DOCSLIB.ORG

Class II Allotypes Promiscuous Binding of Invariant Chain to MHC

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Class II Allotypes Promiscuous Binding of Invariant Chain to MHC Identification of a Sequence That Mediates Promiscuous Binding of Invariant Chain to MHC Class II Allotypes1 Ina M. Siebenkotten, Cornelia Carstens, and Norbert Koch2 The invariant chain (Ii) shows promiscuous binding to a great variety of MHC class II allotypes. In contrast, the affinities of the Ii-derived fragments, class II-associated Ii peptides, show large differences in binding to class II allotypes. The promiscuous association of Ii to all class II polypeptides therefore requires an additional contact site to stabilize the interaction to the poly- morphic class II cleft. We constructed recombinant molecules containing the class II binding site of Ii (CBS) and tested their association with HLA-DR dimers. The CBS fused to the transferrin receptor mediates binding of transferrin receptor-CBS to class II dimers. Within the CBS, deletion of a sequence N-terminal to the groove-binding motif abolished binding of Ii to DR. A promiscuous class II binding site was identified by reinsertion of the N-terminal residues, amino acids 81–87, of Ii into an Ii mutant that lacks the groove-binding segment. DR allotype-dependent association of Ii was achieved by insertion of antigenic sequences. The promiscuous association, in contrast to the class II allotype-dependent binding of Ii, is important to prevent interaction of class II dimers to nascent polypeptides in the endoplasmic reticulum. The Journal of Immunology, 1998, 160: 3355–3362. he first indication that the invariant chain (Ii)3 plays a groove, whereas the N terminus of the Ii fragment is disordered in functional role in Ag processing was obtained with Ii- the crystal (21). Studies on proteolytic fragments of Ii suggest that T deficient APCs (1). Analysis of Ii-deficient and Ii31/Ii41 the CBS also binds to the Ag-binding groove of class II dimers and transgenic mice supported this observation and, in addition, re- that CLIP is a naturally occurring degradation intermediate (22– vealed the importance of Ii for the development of CD41 T cells 25). The affinities of CLIP for different MHC allotypes can vary (2–6). In recent years, several molecular functions of Ii have been over several orders of magnitude (26). This could indicate that the identified. A major function of Ii is the targeting of MHC class II affinity of CLIP regulates the binding of antigenic peptides. Re- dimers to the endocytic pathway (7–9). On this route, Ii degrada- lease of CLIP from MHC class II dimers for which it has a high tion controls the acquisition of peptides by class II molecules in affinity requires the accessory molecule HLA-DM (27–29). Allo- specialized loading compartments (reviewed in Ref. 10). In addi- types showing a high off rate for CLIP apparently do not depend tion, association of class II molecules with Ii supports the assembly on the catalytic function of DM for dissociation, although the ac- of MHC class II polypeptides in the endoplasmic reticulum and is quisition of antigenic peptides might be facilitated by DM (30– essential for certain allotypes to form functional ab dimers (2, 11, 32). In these cases, the acidic conditions in the MHC class II load- 12). Peptide-free class II molecules are stabilized by association ing compartments might be sufficient for dissociation. The strong with Ii, and aggregation is prevented (13–16). A segment encoded binding of Ii to different class II allo- and isotypes even across by exon 3 of the Ii gene is indispensable for the formation of the species barriers suggests a highly conserved interaction between Ii MHC class II/Ii complex (17–19). Fragments of processed Ii are and class II dimers (33). Thus, it is conceivable that contacts ad- called class II-associated Ii peptides (CLIP), the sequences of jacent to the polymorphic class II groove are responsible for sta- which are encoded by exon 3. The sequence of CLIP