Transposon-Mediated BAC Transgenesis in Zebrafish

© 2011 Nature America, Inc. All rights reserved. reduces the labor involved in B prepare a dozen constructs within 3 weeks, and obtain transgenic fish within approximately 3–4 months. fertilized eggs results in clean integrations in the genome and transmission to the germline at a rate of ~15%. reporter gene to replace a target locus in the B cassette in the B transgenesis in zebrafish using the medaka often closely recapitulate the expression patterns of endogenous genes. Here we report a step-by-step protocol for efficient B Bacterial artificial chromosomes (B Published online 1 December 2011; doi:10.1038/nprot.2011.416 should be addressed to M.L.S. ([email protected]) or K.K. ([email protected]). University Bergen,of Bergen, Norway. 1 Maximiliano L Suster Transposon-mediated BAC transgenesis in zebrafish 1998 of insertion or insertion BAC single-copy a either in mice have shown that approximately in half transgenesis of BACBAC of integrations studies extensive resultzebrafish, transgenic in no detailed reports of copy number and fidelity of BAC integration mately 1–3% (or less) germline transmission approxi in results eggs zebrafish fertilized of cytoplasm the into ing the genome occurs randomly via nonhomologous DNA end join in the fertilized zebrafish egg injection of naked DNA (purified DNA without associated proteins) tional expression systems in zebrafish. through the Gal4/UAS neurotoxins and light-activated ion channels have become feasible genes, apoptotic of expression targeted by manipulations genetic Furthermore, types. cell specific of manipulation and alization ing disease human modeling in studies, evolutionary and developmental in live reporters such as GFP can enhance the usefulness zebrafish of lines has not been straightforward. BAC transgenic lines expressing years 10 than advantages. BAC transgenic zebrafish have been reported for more genesis in this model organism could have a number trans of important BAC of reliability and frequency the improving genetics, to bacteria tissues specific or visualize cells in living mice byfluorescent in recombineering created reporters systematically human disease-related genes of study and phenotypes mutant of rescue elements, regulatory transgenic mice have uniquely advanced the analysis of distant size. larger their BAC of effects, presumably because to positional small plasmid-based transgenes, BACs are generally more resistant correct cell type–specific and temporal expression. Compared with of a gene, including long-range ments as large as 300 kb, they often include the complete structure models of human disease cations in mice, from studies of gene regulation to creating animal BAC transgenesis has been used extensively in a broadI range of appli Division of Molecular of Division and Developmental Biology, National Institute Genetics, of Mishima, Shizuoka, Japan. NTRO protocol Given the tractability of zebrafish ( zebrafish of tractability the Given Traditionally, BAC transgenesis has been carried out by micro by Traditionally,out carried been has BAC transgenesis 9 1 . As fertilization is external, live embryos are accessible to visu . A number of reports suggest that BAC DNA microinjection BACmicroinjection DNA that suggest reports of .number A

| VOL.6 NO.12VOL.6 D 9 , targeted manipulation of neural circuits UCT I 6– ON 8 ; however, systematic generation of BAC reporter BACreporter of however,generation ; systematic AC | 2011 plasmid backbone, which contains the inverted minimal 10,1 | 1 1–

1 , LexA/Op natureprotocols , 3 2 . Because BACs can hold genomic frag , Gembu Abe 6 1, or mouse oocyte 2 . BAC reporter transgenes have been 3 cis Department of Genetics, of Graduate Department University for Advanced Studies (SOKENDAI), Mishima, Shizuoka, Japan. Correspondence AC -regulatory elements required for transgenesis and will greatly facilitate biological and biomedical studies in model vertebrates. 1 AC 2 , Cre/ Danio rerio Danio s) s) are widely used in studies of vertebrate gene regulation and function because they 1 lox , Anders Schouw 6– Tol2 1 8 1 . BAC integration in . Although there are 3 or TetON 8 AC and drug screen transposon. ) for vertebrate vertebrate for ) . . Microinjection of the

multicopy multicopy 4, 1 4 5 condi . cis U 2 sing sing recombineering in & Koichi Kawakami ------

including including sive. More recently, attention has turned to transposable elements, ( sis mutagene insertional genome-wide for particularly zebrafish, in Retroviral vectors have also been successfully used for transgenesis enhancing integration of BAC constructs in zebrafish is not known. tion rates for (~5 kb) small constructs integra enhance substantially to found was protein I-SceI with meganuclease recognition site in the plasmid DNA and co-injection I-SceI 18-bp an above. of Inclusion discussed as unreliable is and simplest and easiest method, but suffers from low integration rates introduced into the cytoplasm of one-cell-stage embryos is construct linearized a which DNA, in naked of Microinjection transgenesis because of restrictions in DNA cargo BACto capacityapplicable not are most yet zebrafish, for ( developed been have been desired. Therefore, more reliable methods for BAC transgenesis in zebrafish unwanted deletions may occur upon Cre-mediated recombination. flanking a gene or cassette and the BAC transgene is a concatemer, tion. In particular, when tandem BAC using Cre- a within sequence DNA particular a of deletion conditional The ewe 5 n 4 cpe o te A i vros orientations various in BAC the of copies 48 and 5 between carry remaining the locus; genomic single a at BACconcatemers insert, the insert can be reliably integrated into the genome via via genome the into integrated reliably be can insert the insert, of ends right and left the active in a wide variety of vertebrates BAC into inserts the zebrafish and mouse genomes efficiently carry can and kb) 50 than (more capacity cargo large Furthermore, we recently demonstrated that mutagenesis insertional including genetics, forward and esis in the germ lineage ( them, genes trans the around and inside both lesions genetic and instability silencing, with associated generally are transgenes Concatemeric

< The medaka medaka The In the past two decades, a number of transgenesis methods have 23–2

8 kb) 8 Tol2 6 16,1 ; however, retroviral vectors have a very limited cargo capacity Tol2 7 , potentially limiting important experimental applications. 2 -B cis 7 and their application in the laboratory is labor inten labor is laboratory the in application their and mariner appears to have the highest rate of genomic integration AC -sequences -sequences required for and a transposase codon-optimized m loxP Tol2 2 Sars Sars International Center for Marine Molecular Biology, 1 2 Escherichia Escherichia coli 8 , –mediated recombination 3 , element is a DNA-type transposon that is is that transposon DNA-type a is element Table Tol2 (ref. Tol2

1 ) ) and is now widely used for transgen are placed on either side of a DNA a of side either on placed are 2 9 loxP ) and and ) , , we introduce the 31–3 Tol2 sites are placed within a BAC 2 O 5 2 . When ; whether ; this is foruseful whether Sleeping beauty Sleeping ur ur protocol drastically transposition, and a Tol2 A 2 is one such applica single person can cis has a surprisingly -sequences from 3 3 . RNA iTol2 3 18–2 0 . Among Among . Table into

1 , is the AC 31,3

1 1 ). 5 2 ------. .

© 2011 Nature America, Inc. All rights reserved. TA be repeated several times before this part of the procedure is completed. The circular arrow on the box ‘Step 50’ indicates that this step may have to boxes ‘Steps 16–32’ and ‘Step 33’ indicates that the order can be reversed. protocol and anticipated timing for each step. The double arrow between the Figure 1 in flowchart A stages. three the of consists with zebrafish transgenic BAC of Generation Overview regulation, comparative genomics and targeted gene expression. intact BAC integrations and more reliable tools for analysis of gene BAC in expand zebrafish,the use of clean and aiding transgenesis deliver single-copy BAC integrations. This protocol should greatly injection by providing increased efficiency and higher reliability to son system. Our protocol complements conventional naked DNA efficiently using recombineering technology zebrafish BACtransgenic generate to how detail in illustrate that kanamycin settes ( fish matches the expression the pattern of endogenous gene. (range 5–20%). Notably, reporter expression in the BAC transgenic BAC integrations are observed in ~15% of the injected founder fish source (five BAC libraries tested from two species). Stable germline zebrafish genome very high success rate in the integration of BAC transgenes into the inverted minimal oocytes mouse or eggs zebrafish fertilized in TP we have found that any insert can be efficiently excised by the on the right, and placing them ~1 kb apart on a large BAC plasmid, minimal these inverting a Retrovirus Tol2 Sleeping beauty Meganuclease Naked DNA Method

transposase (TP)-dependent cut-and-paste mechanism cut-and-paste (TP)-dependent transposase Here we report a step-by-step protocol, including new B LE (refs. 1 iTol2-galactokinase

| Flowchart outlining the experimental procedures described in this |

Comparison Comparison of transgenesis methods in zebrafish. of 23–2 29,31–3 ( 18–2 kan

the 7 2 1 2 3 )), reagents and recent examples from our work work our from examples recent and reagents )),

0 procedure 33,3 Tol2 6 ) 7 , regardless of insert size (range 35–230 kb) or cassette ( Creates clean hits on the genome End-to-end integrations Single-copy integrations High integration rates (70–100%) Large cargo capacity ( Creates clean hits on the genome End-to-end integrations Single-copy integrations constructs (up to 10 kb) and 5–20% for BACs High integration rates: 50–70% for small Creates clean hits on the genome End-to-end integrations Single-copy integrations Moderate integration rates (10–30%) prescreen) Moderate integration rates (~30% with Simple and easy A Tol2 dvantages ( galK ends, 150 bp on the left and 200 bp bp 200 and left the on bp 150 ends, ), iTol2 iTol2-ampicillin cassette), we have observed a Figure 3 8 and the

160 160 kb)

( 1 3 amp 3 outlines these these outlines . By using this this using By . Tol2 Tol2 ) and

iTol2

transpo system system 34,3

iTol2- 6 cas Tol2 . By .

- -

(Steps 1–33), a a 1–33), (Steps stages and the proceduresexperimental involved. In the first stage the locus of interest and the as (such gene reporter a recombination homologous clone is grown in a special strain of The databases. online searching by retrieved is interest of region coli E. Requires construction Low cargo capacity ( Requires transposase mRNA Requires construction Low-cargo capacity ( Requires transposase mRNA Requires construction Requires I-SceI meganuclease Requires construction Concatameric integrations constructs ( Low integration rates: 5–10% for small L Laborious viral preparation imitations Recombineering

second stage (Steps 34–48), the Microinjection by recombineering. A BAC clone covering the genomic genomic the covering clone BAC A recombineering. by Screening Stage 3: Stage 2: Stage 1:

10 10 kb) and 2% for BACs Tol2 Step 33:RecombineeringareportergenecassetteintotheBAC Step 49:Selectionandrearingof Steps 16–32:Recombineeringthe Steps 34–44:Microinjectionofthe Steps 45–48:Confirmationof Steps 51–60:Analysis of Steps 1–15:IdentificationandpreparationofBACclones -compatible BAC plasmid is constructed in in constructed is plasmid BAC -compatible

< <

natureprotocols

8 8 kb) 8 8 kb) iTol2 Step 50:Screeningof

cassette into the plasmid backbone. In (B) (A) Kanamycinselection~2 (B) PCRscreening (A) Fluorescencescreening galK BAC selection~6 E. coli

Tol ~3 ~2 ~3 ~2 ~5

transgene is microinjected Tol2 2

d d d d d F -BAC integrationsin | VOL.6 NO.12VOL.6 F in order to introduce by 0 Insertional mutagenesis Transgenesis Insertional mutagenesis BAC transgenesis Transgenesis Insertional mutagenesis Transgenesis Transgenesis BAC transgenesis Transgenesis A injectedfish~3 Tol2 iTol2 0 -dependent BACexcision pplications injectedfish~3–4months d -BAC andtransposase cassetteintotheBAC protocol d |

d GFP 2011 F 1 fish

) at the the at ) |

1999

© 2011 Nature America, Inc. All rights reserved. Table modified from http://www.sanger.ac.uk/Projects/D_rerio/faqs.shtml#dataeight. TA 2000 (gray box), where the plasmids encoding amplification of the The prokaryotic em7 promoter is included in resistance piTol2-galK in ends of cassettes. Red triangles represent the left (L200) and right (R150) minimal ( Figure 2 positive/negative two-step and the of selection deletion precise ( a gene and functions, recombinase λ defective a bacterial harbors which the DY380), from (derived into SW102 strain electroporation by introduced is DNA mid in systems recombination homologous bacteriophage-mediated by exchanged are BAC the in sequences BAC pCCFOS1. vector single-copy the in are inserts the because recombineering Fosmid clones in the CHORI-1073 library can also be modified by CHORI-73, CHORI-1073, DanioKey and DanioKey CHORI-211, Pilot including libraries, ( genomic zebrafish eight least at from available are Clones transgenesis. stable for clone BAC ate appropri most the identify to parallel in tested can and modified be clones These obtained. be should clones BAC overlapping the gene is too large to be contained in a single BAC, If kb). ideally 100 several least (at available clones genomic possible largest the gene the of downstream and upstream both located and distances long over scattered be may gene any Obtaining background the and of procedure.implementation by PCR or genotyping fluorescence sorting. Below we describe the the of transmission for screened and maturity sexual to raised are fish injected the 49–60), (Steps into a L CHORI-1073 CHORI-1073 (FOS) ZFISHFOS BUSM1 (PAC) RPCI-71 CHORI-73 DanioKey Pilot DanioKey CHORI-211 protocol -Red prophage on the genome that contains the heat-inducible heat-inducible the contains that genome the on prophage -Red ) ) Schematic of the medaka ibrary Tol2 B Spec-resistance gene Spec-resistance LE

fertilized eggs together with with together eggs fertilized

| recombineering represent the exons of TP mRNA. In VOL.6 NO.12VOL.6 2 Tol2 ∆

| ( galK |

, , the L and R ends of iTol2 ampR

required for transposition. Gray boxes and overlying lines Zebrafish BAC, PAC and FOS libraries.

BAC ) , , 4 galK ), ), kan 5 Ti sri alw bt snl-tp ant single-step both allows strain This .

kan GFP clones. and and kanamycin recombineering. Kanamycin selection | 2011 kan - , , resistance ( Gal4FF galK is flanked by SpecR

in P CH1073 ZFISHFOS BUSM1 RP71 CH73 DKEYP DKEY CH211 In general, as the regulatory elements of of elements regulatory the as general, In | refix Tol2

cassettes for BAC recombineering. natureprotocols E. coli E. , , ). ). ( Gal4VP16 Tol2 ( transposon and design of the b kanR ) ) Schematic of vectors used for PCR have been inverted flanking the . To modify a BAC clone, DNA clone, BAC a modify To Tol2 ) ) and BAC FRT or E nsembl prefix sites. piTol2-amp TP RNA. In the third stage stage third RNA. the TP In Cre piTol2-galK transgene to the germline germline the to transgene galK 3 contain the SV40 pA 9 , it is wise to start with with start to wise is it , . coli E. genes, respectively. zKp zFD zH dZ bZ zK zC – , , . . Plasmids carry piTol2-kan galK 38,40–4 selection 4 BC plas BAC . iTol2

and Table Insert size(kb)

amp- biotic biotic galK 2 4 ). 5 175 115 110 130 175 171 - - .

