Class II Allotypes Promiscuous Binding of Invariant Chain to MHC

Class II Allotypes Promiscuous Binding of Invariant Chain to MHC

Identification of a Sequence That Mediates Promiscuous Binding of Invariant Chain to MHC Class II Allotypes1 Ina M. Siebenkotten, Cornelia Carstens, and Norbert Koch2 The invariant chain (Ii) shows promiscuous binding to a great variety of MHC class II allotypes. In contrast, the affinities of the Ii-derived fragments, class II-associated Ii peptides, show large differences in binding to class II allotypes. The promiscuous association of Ii to all class II polypeptides therefore requires an additional contact site to stabilize the interaction to the poly- morphic class II cleft. We constructed recombinant molecules containing the class II binding site of Ii (CBS) and tested their association with HLA-DR dimers. The CBS fused to the transferrin receptor mediates binding of transferrin receptor-CBS to class II dimers. Within the CBS, deletion of a sequence N-terminal to the groove-binding motif abolished binding of Ii to DR. A promiscuous class II binding site was identified by reinsertion of the N-terminal residues, amino acids 81–87, of Ii into an Ii mutant that lacks the groove-binding segment. DR allotype-dependent association of Ii was achieved by insertion of antigenic sequences. The promiscuous association, in contrast to the class II allotype-dependent binding of Ii, is important to prevent interaction of class II dimers to nascent polypeptides in the endoplasmic reticulum. The Journal of Immunology, 1998, 160: 3355–3362. he first indication that the invariant chain (Ii)3 plays a groove, whereas the N terminus of the Ii fragment is disordered in functional role in Ag processing was obtained with Ii- the crystal (21). Studies on proteolytic fragments of Ii suggest that T deficient APCs (1). Analysis of Ii-deficient and Ii31/Ii41 the CBS also binds to the Ag-binding groove of class II dimers and transgenic mice supported this observation and, in addition, re- that CLIP is a naturally occurring degradation intermediate (22– vealed the importance of Ii for the development of CD41 T cells 25). The affinities of CLIP for different MHC allotypes can vary (2–6). In recent years, several molecular functions of Ii have been over several orders of magnitude (26). This could indicate that the identified. A major function of Ii is the targeting of MHC class II affinity of CLIP regulates the binding of antigenic peptides. Re- dimers to the endocytic pathway (7–9). On this route, Ii degrada- lease of CLIP from MHC class II dimers for which it has a high tion controls the acquisition of peptides by class II molecules in affinity requires the accessory molecule HLA-DM (27–29). Allo- specialized loading compartments (reviewed in Ref. 10). In addi- types showing a high off rate for CLIP apparently do not depend tion, association of class II molecules with Ii supports the assembly on the catalytic function of DM for dissociation, although the ac- of MHC class II polypeptides in the endoplasmic reticulum and is quisition of antigenic peptides might be facilitated by DM (30– essential for certain allotypes to form functional ab dimers (2, 11, 32). In these cases, the acidic conditions in the MHC class II load- 12). Peptide-free class II molecules are stabilized by association ing compartments might be sufficient for dissociation. The strong with Ii, and aggregation is prevented (13–16). A segment encoded binding of Ii to different class II allo- and isotypes even across by exon 3 of the Ii gene is indispensable for the formation of the species barriers suggests a highly conserved interaction between Ii MHC class II/Ii complex (17–19). Fragments of processed Ii are and class II dimers (33). Thus, it is conceivable that contacts ad- called class II-associated Ii peptides (CLIP), the sequences of jacent to the polymorphic class II groove are responsible for sta- which are encoded by exon 3. The sequence of CLIP is contained bilizing the binding of Ii to MHC class II molecules. in the class II binding site (CBS) of Ii. CLIP were found associated Here, we demonstrate both allotype-dependent and promiscuous with various MHC class II allotypes (reviewed in Ref. 20). The binding of rIi polypeptides mediated by different Ii sequences to x-ray crystal structure of CLIP bound to HLA-DR3 revealed that MHC class II dimers. A membrane proximal region of Ii mediates a number of residues in the sequence 91–99 (groove binding site) binding to three DR allotypes, whereas the groove-binding seg- interact with specific pockets of the MHC class II peptide-binding ment of Ii replaced by an antigenic sequence leads to allotype- dependent association of class II dimers. Division of Immunobiology, University of Bonn, Bonn, Germany Materials and Methods Received for publication September 15, 1997. Accepted for publication December DNA constructs 5, 1997. The costs of publication of this article were defrayed in part by the payment of page DNAs for transferrin receptor (TFR), rIi, and DR chains were expressed charges. This article must therefore be hereby marked advertisement in accordance under SV40 promoter control in the pcEXV3 or pSV51 expression vector with 18 U.S.C. Section 1734 solely to indicate this fact. (7, 34). For construction of TFR-CBS, bp 237–416 of the murine Ii31 1 This work was supported by the Sonderforschungsbereich 284, Sonderforschungs- cDNA, encoding Ii amino acids (aa) 80–139, was excised by AluI diges- bereich 502 and by the Graduiertenkolleg “Funktionelle Proteindoma¨nen.” N.K. was tion. Maintaining the reading frame, this Ii fragment was inserted into the supported on his sabbatical leave by a grant from the Volkswagenstiftung. Eco47III restriction site at the 585-bp position of the human TFR cDNA. D 2 Address correspondence and reprint requests to Dr. Norbert Koch, Abteilung Im- For construction of the deletion mutant Ii80-93, bp 233 to 272 of the munbiologie, Universita¨t Bonn, Ro¨merstrasse 164, D53117 Bonn, Germany. E-mail human Ii33 cDNA (pSV51-huIi) was removed by digestion with FspI, address: [email protected] followed by religation. In DIi105-157, the segment bp 309 to 465 was excised using NcoI. The cDNA/genomic DNA fusion construct for DIi81- 3 Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated