclin B1 in the cytoplasm preventing entry decline in Myt1 protein abundance prior to the entry into into the nucleus, and, second, it can phosphorylate mitosis, which coincides with the loss of Myt1 activity. We associated Cdc2/cyclin B1 at Thr14 and Tyr15 thus localized mitotic phosphoepitopes, recognized by the inhibiting its catalytic activity. monoclonal antibody MPM-2, to the C-terminal domain of Myt1. The mitotic peptidyl-prolyl isomerase, Pin1, was able to associate with this domain in a phosphorylation- Key words: Myt1, Cdc2, Mitosis INTRODUCTION et al., 1991). Dephosphorylation of Thr14 and Tyr15 upon activation of the dual-specificity phosphatase, Cdc25, coupled In all eukaryotic cells, progression through the cell cycle is with inactivation of the Thr14 and Tyr15 kinases (McGowan regulated by the sequential activation of the cyclin-dependent and Russell, 1995; Parker et al., 1995; Watanabe et al., 1995; protein kinases (CDKs) (Norbury and Nurse, 1992; Morgan, Mueller et al., 1995; Liu et al., 1997; Booher et al., 1997) 1997). Activation of the p34cdc2 (Cdc2) CDK is the universal results in the precipitate activation of cyclin B/Cdc2 which event controlling the onset of mitosis. The ability of Cdc2 to triggers M phase. In S. pombe, phosphorylation of Tyr15 is induce M phase is dependent on its association with a cyclin catalyzed by the Wee1 and Mik1 kinases; the additional level partner, yet is also further regulated in a positive and negative of inhibitory phosphorylation, at least under normal conditions, fashion by phosphorylation. Specifically, phosphorylation at at Thr14 exists only in higher eukaryotes. Phosphorylation of Thr161 by the CDK activating kinase (CAK) is necessary Thr14/Tyr15 has been implicated in the G2/M checkpoint that for activation of the CDK/cyclin complex, whereas blocks entry into mitosis in the presence of damaged DNA (Jin phosphorylation of Thr14 and Tyr15 by Wee1 and Myt1 et al., 1996; Poon et al., 1997) or incomplete DNA replication, kinases maintains the complex in an inactive state. Indeed, in although a cyclin B/Cdc2 inhibitory factor may also be higher eukaryotes there is a gradual cytoplasmic accumulation important (Kumagai and Dunphy, 1995). of potentially active cyclin B/Cdc2 heterodimers during S and A dual-specificity, membrane-associated protein kinase G2, that are phosphorylated at Thr161 but maintained in the activity, able to phosphorylate Cdc2 on both Thr14 and inactive state by phosphorylation at Thr14 and Tyr15 (Norbury Tyr15 was identified in Xenopus and HeLa cell extracts 3362 N. J. Wells and others (Kornbluth et al., 1994; Atherton et al., 1994) and the associate with its substrate, Cdc2/cyclin B1, which is Thr14/Tyr15 kinase, Myt1, was subsequently cloned necessary for Myt1 to phosphorylate Cdc2, and also anchors (Mueller et al., 1995; Liu et al., 1997). In contrast to Wee1, Cdc2 within the cytoplasmic compartment. Because this which is localized in the nucleus (McGowan and Russell, domain is phosphorylated by and interacts with Cdc2/cyclin 1995), Myt1 is localized to the endoplasmic reticulum (ER) B1, we deduce that it must lie in the cytoplasm. In and Golgi complex by a membrane-targeting domain on the conclusion, we provide evidence that the C-terminal domain C-terminal side of the catalytic domain (Liu et al., 1997). is required in combination with the catalytic domain for the Specific subcellular localization of protein kinases is of biological activity of Myt1 in inhibiting G2/M progression. significant importance; indeed the compartmentalization modulated by a nuclear export sequence of cyclin B1 regulates the physiological activity of Cdc2/cyclin B1 (Li et MATERIALS AND METHODS al., 1997; Hagting