Class II Allotypes Promiscuous Binding of Invariant Chain to MHC

Identiﬁcation of a Sequence That Mediates Promiscuous Binding of Invariant Chain to MHC Class II Allotypes1

Ina M. Siebenkotten, Cornelia Carstens, and Norbert Koch2

The invariant chain (Ii) shows promiscuous binding to a great variety of MHC class II allotypes. In contrast, the afﬁnities of the Ii-derived fragments, class II-associated Ii peptides, show large differences in binding to class II allotypes. The promiscuous association of Ii to all class II polypeptides therefore requires an additional contact site to stabilize the interaction to the polymorphic class II cleft. We constructed recombinant molecules containing the class II binding site of Ii (CBS) and tested their association with HLA-DR dimers. The CBS fused to the transferrin receptor mediates binding of transferrin receptor-CBS to class II dimers. Within the CBS, deletion of a sequence N-terminal to the groove-binding motif abolished binding of Ii to DR. A promiscuous class II binding site was identiﬁed by reinsertion of the N-terminal residues, amino acids 81–87, of Ii into an Ii mutant that lacks the groove-binding segment. DR allotype-dependent association of Ii was achieved by insertion of antigenic sequences. The promiscuous association, in contrast to the class II allotype-dependent binding of Ii, is important to prevent interaction of class II dimers to nascent polypeptides in the endoplasmic reticulum. The Journal of Immunology, 1998, 160: 3355–3362.

he first indication that the invariant chain (Ii)3 plays a groove, whereas the N terminus of the Ii fragment is disordered in functional role in Ag processing was obtained with Ii- the crystal (21). Studies on proteolytic fragments of Ii suggest that T deficient APCs (1). Analysis of Ii-deficient and Ii31/Ii41 the CBS also binds to the Ag-binding groove of class II dimers and transgenic mice supported this observation and, in addition, re- that CLIP is a naturally occurring degradation intermediate (22– vealed the importance of Ii for the development of CD4ϩ T cells 25). The affinities of CLIP for different MHC allotypes can vary (2–6). In recent years, several molecular functions of Ii have been over several orders of magnitude (26). This could indicate that the identified. A major function of Ii is the targeting of MHC class II affinity of CLIP regulates the binding of antigenic peptides. Re- dimers to the endocytic pathway (7–9). On this route, Ii degrada- lease of CLIP from MHC class II dimers for which it has a high tion controls the acquisition of peptides by class II molecules in affinity requires the accessory molecule HLA-DM (27–29). Allo- specialized loading compartments (reviewed in Ref. 10). In addi- types showing a high off rate for CLIP apparently do not depend tion, association of class II molecules with Ii supports the assembly on the catalytic function of DM for dissociation, although the ac- of MHC class II polypeptides in the endoplasmic reticulum and is quisition of antigenic peptides might be facilitated by DM (30– essential for certain allotypes to form functional ␣␤ dimers (2, 11, 32). In these cases, the acidic conditions in the MHC class II load- 12). Peptide-free class II molecules are stabilized by association ing compartments might be sufficient for dissociation. The strong with Ii, and aggregation is prevented (13–16). A segment encoded binding of Ii to different class II allo- and isotypes even across by exon 3 of the Ii gene is indispensable for the formation of the species barriers suggests a highly conserved interaction between Ii MHC class II/Ii complex (17–19). Fragments of processed Ii are and class II dimers (33). Thus, it is conceivable that contacts ad- called class II-associated Ii peptides (CLIP), the sequences of jacent to the polymorphic class II groove are responsible for sta- which are encoded by exon 3. The sequence of CLIP is contained bilizing the binding of Ii to MHC class II molecules. in the class II binding site (CBS) of Ii. CLIP were found associated Here, we demonstrate both allotype-dependent and promiscuous with various MHC class II allotypes (reviewed in Ref. 20). The binding of rIi polypeptides mediated by different Ii sequences to x-ray crystal structure of CLIP bound to HLA-DR3 revealed that MHC class II dimers. A membrane proximal region of Ii mediates a number of residues in the sequence 91–99 (groove binding site) binding to three DR allotypes, whereas the groove-binding seg- interact with specific pockets of the MHC class II peptide-binding ment of Ii replaced by an antigenic sequence leads to allotype- dependent association of class II dimers.

Division of Immunobiology, University of Bonn, Bonn, Germany Materials and Methods Received for publication September 15, 1997. Accepted for publication December DNA constructs 5, 1997. The costs of publication of this article were defrayed in part by the payment of page DNAs for transferrin receptor (TFR), rIi, and DR chains were expressed charges. This article must therefore be hereby marked advertisement in accordance under SV40 promoter control in the pcEXV3 or pSV51 expression vector with 18 U.S.C. Section 1734 solely to indicate this fact. (7, 34). For construction of TFR-CBS, bp 237–416 of the murine Ii31 1 This work was supported by the Sonderforschungsbereich 284, Sonderforschungs- cDNA, encoding Ii amino acids (aa) 80–139, was excised by AluI diges- bereich 502 and by the Graduiertenkolleg “Funktionelle Proteindoma¨nen.” N.K. was tion. Maintaining the reading frame, this Ii fragment was inserted into the supported on his sabbatical leave by a grant from the Volkswagenstiftung. Eco47III restriction site at the 585-bp position of the human TFR cDNA. ⌬ 2 Address correspondence and reprint requests to Dr. Norbert Koch, Abteilung Im- For construction of the deletion mutant Ii80-93, bp 233 to 272 of the munbiologie, Universita¨t Bonn, Ro¨merstrasse 164, D53117 Bonn, Germany. E-mail human Ii33 cDNA (pSV51-huIi) was removed by digestion with FspI, address: [email protected] followed by religation. In ⌬Ii105-157, the segment bp 309 to 465 was excised using NcoI. The cDNA/genomic DNA fusion construct for ⌬Ii81- 3 Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated Ii peptides; CBS, class II binding site of Ii; PBSite, promiscuous binding site of Ii; aa, 127 has been described previously (17). QASLALSYRLNMFTP is a pep- amino acids; TFR, transferrin receptor; MOMP, peptide from major outer membrane tide derived from the major outer membrane protein of Chlamydia tracho- protein of C. trachomatis; MAT, peptide from inﬂuenza virus matrix protein; matis (MOMP). The aa 81–87 (PKSAKPV) of Ii were designated the NEPHGE, nonequilibrated pH gradient electrophoresis. promiscuous binding site (PBSite). To obtain rIi MOMP, rIi spacer 1, rIi