40 85 in vivo in the of (R150) end right the on bp 150 and (L200) left the on bp 200 As for the genome, a cassette containing the minimal sequences required iTol2 to precise exchange the of target sequence can be induced by shifting the cultures to 42 °C for 15 min, leading temperature Red Because bination. RedExo or product,whereas λ is introduced donor by electroporation into a BAC-containing cells containing cassette) sequence (the and 50 bp homologies to product the target sequence on each PCR end linearized A pGal4VP16-FRT-Kan-FRT b a -Red–encoded Gam function prevents degradation of the PCR PCR the of degradation prevents function Gam -Red–encoded pGal4FF-FRT-Kan-FR Tol2 Tol2 pGFP-FRT-Kan-FR

pCre-FRT-Kan-FR cassette. 3 Tol2 6 L ( transposition must be placed inside the BAC plasmid. plasmid. BAC the inside placed be must transposition pCCFOS1 pFOS-1 pCYPAC6 pTARBAC2.1 pTARBAC2.1 pIndigoBac-536 pIndigoBac-536 pTARBAC2.1 Vector Fig. 2 transposon are sufficient for efficient transposition transposition efficient for sufficient are transposon piTol2-galK piTol2-amp piTol2-kan - sensitive To facilitate integration of the BAC construct into BAC construct the Toof integration facilitate a pgalK ), we created the the created ),we T T T λ α Gal4VP16 repressor (allele /Red Gal4F GFP Cr

e em7 em7 L F β α are under the tight control of the the of control tight the under are and Beta or Red or Beta and [email protected] [email protected] [email protected] [email protected] [email protected] [email protected] [email protected] [email protected] C ampR kan gal gal ontact FRT iTol2 K K R kan kan kan kan cassette, which consists of of consists which cassette, cI857 SpecR SpecR SpecR SpecR SpecR AmpR SpecR R SpecR 45–4 9 . )

FRT 40,4 β mediate recom mediate 1 , recombination 41,4 500 bp R 5 . The -

© 2011 Nature America, Inc. All rights reserved. the gene is electroporated into cells containing the homologies to the first and second exons in A PCR-amplified gene into the are readily obtained. ( plates, colonies containing the gene. After selection on ampicillin and kanamycin homologies to the first and second exons in the and kanamycin flanked by electroporated with a PCR product containing GFP containing the resulting After selection on ampicillin plates, bacteria which contains a gene of interest ( or primers) matching a sequence flanking a with 50-bp overhangs (small arrows represent recombineering. The cassette and kanamycin selection cassette and reporter gene into a BAC clone. ( Figure 3 and induction of recombineering functions, functions, recombineering of induction and of formation trans After gene. target the of exon) second (or intron first the fied by PCR, together with 50-bp to homologies the first exon and as (such cassette gene reporter ( selection the into introduced is gene Introducing ( night cassette ( the with plasmid BAC the containing colonies tions, into BAC-containing cells, and induction of recombineering func ( BAClibraries or and inserted at a fixed location in the BAC a plasmid—either PCR by amplified is end each on homologies 50-bp with cassette Introducing promoters in the BAC tissue-specific of control the under placed typically are cassettes sites and Cre will delete any sequence located between two adjacent any target gene located downstream of its target UAS sequence recombinase Cre the another and Gal4FF gene ( nation signal (i.e., simian virus 40 pA) and an antibiotic-resistance reporter gene (such as ( PCR for templates as serve that cassettes gene reporter of number a containing plasmids several interest. a monitor gene of the expression of We have constructed as (such gene Reporter piTol2-kan recombineering, for DNA cassette kan the inverted L200 and R150 sequences flanking the selection on DOG medium, colonies containing the are recovered. Next, these colonies are electroporated with a linear PCR product encoding a reporter gene ( lox511 lox511 -resistance genes. To prepare linear double-stranded double-stranded linear prepare To genes. -resistance 5 2 . To Gal4 of the restrict or activity Cre in space and time, the kan Fig.

1 site is introduced into the BAC clone, | 0 Recombineering the and Gal4-VP16 (refs. Gal4-VP16 and Tol2-

site, which is present in the plasmid backbone of most most of backbone plasmid the in present is which site, ) ) flanked by gene

( Fig. 3 Tol2 Fig. a

the ). the BAC plasmid) will grow on ampicillin medium over galK GFP Tol2

cassette. Fig. -BAC by 3

reporter product with 50-bp a iTol2-amp iTol2 ) or two-step two-step or ) ) is placed in a coding exon within the BACto the exonwithin coding a in placed is ) -BAC-containing cells with the PCR product product PCR the with cells -BAC-containing b ) ) are used as templates for PCR.

3 ) Introducing a reporter a Tol2 GFP ). After transformation of the PCR product product PCR the of ). transformation After 4, FRT galK FRT 5

Typically, a containing cassette a reporter . cassette -BAC plasmid are sites, with 50-bp linear fragment recombineering.

) is fused to a strong transcription termi sites. Two these of plasmids encode the gene iTol2 Tol2 Tol2- gene X -BAC reporter cassette a

GFP-pA-FRT-kan-FRT into 50,5

) galK into iTol2 Fig. 5 BAC plasmid using antibiotic antibiotic using plasmid BAC loxP ). 2 . Gal4 drives transcription of of transcription drives Gal4 .

piTol2-galK 1 the

) transcriptional activators, activators, transcriptional )

eeto ( selection

2 the b

BAC ). In these plasmids, the the plasmids, these In ).

BAC Tol2 Tol2

clone. kan -BAC:GFP reporter are recovered.

-BAC reporter. After selection on galactose-only medium, Gal , a b clone. 50 bp piTol2-amp Fig.

recombinants recombinants galK- 50 bp The reporter reporter The

ATG ATG 3 The The ) is ampli is ) iTol2-amp iTol2-am Left b Tol2

em7 Gene , galK ). A A ). BAC amp- Iox -BAC Right X iTol2 iTol2 and and 50 bp loxP loxP p 50,5 kan or 1 - - - - - 50 bp ,

recombination iTol2 ( (M.L.S., unpublished observations). Toobservations).(M.L.S.,unpublished carriers germline identify as stronger signals may be correlated with higher integration rates ing the strongest and most even fluorescence signals from the rest, rescent reporter, it is recommended to raise separately those show to sexual maturity. However, the BAC if transgene encodes a fluo show an excision product, and so if all injected embryos are raised sumably by self-ligation gene inside the the target site upon binding to the 10-h-old injected embryos ( plasmid DNA is intact, a simple PCR excision assay is performed on fish. To confirm that TP is functioning properly and that the BAC germline transmission of for zebrafish ( recently generated a synthetic TP of ity activ the ondependent strongly is genome the BACin construct of one-cell-stage embryos mid and synthetic To integrate the BAC construct in the genome, the ampicillin/kanamycin plates the next day next the plates ( ampicillin/kanamycin Microinjection 3 after d ( medium DOG-containing the phosphorylation by containing 2-deoxy- of recombineering functions, cells are plated on minimal medium and 50-bp homologies is transformed into gal gene, a PCR product containing the gene of interest (such as minimal medium after 3 d ( cells is amplified by PCR and electroporated into moter ( kb 1.2 a selection, Tol2 not essential to do so, the recombination Tol2 selection Positive (Gal Am galK Tol2 cassette -BAC plasmid by induction of FLPase in in FLPase of induction by plasmid -BAC 4 5 -BAC: p . Only cells containing containing cells Only . + ) Fig. 2 -BAC reporter plasmid without 3 50 bp 3 .To mRNA,TP increase efficiency translation the of we FRT-kan-FRT b 34,3 zTP GFP 50 bp ) and 50-bp homologies to the BAC target sequence, iTol2

6 of ( ATG , Tol2 Fig. Tol2

FRT GFP Tol2 Fig. the galK galK d galK galK, iTol2 cassette is released, and then circularized pre Kan -BAC -galactose (DOG), a galactose analog that, after GFP -BAC

TP mRNA are co-injected into the cytoplasm 4 natureprotocols

Tol2 4 c gene, including the prokaryotic em7 pro em7 prokaryotic the gene, including 50 bp 33,3

a FRT ). If excision occurs, the bacterial selection ) to replace the : sequences, creating an 8-bp duplication at becomes toxic 5 ). Injection of zTP mRNA leads to reliable Tol2 kan 3 50 bp ae eoee o Lra rt (LB)- broth Luria on recovered are ) 4 ( -BAC ( Fig. Fig. Fig. Fig. gene can be excised later on from the - TP

+ galK BAC

colonies containing the

3 4 Reporter gene

recombination

recombination 4b gene with codon usage optimized b b plasmid Kan ). Efficient integration of the selection Amp, Kan ). TP excises the BAC DNA insert ). To replace (Gal (gal transgenes in ~20% of injected , DOG c cassette ). Ideally, nine of ten embryos Fig. – galK ) 4

+ galK 5

. Only bacteria containing

| ) will grow on galactose galactose on grow will )

VOL.6 NO.12VOL.6 3 and cassette. After negative b Fig.

). Tol2 (Gal + ATG

cells. After induction

stable GFP galK E. coli E.

3 -BAC-containing ATG a protocol – ) will survive on GFP Tol2 ). Although ). it is Although Tol2

Tol2 FRT reporter reporter with a reporter Tol2

transgenesis. 38,4 Kan -BAC -BAC | 2011 -BAC plas 5 -BAC:

. For . FRT | galK

GFP Tol2 2001 galK

) ------

© 2011 Nature America, Inc. All rights reserved. tems commonly used are the the are used commonly tems Choice several model fish sequenced with species genomes. repeats. excessive contains region this when or region genomic particular a for available not BACsare zebrafish when useful be may clones BAC Such studies. genomic comparative for tools useful are and among injected (founder) fish, the progeny are screened by PCR by screened areprogeny the fish, (founder) injected among (asterisks). followed by stable integration and duplication of the 8-bp targetBAC sequenceplasmid align with a random target site (asterisk) in the (usinggenomic the DNA,forward (f) and reverse (r) primers). The is circularized by ligation. This excision product can be amplifiedplasmid by PCR( genome. TP protein (black circles) binds to the of ( band (arrowhead) is detected in embryos co-injected with BAC and TP(see RNA below) are examined on a 1% (wt/vol) agarose gel. A strong PCR336-bp excision assay. The PCR products amplified from the excisedembryos are grown for 10 h, digested with proteinase K and processedco-injected for intoa the cytoplasm of the one-cell embryo. A subset of synthesizedthe injected the pCS2 expression vector. After linearizing this vector with NotI,( zTP mRNA is Figure 4 2002 puffe zebrafish transgenic in work to likely not are promoters mammalian most sible sources of BAC clones for transgenesis in zebrafish. Although sequenced genomes, pos there a arenumber large of in principle Choice Experimental to be determined. on limitation size any of aware not are we Although recombineering. to obstacles recombineering by target regions containing repetitive modifiable or incorrect sequences readily can pose not are kb) (30–50 cosmids as such plasmids multicopy in maintained BACour protocol fish. of is clones that One limitation transgenic of generation systematic the facilitate uniquely can protocol our once, at BACsmany to step recombineering single a in added be elements regulatory gene of circuits neural of tion disease human of studies mechanistic phenotypes, mutant of rescue include applications system nervous the as such organs and tissues complex in structures subcellular and cells of imaging live include These medicine. and biology of fields applied and basic in applications unique of range wide a have tissues and cells specific in proteins ( genome the sion and greater reliability of obtaining single-copy transmis integrations in germline of efficiency increased are methods existing of advantages Twomajor Advantages, preferably 100) embryos from each founder. (but 50 least at Wescreening sorting. recommendfluorescent or

a + protocol ) A synthetic zebrafish codon-optimized

TP mRNA) but not without TP ( Tol2

r | -dependent excision and integration of the VOL.6 NO.12VOL.6 fish

pTol2 | of of Microinjection of the Table 5 AmpR 5 in vitro Fugu rubripes

, BACs from closely related teleost fish, such as the the as such fish, teleost related closely from BACs , BAC recombineering -BAC), leading to excision of the

applications Table

, amp resistance. design 3 from the SP6 promoter. ( lists information regarding BAC libraries from from libraries BAC regarding information lists

clone. | 2011

Tol2 1 ).expressing fluorescent BACfish transgenic 5 4 -mediated BAC transgenesis, this has yet yet has this transgenesis, BAC -mediated Given the number of vertebrates with with vertebrates of number the Given , are known to work properly in zebrafish , drug screening drug , | natureprotocols

9 and , targeted cell ablation and manipula and ablation cell targeted , Tol2 Tol2

−

TP mRNA). M, 1 kb DNA ladder. ( 6,3 system. λ -BAC plasmid and excision assay.

7 limitations . Because the the Because . -mediated BAC transgenesis over transgenesis BAC -mediated -Red system (the one used in this this in used one (the system -Red Tol2 b w rcmiern sys recombineering Two ) The TP cDNA ( iTol2 amp 9 and functional analysis analysis functional and Tol2 Tol2 Tol2 gene (blue arrow) that ends in the -BAC transgene in the iTol2 ends of the excised -BAC and TP mRNA are zTP 3 ) was cloned into 8 sequences can can sequences . In addition, addition, In . iTol2 Tol2 c ) Schematic -BAC cassette 8

. Other Other .

3 - - - - 7

almost almost anywhere in the BAC. tain repetitive sequences, it should be possible to insert the cassette the process and saving costs. As long as the target site doessimplifying thus not plasmid, BACcon the in location fixed a at inserted sette has a generic function (such as the large cassettes are more prone to mutagenesis during PCR. If a cas of homologous recombination homology arms around 200–500 bp because of the lower efficiency ( cassettes larger straightforward, considered. Although homologous exchange DNAof up to 2 kb is kan and cassettes. Thus, the size of the cassette, selection marker ( Tol2 Cassette flanked by or FLP in the advantages as well, such as the presence of arabinose-inducible Cre SW102),functions, such offer(derivates of as and SW106 SW105 recombineering the containing strains bacterial new hand, other preparation BACof plasmid DNA before recombineering. On the (ref.(such as pSIM18 genes these contains that plasmid a supply to is option Another that harbors the genes encoding these functions (such as SW102). tion functions, there are two options. One is to use a bacterial strain homologies bp) (40–60 short with fragments double-stranded using recombination permit systems prophage Rac the from system RecET the and protocol) 1,000 bp b a 100 bp 500 bp and and - BAC galK

TP mRNA design Tol2 transgenes may require several rounds of recombineering M loxP zTP mRNA + -BAC ), sequence procedureand target carefully be should 6 5 4 3 2 1 E. coli In vitro Excision assay or – TPmRNA SP6

Proteinase and FRT ‘Zebrafish’ transposas genome, which permit the excision of cassettes synthesi

recombineering Microinjection ~10 5 pCS2-zT2TP sites, respectively 6 K h )). latter The could to useful be avoid the s 9 8 7 3 8 + TPmRNA . Subcloning is more laborious and AmpR

10 e > 40–4

5 kb) require cloning longer longer cloning require kb) 5 11

4 procedure. .To recombina the supply 12 c iTol2 NotI AAAA 4 * Integration 13 5 . Excision cassette), it should be pTol2 Tol2 r f TP -BAC * Construction of -BAC TP Genomic DNA Ligation 3 Excision product 8 . Both Both . * r f amp - - - , © 2011 Nature America, Inc. All rights reserved. TA • • • • • • • • • • REAGENTS M BAC a create to is aim the future.If the in breeding to due delays avoid to or carriers transgenic of screening facilitate to used be strains the wild-type as such rate) survival highest the (with strain zebrafish healthiest struct should be microinjected into fertilized eggs derived from the Strain aculeatus Stickleback ( Medaka ( ( Green spotted pufferfish rubripes Pufferfish ( N purification (Sigma) and (Sigma) resuspend in10mM purification Tris-Cl, pH 8.5, at100 ing to theBAC the source of clone ( Primers for amplifying K.K. on request (see Tol2 for sequence) plasmidmapandfull FRT FRT Kan (see pCR8GW-iTol2-galK iTol2 (available from NCI-Frederick) galK BAC clones purchased from BACPAC Resouces Center or ImaGenes ( brb/recombineeringInformation.aspx) ∆ ( end SW102 bacteria: SW102( cat. no. A5040) Anesthetic (ethyl 3-aminobenzoate methanesulfonate salt(Sigma, companies) 2-and12-literAquatic tanks(Aqua with facility Schwarz or equivalent relevant guidelines. institutional ethics Tg ( Zebrafish ATER cro-bio Tetraodon nigroviridis B galK ame (species) ( LE UAS:GFP A1 TP plasmid: zebrafish codon-optimized cassette plasmids: - - plasmid: pBluescript SK-pEm7-galK ampicillin resistance plasmid: ampicillin SK-pEm7-galK pBluescript (AmpR) Supplementary cassette plasmids: kan kan 3 4

5 ara for I (obtained from (obtained NCI-Frederick) (http://web.ncifcrf.gov/research/ A) ALS - - ) | FRT FRT Oryzias Oryzias latipes

D139  )