et al., 1998; Yang et al., 1998). Myt1 exhibits a more restricted substrate specificity than Wee1, in Antibodies that it phosphorylates Cdc2/cyclin complexes but not α α Cdk2/cyclin complexes (Booher et al., 1997). This The 9E-10 -Myc and 12CA5 HA monoclonal antibodies were utilized for immunoprecipitations and immunoblotting of Myc- and observation strongly suggests that Myt1 specifically HA-tagged proteins respectively. Rabbit polyclonal antibodies to regulates G2/M phase transition through the inhibitory human Pin1 were used in the GST pull-down assay, as described (Lu phosphorylation of Cdc2. In turn, Myt1 itself is et al., 1996). Immunoblotting of human Cdc2 was carried out with hyperphosphorylated during mitosis, which is coincident rabbit polyclonal serum (antiserum 5517) as described (Watanabe et with its inactivation (Mueller et al., 1995; Booher et al., al., 1995). Antibodies C1-1 and R5084 against Myt1 were kindly 1997). Interestingly studies on Xenopus Myt1 have identified provided by Drs Booher and Piwnica-Worms, respectively (Booher et the kinase as an MPM-2 epitope containing protein (Mueller al., 1997; Liu et al., 1997). The monoclonal antibody MPM-2, was et al., 1995). The MPM-2 monoclonal antibody epitope is purchased from Upstate Biotechnology. a mitotic phosphorylation dependent motif, minimally Expression constructs, site-directed mutagenesis and phospho-Ser/Thr-Pro (Westendorf et al., 1994), and is DNA sequencing recognized by a monoclonal antibody raised by The human Myt1 expression vector, pcDNAmycMyt1, was a kind gift immunization with mitotic HeLa cell extracts (Davis et al., from Dr Piwnica-Worms (Liu et al., 1997). The Myt1 truncation 1983). series, in the mammalian expression vector pCS, was derived by PCR Recently a novel mitotic regulator, Pin1, a highly conserved amplification of the human Myt1 cDNA and cloned into the XbaI site. peptidyl-prolyl isomerase (PPIase) has been described, that The specific primers used were: Myt1 (full length) 5′ primer also recognizes the MPM-2 epitope (Ranganathan et al., 1997; AGAGAGTCTAGAGATGCTAGAACGGCCTCCTGC and 3′ primer Yaffe et al., 1997). Pin1 inhibits entry into mitosis when AGAGAGTCTAGATCAGGTTGGGTCTAGGGTGTC, ∆N-Myt1 5′ overexpressed in HeLa cells and microinjected into Xenopus primer AGAGAGTCTAGAGTCCTTCTTCCAGCAGA and 3′ primer two-cell stage embryos, yet is also required for progression as for full length Myt1, ∆C-Myt1 5′ primer as for full length Myt1 and 3′ primer AGAGAGTCTAGATCAGCCCAGGGGCTGTAGCC- through mitosis (Lu et al., 1996; Crenshaw et al., 1998; Shen ∆ ′ ∆ ′ et al., 1998). PPIases catalyze rotation around the peptide AGCTG and NC-Myt1 5 primer as for N-Myt1 and 3 primer as for ∆C-Myt1. pEGFPF utilized in cotransfections of U2-OS cells was bond preceding a proline residue and may regulate protein previously described (Jiang and Hunter, 1998). For the GST pull- folding and intracellular trafficking (for review see Schmid, down assay the Myt1 C-terminal domain was cloned to the pGEX- 1995). Phosphorylation of a Ser/Thr-Pro motif catalyzed by KG vector, Myt1 COOH-GST, at the BamHI and XhoI sites by PCR Cdc2/cyclin B could create a Pin1 substrate, enabling amplification using the 5′ primer AGAGAGGGATCCGCCAGCT- conformational changes driven by prolyl isomerization. The GGCTACAGCCCCTG and 3′ primer AGAGAGCTCGAGTCA- conformational change may alter enzymatic activity, or GGTTGGGTCTAGGGTGTC. Pin1 was cloned by PCR amplification modify the sensitivity to dephosphorylation by phosphatases into pEVRF0 (Janknecht, 1996), a mammalian expression vector that creating a timed phosphorylation induced activity/ contains an N-terminal HA tag, at the XmaI and Xba1 sites with the 5′ primer

Load more