is contained bilizing the binding of Ii to MHC class II molecules. in the class II binding site (CBS) of Ii. CLIP were found associated Here, we demonstrate both allotype-dependent and promiscuous with various MHC class II allotypes (reviewed in Ref. 20). The binding of rIi polypeptides mediated by different Ii sequences to x-ray crystal structure of CLIP bound to HLA-DR3 revealed that MHC class II dimers. A membrane proximal region of Ii mediates a number of residues in the sequence 91–99 (groove binding site) binding to three DR allotypes, whereas the groove-binding seg- interact with specific pockets of the MHC class II peptide-binding ment of Ii replaced by an antigenic sequence leads to allotype- dependent association of class II dimers. Division of Immunobiology, University of Bonn, Bonn, Germany Materials and Methods Received for publication September 15, 1997. Accepted for publication December DNA constructs 5, 1997. The costs of publication of this article were defrayed in part by the payment of page DNAs for transferrin receptor (TFR), rIi, and DR chains were expressed charges. This article must therefore be hereby marked advertisement in accordance under SV40 promoter control in the pcEXV3 or pSV51 expression vector with 18 U.S.C. Section 1734 solely to indicate this fact. (7, 34). For construction of TFR-CBS, bp 237–416 of the murine Ii31 1 This work was supported by the Sonderforschungsbereich 284, Sonderforschungs- cDNA, encoding Ii amino acids (aa) 80–139, was excised by AluI diges- bereich 502 and by the Graduiertenkolleg “Funktionelle Proteindoma¨nen.” N.K. was tion. Maintaining the reading frame, this Ii fragment was inserted into the supported on his sabbatical leave by a grant from the Volkswagenstiftung. Eco47III restriction site at the 585-bp position of the human TFR cDNA. D 2 Address correspondence and reprint requests to Dr. Norbert Koch, Abteilung Im- For construction of the deletion mutant Ii80-93, bp 233 to 272 of the munbiologie, Universita¨t Bonn, Ro¨merstrasse 164, D53117 Bonn, Germany. E-mail human Ii33 cDNA (pSV51-huIi) was removed by digestion with FspI, address: [email protected] followed by religation. In DIi105-157, the segment bp 309 to 465 was excised using NcoI. The cDNA/genomic DNA fusion construct for DIi81- 3 Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated Ii peptides; CBS, class II binding site of Ii; PBSite, promiscuous binding site of Ii; aa, 127 has been described previously (17). QASLALSYRLNMFTP is a pep- amino acids; TFR, transferrin receptor; MOMP, peptide from major outer membrane tide derived from the major outer membrane protein of Chlamydia tracho- protein of C. trachomatis; MAT, peptide from influenza virus matrix protein; matis (MOMP). The aa 81–87 (PKSAKPV) of Ii were designated the NEPHGE, nonequilibrated pH gradient electrophoresis. promiscuous binding site (PBSite). To obtain rIi MOMP, rIi spacer 1, rIi Copyright © 1998 by The American Association of Immunologists 0022-1767/98/$02.00 3356 PROMISCUOUS BINDING SITE OF INVARIANT CHAIN FIGURE 1. Amino acid sequences of the segment aa 70–140 of recombinant Ii. Single aa code is used. Inserted aa are shown in italics. Deleted sequences are indicated by dashes. PBSite, and rIi spacer 2, the aa shown in Figure 1 were introduced in Cell lines and transfections DIi81-127. For construction of rIi MOMP and rIi PBSite, the two oligo- nucleotides 59AGCTTCAAGCAAGTTTGGCTCTCTCTTACAGACT COS1 (CRL-1650; American Type Culture Collection (ATCC), Rockville, GAATATGTTCACTCCCA and 59AGCTTCCGAAATCTGCCAAAC MD) and COS7 (CRL-1651; ATCC) cells were cultivated in high glucose m CTGTGCTGCAGA were hybridized with their complementary strands, DMEM supplemented with 10% FCS, 100 g/ml penicillin, 100 U/ml thereby generating HindIII overlaps, and ligated into the HindIII restriction streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 2 mM L-glu- site of DIi81-127 (at position bp 4717 of the genomic sequence; Fig. 2). tamine. Transient transfections were performed by DEAE-mediated DNA m 3 6 Due to