BAC libraries from alternative fish species with annotated genomes. Danio rerio Danio Tol2 tet Takifugu ) fish available from M.L.S. on request (see , Gasterosteus Gasterosteus ∆ pCR8GW-Gal4-VP16 ∆ gal -BAC ( 1 ara 0 Supplementary K) harbors adefectiveK) harbors

available from M.L.S. or K.K. on request Data

CAUT , ): wild-type strains ( strains ): wild-type pBSK-GFP leu

iTol2 pCR8GW-iTol2-amp TAB microinjection. ) mcrA )7649 for sequence) plasmidmapandfull ) I ON cassettes (

shouldadhere animalexperiments All to ∆ CHORI-218 CHORI-213 no. 756) Cab (RZPD Hd-rR/HNI Hd-rR A Fugu B L gal ibrary TL ( -pA- mrr-hsd

Data U Table . However, alternativemay strains -pA- rsp FRT Table for plasmid map and full sequence) L FRT

2 λ RMS- Tol2 nup - TAB ). Order PAGE 50nmolwith -prophage and deletion of the -prophage of anddeletion In principle, the BAC conBAC the principle, In kan

4 pCR8GW-iTol2-kan - TP, G ; kan Choose primer accord Choose primer - size (kb) or mcr FRT Φ Insert - pCS2-zT2TP 80d TL 175 190 210 153 126 FRT 80 BC) Supplementary , ) and transgenic ) andtransgenic pCR8GW-Gal4FF lacZ , pCR8GW-Cre ∆

lac ∆ M15 X74 pTARBAC2.1 pTARBAC2.1 pBACe3.6 pBAC- pBAC- pBeloBAC11 pBACe3.6 pBeloBAC11 Vector available from

deo λ and

cI lac lac Table

857 R Data µ - -pA- rec M.) -pA- 4 5

2 ) - screening Ensembl and colony filter ~mbase/mb_base.html http://earth.lab.nig.ac.jp/ http://medaka.utgenome.org/ fr/externe/tetranew/ http://www.genoscope.cns. http://fugu.nimr.mrc.ac.uk/ S earch transgenic line expressing Gal4, the the Gal4, expressing line transgenic and and facilitates live internal tissues. of imaging mutant lacking melanophore pigmentation Gal4 and UASGFP). Another useful strain is fluorescent-positive-injected both embryos/larvae (carrying BAC: strain UASGFP homozygous the into directly injected • • • • • • • • • • • • • • • • • Magnesium sulfate heptahydrate (Sigma, cat. no. M1880) Lithium chloride (Sigma, cat. no. 62478) to theeyes,swallowed irritating andcanbe system respiratory andskin. Methylene blue hydrate (Sigma, cat. no. 28514) Calcium chloride (Sigma, cat. no. C1016) Ammonium sulfate (Sigma, cat. no. A4418) to eyes.swallowed irritating andcanbe Ammonium chloride (Sigma, cat. no. A9434) Chloroform (Sigma, cat. no. C0549) ! Phenol-chloroform-isoamyl alcohol mixture 25:24:1(Sigma, cat. no. 77617) to eyes.irritating Inhalation may causedizziness andnausea. Isopropanol (Sigma, cat. no. I9516) Ethanol (99.7%) Nucleobond BAC 100kit(Macherey-Nagel, cat. no. 740579) QIAquick kit(Qiagen, gelextraction cat. no. 28706) Plasmid miniprep kit(Qiagen, cat. no. 27106) (Sigma), desalted andresuspend in10mMTris-Cl, pH8.5, at100 PCRexcisionPrimers for single-embryo assay ( desalted andresuspend in10mMTris-Cl, pH8.5, at100 Oligos for adapter-ligation (ADL) PCR( at 100 order 25nmol(Sigma), desalted andresuspend in10mMTris-Cl, pH8.5, Primers for sequencing reporter genes after recombineering ( for up to 50 bp. Resuspend in 10 mM Tris-Cl, pH 8.5,order at 50 100 nmol with PAGE purification for oligos longerfor than confirming 50 bp and homologous 25 nmol recombination (REAGENT SETUP andGene-specific primers for recombineering reporter gene cassettes and primers

CAUT µ I ON M) It istoxic by inhalation, skin. ingestion or contact with natureprotocols BPRC-CHORI BPRC-CHORI ([email protected]) sourcebioscience.com) Source BioScience (lifesciences@ MMBase ([email protected]) nibb.ac.jp) Medaka Bioresource Center (mbrc@ cns.fr) Genoscope (webmaster@genoscope. sourcebioscience.com) Source BioScience (lifesciences@ C ontact ! !

CAUT

CAUT Table I I ON Tol2 ON !

It is carcinogenic. Wear gloves.

| 4

It flammable and isvery VOL.6 NO.12VOL.6 CAUT Table ! ; order 25nmol(Sigma), -BAC construct can be be can construct -BAC

CAUT 5 nacre 7 , which is transparent I

4 ON I ; order 25nmol ON , a protocol It is harmful if It if isharmful µ µ M) It is harmful if It if isharmful M.) mitfa- Table | 2011 1 0 to select select to Table µ recessive

4 M) ; |

2003

4 ; © 2011 Nature America, Inc. All rights reserved. TA 2004 ALS iT2galK-exc922R iT2galK-exc159F iT2amp-exc168F iT2amp-exc168R geneX_galK_rev geneX_galK_fw pA_seqR Cre_seqF Gal4-VP16_seqF Gal4FF_seqF GFP_seqF geneX_pA-rev geneX_frt-kan-rev geneX_Cre_fw geneX_Gal4-VP16_fw geneX_Gal4FF_fw geneX_GFP_fw pindigobac_itol2_rev pindigobac_itol2_fw ptarBac_itol2_rev ptarbac_itol2_fw P protocol rimer name B LE

| VOL.6 NO.12VOL.6 4 |

Primers and adapter sequences.

| 2011 GAATAGGAACTTCCTGCAGGAATTC ATGGCCAATTTACTGACCGTACACC ATGGTGAAGCTACTGTCTTCTATCG ATGAAGCTACTGTCTTCTATCGAAC ATGGTGAGCAAGGGCGAGGAGCTG TTCGGACAAACCACAACTAG - GTAGGCTGGAGCTGCTTC - GCCACCATGGCCAATTTACTGACCGTACACC - GCCACCATGGTGAAGCTACTGTCTTCTATCGAAC - GCCACCATGAAGCTACTGTCTTCTATCGAAC - gccaccatg - CATATTATGATCCTCTAGATCAGATCT CCCGCCAACACCCGCTGACGCGAACCCCTTGCGGCCG GAGCTCATCGCTCCCTGCTCGAGCCGGGCCCAAGTG TTCTCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCC AATTAAGTCTACTAATTATGATCCTCTAGATCAGATCT CGCGGGGCATGACTATTGGCGCGCCGGATCGATCCTT CCCGACATAGATCCCTGCTCGAGCCGGGCCCAAGTG GCGTAAGCGGGGCACATTTCATTACCTCTTTCTCCGCA S GGGCAGGT CTAATACGACTCACTATAGGGCTCGAGCGGCCGCGG CCGTGCCGCAAATTGACACTCTGG CACGGTTTGATAATCAATCGCGCAG GGTCTCGCGGTATCATTGCAGCACTG GGGCGACACGGAAATGTTGAATACTC CTGCTCCTT bp CCTGTTGACAATTAATCATCGGCA- - |

------equence (5 - natureprotocols

------_

50-bp_homology_rev_comp- 50-bp_homology_rev_comp------homology_rev_comp-

- - - - -

GTGAGCAAGGGCGAGGAGCTGTTC - - - - -

- - - - -

- - - - ′ - –3

-50-bp_homology- -50-bp_homology- -50-bp_homology- -50-bp_homology- -50-bp_homology- ′ )

TCAGCACTGTC

50- - -

- - - -

- - -

- - - -

- GGAA CCGCGT

- - - - -

------

Amplify Amplify of Gal4VP16 cassette for BAC recombineering (Steps 33A(i) and 33B(x)) Amplify Gal4FF cassette for BAC recombineering (Steps 33A(i) and 33B(x)) Amplify GFP cassette for BAC recombineering (Step 16) pCCFOS1 pBeloBAC11 pIndigoBac-536 Amplify (Step 16) pBACe3.6 pTARBAC2.1 Amplify P ADL-PCR ADL-PCR adapter (see REAGENTS) PCR excision assay for PCR excision assay for PCR excision assay for PCR excision assay for Amplify F1 screening (Step 50B(ii)) Sequencing Kan cassettes (Step 33A(xviii) and 33B(xiv)) Screening F1 fish (Step 50B(ii)) Sequencing Cre (Step 33A(xviii) and 33B(xiv)) Screening F1 fish (Step 50B(ii)) Sequencing Gal4-VP16 (Step 33A(xviii) and 33B(xiv)) Screening F1 fish (Step 50B(ii)) Sequencing GalFF (Step 33A(xviii) and 33B(xiv)) Screening F1 fish (Step 50B(ii)) Sequencing GFP (Step 33A(xviii) and 33B(xiv)) Amplify cassettes for (Step 33A(i)) Amplify and 33B(x)) Amplify Cre cassette for BAC recombineering (Steps 33A(i) (Steps 33A(i) and 33B(x)) urpose iTol2 iTol2 galK FRT-kan-FRT

cassette for BAC recombineering (Step 33B(i))

cassette for BAC recombineering into vectors: cassette for BAC recombineering into vectors:

cassettes for BAC recombineering galK iTol2-galK iTol2-galK iTol2-amp iTol2-amp replacement (Step 33B(x)) cassette (Step 46) cassette (Step 46) cassette (Step 46) cassette (Step 46)

(continued)

© 2011 Nature America, Inc. All rights reserved. TA • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • ‘50-bp homology’ refers totarget 100L-out 100R-out 150L-out Ap2 150R-out 175L-out Ap1 ASS(CTAG) ASS(GATC) P carcinogenic. is It contact. skin and ingestion inhalation, by toxic is It formaldehyde. no. AM1940) cat. (Invitrogen, gel RNA denaturing running for kit NorthernMax RNA Ladder (0.5–10Kb; Invitrogen, cat. no. 15623-200) Mini Quick SpinRNA columns (Roche, cat. no. 11814427001) mMESSAGE mMACHINE SP6kit(Ambion, cat. no. 1340) λ DNA ladder (1Kb; Invitrogen, cat. no. 15615-016) BlueJuice buffer gelloading (10×; Invitrogen, cat. no. 10816-015) It istoxic by inhalation anditcausesdamage to DNA. Ethidium bromide solution, 10mgml Sigma, cat. no. E5134) Ethylenediaminetetraacetic disodiumsaltdihydrate acid (EDTA; corrosive.highly acetic (Sigma,Glacial acid cat. no. 320099) Tris base(Sigma, cat. no. T1503) Agarose (Sigma, cat. no. A5093) MacConkey base(Difco, agar cat. no. 281810) (Difco,Bacto-agar cat. no. 0140-01) (Difco,Bacto-yeast extract cat. no. 0127-05-3) (Difco,Bacto-tryptone cat. no. 0123-01-1) Sterile H Minimal salts, M9 Spectinomycin dihydrochloride pentahydrate (Sigma, cat. no. 85555) to theeyes, system respiratory andskin. Tetracycline hydrochloride (Sigma, cat. no. T3383) Kanamycin sulfate (Invitrogen, cat. no. 11815) Chloramphenicol (Sigma, cat. no. C-0378) ! Ampicillin sodiumsalt, cell culture tested (Sigma, cat. no. A0166) l 2-Deoxy- d Glycerol, min99%(Sigma, cat. no. G6279) d corrosive.highly Potassium hydroxide (Sigma, cat. no. P5958) swallowed. if harmful Ferrous sulfate heptahydrate (Sigma, cat. no. F8048) phosphate,Sodium dibasic(Sigma, cat. no. S7907) chlorideSodium (Sigma, cat. no. S7653) Potassium phosphate, monobasic (Sigma, cat. no. P5655) Potassium chloride (Sigma, cat. nos. P9333andRNase-free P9541)

-Leucine (Sigma, cat. no. L8912) DNA/HindIII (Invitrogen, fragments cat. no. 15612-013) rimer name -( -biotin (Sigma, cat. no. 47868) B CAUT LE

)-galactose (Sigma,)-galactose cat. no. G0750) 4 I ON 2 | d O purified, deionized and0.22

Primers and adapter sequences (continued). -galactose (Sigma,-galactose cat. no. 31050) Inhalation andskincontact may reactions. causeallergic !

CAUT gene X I ON AGTATTGATTTTTAATTGTA AGATTCTAGCCAGATACT GAGTAAAAAGTACTTTTTTTTCT CACTATAGGGCTCGAGCGG AATACTCAAGTACAATTTTA TTTTTGACTGTAAATAAAATTG GGATCCTAATACGACTCACTATAGGG CTAGACCTGCCCCCGCTT GATCACCTGCCCCCGCTT S equence (5 inthe BAC; ‘rev_comp’ refers tothe reverse-complement DNA sequence. Lowercase and italic in‘Sequence’ columnmarks nucleotides not present inthe templateDNA. Loading dye, gel and buffer contain contain buffer and gel dye, Loading

−

1 (Sigma, cat. no. E1510) µ m filtered (Milli-Q, Millipore) ′ –3 ! !

CAUT CAUT ! ′

CAUT ) I I ON ! ON

I ! CAUT ON

It iscarcinogenic. It isflammable and CAUT It istoxic and I ON I ON It is irritating It isirritating It is !

CAUT

I ON

• • • • • • • • • • • • • • • • • • EQUIPMENT • • • • • • • • • • Sequencing ADL-PCR products (Steps 59) (Steps 56 and 59) Second round in ADL-PCR, sequencing ADL-PCR products Second round in ADL-PCR (Step 56) Second round in ADL-PCR (Step 56) First round in ADL-PCR (Step 54) First round in ADL-PCR (Step 54) First round in ADL-PCR (Step 54) ADL-PCR adapter (see REAGENTS and Step 53) ADL-PCR adapter (see REAGENTS and Step 53) P cat. no. 352059) round-bottom cap(14ml;Bacterial BDBiosciences, with tubes microSafeSeal (2ml; tubes Sarstedt, cat. no. 72.695) cat. no. 72.694.406) stocks bacterial (2ml; forSterile tubes Sarstedt, storage of tubes,Sterilized Eppendorf 3810(1.5ml; Eppendorf, cat. no. 700-5239) flatcap(0.5ml; with PCR tube VWR, cat. no. 732-0675) cat. nos. TLS-0801, TCS-0803) for PCR(Bio-Rad, (0.2ml)andflat8-capstrips PCRtube Eight-strip forSterile tubes PCR(0.2ml; VWR, cat. no. 732-0547) Sterile Petri dishesfor microinjection, 60×15mm(Falcon, cat. no. 351007) Sterile Petri dishes, 92×16mm(Sarstedt, cat. no. 82.1472.001) Shaking water bath, 210r.p.m, temperature control with (Grant) D1105) heatblocksConstant at42–95°C(Medinor, set temperature dry cat. no. cat. no. 15110) Constant temperature incubators at32°Cand37(Medinor, set Benchtop (Eppendorf, centrifuge cat. no. 5424000410, 5418) model cat. no. 5805000017, 5804R, model Eppendorf) Benchtop refrigerated centrifuge, 0.5–50 ml(Eppendorf, capacity (OD Spectrophotometer at600nm opticaldensity bacterial for measuring Scientific) Thermo Spectrophotometer for determining DNA concentration (NanoDrop, Bio-Rad) DNA electrophoresis system, submerged horizontal (Sub-Cell Systems, cyclerThermal andaccessories for PCR(MyCycler, Bio-Rad) ing buffer for diluting HiDi enzyme; formamide (Applied Biosystems) DNA sequencing, BigDye terminator v3.1cycle sequencing kit; 5×sequenc XhoI) andT4DNA (Takara ligase andNEB) (AluI,Restriction enzymes DpnI, MboI, BglII, NotI, SalI, SpeI, XbaIand PCR nucleotide mix(dNTPs), 10mMeach (Roche, cat. no. 11581295001) cat. no. M8305) GoTaq Flexi DNA for quick PCRscreening polymerase (Promega, (Roche, cat. no. 11681834001) PCRsystemwith proofreading or asimilarkit Expand high-fidelity ability acetateSodium buffer solution, pH5.2(3M; Sigma, cat. no. S7899) sulfate dodecyl Sodium (Invitrogen, cat. no. 15525-017) systemrespiratory andskin. Proteinase K(Sigma, cat. no. P2308) to theeyes, system respiratory andskin. Wear gloves it. handling when Phenol red sodiumsalt(Sigma, cat. no. 114537) Nuclease-free water (Invitrogen, cat. no. AM9930) urpose 600 ) (DU640, Beckman) natureprotocols !

CAUT I ON

| VOL.6 NO.12VOL.6 It is irritating to theeyes, It isirritating !

CAUT I protocol ON

It is irritating It isirritating | 2011

2005 - © 2011 Nature America, Inc. All rights reserved. 2006 Protect from light. (vol/vol) ethanol. Store at Tetracycline at Ampicillin at Kanamycin ! in 99.7%(vol/vol) ethanol. Store at Chloramphenicol relevant with ethical guidelines on animal experiments. cycledark a 14-h with at light:10-h 28.5 °C. Zebrafish REAGENT • • • • • • • • • • • • • • • • • • •

3130xl or similar) electrophoresis (e.g., instrument Capillary Applied Biosystems v2.0.30 and Amplify 3×) DNA sequences (DNA design andprimer Strider, ApE PlasmidEditor Computer web browser with andother softwaregenomic for analysis of (MZFLIII, Leica) Fluorescent stereomicroscope GFP/RFPfilters with equipped stereomicroscopeDissecting (SMZ645, Nikon) Instrumentation, MPPI-3) Pressure microinjection pipette system holder (Applied with Scientific cat. no. 11254-20) Dumont No. 5forceps, 0.05mm×0.01(FineScience Tools, Dow Corning Sylgard 184elastomer kit(VWR, cat. no. 634I65S) (Sutter puller Micropipette Instruments, capillary cat. no. P-87) cat. no. 5242956.003) (Eppendorf,Microloader capillaries glass for tips loading KIMAX-51 capillaries, 0.8–1.10 × 100 mm (Sigma, for microinjectionGlass capillaries (GC-1, Narishige) cat. no. KIM-34502-99-20EA) boxes, mating Plastic 24.5×1516.5cm(Spawn Box 3, Aqua Schwarz) cat. no. 1652089) GenePulser cuvettes, electroporation (Bio-Rad, 0.1-cmgap machine,Electroporation MicroPulser (Bio-Rad, cat. no. 165-2100) for 1–10mlvolume Pipetman Hand-held (Medinor electric P2000) 732-2236,732-2207) (VWR, andfiltered set Gilson Pipetman tips cat. nos. 732-2225, Erlenmeyer narrow-neckDuran flasks(50ml; Sigma, cat. no. Z232785) Falcon (50ml; tubes VWR, cat. no. 734-0448) Falcon (15ml; tubes VWR, cat. no. 734-0451) protocol CAUT B 17. 16. 15. Decant allsupernatant and resuspend inafinal volume of 1ml of ice-cold sterile10%(wt/vol)glycerol. 14. Spinat4,500 13. Transfer SW102cells(10ml)toaprechilled 15-mlFalcontube. 12. Remove the supernatant from eachtubeand resuspend in5mlof ice-cold sterile10%(wt/vol)glycerol. 11. Spinat4,500 10. Remove the supernatant from eachtubeand resuspend in200mlof ice-cold sterilewater.

− −

9. Spinat4,500 8. Remove the supernatant from eachtubeand resuspend in200mlof ice-cold sterilewater. 7. Spinat4,500 6. Transfer to2250-mlprechilled centrifuge tubes. Chillthe cellsfor 20minonanice-water bath. 5. Grow culture at32°Cuntil the OD 4. The next morning, dilute2.5mlof culture into 500mlof LB-tetracycline. 3. Pick asingle colony and grow itovernight in5mlof LB-tetracycline medium. 2. Grow SW102cellsfor 16–18hat32°C. 1. Streak outglycerol stock(from

20 °Cin1-mlaliquots for up to 1year. 20 °Cin1-mlaliquots for up to 1year. ox

| (25 for electrocompetent cells. Dispense into 2050- Measure the OD I VOL.6 NO.12VOL.6 ON 1

Wear gloves and a dust mask when handling powder and solution.

Adult fish are maintained at a density of 10–30 fish per 12-liter tank µ SETUP

Ampicillin isprepared by 50mgml dissolving

l perelectroporation). Kanamycin isprepared by 25mgml dissolving Tetracycline isprepared by 12.5mgml dissolving | P

Chloramphenicol isprepared by 12.5mgml dissolving reparation of | g g g g 2011 for 20minat4°C. for 15minat4°C. for 15minat4°C. for 15minat4°C. 600

− for a1:100dilution of cells. AnOD

20 °Cin1-mlaliquots for upto 1year. |

µ natureprotocols l aliquots and store immediately at

−

20 °Cin1-mlaliquots for upto 1year.

− !

80 °Cfreezer) onanLBplatecontaining tetracycline (20

SW102 CAUT 600 reaches 0.6(~3–4h). I ON All work must comply

−

− inH

1 electrocompetent cells inH

−

1 in50%

2 O. Store

O. Store 600 of 3.75corresponds to~2.5×10

−

− 80 °C.These cellsshould beenough for ~40experiments

up to 6months. TE up to 2months. methylene sterile H blue in20liters of CaCal E3 ~30 92-mmPetri dishes andstore at4°Cfor upto 2months. galactose, 20%(wt/vol) sterilize,of cool antibiotic. andadd Pour into MacConkey Pour into ~4092-mmPetri dishesand store at4°Cfor upto 2months. 0.2mgml 5 mlof MgSO H distilled DOG 4 °Cfor upto 2months. sterile filtered) andantibiotic. Pour into ~4092-mm dishesand storePetri at (0.2 MgSO H distilled M63 store for bottle upto 1year. at25°Cin aglass FeSO M63 up to 1year. NaCl sterile H in 1liter of M9 prepare electrocompetent in cells asdescribed 2-ml sterile tube; store at by combining 500 LB-tetracycline at32°C, shakingat210r.p.m. with Prepare aglycerol stock colonies.to single obtain colony Pick asingle andgrow overnight in5mlof SW102 12.5 12.5 one or several antibiotics: with chloramphenicol, Bacto-agar 1% (wt/vol) LB-agar 6 months. NaCl H distilled in 1liter of LB Store at Spectinomycin

medium medium

buffer medium µ

µ µ minimal medium 4

m sterile filtered), 10mgml 4.5ml of ·7H minimal 2 g ml g ml 4 4 , 1MMgSO 6.6mlof . ·7H

7H electrocompetent

− plates 2

20 °Cin1-mlaliquots for upto 1year. 2 2 O in 1 liter of sterile H O in1liter of

− − 2 2 Combine 10mMTris, pH8.0, and1mMEDTA. Store at25°Cfor O, sterilize, 5×M63medium, 1M and then 200mlof add 1mlof O, 5×M63medium, 1M sterilize andthen 200mlof add 1mlof O, glycerol, 20%(wt/vol) 10 mlof DOG, 20%(wt/vol) 10mlof O, galactose, 0.2mgml 20%(wt/vol) 5mlof 10 mlof

1 1

. Store at4°Cfor upto 2months. ; kanamycin, 25

agar Mix 20 ml of 5MNaCl,Mix 20mlof 1MKCl, 3.4mlof 1M 6.6 mlof Mix 10 g of Bacto-tryptone, 5 g Bacto-yeast and 5 g of 5gBacto-yeast and5gof Bacto-tryptone, Mix 10gof

Mix 6 g of NaMix 6gof

(5×) medium

medium Sterile Petri dishes(92mm×16mm)containing Spectinomycin isprepared by 50mgml dissolving

plates − µ

1 biotin, 10mgml 4.5mlof l of thisculture and500 l of Mix 10 g of (NH Mix 10gof

plates

●

plates Dissolve 5 g of agar in 500 ml of distilled H distilled in 500 mlof agar Dissolve 5gof

− 2

10 cells O. Autoclave andstore for bottle at25°Cinaglass

2 80 °Cfor upto 1year. from thisstock, Starting 2 cellsperml,which isanoptimal density HPO 4 O. Autoclave andstore at25°Cfor upto T µ µ and 2 ml of 0.05%(wt/vol; optional) and2mlof

g ml g ml IMI

Dissolve 15 g Bacto-agar in 800 ml of Dissolve in800mlof 15gBacto-agar Dissolve 15 g Bacto-agar in 800 ml of Dissolve in800mlof 15gBacto-agar Streak onto bacteria anLB-tetracycline plate 2 4 O; KOH. adjust pHto 7with Autoclave and , KH 3gof

−

− 1

; ampicillin, 50 1 4 N ) ) toobtainsingle colonies. 2 2 O. Adjust pHto 7. Store at25°Cfor SO G 1 4 , KH 68gof

−

µ 1 2 leucine (heated and0.2- PO l of 30% (wt/vol) glycerol 30%(wt/vol) l of ina Box

− d

1 leucine andantibiotic. 4 , NH 1gof

1 µ . g ml 2 PO

−

4 1 and 2.5 mg of and2.5mgof ; andtetracycline, 4 Cl and 0.5 g of Cl and0.5gof

−

biotin

1 2 inH

O, 5 ml

2 O.

© 2011 Nature America, Inc. All rights reserved. start, whereas the second primer should contain sequence annealing annealing sequence contain should primer second the whereas translation start, expected the of upstream and surrounding bp to 50 least at annealing sequence contain should primer cassette one BAC, the in frame reading open an To replace site. target BAC bp the from 50–100 away approximately are that sequences choosing by PCR, by events in the and amplify to oligos PCR stranded Gene-specific EDTAof H in1liter of TAE proteinase K. Freshly prepare use. on theday of 10 mMEDTA; 200mMNaCl; SDS; 0.5%(wt/vol) and200 Genomic proteinase K. Freshly prepare use. on theday of Embryo water. Store at Phenol Freshly prepare use. on theday of Tricaine plate toobtain single colonies. 6| P many repeats might leadtotoxicity thatcouldcompromise recombineering ortransgenesis steps. preparation and microinjection steps. Inaddition, keep inmind thatthe presence of unusually high GC-rich sequences or  region hasnot beenwell annotated.  100 kband there are several BAC orFOSclones that coverthe region of interest, order twoclones thatoverlap. name zC175D15inEnsembl belongs tothe CHORI-211 library (prefix zC),clone number 175D15.Ifyour gene islarger than number corresponding tothe Ensembl prefix obtained inStep3above(seealso 5| programs such asDNAStrider tocarryoutsequence alignments. or ‘trace’ sequences thatmay not havebeenannotated yetinEnsembl. We recommend using computerizedDNAanalysis all exons, introns and the first methionine. Insome cases, youcanusethe NCBIGenome Project browser to identify clones 4| of thatgene. such aclone willcontain most, ifnot all,of the It ispreferable touseaBAC clone inwhich the gene of interest islocatedinthe middle of the BAC, asitismore likely that flanked bythe bluesquares) whose ends coverthe gene of interest toobtainthe Ensembl prefix (e.g., zC175D15.za). 3| alignments’ under the Main panel. Enable ‘BAC ends’ and ‘FOSends’ toseegenomic clones inyourregion of interest. ‘Configure thispage’ from the leftpanel. Thiswillopena new window inside the page. Inthiswindow, click ‘Other DNA 2| websites in your web browser and type the gene name or perform1| a search using BLAST options. Identification of B PROCE online Free sequence. BAC the to homology 50-bp a of minimum of temperature melting a have should primers primer. general, In first the from downstream bp 500 least at exon/intron an to reparation of B

Table

CR CR

(10×) Streak asmall amount of bacteria from the BAC agarstabshippedbythe supplier toafresh LB-chloramphenicol agar Order the BAC, PAC orfosmid (FOS)clones. To order the clones, youmust find the original library clone name and Align the entire coding sequence of the gene withthe contig, scaffold orBAC clone sequence toidentify unambiguously Locate ‘BAC ends’ that appear as blue squares within the expanded genomic region. Click on those BACs (unfilled rectangles In Ensembl, openthe ‘Gene’ page of yourgene of interest and click on‘Location’ toopen‘chromosome view’. Select Open the Ensembl Zv9 (http://www.ensembl.org/Danio_rerio/Info/Index) or ZFIN (http://zfin.org/cgi-perl/gbrowse/current/) I I

red T T D

kan

lysis solution 4 I I

DNA URE . Also design 25–30-mer oligos to confirm the recombination recombination the confirm to oligos 25–30-mer design .Also CAL CAL

solution Mix 48.4 g of TrisMix 48.4gof acetic and3.72g acid base, glacial 11.42mlof recombineering cassettes ( cassettes recombineering

buffer

−

primers

extraction STEP STEP

20 °Cin1-mlaliquots for upto 1year.

Dissolve 20 mg of TricaineDissolve 20mgof E3medium. in100mlof

Mix 10mMTris, 10mMEDTA and200 AC Dissolve 2.5% of (wt/vol) phenol (wt/vol) redDissolve innuclease-free 2.5%of Ifpossible, avoid excessively large BACs ( Pay careful attention tothe correct identification of the gene and BAC clones, particularly ifyour genomic 2 O. Store at25°Cfor upto 6months.

AC -containing -containing competent cells For recombineering, design 82–90-mer single- 82–90-mer design recombineering, For

buffer clones

galK Combine 10mMTris-HCl, pH8.2; ● , GFP

Fig. T IMI ,

Gal4FF 2 b N ) using the sequences listed listed sequences the using ) G 1d , Gal4VP16 µ g ml

> cis µ

55 °C and a and °C 55 ● g ml

or or − -regulatory elements required for the fulland correct expression pattern

− IMI Cre

4 d >

200 kb),asthese are more prone tobreakage during BAC DNA ADL-PCR primers. the designing for used be can (http://engels.genetics.wisc.edu/amplify/) 3× Amplify as such software A source of compressedA source atleast20psiisrequired. of airwith according externalfoot pedal trigger to themanufacturer’s instructions. Microinjection a ~2–3- time Micropipette (e.g., puller Sutter P-87, heat Microinjection (wt/vol) agarose a ramp with plate glass as previously described toplaced at equal distance each and other.parallel Alternatively, prepare a 1% to cover four (Kimax-51,glass capillaries ~3.5 cm long, outer diameter 1 mm) just instructions) manufacturer’s the to according (prepared Sylgard enough Embryo EQUIPMENT Store at andresuspendethanol 50 inafinal volume of (vol/vol) ethanol, spindown for 10minat16,000 for 1minandat60°Cfor 10min, cool down to 25°C, precipitate 99.7% with 37 °C for 1 h and at 75 °C for 5 min, add 50 10×buffer,of 10 100 µ

= M ASS(GATC) or ASS(CTAG), 2

50)to along obtain andfineneedle;with breakforceps to create µ

− microinjection m tip. Prepare immediately before microinjection.

20 °Cfor upto 6months.

adapters

SETUP

setup capillaries µ l of 10mM ATPl of and28

T Mix the following in 1.5-ml Eppendorf tubes: 50 Mix in1.5-mlEppendorf thefollowing able

Set upthe Set ASI MPPI-3 pressure system injection with

dish natureprotocols

2 Pull glass capillaries (Narishige a capillaries Pull GC-1)with glass ). Forexample, aclone withthe

Fill the lid of a Petri dish (60 × 15 mm) with with mm) 15 × (60 dish Petri a of lid the Fill µ l of T4polynucleotide kinase,l of 10 µ µ

= l of 100 l of sterile H l of

645, pull µ

l of 10mMTris-Cl,l of pH8.5. | VOL.6 NO.12VOL.6 g , 70%(vol/vol) washwith µ M ALS, incubate at 94 °C

= 2

163, vel O. Incubate at protocol | 5 2011 3 .

145and µ |

l of l of

2007

µ l

© 2011 Nature America, Inc. All rights reserved. Incubate at32 °Cfor 1hwithshaking at 210r.p.m. 14| ? during electroporation.  ! under the Ec1setting inthe BioRad MicroPulser electroporator. ration holder and apply1.8kV, 25 13| cells, mixgently bytapping and incubate for 5–10minonice. 12| 11| and rechecking several more colonies before proceeding.  neb.com/NEBcutter2/. observed patternwiththe one expected from the availablegenomic DNAsequence using the free webtoolathttp://tools. gel for ~1hat90V. Photograph the gel under UVlight (400nm–315nm)and observethe digestion pattern.Compare the 10| 2008 9| 500 is resuspended in50 8| tubes containing 5mlof LB-chloramphenicol. Grow overnight at32°Cwithshaking at210r.p.m. 7| Sterile Sterile water SalI (20 U Takara (10×) H or M buffer BAC plasmid DNA C protocol

B 9. 8. 7. Transfer the supernatant to2-mlSafeSealmicrocentrifuge tube. 6. 5. Add 250 4. Add 250 3. Remove the supernatant and dissolvethe pelletin250 2. Collectthe bacteria bycentrifugation at2,500 1. CAUT TROU

omponent

CR CR ox Immediately add 1mlof LBtothe cuvette, pipette cellsupand down and transfer toa14-mlround-bottom tube. Transfer the cellstoaprechilled 0.1-cmgapcuvetteand keep itonice. Quickly transfer the cuvettetothe electropo Transfer 25 ThawSW102electrocompetent cellsstored as25- Add 4 restriction enzyme analysis, sequencing and transformation of SW102bacterial cells. centrifuge for 10minat16,000 at 200r.p.m. Dissolve the pelletin50 Add 750 Grow bacteria harboring the BAC ina15-mlFalcontubewith5mlof LB-chloramphenicol medium overnight at32°Cwithshaking new tube. new Clear the supernatant by two rounds of centrifugation at 16,000 at centrifugation of rounds two by supernatant the Clear

µ Digest BAC plasmid DNA tocheck itssizeand integrity asfollows: The next day, prepare BAC DNAfrom the bacterial cultures using aquick miniprep protocol ( Pick twoindividual colonies using aplastic filtered tiponaP20pipetteand transfer them into 14-ml round-bottom | I I VOL.6 NO.12VOL.6 l of culture and 500 T T I 2 I I B ON CAL CAL LES µ µ Ensure thatthe outside of the cuvetteisdry before applying acurrent. | l µ µ µ

l of gel loading dye (10×BlueJuice) tothe reaction and runthe sampleina0.8%(wt/vol)agarose gel. Runthe

BAC DNA H − STEP STEP

l of isopropanol tothe elutedsampletoprecipitate the BAC DNA.Mixgently and incubate onice for 10min,and then l of N3buffertothe suspension. Mixgently byinverting and incubate for 5minonice. l of P2buffertothe suspension. Mixgently byinverting and incubate for 5minatroom temperature. 1 OOT ) ) or SpeI (10 U µ | 2011 l of SW102cellstoaprechilled 1.5-mltube. Add 1–5 Ensure thatbacteria are quickly transferred from ice tothe electroporation holder. Cellsmust becold Ifunexpected band sizes are observeduponrestriction digestion, werecommend repeating DNAisolation I N G µ l of sterilewater. Remember toretain 500 | natureprotocols µ µ l of sterile30%(wt/vol)glycerol; store at l of 10mMTris-Cl, pH8.5orsterilewater. Approximately 1–1.5 miniprep protocol µ l

−

1 ) g . Wash the pelletin70%(vol/vol)ethanol and then air-dry. µ F and 200 A mount ( g Ω for 5min. To 40 resistance, withatime constant of 5msec, bypressing the pulsebutton 25 1 4  µ µ l) l of bufferP1(Qiagen miniprep kit);transfer toa1.5-mlEppendorf tube. l aliquots at

●

T IMI Variable 1× Unknown Final g for 5 min. Each time, the supernatant is transferred to a to transferred is supernatant the time, Each min. 5 for µ l of the culture toprepare aglycerol stockbymixing N

− G

80 °C.Placecellsonice (alwayskeep closeto0°C).

− 2 µ

80 °Cindefinitely. l (approximately 200–500 ng) of BAC DNAtothe h

µ g of DNAisobtained. Use the samplefor Box 2 ) and ensure thatDNA

- © 2011 Nature America, Inc. All rights reserved. 17| further information). for CHORI-1073, DanioKey and DanioKey Pilot,useprimers pindigobac_itol2_fw and pindigobac_itol2_rev ( primers at50 16| R agar plates(asthe BAC clone carries the behind. Resuspend bytapping afewtimes (do not vortex). Spread the transformed bacteria evenlyonLB-chloramphenicol 15| 15-ml Falcon tubes, 2 1.5-ml Eppendorf tubes. Place 6 10-ml pipettes and 2 electroporation cuvettes in a refrigerator at 4 °C. 23| ? within 0.55–0.6.Ifnot, restart Step22.  Grow cellsat32°C,210r.p.m., until OD 22| LB-chloramphenicol and shake overnight at32°C,210r.p.m. 21|  concentration of 0.2–1 1368 bpfor instructions. Use 10 1% (wt/vol)agarose TAE gel. Perform gel extraction using the QIAquick gel extraction kitaccording tothe manufacturer’s 20| positive colonies willariseinStep32.  19| 18| 31 2–30 1 C Nuclease-free water Expand high-fidelity enzyme (3.5 U Primer itol2_rev (50 Primer itol2_fw (50 10 mM dNTP mixture (10 mM) Expand high-fidelity buffer (10×) with MgCl piTol2-amp C

ecombineering the ecombineering TROU

ycle number omponent PAUSE CR CR Prepare ice/sterile water slush in a Styrofoam box, and place inside it for each flask: 50 ml of autoclaved Milli-Q water, 2 Transfer 500 Pick twosingle SW102colonies containing the BAC (from Step15)into 14-mlround-bottom tubescontaining 5mlof Combine the following reagents for a100- Dilutethe Transfer cellstoa1.5-mlEppendorf tube. Spinat14,000 Remove the templateplasmid DNAbyadding itto2 Runthe PCRwiththe following conditions optimizedfor Roche PCRenzymes onaBio-Rad machine (MyCycler): Purifythe PCRproduct byadding 10 I I T T I I B CAL CAL LES

PO plasmid DNA (1 ng

iTol2-kan H I STEP STEP NT µ OOT piTol2-amp, piTol2-kan M inH PCR product can be stored at µ Donot harvestcellsunder orovergrown before proceeding tothe next step. It iscrucial thatthe OD It isessential toensure completedigestion of the plasmid DNAtemplatebyDpnI.Otherwise, many false- I l of overnight SW102:BAC culture into 25mlLB-chloramphenicol (prewarmed toRT)ina50-mlflask. N µ µ 94 94 °C, 2 min M) 94 94 °C, 30 s µ G M) Denature and 1,662bpfor l of a 100 ng iTol2 2 O. ForCHORI-211 and CHORI-73 BAC libraries, useprimers ptarbac_itol2_fw and ptarbac_itol2_rev; µ g cassette into the B µ l µ

− l

− . Typically, thisPCRproduct isenough for recombineering 20–30BACs.

1 ) µ l

µ −

1 58 58 °C, 30 s l ) or

− A

1 1-kb ladder to check the size of PCR products, which should be 1416 bp for iTol2-galK nneal 2 600 piTol2-galK CmR µ reaches 0.55–0.6.Thistakes approximately 3–4h. l of 10×BlueJuice, splitthe sampleand load50 gene). Incubate the platesovernight at32°C.

− µ AC

20 °C for several weeks. l PCRina0.2-mlsteriletube: . CollectPCRproduct with sterileH plasmid 72 72 °C, 5 min 72 °C, 2 min plasmids ( A mount ( E xtend To 100 10 µ 2 2 2 1 1 l of DpnItothe PCRproduct and incubating itat37°Cfor 6–8h. ●  g

Fig. 2 T for 30s. Remove most of the supernatant, leaving 100 l) IMI N a G ) to1ng 2 d 0.3 0.3 mM 3.5 3.5 U Final 1 1 1 1 1 ng 1× µ µ M M µ l

−

1 and prepare aliquots of the 2 O into asterile1.5-mltubeatfinal natureprotocols µ l eachinto twowellsina

| VOL.6 NO.12VOL.6 T able protocol iTol2 2 | 2011 and for iTol2-amp cassette µ 600

l |

is 2009

© 2011 Nature America, Inc. All rights reserved. ( mutations inside aBAC. DOG minimal medium. Thisoption isbestfor making atranslational fusion and for creating precise deletions orpoint on minimal medium, followed byasecond round of recombineering withareporter gene and 3d of negative selection on option is ideal for modifying many BACs in parallel. Option B involves recombineering a experiment. Option Aconsists of recombineering akanamycin cassetteand overnight selection on LB-agarmedium. This 33| R ? 28| harsh treatment of cellswillreduce the success of recombineering drastically.  adding 10mlof prechilled autoclavedMilli-Qwaterusing achilled10-mlpipette. 27| completed,transfer the tubestoice/water slush. 26| up/down and transfer 10mlfrom eachtoa15-mlFalcontube. Store the rest at4°C. 25| heat transfer.  24| 2010 M63 minimal plateswithchloramphenicol. Incubate overnight at32°Cfor LB-chloramphenicol-kanamycin and LB-chloramphenicol-spectinomycin agarplates. For on LB-chloramphenicol-kanamycin for 32| a fewtimes. Centrifuge the remaining 900 31| 30|  ready for electroporation. tapping itafewtimes. Transfer this50 that virtually allsupernatant isdrained out,except for ~50 29| transfer the tubestoice/water slush.RepeatSteps27and 28. protocol A

ecombineering a ecombineering reporter gene into the (iii) (vi) Drythe pellet at25°Cfor 5–10min. (iv) TROU

(ii) ) (v) CR CR CR (i) To introduce areporter gene into the BAC, werecommend one of the following twooptions, depending onthe aimof the Plate100 Recovercellswith1mlof LBand grow at32°Cfor 1h.Keep a100- Mix50 Carefully butrapidly drain outthe supernatant byinverting the tubeswithout disturbing the pellet.Thistime, ensure Centrifuge for 5minat4,500 Carefully butrapidly drain outthe supernatant byinverting the tubeswithout disturbing the pellet.Resuspend pelletby Centrifuge the tubesfor 5minat4,500 Placethe cellsinaflask(from Step24)on ice/water slushimmediately. Allowtocool for 5min.Mix gently byinverting Heat-shock the SW102cellswithBAC at42°Cfor exactly 15min,shaking at210r.p.m. (orbyhand every4min). R

| I I I VOL.6 NO.12VOL.6 ecombineering areporter geneby kanamycin selection  30 min at and downstream of the chosen target siteonthe BAC plasmid (seeREAGENT SETUPand geneX_Gal4FF_fw, geneX_Gal4-VP16_fw orgeneX_Cre_fw and geneX_frt-kan-rev) designed tomatch 50bpupstream time should beincreased to2min40s. Use 1ng of the plasmid DNAand gene-specific primers (geneX_GFP_fw, ( Precipitate 95 T T T Remove the plasmid DNAtemplatebydigesting the PCRproduct with2 Amplify the Carefully wash the pelletonce with1ml of 70%(vol/vol)ethanol. Centrifuge the precipitated PCRproduct at19,300 Fig. I I I B

CAL CAL CAL PAUSE LES

2 µ

H STEP STEP STEP b l of cellsand 1–2 OOT and µ

l of the cellsbefore and aftercentrifugation onLB-chloramphenicol-ampicillin agarplatesfor PO

− | 2011 The cellsmust not beheat shocked longer than15minand should beshaken periodically toensure even The cellsshould beusedimmediately, butwithin30minatthe latest. Carefully resuspend bykeeping tubesinside the ice/water slushatthisand allsteps, becausewarming or

I 20 °C. Run the remaining 5 GFP I N S NT G µ upplementary Data l of PCR product by adding 5 -pA- PCRproduct canbestored at | natureprotocols FRT - µ kan µ l, then remove allsupernatant except the ‘bottom’100 g of g - inanEppendorf centrifuge precooled to0°C.Immediately afterthe spiniscompleted, FRT iTol2 , iTol2-kan Gal4FF µ ) according tothe conditions usedinSteps17and 18,except thatthe extension l of competent cellstoanew prechilled 1.5-mltubeand keep itonice until youare cassetteand electroporate asdescribed inSteps12and 13. Tol2 g inanEppendorf centrifuge precooled to0°C.Immediately afterthe spinis µ -pA- l of PCR product on a 1% (wt/vol) TAE-agarose gel to check the success of PCR. . To avoid false positives, make replica platesfrom the same colonies onboth -B FRT AC µ l of 5 M LiCl and 300

plasmid − -

kan 20 °Covernight. g for 15minat4°C. - FRT µ l leftatthe bottom,byinverting the tubeontissuepaperand , Gal4VP16 ●

T IMI N -pA- µ µ G l of 99.7% (vol/vol) ethanol. Mix well and place for l aliquot of these cellsfor plating (Step32). 2d iTol2-amp FRT µ l of DpnI.Incubate itat37 °Cfor 6–8h. - kan - and FRT galK µ iTol2-galK, l and resuspend the pelletbytapping or iTol2-kan cassette, 3 d of positive selection Cre T -pA- able platetransformed cellson and 3days for FRT 4 ). - kan - FRT iTol2-amp cassette iTol2-galK

and

(B) (viii) (viii) (xiii) (xiv) (xiv) (xvi) (vii) (xii) (vii) (xv) (iii) (xi) Prepare competent cellsasdescribed inSteps23–29. (ix) (ix) (vi) Transform the cellswith (iv) (ii) (x) (v) Prepare competent cells asdescribed inSteps23–29. (x) (i) R ecombineering areporter geneby with shaking at210r.p.m. it into a14-mlround-bottom tubecontaining 5mlof LBwithchloramphenicol and ampicillin. Grow overnight at32°C  normally inthe range approximately 2–5 tration withaspectrophotometer. Concentration is 32 °Cfor 3d. 250 mycin agarplates. colonies onLB-chloramphenicol-ampicillin-spectino and 15.To avoid false positives, make replica plate ampicillin-kanamycin agar plates according to Steps 14 the BAC plasmid (see REAGENT SETUP and and geneX_galK_rev) withhomologies designed tomatch 50bpupstream and downstream of the chosen target siteon at 210r.p.m. by electroporation asdescribed inSteps12and 13. ? and grow them in5mlof LB-chloramphenicol-ampicillin orLB-chloramphenicol-kanamycin at32°Covernight. or kanamycin). Grow cellsat32°CtoOD Grow overnight at32°Cwithshaking at210r.p.m. containing 5mlof LB-chloramphenicol-ampicillin. 32) and transfer itinto a14-mlround-bottom tube pipette from SW102 cells harboring Pick colonies and streak onMacConkey agarplateswithchloramphenicol. Pick single bright red (Gal Wash the bacteria twice with1×M9medium. Resuspend the pelletin1mlof 1× M9medium, and plate10,100and Transfer the bacteria toa14-mlbacterial round-bottom tubewith1mlof LB;incubate at32°Cfor 1hwithshaking Add 500 Pick acolony using aplastic filtered tiponaP20pipettefrom SW102cellsharboring Digest the PCRproduct toremove the plasmid DNAtemplateand purifyasdescribed inSteps19and 20. Amplify the Confirm homologous recombination byPCRamplification using gene-specific primers (see REAGENT SETUP) and Analyze DNAbyrestriction enzyme digestion withSalIorSpeI.Runitona0.8%(wt/vol)agarose gel and photograph Recover cellsand plateonLB-chloramphenicol- Transform the cellswith Add 500 Pick acolony using aplastic filtered tiponaP20 Use 1 Resuspend in10 Amplify the reporter gene (e.g., depending onthe cassette( sequence the reporter gene using GFP_seqF, Gal4FF_seqF, Gal4-VP16_seqForCre_seqF and Kan_seqR primers, Pick 10–12 colonies from the LB-chloramphenicol-ampicillin-kanamycin agar plates (which did not grow on on grow not did (which plates agar LB-chloramphenicol-ampicillin-kanamycin the from colonies 10–12 Pick the appropriate modification atthe target site Steps 19and 20. Alternatively, usedouble-stranded oligos containing apoint mutation, deletion orinsertion tocreate used for the and gene-specific primers (e.g., geneX_GFP_fw and geneX_pA_rev in OD LB-chloramphenicol-ampicillin. Grow cellsat32°Cto ? spectinomycin) and prepare plasmid DNAaccording to ? plasmids ( the gel under UVillumination. Compare the digestion patternof the original BAC,

TROU TROU TROU PAUSE 600 µ

l of cellsonto M63minimal medium plateswithchloramphenicol (and ampicillin orkanamycin). Incubate at = µ

0.55–0.6(3–4h)withshaking at210r.p.m. B l of the suspension tomeasure DNAconcen B B µ µ LES LES LES

PO Fig. l of the overnight culture into 25mlof l of the overnight culture into 25mlof LBwithchloramphenicol and the galK H I H H galK NT OOT OOT OOT 5 PCRproduct canbestored at ). cassette( primers inStep33B(i).Digest the PCRproduct with µ

I I I l of nuclease-free water. N N N G G G kan galK Fig. 2 cassetteDNA(5–10 T cassetteDNA(25-50ng) byelectroporation asdescribed inSteps12and 13. able GFP, Gal4FF, Gal4-VP16 b 4 ) byPCRusing 1ng of the p Tol2 ). galK -BAC (from Step selection 600 µ T able g

= µ

0.55–0.6(~4h)withshaking at210r.p.m. l 3

− − 8 4

1 .

. 20 °Cfor several weeks. ). Set up PCR reactions and conditions as described in Steps 17 and 18. µ

g) - ● -

T or

Box IMI (arrows). in band size may be detected from one recombineering step to the next 398L10, CHORI-73-313L2 are shown. In some cases, new bands or changes and digested with SalI and separated on a 1% (wt/vol) agarose gel. BAC, was prepared as described in recombineering the Figure 5 Cre N 2 G . ) byPCRusing the plasmids in

Tol2 6d galK -BAC:Gal4 DNA from BAC clones CHORI-211-266O5, CHORI-1073-

| λ Restriction analysis of BAC plasmid DNA before and after 10 kb plasmid and gene-specific primers (geneX_galK_fw , lambda DNA ladder; M, 1-kb DNA ladder. 1 kb 2 kb 3 kb T Dpn able M I and purifybygel extraction asdescribed in iTol2-amp 4

) containing the same 50-bp homologies BAC 266O5 natureprotocols Tol2 Box and Gal4-VP16 cassettes. BAC DNA miniprep -BAC

Tol2 Tol2 iTol2

1 -BAC:Gal4 . A volume of 20 Tol2 BAC -BAC and final 398L10

cassetteantibiotic (ampicillin Tol2 -BAC (Step32)and transfer -BAC Tol2 Figure 2 -BAC:Gal4

BAC | 313L2 VOL.6 NO.12VOL.6 Tol2 µ

l from each prep was + -BAC

b Tol2 ) colored colonies Tol2

astemplates -BAC:Gal λ protocol

-BAC reporter

4 23 kb | 2011

Tol2 |

2012 holding the embryosinplaceduring microinjection (seeEQUIPMENTSETUPand 39|  ! 250 ng nuclease-free water. Approximately 30 at 4°Cfor 15minatmaximum speed. Carefully remove the supernatant and resuspend the precipitated mRNAin50 38| and then withanequal volume of chloroform. Transfer the aqueousphase toanew tube. of ammonium acetatestopsolution and extract the mRNAonce withanequal volume of phenol-chloroform-isoamyl alcohol spin RNAcolumnaccording tothe manufacturer’s instruction. Adjust the volume of the elutedsolution to135 37| manufacturer’s instruction. 36| concentration of ~1 extraction. Ethanol precipitate, rinse once with70%(vol/vol)ethanol and dissolveinnuclease-free wateratthe 35| Impurities and/or phenol are highly toxic toembryosand willlikely result inmortality uponmicroinjection (Step44).   ! freeze/thawing of the BAC DNAbefore microinjection. immediate useand store the rest at at least1h.Keep asmall aliquot of the BAC DNAat4°Cfor flick the tube gently several times and letit rest at25°C for nuclease-free water at 250 ng rinse once with70%(vol/vol)ethanol and resuspend in acetate (pH5.2)and 3volumes of 99.7%(vol/vol)ethanol, extraction, precipitate withone-tenth volume of 3Msodium Next, purifyDNAbyphenol-chloroform-isoamyl alcohol BAC 100kitaccording tothe manufacturer’s instructions. 34| ● Microinjection of the (xiii) (xiv) protocol

(xii) CAUT CAUT

(xi)

T PAUSE CR CR IMI Ensure thatMPPI-3microinjection systemisworking properly, including the airsupply( Add an equal volume of isopropanol, mix well, chill the mixture at least for 15 min at Add nuclease-free watertothe synthesized mRNA toafinal volume of 100 Use mMESSAGE mMACHINE SP6kittosynthesize Digest pCS2-zT2TP( Prepare recombineered BAC DNAusing the Nucleobond

| I I VOL.6 NO.12VOL.6 kanamycin. Incubate at32°Cfor 3–4d. medium plateswithchloramphenicol and ampicillin or plate 10,100and 250 Resuspend the pelletin1mlof 1×M9medium, and for 4.5hwithshaking at210r.p.m. T T Steps 12and 13. to the electroporation procedure described in oligos into Gal Prepare plasmid DNAfrom 10to12colonies according Wash the bacteria twice with1×M9medium. Transfer the cellsto10mlof LBand incubate at32°C Introduce 1–2 ? 33A(xvi) and 33A(xvii). to I I N I I µ

ON ON CAL CAL TROU G l Box

PO − 3 d

1 Phenol istoxic byinhalation, ingestion orcontact withskin.Wear suitableglovesand workinafume hood. Isopropanol isveryflammable and irritating toeyes;inhalation may cause dizziness and nausea. for microinjection. Store itin5-

I STEP STEP NT 2 B and analyze BAC DNAasdescribed inSteps LES Transposase mRNA can be stored at | 2011 Avoid transferring any of the bottomphenol layerand any material atthe interface during DNAextraction. Never vortex orpipetteBAC DNAupand down, as thiswillleadtoshearing. H µ OOT

+ µ

g cellsfrom Step33B(ix)according g of PCRproduct ordouble-stranded | Tol2

µ natureprotocols Fig. 3 I l N

−

1 G -B . µ µ AC

a l of cellsonto DOGminimal l

) withNotI and purifybyphenol-chloroform-isoamyl extraction followed bychloroform − D

1 . To resuspend the BAC DNA, NA

− and

20 °C.Avoid repeated µ g of mRNAwillbesynthesized. Take analiquot and adjustthe concentration to TP µ

RNA l aliquots at

− Tol2

80 °C for several months.

TPmRNAfrom 1

−

80 °C.

The arrow points to the foot pedal trigger. ( embryo dish, forceps and MPPI-3 pressure injection system is shown. zebrafish. ( Figure 6 tank system for raising adult fish ( 2.4 cm. ( A green nylon ball is placed inside the box as a spawning stimulus. Scale bar, ( phenol red solution (asterisk) in the MPPI-3 holder. Scale bar, 2.5 cm. E3 medium. Scale bar, 5 mm. ( arrows in which embryos are lined up (white dashed line) and covered with injection and the needle holder. Trenches (1 mm wide) are indicated by d b a ) Mating box with males (top) and females (bottom) before mating.

e | Microinjection setup and breeding and raising of transgenic , Stereomicroscope f a ) A 2-liter tank system for raising young larvae ( ) Nikon SMZ645 stereomicroscope with backlight illumination, µ g of the linearized template according tothe µ Fig. 6 Forceps l and purifythe samplewithaminiquick- Injection system b ). c ) Injection needle filled with BAC/RNA

− f

). Fig. 20 °C and centrifuge the mixture c * 6 e d ), and prepare adishfor b ) The Sylgard dish for embryo µ e l. Add 15 ) and a 12-liter µ l of

µ l © 2011 Nature America, Inc. All rights reserved. from Step 45. Step from in provided also are cassettes the list 46|  amplification inthe following steps.  95 °Cfor 10min. as much E3medium aspossible. Add 50 45| C ? 2053proj/biol2053estimating%20size.htm. describing the useof the graticule canbefound athttp://www.cavehill.uwi.edu/FPAS/bcs/courses/Biology/BIOL2053/ eyepiece graticule and micrometer slide canbeusedtomeasure the relative volume of the injected solution. Ausefulsite The phenol red included inthe solution helps monitor the location and amount of solution injected. Ifnecessary, an  steps. following the in thedesiredPetri until age for use in dishes °C 28.5 at medium E3 in embryos theinjected Incubate oftheclutch. the health check controlsto as embryos uninjected some BAC Save foreach construct. embryos 100–200 andinject 43 Step volume. Repeat one-tenth the cytoplasmic of least at fill to solution enough inject inside is theOnceneedle thecytoplasm, ( of theneedle thetip with ( 44| the one-cell stage, namely within20–30minafterfertilization. partment and waituntil they layeggs. Collecteggs into Petri dishes withE3medium. Microinjection should becarried outat 43| pulse duration to50ms. ( 3 42| plasmid.  flicking the tubeseveral times and always keep on ice: 41| several rounds of injection inagivenmorning. afternoon afterfeeding ( 40| Fig. 6 Fig. Phenol red solution (2.5%, wt/vol) KCl (0.4 M) Tol2 Tol2 C onfirmation onfirmation of

µ TROU

omponent PAUSE CR CR CR l of the DNA/RNAmixture into the glasscapillaryneedle using aP20pipetteand Microloader tips. Attach the capillary Transfer eight injectedembryosfrom Step44at10hpostfertilization (hpf) towellsinaneight-strip PCRtube. Remove Mate fishinone 3-liter mating box (from Step40) atatime byplacing male and female fishtogether in the uppercom Prepare fine needles for microinjection ( The next morning, prepare the BAC DNA/RNAinjection mixture ina0.5-mlRNAse-free tubeasfollows, mixbygently Placeone ortwomale and one ortwofemale zebrafish inseparate compartments of a3-liter mating box inthe late Line up ~60 newly fertilized zebrafish eggs (obtained from paired matings in Step 43) inside an embryo injection dish dish injection inside embryo 43) an Step in paired from matings (obtained eggs zebrafish fertilized newly ~60 up Line Combine the reagents tabulated below to make an 8× master mix for the PCR ‘excision assay’. Below we we Below assay’. ‘excision PCR the for mix master 8× an make to below tabulated reagents the Combine transposase RNA (250 ng -BAC plasmid DNA (250 ng

I I I 6 T T T c b I I I B

) tothe needle holder of the MPPI-3pressure injection system( ) containing E3 medium. Once each embryo is in place, rapidly penetrate the chorion of the one-cell-stage embryo embryo place, rapidlythechorionin penetrate of theone-cell-stage is embryo each Once medium. E3 containing ) CAL CAL CAL primers for the the for primers LES

H I STEP STEP STEP NT OOT Embryo extracts can be stored at Tol2 It iscrucial toinactivate the proteinase Kat95°Cfor 10min.Failure todo sowillresult inno PCR It iscrucial toinjectthe DNA/RNAmixdirectly into the cell(not into the yolk)atthe one-cell stage. Donot vortex orpipetteBAC DNAmixture upand down, asthiswillleadtobreakage of the I N G -mediated -mediated B Fig. 6 iTol2 Fig. 6 Fig. µ µ l

l - −

− d 1 amp

) 1 ). Prepare enough mating boxes tosetupfour tosixpairmatings toobtainenough eggsfor ) T able c AC , asterisk), and then move slowly into the boundary between the yolk and cytoplasm. andcytoplasm. theyolk theintoboundarybetween slowly andmovethen asterisk), , cassette, but details of excision primers for the the for primers excision of details but cassette, excision in injected embryos

4 µ . Dispense 20 20 Dispense . A l of embryolysisbuffer. Incubate at50°Covernight. Inactivate the enzyme at mount ( Fig. 6 10 2 4 4

 − c

l) ) bypulling aglasscapillary, and break the tipwithfine forceps. Load 20 °C for several weeks. µ l of this mix per tube and add 1 1 add and tube per mix this of l 0.25% 0.2 0.2 M Final 1 1 1 µ µ g g ●

T Fig. 6 IMI N G a 2 d ). Setthe pressure to20psiand adjustthe natureprotocols iTol2 µ - kan l of the embryo extract extract embryo the of l and and

| iTol2-galK VOL.6 NO.12VOL.6 protocol Tol2

| 2011 -BAC

2013

47| 2014 ( either byvisualization of the fluorescence signal (option A)orbyPCRscreening (option B). 50| S ? sexually mature (3–4months) in12-litertanks( until 12dpf, and then transfer them to2-litertanksuntil they are 2months old( up to 30 injected larvae at 5 days post fertilization (dpf) from Step 44 into a 200-ml Pyrex glass beaker. Grow larvae in beakers the rest. Stronger fluorescence canbecorrelated withhigher integration rates (M.L.S.,unpublished observations). Transfer show fluorescence. Separate embryos/larvaewithverybright and/or evenfluorescence signals and grow them separately from fluorescence under adissection microscope equippedwithUVlight and appropriate filters. Record the tissues and cells that 49| S ? DNA and TPRNAand repeat injection (orrestart from Step34).  injected with (336 bp)should bedetected from embryosinjectedwithboththe 48| 36 2–35 1 C Nuclease-free water GoTaq Flexi DNA polymerase (5 U Primer iT2amp-exc168R (50 Primer iT2amp-exc168F (50 dNTP mixture (10 mM) MgCl Buffer (5×) with green loading dye C protocol A creening of election and rearing of

(iii) (iv) TROU TROU

ycle number omponent (ii) ) Fluorescence screening CR (i) Identify F Ifinjectedembryos(F Check 10 Runthe PCRwiththe following conditions:

| 2 I VOL.6 NO.12VOL.6 (25 mM) ? ? (e.g., UASGFP fish carries the GFPreporter, mate the injected fishwithwild-typefish.If the BAC carries Gal4, mate the injectedfishwith Collect eggs the next morning in E3 medium and examine them every day from 10 hpf to 5 dpf for fluorescence ( T tends togenerate single-copy BAC integrations, veryfewembryosare expected toshow fluorescence inaclutch. there isastrong correlation betweentransmission frequency inthe F1progeny and transgene copynumber. As  Set aside founder fishwhose progeny show stable expression of the reporter gene inthe correct pattern Raise the fluorescence-positive F1progeny toadulthood and maintain stable lines byoutcrossing. Place single male orfemale injectedfishin mating boxes inthe lateafternoon, atleast1hafterfeeding. Ifthe BAC I B B

TROU TROU CAL

LES LES CR I

Fig. 7a H H T STEP I Tol2 B B Tol2 µ OOT OOT 0 CAL fishwithintegrations inthe germline, by mating single fishas described below and screening their progeny LES LES l of the PCRsamplesbyagarose gel electrophoresis (2%(wt/vol)agarose inTAE). The excision product | 94 94 °C, 2 min 2011 Ifno excision product isdetected, the injectedembryosshould bediscarded. Check the quality of BAC -BAC plasmid only( 94 94 °C, 30 s 1 -B I I

Denature 0 H H N N STEP . , d OOT OOT AC G G , e | –injected –injected fish

; see natureprotocols Aminimum of 50(and ideally 100)embryosshould beobservedfrom eachmating. Onaverage, I I N N Tol2 µ µ 0 G G ) are expected toexpress fluorescent proteins such asGFP, screen the injectedembryos/larvae for M) M) S upplementary Fig.1 -B µ l AC

− 55 55 °C, 30 s

1 ) A –injected –injected fish nneal Fig. 4 ●

T IMI A b mount ( ). To 160 N 1.6 3.2 3.2 3.2 G 16 32 72 72 °C, 5 min 72 °C, 1 min Fig. 6 3 d E ● xtend for comparisonof reporter gene and endogenous expression). 

l) T e IMI ). N G 3–4 months 0.2 0.2 mM 2.5 mM Final 1 1 1 8 8 U 1× µ µ Tol2 M M -BAC plasmid and the TP mRNAbutnot from embryos Fig. 6 d ). Finally, raise them until they are

33,3 7

Fig. Tol2

7 ).