FIGURE 1. Amino acid sequences of the segment aa 70–140 of recombinant Ii. Single aa code is used. Inserted aa are shown in italics. Deleted sequences are indicated by dashes.

PBSite, and rIi spacer 2, the aa shown in Figure 1 were introduced in Cell lines and transfections ⌬Ii81-127. For construction of rIi MOMP and rIi PBSite, the two oligonucleotides 5ЈAGCTTCAAGCAAGTTTGGCTCTCTCTTACAGACT COS1 (CRL-1650; American Type Culture Collection (ATCC), Rockville, GAATATGTTCACTCCCA and 5ЈAGCTTCCGAAATCTGCCAAAC MD) and COS7 (CRL-1651; ATCC) cells were cultivated in high glucose ␮ CTGTGCTGCAGA were hybridized with their complementary strands, DMEM supplemented with 10% FCS, 100 g/ml penicillin, 100 U/ml thereby generating HindIII overlaps, and ligated into the HindIII restriction streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 2 mM L-glu- site of ⌬Ii81-127 (at position bp 4717 of the genomic sequence; Fig. 2). tamine. Transient transfections were performed by DEAE-mediated DNA ␮ ϫ 6 Due to the cloning procedure, there is an additional C-terminal KL and transfer (10 g DNA/3 10 COS1 cells; 24 h), electroporation (210 ␮ ϫ 6 LQKL that connects MOMP and Ii aa 81–87, respectively, to Ii aa 128. In V/1.2 mF, 25 g DNA/6 10 COS1 cells; 72 h), and liposome-aided ␮ ϫ 5 the constructs rIi spacer 1 and rIi spacer 2, the oligonucleotides coding for transfer (1 g DNA/5 10 COS7 cells; 48 h) as described (35–37). MOMP and for PBSite were inserted in the inverse orientation, thereby Metabolic radiolabeling of proteins and immunoprecipitation encoding a nonrelated sequence with the same number of aa. Oligonucle- otides encoding aa 17–31 of the inﬂuenza virus matrix protein (MAT) After incubation of cells for1hat37°C in methionine-free RPMI 1640, sequence were introduced into genomic Ii DNA. The small fragment be- newly synthesized proteins were labeled for 10 min with 50 ␮Ci [35S]me- tween the restriction sites HindIII (bp 4717 in exon 2) and NcoI (bp 4945 thionine (Amersham, Braunschweig, Germany) in methionine-free RPMI in exon 3) was replaced by the oligonucleotides AGCTTTCGGGCCC (supplemented with 10% dialysed FCS, 1 mM sodium pyruvate, 2 mM G GCTGAAGGCGGAGATC /ACGCAGCGCCTCGAGGACGTGTC. This glutamine, and 10 mM HEPES). The cells were lysed with 1% Nonidet resulted in replacement of aa 81–101 of Ii by MAT aa 17–31, with alanine P-40 in Tris-buffered saline in the presence of protease inhibitors (1 ␮M or threonine at residue 89 of rIiMAT. PMSF and 0.024 trypsin inhibitor units of aprotinin per ml). Lysates were

FIGURE 2. Schematic representation of recombinant Ii constructs. The cDNA/genomic DNA fusion construct encoding the Ii deletion mutant ⌬Ii81-127 lacks exon 3 and part of exon 4. The deletion mutant was used for the generation of MOMP and PBSite derivatives. Restriction sites that were used for cloning procedures are indicated. Oligonucleotides encoding MOMP, PBSite (PBS), and unrelated sequences of the same length (spacer 1 and spacer 2) were cloned into the HindIII site. In the Ii DNA, a HindIII/NcoI fragment was replaced by sequences encoding MAT A or MAT T. In these mutants, the two N-linked glycan sites of Ii are preserved. The expressed rIi products are shown schematically. Exon boundaries are indicated by vertical lines. Inserted antigenic sequences are indicated in black and the spacer regions as strips. The transmembrane region is shown by diagonal strips. The positions of N-glycosylation sites are indicated by asterisks. The Journal of Immunology 3357

FIGURE 3. A chimeric TFR is coprecipitated with DR molecules. A, A DNA fragment encoding aa 80–139 of Ii was inserted into the cDNA of the human TFR. This sequence contains the CBS and the recognition site for mAb P4H5. A schematic presentation of the resulting TFR-CBS protein is shown. The segment containing the CBS is black, and diagonal strips label the transmembrane region. Asterisks indicate the positions of N-glycosylation sites. The Ii segment in TFR-CBS is 107 aa from the transmembrane domain, compared with 22 aa in Ii. B, COS1 cells were transiently transfected with DR3 cDNAs and with Ii, TFR, or TFR-CBS as indicated. Cells were biosynthetically labeled, lysed, and immunoprecipitated with mAbs shown below the lanes: DR (ISCR3 and I251SB), TFR (PA1), and Ii (P4H5). Precipitates were subjected to 10 to 15% gradient SDS-PAGE analysis under reducing conditions. The ␣ ␤ migration of a m.w. markers (Mr) is marked on the left in kDa. The positions of TFR-CBS, TFR, DR ,DR , and Ii are indicated on the right.

precleared by a 2-h incubation with Sepharose CL4B. To reduce back- proteins were separated according to their charge using 4% polyacrylamide ground in some experiments, the lysates were first adjusted to pH 5 by the rod gels (first dimension). The rod gels were then incubated for2hin addition of acetic acid. Acid-precipitated proteins were spun down by cen- reducing sample buffer. In the second dimension, the proteins were sepa- trifugation. The supernatant was neutralized and further cleared by addition rated according to molecular mass in 13% SDS-polyacrylamide gels. of Sepharose CL4B. mAbs used for immunoprecipitation were PA1 (␣TFR, a gift from Dr. G. Moldenhauer, Heidelberg, Germany), P4H5 (␣-Ii peptide RPMSMDNMLLGPVKNVTK; Ref. 38), VicY1 (␣-human Results Ii; Ref. 39), In1 (␣-murine Ii; Ref. 40), ISCR3, and I251SB (␣-HLA-DR Transfer of a class II binding Ii segment to the TFR chains; Refs. 41 and 42) For immunoprecipitation, mAbs were added to the cell lysates in the presence of 10 ␮l protein A-Sepharose CL4B. After In an attempt to localize contact sites of Ii that stabilize the inter- overnight incubation, precipitates were washed three times in 0.25% Non- action of the groove-binding segment to class II polypeptides, we idet P-40 in Tris-buffered saline (pH 6.8). inserted a sequence of Ii that contains the previously identified CBS to the luminal domain of another type II membrane protein, Gel electrophoresis the TFR. The segment of the Ii cDNA encoding aa 80–139 was Immunoprecipitates were boiled in reducing sample buffer for 4 min and ligated into the TFR cDNA (Fig. 3A). This Ii sequence contains the analyzed on 10 to 15% SDS polyacrylamide gradient gels or 13% SDS CBS (aa 81–109) and an adjacent stretch of 30 aa that provides an polyacrylamide gels (17). For two-dimensional nonequilibrated pH gradient electrophoresis (NEPHGE), protein A-Sepharose pellets were incu- epitope recognized by the mAb P4H5. This recombinant TFR-CBS bated for1hatroom temperature in NEPHGE sample buffer (9.5 M urea, forms S-S-linked dimers, and its N-linked glycan side chains ac- 2% Nonidet P-40, 2% ampholines (pH 3.5–10), and 50 mM DTT), and the quire Endo H resistance upon intracellular transport (G. Reuter and 3358 PROMISCUOUS BINDING SITE OF INVARIANT CHAIN

N. Koch, unpublished observations). To explore the binding properties of the recombinant TFR to HLA-DR molecules, various combinations of TFR-CBS, TFR, and Ii constructs were transiently coexpressed with DR␣ and -␤ cDNAs in COS cells (Fig. 3B). Since some DR allotypes were reported to bind TFR-derived sequences, we used the DR3 allele, because no TFR peptides had been eluted from this allotype (43). Cells were radiolabeled, lysed, and immunoprecipitated with mAbs specific for DR, TFR, or Ii. The mAb against TFR immunoprecipitates TFR and TFR-CBS (Fig. 3B). The 60-aa Ii segment increases the size of TFR-CBS compared with TFR. The Ii-specific mAb P4H5 does not bind to TFR, but immunoisolates TFR-CBS. This demonstrates that the Ii segment is positioned in a site accessible for the mAb P4H5. Im- munoprecipitates of DR molecules reveal that large amounts of TFR-CBS, similar to the amounts of Ii in the first lane, are coisolated. Precipitation with Ii or TFR Abs do not exhibit class II bands, because the TFR-CBS is in large excess. This result is also obtained with wild-type Ii (data not shown). Coprecipitation of TFR-CBS with DR indicates that the Ii segment aa 80–139 endows class II binding properties. The rest of Ii appears to be dispensable for interaction to DR molecules. This demonstrates that the Ii segment aa 80–139 alone is sufficient for productive association with MHC class II molecules. The association may be due to the groove-binding sequence alone, or additional sequences may stabilize the Ii/class II groove interaction. An N-terminal deletion of the class II binding sequence of Ii abrogates association with class II molecules FIGURE 4. Deletion of aa 80–93 in Ii abrogates association with DR We studied whether the sequences flanking the groove-binding molecules. A, Ii deletion constructs were generated by digesting human Ii segment (aa 91–99) influence Ii/class II association. With two cDNA with restriction endonucleases FspI(⌬Ii80-93) or NcoI(⌬Ii105- available restriction sites, sequences adjacent to the groove-bind- 157), followed by religation. The CBS-containing segment is shown in ing segment of Ii were deleted (Fig. 4A). In ⌬Ii80-93, the truncated black, and the transmembrane region is marked by bars. Asterisks indicate anchor positions Met91 and Met93, in addition to the deleted aa the positions of N-glycosylation sites. B, Two-dimensional separation (NEPHGE/SDS-PAGE) of Ii (left) and DR (right) immunoprecipitates. 80–90, could impair binding to class II dimers. The deletion in ⌬ COS1 cells were cotransfected with DR3 cDNAs and the human Ii cDNA Ii105-157 starts exactly beyond the sequence of CLIP (aa 81– (top), ⌬Ii80-93 (middle), or ⌬Ii105–157 (bottom). Cells were radiolabeled ⌬ ⌬ 104). Ii80-93 or Ii105-157 was coexpressed with DR cDNAs and lysed. DR was immunoprecipitated with mAbs ISCR3 and I251SB; and immunoprecipitated with anti-Ii or anti-DR mAbs. Since mAb VicY1 was used for isolation of Ii. Positions of Ii derivatives are ⌬Ii80-93 comigrates with the DR ␤-chain in one-dimensional marked by arrowheads; DR chains are indicated by ␣ and ␤, respectively. SDS-PAGE, the immunoprecipitates were analyzed in two-dimen- The position of ⌬Ii80-93 in the DR precipitates was determined by com- sional NEPHGE/SDS-PAGE (Fig. 4B). The anti-Ii immunopre- parison with the Ii precipitates (left) and is indicated by an open circle. cipitates show that the recombinant Ii and wild-type Ii are expressed at a high level. Class II is not detected because of the excess of Ii. DR precipitates reveal that wild-type Ii is coprecipi- (Fig. 5A, left) (17). Ii immunoprecipitates show that the Ii deriv- tated (Fig. 4B, top), whereas ⌬Ii80–93 is not detected in DR pre- atives were strongly expressed (Fig. 5A, right). Ii precipitates usu- cipitates (Fig. 4B, middle). This result was verified by endoglyco- ally do not show class II bands. To examine the specificity of aa sidase H digestion and one-dimensional separation of the 81–87 binding, a construct with an unrelated spacer sequence of immunoprecipitates, in which ⌬Ii80-93 and DR␤ have different the same length (rIi spacer 2) was generated. Transient expression m.w.s according to the differing number of digested N-glycan side with DR1 and immunoprecipitation with anti-DR Abs revealed chains (data not shown). In contrast to the recombinant Ii lacking that rIi spacer 2 did not bind to class II dimers, which supports the aa 80–93, the mutant ⌬Ii105-157 is coisolated with MHC class II specific binding of rIi PBSite to DR molecules. This result indi- molecules from cotransfectants (Fig. 4B, bottom). cates that aa 81–87 mediate binding of an Ii mutant, which lacks the groove-binding segment, to class II molecules. A sequence adjacent to the groove-binding segment of Ii The important question now was whether rIi PBSite binds to mediates promiscuous binding of Ii to class II molecules other DR allotypes. rIi PBSite was coexpressed with DR3 or DR4 The lack of association of ⌬Ii80-93 to DR molecules could suggest dimers. Class II immunoprecipitates show that rIi PBSite also as- that residues N-terminal to the groove-binding motif of Ii are im- sociates with DR3 and DR4 molecules (Fig. 5, B and C). Again, portant for the association with MHC class II molecules. We in- ⌬Ii81-127 did not coprecipitate with DR. This result demonstrates vestigated whether in the absence of the groove-binding segment promiscuous binding of rIi PBSite to three DR allotypes. reintroduction of N-terminal residues would restore binding to class II. Fig. 2 shows a schematic representation of a recombinant Class II binding of a mutant Ii is mediated by an antigenic Ii (rIi PBSite) in which aa 81–87 were introduced into ⌬Ii81-127. sequence These two deletion constructs and DR cDNAs were coexpressed in Ii thus appears to harbor a promiscuous allotype-independent site COS cells. rIi PBSites was coprecipitated with DR1; while con- in addition to an allotype-dependent class II binding site. Allotype- sistent with our previous results, ⌬Ii81-127 could not be coisolated dependent binding of CLIP has been demonstrated, but a basis for The Journal of Immunology 3359

FIGURE 6. Coisolation of rIi MOMP with DR3 molecules. COS7 cells were transiently transfected with vectors encoding DR3 and the indicated wild-type or mutant Ii. Radiolabeled DR (mAbs ISCR3 and I251SB) and Ii (mAb In1) immunoprecipitates were isolated and resolved by 13% SDS-

PAGE. Molecular weight markers (Mr) are separated (left), and positions of DR␣,DR␤, Ii, and rIi are marked by arrows (right). The increased mobility of rIi (21 kDa) is explained by the lack of two N-bound glycan site chains compared with the wild-type Ii (31 kDa).

the allotype-independent binding of Ii has not been defined. To monitor DR allele-specific binding of Ii, we introduced antigenic sequences into ⌬Ii81-127. At first, we studied whether association of a rIi, with the groove-binding segment replaced by an antigenic sequence, to DR dimers is possible. The sequence of MOMP, QASLALSYRLNMFTP, binds to DR3 (44). ⌬Ii81-127 lacking the CBS was used to introduce the sequence of MOMP (compare Figs. 1 and 2). Coexpression of this chimeric Ii with DR3 molecules and subsequent immunoisolation of DR molecules show coisolation of rIi MOMP (Fig. 6). As a control, rIi spacer 1, with an unrelated sequence of the same length as MOMP, does not coprecipitate with DR3. Immunoprecipitation of Ii indicates equivalent expression of both rIi. Class II is not detected in the Ii precipitates.

Allotype-dependent class II binding of chimeric Ii with the CBS replaced by MAT To determine allotype-dependent binding, we introduced the sequence of MAT into Ii. MAT is a peptide comprising aa 17–31 of influenza virus matrix protein. The MAT peptide 17SGPLKAE- IAQRLEDV31 has been shown to bind to DR1, while the A in position 25 replaced by a T leads to binding to DR4 (45). Both sequences were cloned into ⌬Ii81-101 (Figs. 1 and 2) and expressed in COS cells with either DR1 or DR4 (Fig. 7). Immuno- precipitation demonstrates that rIi MAT A is coprecipitated with DR1, whereas the mutation of Ala25 to Thr almost completely abrogates binding to DR1. Conversely, rIiMAT T binds to DR4, whereas rIi MAT A does not. This shows that the binding of the rIi FIGURE 5. In the absence of the groove-binding segment of Ii, the MAT constructs is DR allele specific and that an allotype-inde- sequence aa 81–87 restores binding to different DR allotypes. COS1 cells pendent binding sequence is missing in these constructs. The ex- were transfected, radiolabeled, lysed, and immunoprecipitated with mAbs pression of the recombinant Ii is similar in all samples (Fig. 7, specific for DR (ISCR3 and I251SB) and against Ii (In1). DR (left)orIi bottom). Class II is not visible in Ii precipitates. (right) immunoprecipitates from COS1 transfectants expressing various combinations of DR1 (A), DR3 (B), or DR4 (C) and Ii, ⌬Ii81-127, rIi Discussion PBSite, or rIi spacer 2 are shown. In lane ␾, DR without Ii was transfected. Positions of the DR ␣- and ␤-chains and the Ii derivatives are indicated on Several pieces of data indicate that Ii and CLIP bind with the same the right. Migration of m.w. markers (Mr) is shown on the left. sequence to MHC class II dimers. The observation that both CLIP 3360 PROMISCUOUS BINDING SITE OF INVARIANT CHAIN

whereas the binding of CLIP differed according to the individual allotypes (47). These authors in addition reported that the groove- binding peptide inhibits binding of antigenic peptides. In contrast, the Ii76-91 peptide enhances binding of two different HEL peptides. Peptides containing aa 81–87 of Ii possibly bind to the ␣1 domain of MHC class II dimers, as their binding site seems to overlap with the Staphylococcus enterotoxin B contact region (48, 49). The interactions of these Ii-derived peptides and of intact Ii with class II seem to involve the same class II domain, as the peptide binding can be inhibited by soluble Ii (49). Possible contact residues on the ␣1 domain were suggested to be Asp17, Glu21, and/or Asp35 of DR (48). These residues were proposed to interact with Lys83 and/or Lys86 of human Ii. These residues are highly conserved between mice and humans, and there are putative acidic counterparts for the lysine residues in the ␣1 domain of H2-A, H2-E, DR, DP, and DQ. The interaction of these class II residues with the lysine-rich PBSite could thus have a stabilizing effect on Ii binding irrespective of the class II allele. A binding domain containing residues 81–87 of Ii might not be formed by a peptide of the same sequence. This could explain why a strong binding of the free peptide to class II molecules was not observed (48). The aa 81–87 sequence could be part of a larger motif that is destroyed by Ii degradation. Presumably, there are several contact sites of Ii and class II in ␣␤ the ( Ii)3 complex. A recombinant, soluble Ii lacking the N- terminal part up to aa 117 augmented antigenic peptide binding of FIGURE 7. DR allotype-specific binding of rIi MAT. rIi were coex- DR dimers, suggesting that the C-terminal part of Ii also interacts pressed with DR1 or DR4 molecules in COS7 cells. Analysis of radiola- with class II molecules (24). Recently, it was shown that the mem- beled immunoprecipitates was performed with mAbs ISCR3 and I251SB brane-proximal region and the sequence from which CLIP is de- (DR) and In1 (Ii). The upper part exhibits DR immunoprecipitates, and in rived are extended in the Ii trimer (50). This open structure could the lower part, Ii immunoprecipitates of the same cell lysates are shown. allow binding to the class II groove. Our result that aa 80–139 of Molecular weight markers are separated on the left, and the positions of Ii fused into the TFR sequence 107 aa from the transmembrane ␣ ␤ DR ,DR , and rIi are indicated on the right. domain permits binding to class II polypeptides suggests that this open structure is retained in the TFR-CBS. Presumably other sequences of Ii are not essential for class II interaction. and an Ii degradation product containing the CBS can stimulate the The interaction between class II and aa residues 81–87 of the same T cell clone argues that in the intact protein, Ii interacts with class II in much the same way as the peptide (25). However, the CBS suggests how Ii release could be controlled. The acquisition binding characteristics of CLIP and the CBS of Ii show one major of peptides by class II dimers is postponed until a final step of Ii difference. The strength of the interaction of CLIP with individual degradation, when the CLIP sequence is proteolytically separated allotypes varies up to four orders of magnitude (26). Affinity mea- from the highly conserved 22 aa between the transmembrane do- surements for the association of Ii with various MHC class II al- main and the CBS. The stepwise release of Ii from MHC class II leles are not available. However, if binding differences of this or- molecules is initiated by cleavage at a position C-terminal to the der existed, they should have been detected in biochemical studies groove-binding motif (51). The Ii fragment LIP is still associated of class II/Ii interaction. Thus, the nonameric complex of class II with class II dimers (52) and might dissociate from the nonameric and Ii probably bears additional contact sites that stabilize the in- complex. The trimer could be more accessible to proteases and to teraction between Ii and class II molecules. We report here that the HLA-DM than the nonamer (28). If LIP is not removed by DM, sequence comprising aa 81–87 (PKSAKPV) is important for bind- further cleavage at residues 80–87 and C-terminal trimming of the ing of a recombinant Ii protein to class II polypeptides. Despite the fragment yields CLIP bound to MHC class II dimers. This degra- absence of the groove-binding segment, rIi PBSite shows promis- dation step might impair interactions of the proline-lysine-rich mo- cuous binding to three DR alleles. In particular, HLA-DR4, which tif of CLIP with class II polypeptides. The allotype-dependent possesses only moderate binding capacities for CLIP (22), binds binding of aa 91–99 then could determine whether accessory mol- efficiently to rIi PBSite. The PBSite of Ii may compensate for the ecules such as HLA-DM are necessary for CLIP release. allele-regulated interaction of aa 91–99 with polymorphic residues The promiscuous binding of Ii to class II molecules may facil- of the class II pockets. The proximity of the PBSite to the groove- itate the assembly of the nonameric class II/Ii complex in the en- binding motif could be of particular importance for stabilization of doplasmic reticulum and could postpone the binding of antigenic the class II cleft. A stabilizing effect of elongations of sequences sequences to MHC class II vesicles. In this compartment, CLIP accommodated within the class II groove has previously been governs the acquisition of peptides by class II dimers as has been shown for antigenic peptides. The elongation of synthetic HEL demonstrated with H2-M-deficient mice (53–55). It remains to be peptides at either end of the core region increases the stability of shown whether CLIP modulates an immune response as a conse- the class II/peptide complex, an N-terminal elongation being par- quence of the MHC polymorphism. ticularly effective (46). Positioning of an antigenic sequence into Ii might be useful for Consistent with our findings, almost identical binding charac- raising cellular vaccines. A similar strategy recently was described teristics were found for the Ii76-91 peptide to four murine alleles, (56). In this report, a T cell epitope from hemagglutinin was used The Journal of Immunology 3361 for insertion into Ii beyond aa 90. This construct contains the 18. Bijlmakers, M-J., E. P. Benaroch, and H. Ploegh. 1994. Mapping functional re- PBSite that we identified. A transfectant containing this chimeric gions in the lumenal domain of the class II-associated invariant chain. J. Exp. Med. 180:623. Ii was efficiently recognized by a hemagglutinin-specific T cell 19. Romagnoli, P., and R. N. Germain. 1994. The CLIP region of invariant chain clone. By comparison, we introduced the antigenic sequence of plays a critical role in regulating major histocompatibility complex class II fold- MAT into an Ii deletion mutant that lacks the PBSite and obtained ing, transport, and peptide occupancy. J. Exp. Med. 180:1107. DR allotype-dependent binding of MAT to class II molecules. This 20. Rammensee, H.-G., T. Friede, and S. Stevanovic. 1995. MHC ligands and peptide result suggests binding of the recombinant MAT to the class II motifs: first listing. Immunogenetics 41:178. 21. Ghosh, P., M. Amaya, E. Mellins, and D. C. Wiley. 1995. The structure of an peptide-binding groove. Our finding that an Ii sequence adjacent to intermediate in class II MHC maturation: CLIP bound to HLA-DR3. Nature the groove-binding segment stabilizes binding of Ii to class II mol- 378:457. ecules is consistent with a recent publication (57). In this report, 22. Avva, R. R., and P. Cresswell. 1994. In vivo and in vitro formation and disso- antigenic sequences introduced into Ii mediate resistance of the ciation of HLA-DR complexes with invariant chain-derived peptides. Immunity 1:763. DR1/Ii complex to SDS treatment. This result is consistent with 23. Riberdy, J. M., R. R. Avva, H. J. Geuze, and P. Cresswell. 1994. Transport and binding of the antigenic sequence into the peptide binding cleft of intracellular distribution of MHC class II molecules and associated invariant class II molecules. chain in normal and antigen-processing mutant cell lines. J. Cell. Biol. 125:1225. 24. Park, S.-J., S. Sadegh-Nasseri, and D. C. Wiley. 1995. Invariant chain made in Escherichia coli has an exposed N-terminal segment that blocks antigen binding Acknowledgments to HLA-DR1 and a trimeric C-terminal segment that binds empty HLA-DR1. Proc. Natl. Acad. Sci. USA 92:11289. We thank Drs. O. Bakke, J. Miller, and H. Ploegh for providing cDNAs 25. Morkowski, S., A. W. Goldrath, S. Eastman, L. Ramachandra, D. C. Freed, and vectors; A. Ko¨nig for excellent technical assistance; and Drs. P. Glee- P. Whiteley, and A. Y. Rudensky. 1995. T cell recognition of major histocom- son, R. Lindner, F. Sanderson, and J. Trowsdale for critical discussions. patibility complex class II complexes with invariant chain processing intermedi- ates. J. Exp. Med. 182:1403. 26. Sette, A., S. Southwood, J. Miller, and E. Appella. 1995. Binding of major histocompatibility complex class II to the invariant chain-derived peptide, CLIP, is References regulated by allelic polymorphism in class II. J. Exp. Med. 181:677. 1. Stockinger, B., U. Pessara, R. H. Lin, J. Habicht, M. Grez, and N. Koch. 1989. 27. Denzin, L. K., N. F. Robbins, C. Carboy-Newcomb, and P. Cresswell. 1994. A role of Ia-associated invariant chains in antigen processing and presentation. Assembly and intracellular transport of HLA-DM and correction of the class II Cell 56:683. antigen processing defect in T2 cells. Immunity 1:595. 2. Viville, S., J. Neefjes, V. Lotteau, A. Dierich, M. Lemeur, H. Ploegh, C. Benoist, 28. Denzin, L. K., and P. Cresswell. 1995. HLA-DM induces CLIP dissociation from and D. Mathis. 1993. Mice lacking the MHC class II-associated invariant chain. MHC class II ␣␤ dimers and facilitates peptide loading. Cell 82:155. Cell 72:635. 29. Sherman, M. A., D. A. Weber, and P. E. Jensen. 1995. DM enhances peptide 3. Bikoff, E. K., L. Y. Huang, V. Episkopou, J. van Meerwijk, R. N. Germain, and binding to class II MHC by release of invariant chain-derived peptide. Immunity E. J. Robertson. 1993. Defective major histocompatibility complex class II as- 3:197. sembly, transport, peptide acquisition, and CD4ϩ T cell selection in mice lacking invariant chain expression. J. Exp. Med. 177:1699. 30. Malcherek, G., V. Gnau, G. Jung, H.-G. Rammensee, and A. Melms. 1995. Su- 4. Naujokas, M. F., L. S. Arneson, B. Fineschi, M. E. Peterson, S. Sitterding, permotifs enable natural invariant chain-derived peptides to interact with many A. T. Hammond, C. Reilly, D. Lo, and J. Miller. 1995. Potent effects of low levels major histocompatibility complex-class II molecules. J. Exp. Med. 181:527. of MHC class II-associated invariant chain on CD4ϩ T cell development. Im- 31. Stebbins, C. C., G. E. Loss, Jr., C. G. Elias, A. Chervonsky, and A. J. Sant. 1995. munity 3:359. The requirement for DM in class II-restricted antigen presentation and SDS- 5. Shachar, I., E. A. Elliott, B. Chasnoff, I. S. Grewal, and R. A. Flavell. 1995. stable dimer formation is allele and species dependent. J. Exp. Med. 181:223. Reconstitution of invariant chain function in transgenic mice in vivo by individ- 32. Roche, P. A. 1995. HLA-DM: an in vivo facilitator of MHC class II peptide ual p31 and p41 isoforms. Immunity 3:373. loading. Immunity 3:259. 6. Takaesu, N. T., J. A. Lower, E. J. Robertson, and E. K. Bikoff. 1995. Major ϩ 33. Glimcher, L. H., B. S. Polla, A. Poljak, C. C. Morton, and D. J. McKean. 1987. histocompatibility class II peptide occupancy, antigen presentation, and CD4 T Murine class II (Ia) molecules associate with human invariant chain. J. Immunol. cell function in mice lacking the p41 isoform of invariant chain. Immunity 3:385. 138:1519. 7. Bakke, O., and B. Dobberstein. 1990. MHC class II-associated invariant chain 34. Okyama, H., and P. Berg. 1983. A cDNA cloning vector that permits expression contains a sorting signal for endosomal compartments. Cell 63:707. of cDNA inserts in mammalian cells. Mol. Cell. Biol. 3:280. 8. Lotteau, V., L. Teyton, A. Pelereaux, T. Nilsson, L. Karlsson, S. L. Schmid, V. Quaranta, and P. A. Peterson. 1990. Intracellular transport of class II MHC 35. Cullen, B. R. 1987. Use of eukaryotic expression technology in the functional molecules directed by invariant chain. Nature 348:600. analysis of cloned genes. Methods Enzymol. 152:684. 9. Lamb, C. A, J. W. Yewdell, J. R. Bennink, and P. Cresswell. 1991. Invariant 36. Chu, G., H. Hayakawa, and P. Berg. 1987. Electroporation for the efficient trans- chain targets HLA class II molecules to acidic endosomes containing internalized fection of mammalian cells with DNA. Nucl. Acids Res. 15:1311. influenza virus. Proc. Natl. Acad. Sci. USA 88:5998. 37. Rose, J. K., L. Bionocore, and M. A. Whitt. 1991. A new cationic liposome 10. Mellman, I., P. Pierre, and S. Amigorena. 1995. Lonely MHC molecules seeking reagent mediating nearly quantitative transfection of animal cells. Biotechniques immunogenic peptides for meaningful relationships. Curr. Opin. Cell Biol. 7:564. 10:520. 11. Anderson, M. S., and J. Miller. 1992. Invariant chain can function as a chaperone 38. Mehringer, J. H., M. R. Harris, C. S. Kindle, D. W. McCourt, and S. E. Cullen. protein for class II major histocompatibility complex molecules. Proc. Natl. 1991. Characterization of fragments of the murine Ia-associated invariant chain. Acad. Sci. USA 89:2282. J. Immunol. 146:920. 12. Bikoff, E. K., R. N. Germain, and E. J. Robertson. 1995. Allelic differences 39. Quaranta, V., O. Majdic, G. Stingl, K. Liszka, H. Honigsmann, and W. Knapp. affecting invariant chain dependency of MHC class II subunit assembly. Immu- nity 2:301. 1984. A human Ia cytoplasmic determinant located on multiple forms of invariant chain. J. Immunol. 132:1900. 13. Schaiff, W. T., K. A. Hruska, D. W. McCourt, M. Green, and B. D. Schwartz. 1992. HLA-DR associates with specific stress proteins and is retained in the 40. Koch, N., S. Koch, and G. J. Ha¨mmerling. 1982. Ia-invariant chain detected on endoplasmic reticulum in invariant chain negative cells. J. Exp. Med. 176:657. the lymphocyte surfaces by monoclonal antibody. Nature 299:644. 14. Germain, R. N., and A. G. Rinker, Jr. 1993. Peptide binding inhibits protein 41. Watanabe, M., T. Suzuki, M. Taniguchi, and N. Shinohara. 1983. Monoclonal aggregation of invariant-chain free class II dimers and promotes surface expres- anti-Ia murine alloantibodies cross-reactive with the Ia-homologues of other spe- sion of occupied molecules. Nature 363:725. cies including human. Transplantation 36:712. 15. Bonnerot, C., M. S. Marks, P. Cosson, E. J. Robertson, E. K. Bikoff, 42. Pesando, J. M., and L. Graf. 1986. Differential expression of HLA-DR, -DQ, and R. N. Germain, and J. S. Bonifacino. 1994. Association with BiP and aggregation -DP antigens on malignant B cells. J. Immunol. 136:4311. of class II MHC molecules synthesized in the absence of invariant chain. EMBO 43. Chicz, R. M., R. G. Urban, J. C. Gorga, D. A. A. Vignali, W. S. Lane, and J. 13:934. J. L. Strominger. 1993. Specificity and promiscuity among naturally processed 16. Elliott, E. A., J. R. Drake, S. Amigorena, J. Elsemore, P. Webster, I. Mellman, peptides bound to HLA-DR alleles. J. Exp. Med. 178:27. and R. A. Flavell. 1994. The invariant chain is required for intracellular transport and function of major histocompatibility complex class II molecules. J. Exp. Med. 44. Riberdy, J. M., and P. Cresswell. 1992. The antigen-processing mutant T2 sug- 179:681. gests a role for MHC-linked genes in class II anigen presentation. J. Immunol. 17. Freisewinkel, I. M., K. Schenck, and N. Koch. 1993. The segment of invariant 148:2586. chain that is critical for association with major histocompatibility complex class 45. Hammer, J., P. Valsasnini, K. Tolba, D. Bolin, J. Higelin, J. Takacs, and II molecules contains the sequence of a peptide eluted from class II polypeptides. F. Sinigaglia. 1993. Promiscuous and allele-specific anchors in HLA-DR binding Proc. Natl. Acad. Sci. USA 90:9703. peptides. Cell 74:197. 3362 PROMISCUOUS BINDING SITE OF INVARIANT CHAIN

46. Nelson, C. A., S. J. Petzold, and E. R. Unanue. 1993. Identification of two distinct 52. Newcomb, J. R., and P. Cresswell. 1993. Structural analysis of proteolytic prod- properties of class II major histocompatibility complex-associated peptides. Proc. ucts of MHC class II-invariant chain complexes generated in vivo. J. Immunol. Natl. Acad. Sci. USA 90:1227. 151:4153. 47. Adams, S., and R. E. Humphreys. 1995. Invariant chain peptides enhancing or 53. Miyazaki, T., P. Wolf, S. Tourne, C. Waltzinger, A. Dierich, N. Barois, inhibiting the presentation of antigenic peptides by major histocompatibility com- H. Ploegh, C. Benoist, and D. Mathis. 1996. Mice lacking H2-M complexes, plex class II molecules. Eur. J. Immunol. 25:1693. enigmatic elements of the MHC class II peptide-loading pathway. Cell 84:531. 48. Kropshofer, H., A. B. Vogt, and G. J. Ha¨mmerling. 1995. Structural features of 54. Martin, W. D., G. G. Hicks, S. K. Mendiratta, H. I. Leva, H. E. Ruley, and the invariant chain fragment CLIP controlling rapid release from HLA-DR mol- L. Van Kaer. 1996. H2-M mutant mice are defective in the peptide loading of ecules and inhibition of peptide binding. Proc. Natl. Acad. Sci. USA 92:8313. class II molecules, antigen presentation, and T cell repertoire selection. Cell 84: 49. Vogt, A. B., L. J. Stern, C. Amshoff, B. Dobberstein, G. J. Ha¨mmerling, and 543. H. Kropshofer. 1995. Interference of distinct invariant chain regions with super- antigen contact area and antigenic peptide binding groove of HLA-DR. J. Im- 55. Fung-Leung, W.-P., C. D. Surh, M. Liljedahl, J. Pang, D., Leturcq, munol. 155:4757. P. A. Peterson, S. R. Webb, and L. Karlsson. 1996. Antigen presentation and T 50. Jasanoff, A., S-J. Park, and D. C. Wiley. 1995. Direct observation of disordered cell development in H2-M-deficient mice. Science 271:1278. regions in the major histocompatibility complex class II-associated invariant 56. van Bergen, J., S. P. Schoenberger, F. Verreck, R. Amons, R. Offringa, and chain. Proc. Natl. Acad. Sci. USA 92:9904. F. Koning. 1997. Efficient loading of HLA-DR with a T helper epitope by genetic 51. Blum, J. S., and P. Cresswell. 1988. Role for intracellular proteases in the pro- exchange of CLIP. Proc. Natl. Acad. Sci. USA 94:7499. cessing and transport of class II HLA antigens. Proc. Natl. Acad. Sci. USA 85: 57. Stimptner, P., and P. Benaroch. 1997. Interaction of MHC class II molecules with 3975. the invariant chain: role of the invariant chain (81–90) region. EMBO J. 16:5807.