the cloning procedure, there is an additional C-terminal KL and transfer (10 g DNA/3 10 COS1 cells; 24 h), electroporation (210 m 3 6 LQKL that connects MOMP and Ii aa 81–87, respectively, to Ii aa 128. In V/1.2 mF, 25 g DNA/6 10 COS1 cells; 72 h), and liposome-aided m 3 5 the constructs rIi spacer 1 and rIi spacer 2, the oligonucleotides coding for transfer (1 g DNA/5 10 COS7 cells; 48 h) as described (35–37). MOMP and for PBSite were inserted in the inverse orientation, thereby Metabolic radiolabeling of proteins and immunoprecipitation encoding a nonrelated sequence with the same number of aa. Oligonucle- otides encoding aa 17–31 of the influenza virus matrix protein (MAT) After incubation of cells for1hat37°C in methionine-free RPMI 1640, sequence were introduced into genomic Ii DNA. The small fragment be- newly synthesized proteins were labeled for 10 min with 50 mCi [35S]me- tween the restriction sites HindIII (bp 4717 in exon 2) and NcoI (bp 4945 thionine (Amersham, Braunschweig, Germany) in methionine-free RPMI in exon 3) was replaced by the oligonucleotides AGCTTTCGGGCCC (supplemented with 10% dialysed FCS, 1 mM sodium pyruvate, 2 mM G GCTGAAGGCGGAGATC /ACGCAGCGCCTCGAGGACGTGTC. This glutamine, and 10 mM HEPES). The cells were lysed with 1% Nonidet resulted in replacement of aa 81–101 of Ii by MAT aa 17–31, with alanine P-40 in Tris-buffered saline in the presence of protease inhibitors (1 mM or threonine at residue 89 of rIiMAT. PMSF and 0.024 trypsin inhibitor units of aprotinin per ml). Lysates were FIGURE 2. Schematic representation of recombi- nant Ii constructs. The cDNA/genomic DNA fusion construct encoding the Ii deletion mutant DIi81-127 lacks exon 3 and part of exon 4. The deletion mutant was used for the generation of MOMP and PBSite derivatives.
Load more

Recommended publications
  • Selection in the Thymus Stromal Cell Type in Positive and Negative
    Differential Effects of Peptide Diversity and Stromal Cell Type in Positive and Negative Selection in the Thymus This information is current as Graham Anderson, Katharine M. Partington and Eric J. of September 29, 2021. Jenkinson J Immunol 1998; 161:6599-6603; ; http://www.jimmunol.org/content/161/12/6599 Downloaded from References This article cites 31 articles, 9 of which you can access for free at: http://www.jimmunol.org/content/161/12/6599.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 29, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1998 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Differential Effects of Peptide Diversity and Stromal Cell Type in Positive and Negative Selection in the Thymus1 Graham Anderson,2 Katharine M. Partington, and Eric J. Jenkinson Thymocyte positive selection results in maturation to the single-positive stage, while negative selection results in death by apo- ptosis. Although kinetic analyses indicate only 3–5% of CD4181 cells reach the single-positive stage, the balance of positive and negative selection and the nature and quantity of cells mediating maximal negative selection are uncertain.
    [Show full text]
  • Endosomal/Lysosomal Compartments Receptor and Modulates Its
    The MHC Class II-Associated Invariant Chain Interacts with the Neonatal Fc γ Receptor and Modulates Its Trafficking to Endosomal/Lysosomal Compartments This information is current as of October 2, 2021. Lilin Ye, Xindong Liu, Subrat N. Rout, Zili Li, Yongqi Yan, Li Lu, Tirumalai Kamala, Navreet K. Nanda, Wenxia Song, Siba K. Samal and Xiaoping Zhu J Immunol 2008; 181:2572-2585; ; doi: 10.4049/jimmunol.181.4.2572 Downloaded from http://www.jimmunol.org/content/181/4/2572 References This article cites 68 articles, 35 of which you can access for free at: http://www.jimmunol.org/content/181/4/2572.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 2, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The MHC Class II-Associated Invariant Chain Interacts with the Neonatal Fc␥ Receptor and Modulates Its Trafficking to Endosomal/Lysosomal Compartments1 Lilin Ye,*§ Xindong Liu,*§ Subrat N.