© 2011 Nature America, Inc. All rights reserved. in the hindbrain (hb) and spinal cord (sc). carriers. GFP expression is localized to neurons of 5% (2 of 40) founder fish were germline 43 ( mating two founder fish (nos. 18 ( Fugu evx1:Gal4FF muscle cells. ( Transient ‘ectopic’ expression is observed in commissural neurons by 4 dpf (arrowheads). 10 hpf, but becomes very restricted to (dpf) ( fertilization (hpf) ( homozygous Gal4FF ( cluster. Gray box is the plasmid backbone. exon 2: Tol2BAC BAC transgenic fish. ( Figure 7 illustrated in describe how toretrieve the genomic junctions byADL-PCRand determine the BAC integration site. The fullprocedure is zebrafish germline, itis relatively easyto retrieve the transposon insertions asdescribed previously type control and anadult UASGFP control fish.Southern blot hybridization canbeusedto determine the actual number of 51| A (B) Tol2BAC GFP expression that recapitulate endogenous Arrowheads point to the otic vesicle. ( mosaic GFP expression at 10 hpf ( fusion of GFP and exon 1 of Tol2BAC ( consistent with endogenous The arrowhead shows GFP expression in cloaca b f , nalysis of B 7. Measure DNAconcentrations byusing aspectrophotometer. 6. Rinse once with70% (vol/vol)ethanol and resuspend in50 5. Precipitate DNAwith20 4. PurifyDNAbyphenol-chloroform extraction. 3. Incubate at50°Covernight, and dissolvethe tailfincompletely. 2. 1. Anesthetize adult fishwithtricaine. (iii) , (iv) g

c (ii) ) (i) ) Transient mosaic expression e ox Extract genomic DNAfrom transgenic adult zebrafish tailfins according to fish immediately tosystemwater. Cut one-third of the tailfinwithablade and submerge in 200 )) and homozygous Tol2BAC PCR after co-injection with TP RNA into c Gal4FF - - - ). GFP expression is observed widely at ? gene (e.g., GFP_seqF, Gal4FF_seqF, Gal4-VP16_seqForCre_seqF and pA_seqRin and grow their progeny until adulthood. Set aside injectedfishwhose embryoclutches were PCRpositive. Mate these fishes againas describedinStep50B(i) Run a1–2%(wt/vol)agarose gel and visualize PCRproducts under UVlight. Collect 20–50embryosin200 Place asingle male orfemale injectedfishin mating boxes inthe lateafternoon, atleast1hafterfeeding. fgf24:GFP-1 fgf24:GFP-2 Fugu evx1:Gal4FF

3 |

Generation and identification of screening TROU UAS:GFP - | fusion downstream of the fgf24:GFP-1 d P , T e ol2-B ; Figure B ) Double-transgenic UAS:GFP reparation of genomic b LES and (~140 kb) ( ) and 4 days post fertilization fertilized eggs at 10 h post a ) Schematic of the ~70-kb H AC Tol2BAC UAS:GFP (~165 kb) ( plasmid containing the OOT 8 larvae obtained by integrations (optional) fgf24 along withtypical results. evx1 I g N - h expression. . ( . A total ) contain a fgf24:GFP-2 µ Fugu evx1: G ) and 30 hpf ( d l of 3Msodiumacetate, pH5.2,and 1mlof 100%ethanol. h ) and , f i Tol2BAC j ) and ) Transient ) Representative embryo from stable transgenic hoxA

Tol2 were germline carriers. Scale bars,

- fgf24

- i l of embryolysisbufferand follow Steps46–47withprimers specific for each reporter ).

expression (see 33,5 Stable Stable Transient d b e a 3 ● DNA . However, as

T IMI Tol2BAC-Fugu evx1 hb S upplementary Fig. 1 Tol2 N from zebrafish tail fin G Tol2BAC-Fugu evx1:Gal4FF;UAS:GFP 3d -genomic junctions byinversePCRorADL-PCR.Steps52–60 µ l of TE. 10 hp hoxA µ l of DNAextraction bufferina1.5-mlEppendorf tube. Returnthe Tol2 b f , ~1980 : Gal4FF Transient c typically generates one ortwoBAC integrations inthe sc Tol2BAC ( µ ). A total of 20% (5 of 25) and 22% (2 of 9) of fish injected with ∼ m; 70 kb) c - Gal4FF , fgf24:GFP-2 e , ~250 No. 43 No. 18 Box 4 dpf * µ

m; 3 at 24 hpf. Arrowheads point to the main sites of ; include extracts from anadult wild- natureprotocols h T Transient Stable , ~1875 h able g f j

● 4

µ ). T Tol2BAC-fgf24:GFP-2 Tol2BAC-fgf24:GFP-1 m; IMI i , ~278 10 hpf N

| G VOL.6 NO.12VOL.6 µ 1 m; and Transient i Tol2BAC-fgf24:GFP-2 d GFP ( ( ∼ ∼ protocol

140 kb) 165 kb) j , ~400 | 2011 µ m. 30 hpf

24 hpf |

2015

© 2011 Nature America, Inc. All rights reserved. 37 °Cfor 1h: 52| cyclic nucleotide gated channel beta 3. neurotransmitter transporter (solute carrier family 6 member 17); is indicated. chr, chromosome; in two independent lines ( Ap2. The final products can be sequenced directly with amplified in two steps (first and second PCR) with nested primers Ap1 and ligation of GATC or CTAG oligo ‘adapters’, the (e.g., MboI) to create ( fin from adult Figure 8 2016 54|  The next day, inactivate the ligase at70°Cfor 15min. reaction astabulatedbelowand incubate itat16°Covernight. 53| c b Nuclease-free water Expand high-hidelity enzyme (3.5 U Primer 175L-out or 150R-out (50 Primer Ap1 (50 dNTP (10 mM) mixture Expand high-fidelity buffer (10×) with MgCl Tenfold-diluted DNA from Step 53 C Nuclease-free water T4 DNA ligase (350 U Takara (10×) ligase buffer GATC adapter (see REAGENT SETUP) MboI-digested DNA from Step 52 C Nuclease-free water MboI (5 U NE (10×) buffer 4 Genomic DNA from Step 51 C protocol , ) Genomic DNA is digested with GATC or CTAG restriction enzymes

omponent omponent omponent d PAUSE ) Schematic of the genomic integration sites of Inactivate the enzyme at 70 °C for 15 min, set up a ligation Dilutethe entire ligation reaction tenfold byadding 180 Setupadigest astabulatedbelow, and then incubate at

| VOL.6 NO.12VOL.6

| Analysis of

PO µ Tol2BAC l

I −

1 NT ) µ Inactivated ligation reactions can be stored at M) | - 2011 Tol2 Tol2 Fugu evx1:Gal4FF 3 3 µ . The duplicated sequence of the 8-bp target site genomic left (L) and right (R) fragments. After -BAC integrations. ( l

− |

1 natureprotocols ) ntt4 , orphan sodium- and chloride-dependent A µ fish was cut for DNA extraction. M) mount ( Variable µ A To 20 l Tol2

− mount ( a

1 1 2 ) ) A section of the tail To 20 genomic junctions are 2 2 2 1  2 Tol2BAC l)  Tol2 l) - -specific primers. Fugu evx1:Gal4FF A mount ( Unknown Unknown Final To 50 10 10 U 1 1 350 350 U cng3 Final 1.5 1× 1× µ 1 1 1 5 2

, 

l of H

−

20 °C overnight. Unknown 0.3 0.3 mM 3.5 3.5 U Final 1 1 1 2 O. Setupthe firstPCRastabulatedbelow: 1× µ µ M M b a d c cng3 ntt4 Adaptor chr8 Genome 3 5 ′ ′ Tol2 DNA extraction 3 ′ 5 Tol2BAC chr18 ′ -BAC43 L L Sequencing - Fugu Digestion Tol2 Ligation -BAC

evx1 : Gal4FF Second PC First PC R R Tol2 Adapto Genome -BAC18 R R r 3 3 3 ′ Ap2 gylt1b ′ ′ 5 ′ Ap1 5 5 ′ ′ © 2011 Nature America, Inc. All rights reserved. tabulated below: 56| 55| http://recombineering.ncifcrf.gov/faq.asp. Troubleshooting advice canbefound in ? ? the 60| 3130xl, Applied Biosystems). 70% (vol/vol)ethanol, dry and suspend in20 of 99.6%(vol/vol)ethanol. Incubate the sampleat25°Cfor 5min,centrifuge at19,300 cording to the manufacturer’s instructions. Mix the sample with a one-tenth volume of 3 M sodium acetate and three volumes 59| ? according tothe manufacturer’s instructions. Final volume willbe~40 in the BAC transgenic fishbut not inwild-typecontrol or UASGFP fish from the gelwith the QIAquick gel extraction kit 58| 57| TA C 31 Nuclease-free water Expand high-fidelity enzyme (3.5 U Primer 150L-out or 100R-out (50 Primer Ap2 (50 dNTP (10 mM) mixture Expand high-fidelity buffer (10×) with MgCl Tenfold-diluted DNA from Step 55 2–30 1 C 13 S

TROU TROU TROU omponent ycle number tep B LE BLASTthe retrieved DNA sequences against the zebrafish genome using Ensembl and NCBItofind the precise location of Use 4 Analyze 10 Runthe PCRreaction withthe same conditions described inStep55. Dilutetenfold bymixing 1 Runthe PCRasfollows: Tol2 5 B B B -BAC integration inthe genome ( | LES LES LES

Troubleshooting table. µ l of the DNAsamplefor sequencing with100L-out,100R-outand the BigDye terminator cyclesequencing kitac H H H electroporation Cells ‘zapped’ during P roblem OOT OOT OOT µ µ M) l of the sampleona1.5%(wt/vol)agarose/TAE gel electrophoresis. Purifythe DNAbands thatare observed I I I N N N 94 94 °C, 30 s 94 °C, 30 s Denature G G G µ µ M) l of the PCRreaction from Step55and 9 µ 57 57 °C, 30 s l

−

1 A ) Sample Sample is too conductive P nneal ossible reasons(s) T 2 able Fig. 8c 5 µ A . Specifictroubleshooting tips for recombineering are availableat l of HiDiformamide. Analyze the samplebysequencing (e.g., ABIPRISM , mount ( d 72 72 °C, 5 min 72 °C, 1 min ). To 50 E 1.5 xtend 1 1 5 2 1  l) Unknown 0.3 0.3 mM 3.5 3.5 U Final 1 1 1 1× µ µ remaining cells Wash cells again to remove salts; discard sample and wash S µ olution(s) M M l. µ l of H 2 O. Setupthe second PCRreaction as natureprotocols g for 20minat4°C,rinse with

| VOL.6 NO.12VOL.6 protocol

| 2011 (continued)

2017 -

| VOL.6 NO.12VOL.6 5 |

Troubleshooting table (continued). Larvae Larvae are dead 3–14 dpf High embryo mortality on agarose gel Multiple bands or smear agarose gel No excision product on out of needle Solution does not come the DOG minimal plates Too many colonies on No colonies on the plate the M63 minimal plates Too many colonies on minimal plate No colonies on the M63 pattern looks strange The BAC DNA restriction the plate Too many colonies on No colonies on the plate tinomycin replica plates Colonies grow on spec kanamycin or M63 plates No colonies on ampicillin, Poor culture growth P roblem | 2011 | natureprotocols - Transgene/reporter is toxic Too much DNA/RNA is injected DNA/RNA mixture is impure Annealing temperature too low Primers are degraded Too much genomic DNA not work TP RNA is degraded; PCR did Insufficient pressure Tip is too small or is clogged deleted/mutated DOG selection failed; Step 33A(xvi) See possible reasons for p Step 33A(xv) See possible reasons for genomic DNA; BAC DNA is Contamination with bacterial contamination FRT-kan-FRT not suitable The target site in the BAC is Drug selection issues electroporation failed Too little PCR product; plasmid Contamination with Electroporation failed Too little PCR product Bacteria are too old P ossible reasons(s) GalK plasmid contamination plasmid pCR8GW-iTol2 galK

damaged is

Ensure complete DpnI digestion (Step 33A(ii)) different site in the BAC Design new primers for recombineering the cassette into a Ensure that the drug concentration is appropriate for BACs See solutions for Step 32 Ensure complete DpnI digestion (Step 19) growth medium; wash salts thoroughly attention to preparation of electrocompetent cells and Make sure PCR product is fresh and correct; pay careful Repeat electroporation with more PCR product Start culture from a fresh plate or restreak from glycerol stock S reporter (Gal4FF rather than Gal4-VP16) Reduce the amount of BAC DNA. If necessary, try a different Reduce the amount of BAC DNA used in Step 41 Clean up DNA by phenol-chloroform extraction (Step 34) Increase annealing temperature by 1–2 °C Store primers in Tris buffer at Use less embryo extract or dilute for PCR ensure that proteinase K is inactivated (Step 45) Check RNA by measuring OD and running on denaturing gel; Increase the pressure in the MPPI injection system Under a microscope, break the tip further with forceps Step 33B(v) exchange. Ensure that bacteria are properly heat shocked in If colonies are Gal Gal Transfer colonies to MacConkey agar plates. If colonies are See possible solutions for Step 33A(xvi) Ensure complete DpnI digestion (Step 33B(ii)) See possible solutions for Step 33A(xv) extraction solutions Repeat BAC DNA miniprep; use correct volumes of DNA olution(s)

( galK

), ), DOG selection failed. Prepare new DOG plates.

−

, , galK was lost without homologous

−

20 20 °C (continued) © 2011 Nature America, Inc. All rights reserved. TA are readily applicable toavariety of model organisms, including mice the genome canbeeasily deduced byPCRmethods ( a fluorescent reporter inside the BAC ( BAC DNAitselfcouldbeunstable orhavedeleterious effects. StableBAC transgenic fishare easily identified by detection of this yet.Inthe exceptional casewhere aBAC does not integrate stablyinthe germline, weassume thatsequences in the Fig. sion occursin~15%of injectedfish regardless of the source orsize of the BAC DNA(70–165kband twodifferent libraries, approximately 5–20of the injectedfishwillcarryastable germline integration of the out aPCRexcision assay ( the (Steps 1–33).It iseasytoconfirmthe success of BAC modifications atevery step of the procedure ( Identification of BACs and construction of ANT Box 3 Box 2 Box 1 Steps 51–60,Analysis of Step 50,Screening of Step 49,Selection and rearing of Steps 45–48,Confirmation of Steps 34–44,Microinjection of the Step 33,Recombineering areporter gene into the Steps 16–32,Recombineering the Steps 6–15,Preparation of BAC-containing competent cells:4d Steps 1–5,Identification of BAC clones: 1d ● 60 58 50B(iii) 50A(ii), S

tep B T LE IMI Tol2 I 7 C 5 , Preparation of genomic DNAfrom zebrafish tailfin:1d , BAC DNAminiprep: 2h , Preparation of SW102electrocompetent cells:1d and I PATE N -BAC plasmid isintact and thatthe | G

Troubleshooting table (continued). S D upplementary Fig.1 sequence match zebrafish genomic PCR products does not Sequence from ADL- Too many PCR bands No PCR bands expression match endogenous gene transgenic fish does not GFP pattern from BAC positives No BAC transgene P roblem RESULTS Tol2 Tol2 Fig. 4 -BAC injectedfish:3d -BAC integrations (optional): 3d Tol2 b ). Aftermicroinjection of 100orsoembryosperconstruct (Step44),one canexpect that ). Although itispossiblethatthere isasizelimitfor Tol2 -mediated BAC excision ininjectedembryos:2d iTol2 Tol2 Sequence is missing in browser PCR artifact of repeats in sequence Template contamination; Annealing temperature is too low Problem with adapters or primers ligation did not work (Step 53) Poor quality of DNA extract; BAC transgene broke up tial regulatory elements; BAC transgene is missing essen Reporter is silenced in germline; BAC transgene broke up Low or no germline transmission; P -BAC injectedfish:3–4 months Fig. ossible reasons(s) cassetteinto the BAC: 2d -BAC DNAand TPRNA:3d Tol2 7 Tol2 ) orbyPCR.We cananticipate thatthe integration siteof the BAC construct in -compatible BAC transgenes byrecombineering isrelatively straightforward mRNAworksproperly during microinjection, wehighly recommend carrying Tol2 Fig. 8c -BAC plasmid: 2–6d

d presence ). Finally, our - 3 SpeI, SpeI, XbaI, NheI, and AvrI for CTAG adapter enzymes for digestion: BglII, BamHI, BclI for GATC adapter, Ensure sterile handling of samples before PCR; try different Increase annealing temperature by 1–2 °C control sample (e.g., UASGFP) and primers Ensure that adapters are working properly. Use a positive all reagents proteinase K is inactivated (Step 51); check the ligase and Use to embryos/larvae prepare genomic DNA; ensure that sequence; prepare new BAC DNA. Avoid shearing more founder fish; use larger BACs with surrounding genomic Try a different BAC covering the gene of interest; screen Prepare new BAC DNA and be careful to avoid shearing Use fresh transposase RNA Screen more founder fish P BLAST BLAST sequence against NCBI database Try new template or high-quality genomic DNA 3 . ossible solution(s) iTol2 cassettesand protocols for BAC transgenesis natureprotocols Tol2 Tol2 -BAC construct. Germline transmis inserts, wehavenot observed

Fig.

| VOL.6 NO.12VOL.6 5 ). To confirmthat

protocol | 2011 |

2019 - © 2011 Nature America, Inc. All rights reserved. com/reprints/index.htm at online available is information permissions and Reprints Published online at interests. CO and wrote the manuscript. optimized extensively the protocol. G.A. contributed data. K.K directed the work the Sars Centre and generated data and reagents. A.S. contributed reagents and AUT Technnology of Japan to K.K. Project of Japan and the Ministry of Education, Culture, Sports, Science and Takeda Science Foundation to M.L.S., and grants from the National BioResource Centre, a fellowship from the Japan Society for the Promotion of Science and the FRT initial characterization of zT2TP and K. Sumiyama for the and T. Uematsu at the National Institute of Genetics. We thank A. Urasaki for J. Xu at the Sars International Centre, and A. Ito, M. Suzuki, M. Mizushina,A N. Mouri is availableNote: information the via HTML of version Supplementary this article. 2020 7. 5. 4. 3. 2. 1. 20. 19. 18. 17. 16. 15. 14. 13. 12. 11. 10. 9. 8. 6. protocol cknowle

plasmid. This work was supported by core funding from the Sars International H PET transgenic animals.transgenic correlations with transgene integrity and expression. and integritytransgene with correlations and linestransgenic multiple across variation number copy transgene (2010). 19933–19938 zebrafish. in expressiongene conditional USA leukemia. lymphoblastic acute T-cellmyc-induced (2008). 113–121 zebrafish.transgenic in expressiongene control and trapping. USA Sci. Acad. Natl. Proc. transposon-mediated view.into swim neurons. system nervous central transgenesis. 23 zebrafish. in rag1 of regulation negative long-distance reveals research.neuroscience functionalmousegenomics.for tool oocytes. mouse fertilized of injection pronuclear through transgenesis chromosome artificial Bacterial 2001). USA,York, Harbor,New Spring Cold Manual Laboratory A Embryo: Mouse 4105–4111 (1997). 4105–4111 gene. reporter GFP using zebrafish transgenic Biol. Dev. embryos. zebrafish live in reporter a as used be can protein fluorescent embryos. zebrafish early into injected sequences foreign of transmissiongerm-line stable Res. Transgenic. mammals. in silencing (2007). 693–708 Yang, Z. Yang, for micetransgenic bac of use the future: the to BAC N. Heintz, newRecombineering:powerful D.L. aCourt, & Jenkins,Copeland,N.A.N.G., A.F. Stewart, & K. Anastassiadis, R., Naumann, G., Testa, K., Vintersten, Behringer,R. & K. Vintersten, M., Gertsenstein, Nagy,A., in PACsand YACs,BACs of use matters: Size L. Montoliu, P.& Giraldo, Long, Q. Long, The N. Hopkins, & S. Lin, A., Amsterdam, and integration Replication, M. Westerfield, G.W.,McMurray,J.V.& Stuart, vertebrates? in heterochromatinform arraystransgene Do Dorer,D.R. geneRepeat-induced E. Whitelaw, & D.I. Martin, S., Fiering, D., Garrick, Chandler,K.J. F.Knopf, D.M. Langenau, drive to system LexPRMifepristone-inducible Parinov, S. & Emelyanov,A. E. Scott, K. Asakawa, zebrafish disease: human of models P.D.Animal Currie, & G.J. Lieschke, in proteins fluorescent expressing Transgeniczebrafish S.-I. Higashijima, transgenesis chromosome Artificial S. Lin, & C.E. Willett, J.R., Jessen, OR

| , 15–16 (1999). 15–16 , VOL.6 NO.12VOL.6 I

N CONTR 102 G G FI dgm , 6068–6073 (2005). 6068–6073 , et al. et

et al. et et al. et et al. et NANC Nat. Methods Nat. 171 IB ents et al. et UT Methods , 123–129 (1995). 123–129 , Modified bacterial artificial chromosomes for zebrafish for chromosomes artificial bacterial Modified et al. et GATA-1 expression pattern can be recapitulated in living in recapitulated be can GATA-1pattern expression Targeting neural circuitry in zebrafish using Gal4 enhancer Gal4 using zebrafish in circuitry Targetingneural http://www.natureprotocols.com Dually inducible TetON systems for tissue-specific for systems TetONinducible Dually

I I

et al. et 6 AL Nat. Rev. Genet. Rev. Nat. For For excellent fish care, we thank T. Kronstad, F. Silva and ONS | , 3–10 (1997). 3–10 , Genetic dissection of neural circuits by Tol2 by circuits neural of dissection Genetic 2011 l I Development . Relevance of BAC transgene copy number in mice: in number copy transgeneBAC of Relevance Transgenic. Res. Transgenic. NTERESTS

Gal4 Cre/lox-regulated zebrafish model with conditional with model zebrafish Cre/lox-regulated

M.L.S. M.L.S. wrote the manuscript, directed the work at 39

Nat. Genet. Nat. Nat. Rev. Neurosci. Rev. Nat. 4 , 323–326 (2007). 323–326 , , 183–188 (2006). 183–188 , |

gene and enhancer trapping in zebrafish. in trapping enhancer and gene

105 natureprotocols Methods Mol. Biol. Mol. Methods

, 1255–1260 (2008). 1255–1260 , The authors declare no competing financial

103 Dev. Growth Diff. Growth Dev. 8

, 353–367 (2007). 353–367 , 18

, 3rd edn. (Cold Spring Harbor Press, Harbor Spring (Cold edn. 3rd , Nat. Rev.Genet.Nat. 10 , 403–412 (1988). 403–412 , , 56–59 (1998). 56–59 , , 83–103 (2001). 83–103 ,

Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. 2 Aequorea victoria Aequorea , 861–870 (2001). 861–870 , Development

/ 415 .

Proc. Natl. Acad. Sci. Acad. Natl. Proc. 50

pBSK-GFP-pA-FRT-kan- , 83–100 (2008). 83–100 , 2 , 407–413 (2008). 407–413 , Dev. Biol. Dev.

Mamm. Genome Mamm. , 769–779 (2001).769–779 , http://www.nature.

Manipulating the Manipulating 124 green

320 , Nat. Genet. Nat.

, 107

18 , ,

30. 29. 28. 27. 26. 25. 24. 23. 22. 21. 43. 42. 41. 40. 39. 38. 37. 36. 35. 34. 33. 32. 31. 47. 46. 45. 44.

(2003). the using zebrafish (2004). zebrafish. in genes regulated developmentally 95 from element (2003). therapy.gene for vectors viral of use (2007). insertions.retroviral genome. USA Sci. Acad. Natl. Proc. zebrafish. in insertions proviral of transmission germ-line efficient Highly zebrafish. in vector retroviral construct. reporter a fluorescent with co-injection by fish transgenic of selection efficient Biol. Dev. origin. zebrafish of promoters using by body whole the or muscles whole in GFP express reliably which zebrafish transgenicof generation frequency engineering using recombination in Escherichia coli. Escherichia in recombination using engineering in replacement (1998). in replacementgene 17 regions. ENCODE the in elements regulatory of correlation Protoc. Nat. engineering.genetic of methodrecombination-based homologous a Biol. Dev. mammals. to fish from cis-regulation and morphologyinterneuron Genetics transposition. for essential region subterminal the in sequence repetitive highly a and cis-sequence minimal the identified element transposable vertebrates. in applicationsgenetic zebrafish in elementTol2 fish medaka (2009). mice. and zebrafish in transgenesis BAC Biol. Genome Biol. Genome enzymatic reaction. enzymatic recombination.genetic Res. Acids Nucleic selection. galK using recombineering BAC efficient highly and Simple (2000). in engineering (2000). 1314–1317 in recombinationhomologous (1998). 123–128 Davidson, A.E. Davidson, K. Kawakami, the Transpositionof J.E. Dowling, & D.L. Hartl, J.M., Fadool, the with problems and Progress Kay,M.A. & A. Ehrhardt, C.E., Thomas, D. Wang, S. Ellingsen, N. Hopkins, & K. Kawakami, A., Amsterdam, M., Allende, N., Gaiano, S. Lin, fish: Transgenesisin J. Wittbrodt, & N.S. Foulkes, K., Lahiri, M., Rembold, High- G. Eguchi, & Y.Hotta, N., Ueno, H., Okamoto, S., Higashijima, Zhang, Y., Muyrers, J.P., Testa, G. & Stewart, A.F. DNA cloning by cloning DNA A.F. Stewart, & G. J.P.,Testa,Muyrers,Y., Zhang, DNA for logic new A A.F. Stewart, J.P.& Muyrers,F., Buchholz,Y., Zhang, gene PCR-mediated A.R. Poteete, & K.G. Campellone, Murphy,K.C., promote to functionsrecombination l bacteriophage of Use Murphy,K.C. Z.D. Zhang, Recombineering: D.L. Court, & Kuznetsov,S.G. L.C., Thomason, K., Sharan, M.L. Suster, Tol2 the of dissection Functional K. Kawakami, & G. Morvan, A., Urasaki, D. Balciunas, the of transposase Tol2 the Identification of A. Shima, & K. Kawakami, Transposon-mediated K. Kawakami, & K. Sumiyama, M.L., Suster, vertebrates. in screens trap enhancer for tools V.Transposonsas Korzh, vertebrates. in vector transfer gene versatile a Tol2: K. Kawakami, Little, J.W. An exonuclease induced by bacteriophage l. II. Nature of the of Nature II. l. bacteriophage by inducedexonuclease J.W.An Little, in exonuclease l of action the for Mechanism C.M. Radding, & E. Cassuto, N.G. Copeland, & N.A. Jenkins, D.L., Court, N., Costantino, S., Warming, D. Yu, , 5182–516 (1998). 5182–516 , , 787–797 (2007). 787–797 , et al. et et al. et

174 Development

et al. et 192 325

An efficient recombination system for chromosome for system recombination efficient An et al. et et al. et 4 Oryzias latipes Oryzias Integration and germ-line transmission of a pseudotyped a of transmissiongerm-line and Integration

, 639–649 (2006). 639–649 , et al. et 8 8 et al. et , 206–223 (2009). 206–223 , Drosophila et al. et , 289–299 (1997). 289–299 , , 422–433 (2009). 422–433 , Efficient genome-wide mutagenesis of zebrafish genes by genes zebrafish of genome-wide mutagenesis Efficient (Suppl 1): S8 (2007). S8 1): (Suppl (2007). S7 1): (Suppl et al. et Escherichia coli Escherichia Escherichia coli Escherichia

Statistical analysis of the genomic distribution and distribution genomic the of analysis Statistical A novel conserved evx1 enhancer links spinal links enhancer evx1 conserved novel A 33 Large-scale enhancer detection in the zebrafish the in detection enhancer Large-scale Harnessing a high cargo-capacity transposon for transposon cargo-capacity high a Harnessing A transposon-mediated gene trap approach identifies approach trap genetransposon-mediated A Nat. Protoc. Nat. Sleeping J. Biol. Chem. Biol. J. Efficient gene delivery and gene expression in expression gene and delivery gene Efficient Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. , e36 (2005). e36 , Escherichia coli Escherichia

132 Nat. New Biol. New Nat.

mauritiana

Danio rerio Danio , 3799–811 (2005). 3799–811 , 93 that catalyzes excision of a nonautonomous a of excision catalyzes that

Beauty , 7777–7782 (1996). 7777–7782 , Science . . Escherichia coli Escherichia

Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. 1 Gene , 1133–1139 (2006). 1133–1139 ,

242 transposon. in zebrafish. in . PLoS Genet. PLoS

246 J. Bacteriol. J. 265

Nat. Rev. Genet. Rev. Nat. Gene 229 , 679–686 (1967). 679–686 , , 321–330 (2000). 321–330 , BMC Genomics BMC , 666–669 (1994). 666–669 , , 13–16 (1971). 13–16 ,

240 .

Dev. Cell Dev. Nat. Biotechnol. Nat. 104

, 239–244 (1999). 239–244 , Dev. Biol. Dev. 2

Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. , e169 (2006). e169 , 180 , 12428–12433 , Nat. Genet. Nat.

, 2063–2071 ,

4 7

, 346–358 , 10 , 133–144 ,

97 263 Genome Res. Genome , 477 477 , , 5978–5983 , mariner

, 191–202 , 18

recombination: I. Recombination between Recombination I. recombination: embryos. activator.transcriptional potent unusually DNA l of V.Recombinationrecombination. genetic in l phage of protein b and exonuclease.lambda of action of mode the and specificity Substrate II. recombination.genetic in l phage 467–486 (1981). 467–486 Sternberg, N. & Hamilton, D. Bacteriophage P1 site-specific P1 Bacteriophage D. Hamilton, & N. Sternberg, zebrafish living in expressiontransgeneTracing Fraser,S.E. R.W.& Köster, an is GAL4-VP16 M. Ptashne, & S. Triezenberg, J., Ma, I., Sadowski, exonucleaseof Role C.M. Radding, & K.S. Sriprakash,T., Lash, E., Cassuto, of protein b andexonuclease of role The C.M. Radding, & D.M. Carter, in vitro in Dev. Biol. Dev. . Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc.

233 , 329–346 (2001). 329–346 , J. Biol. Chem. Biol. J.

68 loxP Nature , 1639–1643 (1971). 1639–1643 , sites.

246

335 , 2502–2512 (1971). 2502–2512 , J. Mol. Biol. Mol. J. , 563–564 (1988). 563–564 ,

150 , 57. 56. 55. 54. 53.

crest-derivedfate.pigmentcell zebrafish microphthalmia-relatedencodesa regulates neural- that protein bacteria. Gram-negative for Res. Acids Nucleic cells. fish in sequences enhancer and promoterheterologous and spotlight. the in behavior—zebrafish Biol. Transgenesis in zebrafish with the tol2 transposon system. transposon tol2 the with zebrafish Transgenesisin Lister, J.A., Robertson, C.P., Lepage, T., Johnson, S.L. & Raible,Lister,C.P.,Robertson,D.W.J.A.,nacreLepage,& T., Johnson,S.L. plasmids recombineering of set A D.L. Court, & N. Costantino, S., Datta, homologous by directedTransient expression M. Schartl, & H. Friedenreich, and circuits neural of targeting optical and Genetic E.K. Scott, & Baier,H. K. Kawakami, & K. Asakawa, A., Urasaki, H., Kikuta, M.L., Suster,

561 , 41–63 (2009). 41–63 ,

18 , 3299–3305 (1990). 3299–3305 , natureprotocols Gene Development

379 , 109–115 (2006). 109–115 , Curr. Opin. Neurobiol. Opin. Curr.

126 | VOL.6 NO.12VOL.6 , 3757–3767 (1999).3757–3767 , protocol

19 Methods Mol. Methods | 2011 , 553–560. ,

2021