    [Show full text]
  • Bidirectional Binding of Invariant Chain Peptides to an MHC Class II Molecule
    Bidirectional binding of invariant chain peptides to an MHC class II molecule Sebastian Günthera,b,1, Andreas Schlundta,1, Jana Stichta, Yvette Roskeb, Udo Heinemannb, Karl-Heinz Wiesmüllerc, Günther Jungc, Kirsten Falkb, Olaf Rötzschkeb,d, and Christian Freunda,2 aLeibniz-Institute for Molecular Pharmacology and Freie Universität Berlin, 13125 Berlin, Germany; bMax-Delbrück-Center for Molecular Medicine, 13125 Berlin, Germany; cEMC Microcollections GmbH, D-72070 Tübingen, Germany; and dSingapore Immunology Network, Agency of Science, Technology and Research, Singapore 138648 Edited* by Emil R. Unanue, Washington University, St. Louis, MO, and approved November 2, 2010 (received for review September 30, 2010) T-cell recognition of peptides bound to MHC class II (MHCII) Here we determined the crystal structures of the human MHCII molecules is a central event in cell-mediated adaptive immunity. molecule HLA-DR1 in complex with two CLIP length variants The current paradigm holds that prebound class II-associated in- and observed a unique bidirectional binding mode. NMR analyses variant chain peptides (CLIP) and all subsequent antigens maintain by chemical shift mapping and spin label-induced relaxation en- a canonical orientation in the MHCII binding groove. Here we hancement of the uncatalyzed and HLA-DM edited reactions il- provide evidence for MHCII-bound CLIP inversion. NMR spectroscopy lustrate the dynamic reorientation of the complex in solution. demonstrates that the interconversion from the canonical to the Surface charge distributions differ largely for the two MHC-CLIP inverse alignment is a dynamic process, and X-ray crystallography variants and result in T-cell epitopes with inverted polarity. shows that conserved MHC residues form a hydrogen bond network with the peptide backbone in both orientations.
    [Show full text]
  • Evolution of Male Pregnancy Associated with Remodeling of Canonical Vertebrate Immunity in Seahorses and Pipefishes
    Evolution of male pregnancy associated with remodeling of canonical vertebrate immunity in seahorses and pipefishes Olivia Rotha,1, Monica Hongrø Solbakkenb, Ole Kristian Tørresenb, Till Bayera, Michael Matschinerb,c, Helle Tessand Baalsrudb, Siv Nam Khang Hoffb, Marine Servane Ono Brieucb, David Haasea, Reinhold Haneld, Thorsten B. H. Reuscha,2, and Sissel Jentoftb,2 aMarine Evolutionary Ecology, GEOMAR Helmholtz Centre for Ocean Research Kiel, D-24105 Kiel, Germany; bCentre for Ecological and Evolutionary Synthesis, Department of Biosciences, University of Oslo, NO-0371 Oslo, Norway; cDepartment of Palaeontology and Museum, University of Zurich, CH-8006 Zürich, Switzerland; and dThünen Institute of Fisheries Ecology, D-27572 Bremerhaven, Germany Edited by Günter P. Wagner, Yale University, New Haven, CT, and approved March 13, 2020 (received for review September 18, 2019) A fundamental problem for the evolution of pregnancy, the most class I and II genes (7–9) plays a key role for self/nonself-recognition. specialized form of parental investment among vertebrates, is the While in mammals an initial inflammation seems crucial for embryo rejection of the nonself-embryo. Mammals achieve immunological implantation (10), during pregnancy mammals prevent an immuno- tolerance by down-regulating both major histocompatibility com- logical rejection of the embryo with tissue layers of specialized fetal plex pathways (MHC I and II). Although pregnancy has evolved cells, the trophoblasts (11–13). Trophoblasts do not express MHC II multiple times independently among vertebrates, knowledge of (14–16) and thus prevent antigen presentation to maternal T-helper associated immune system adjustments is restricted to mammals. (Th) cells (17), which otherwise would trigger an immune response All of them (except monotremata) display full internal pregnancy, against nonself.
    [Show full text]
  • Binding of Major Histocompatibility Complex Class 1I to the Invariant
    Binding of Major Histocompatibility Complex Class 1I to the Invariant Chain-derived Peptide, CLIP, Is Regulated by Allelic Polymorphism in Class 1I By Alessandro Sette,* Scott Southwood,* Jim Miller, and Ettore Appella$ From the "Department of Immunology, Cytel, San Diego, CA 92121; the *Department of Molecular Genetics and Cell Biology, University of Chicago, Chicago, Illinois 60637-1432; and SNational Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 Summary Major histocompatibility complex class II-associated invariant chain (Ii) provides several important functions that regulate class II expression and function. One of these is the ability to inhibit class II peptide loading early in biosynthesis. This allows for efficient class II folding and egress from the endoplasmic reticulum, and protects the class II peptide binding site from loading with peptides before entry into endosomal compartments. The ability of Ii to interact with class II and interfere with peptide loading has been mapped to Ii exon 3, which encodes amino acids 82-107. This same region of Ii has been described as a nested set of class II-associated Ii peptides (CLIPs) that are transiently associated with class II in normal cells and accumulate in human histocompatibility leukocyte antigen-DM-negative cell lines. Currently it is not clear how CLIP and the CLIP region of Ii blocks peptide binding. CLIP may bind directly to the class II peptide binding site, or may bind elsewhere on class II and modulate class II peptide binding a11osterically. In this report, we show that CLIP can interact with many different murine and human class II molecules, but that the affinity of this interaction is controlled by polymorphic residues in the class II chains.
    [Show full text]
  • Class II-Associated Invariant Chain Peptide Expression on Myeloid Leukemic Blasts Predicts Poor Clinical Outcome
    [CANCER RESEARCH 64, 5546–5550, August 15, 2004] Advances in Brief Class II-Associated Invariant Chain Peptide Expression on Myeloid Leukemic Blasts Predicts Poor Clinical Outcome Martine E. D. Chamuleau,1 Yuri Souwer,3,4,5 S. Marieke van Ham,4 Adri Zevenbergen,1 Theresia M. Westers,1 Johannes Berkhof,2 Chris J. L. M. Meijer,3 Arjan A. van de Loosdrecht,1 and Gert J. Ossenkoppele1 Departments of 1Hematology, 2Clinical Epidemiology and Biostatistics, and 3Pathology, VU University Medical Center, Amsterdam, the Netherlands; 4Division of Tumor Biology, The Netherlands Cancer Institute, Amsterdam, the Netherlands; 5Department of Immunopathology, Sanquin Research at Central Laboratory of The Netherlands Red Cross Blood Transfusion Service, Amsterdam, the Netherlands Abstract CLIP correlates with a high DO:DM ratio and can be viewed as an indicator for low effectiveness of antigen presentation (8). ؉ Effective antitumor responses need the activation of CD4 T cells. In MHC class II negative tumors, the activation of CD4ϩ T cells MHC class II antigen presentation requires the release of class II-associ- relies on presentation of tumor antigens by professional antigen- ated invariant chain peptide (CLIP) from the antigen-binding site. In presenting cells (APCs). MHC class II transfection studies in mice antigen-presenting cells, human leukocyte antigen DM (HLA-DM; abbre- viated DM in this article) catalyzes CLIP dissociation. In B cells, HLA-DO have shown that, upon expression of MHC class II molecules, tumor ϩ (DO) down-modulates DM function. Cell surface CLIP:HLA-DR (DR) cells can present their tumor antigens directly to CD4 T cells, thus ratio correlates to DO:DM ratio and the efficacy of antigen presentation.
    [Show full text]
  • Ancient Features of the MHC Class II Presentation Pathway, and a Model for the Possible Origin of MHC Molecules
    Immunogenetics (2019) 71:233–249 https://doi.org/10.1007/s00251-018-1090-2 REVIEW Ancient features of the MHC class II presentation pathway, and a model for the possible origin of MHC molecules Johannes M. Dijkstra1 & Takuya Yamaguchi2 Received: 16 August 2018 /Accepted: 6 October 2018 /Published online: 30 October 2018 # Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract Major histocompatibility complex (MHC) molecules are only found in jawed vertebrates and not in more primitive species. MHC class II type structures likely represent the ancestral structure of MHC molecules. Efficient MHC class II transport to endosomal compartments depends on association with a specialized chaperone, the MHC class II invariant chain (aliases Ii or CD74). The present study identifies conserved motifs in the CLIP region of CD74 molecules, used for binding in the MHC class II binding groove, throughout jawed vertebrates. Peculiarly, in CD74a molecules of Ostariophysi, a fish clade including for example Mexican tetra and zebrafish, the CLIP region has duplicated. In mammals, in endosomal compartments, the peptide-free form of classical MHC class II is stabilized by binding to nonclassical MHC class II BDM,^ a process that participates in Bpeptide editing^ (selection for high affinity peptides). Hitherto, DM-lineage genes had only been reported from the level of amphibians, but the present study reveals the existence of DMA and DMB genes in lungfish. This is the first study which details how classical and DM lineage molecules have distinguishing glycine-rich motifs in their transmembrane regions. In addition, based on extant MHC class II structures and functions, the present study proposes a model for early MHC evolution, in which, in an ancestral jawed vertebrate, the ancestral MHC molecule derived from a heavy-chain-only antibody type molecule that cycled between the cell surface and endosomal compartments.
    [Show full text]
  • Assembly, Maturation, and Function Mutant HLA-DM Molecule
    Aberrant Intermolecular Disulfide Bonding in a Mutant HLA-DM Molecule: Implications for Assembly, Maturation, and Function This information is current as Robert Busch, Robert C. Doebele, Emily von Scheven, Jimothy of September 28, 2021. Fahrni and Elizabeth D. Mellins J Immunol 1998; 160:734-743; ; http://www.jimmunol.org/content/160/2/734 Downloaded from References This article cites 51 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/160/2/734.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 28, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1998 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Aberrant Intermolecular Disulfide Bonding in a Mutant HLA-DM Molecule: Implications for Assembly, Maturation, and Function1 Robert Busch,2* Robert C. Doebele,† Emily von Scheven,‡ Jimothy Fahrni,* and Elizabeth D. Mellins* HLA-DM (abbreviated DM) is an MHC-encoded glycoprotein that catalyzes the selective release of peptides, including class II-associated invariant chain peptides, from MHC class II molecules.
    [Show full text]
  • RA0066-C.5-IFU-RUO CD74 (B-Cell Marker); Clone CLIP/813
    Instructions For Use RA00 66 -C.5 -IFU -RUO Revision: 1 Rev. Date: Oct. 3, 2014 Page 1 of 2 P.O. Box 3286 - Logan, Utah 84323, U.S.A. - Tel. (800) 729-8350 – Tel. (435) 755-9848 - Fax (435) 755-0015 - www.scytek.com CD74 (B-Cell Marker); Clone CLIP/813 (Concentrate) Availability/Contents: Item # Volume RA0066-C.5 0.5 ml Description: Species: Mouse Immunogen: Recombinant human CD74 protein Clone: CLIP/813 Isotype: IgG1, kappa Entrez Gene ID: 972 (Human) Hu Chromosome Loc.: 5q33.1 Synonyms: CLIP, DHLAG, Gamma chain of class II antigens, HLA class II histocompatibility antigen gamma chain, HLA-DR antigens-associated invariant chain, HLADR-gamma (HLADG), Ia antigen-associated invariant chain, la-gamma, Major histocompatibility complex class II invariant chain, MHC HLA-DR gamma chain Mol. Weight of Antigen: 33-41kDa Format: 200µg/ml of Ab purified from Bioreactor Concentrate by Protein A/G. Prepared in 10mM PBS with 0.05% BSA & 0.05% azide. Specificity: This monoclonal antibody recognizes a protein of ~35kDa, identified as CD74. Background: CD74 is a type II transmembrane protein which binds to the peptide binding groove of newly synthesized MHC class II alpha/beta heterodimers and prevents their premature association with endogenous polypeptides. CD74 is expressed primarily by antigen presenting cells, such as B-lymphocytes (from before the pre-B cell stage to before the plasma cell stage), macrophages, monocytes, and many epithelial cells. Anti-CD74 stains predominantly germinal center lymphocytes and B-cell lymphomas, but rarely T-cell lymphomas. Anti-CD74 has been shown to be useful in differentiating atypical fibroxanthoma (-) from malignant fibrous histiocytoma (+).
    [Show full text]
  • Vitamin D3 Suppresses Class II Invariant Chain Peptide Expression
    Hindawi Publishing Corporation Journal of Nutrition and Metabolism Volume 2016, Article ID 4280876, 8 pages http://dx.doi.org/10.1155/2016/4280876 Research Article Vitamin D3 Suppresses Class II Invariant Chain Peptide Expression on Activated B-Lymphocytes: A Plausible Mechanism for Downregulation of Acute Inflammatory Conditions Omar K. Danner,1 Leslie R. Matthews,1 Sharon Francis,1 Veena N. Rao,1 Cassie P. Harvey,2 Richard P. Tobin,2 Ken L. Wilson,3 Ernest Alema-Mensah,1 M. Karen Newell Rogers,2 and Ed W. Childs1 1 Morehouse School of Medicine, Atlanta, GA, USA 2Texas A&M School of Medicine, Temple, TX, USA 3Michigan State University College of Human Medicine, Flint, MI, USA Correspondence should be addressed to Omar K. Danner; [email protected] Received 24 December 2015; Revised 17 March 2016; Accepted 18 April 2016 Academic Editor: Azeddine Ibrahimi Copyright © 2016 Omar K. Danner et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Class II invariant chain peptide (CLIP) expression has been demonstrated to play a pivotal role in the regulation of B cell function after nonspecific polyclonal expansion. Several studies have shown vitamin D3 helps regulate the immune response. We hypothesized that activated vitamin D3 suppresses CLIP expression on activated B-cells after nonspecific activation or priming of C57BL/6 mice with CpG. This study showed activated vitamin D3 actively reduced CLIP expression and decreased the number + of CLIP B-lymphocytes in a dose and formulation dependent fashion.
    [Show full text]
  • Specific Treatment of Autoimmunity with Recombinant Invariant Chains in Which CLIP Is Replaced by Self-Epitopes
    Specific treatment of autoimmunity with recombinant invariant chains in which CLIP is replaced by self-epitopes Felix Bischof*†‡§, Wolfgang Wienhold†‡, Christoph Wirblich†, Georg Malcherek†, Olayinka Zevering*, Ada M. Kruisbeek*, and Arthur Melms† *Division of Immunology, The Netherlands Cancer Institute, 1066CX Amsterdam, The Netherlands; and †Department of Neurology, University of Tu¨bingen, 72076 Tu¨bingen, Germany Edited by Michael Sela, Weizmann Institute of Science, Rehovot, Israel, and approved August 23, 2001 (received for review May 4, 2001) The invariant chain (Ii) binds to newly synthesized MHC class II antigen-specific tolerance and preventing EAE. Importantly, i.v. molecules with the CLIP region of Ii occupying the peptide-binding injection of Ii-MBP84–96 or Ii-PLP139–151 after disease induc- groove. Here we demonstrate that recombinant Ii proteins with tion completely suppressed EAE, demonstrating the qualities of the CLIP region replaced by antigenic self-epitopes are highly recombinant Ii proteins as potent antigen delivery systems for efficient in activating and silencing specific T cells in vitro and in the treatment of autoimmunity. vivo. The Ii proteins require endogenous processing by antigen- presenting cells for efficient T cell activation. An Ii protein encom- Materials and Methods passing the epitope myelin basic protein amino acids 84–96 (Ii- Mice. SJL mice were bred under specific pathogen-free condi- MBP84–96) induced the model autoimmune disease experimental tions at the Netherlands Cancer Institute. In all experiments, 8- allergic encephalomyelitis (EAE) with a higher severity and earlier to 12-week-old female mice were used according to approved onset than the peptide. When applied in a tolerogenic manner, protocols.
    [Show full text]
  • Lacking Invariant Chain and DM Functions MHC Class II Expression
    MHC Class II Expression in Double Mutant Mice Lacking Invariant Chain and DM Functions George Kenty, W. David Martin, Luc Van Kaer and Elizabeth K. Bikoff This information is current as of September 28, 2021. J Immunol 1998; 160:606-614; ; http://www.jimmunol.org/content/160/2/606 References This article cites 84 articles, 37 of which you can access for free at: Downloaded from http://www.jimmunol.org/content/160/2/606.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: by guest on September 28, 2021 http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1998 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. MHC Class II Expression in Double Mutant Mice Lacking Invariant Chain and DM Functions1 George Kenty,* W. David Martin,2† Luc Van Kaer,3† and Elizabeth K. Bikoff4* Invariant (Ii) chain and DM functions are required at distinct stages during class II maturation to promote occupancy by diverse peptide ligands.
    [Show full text]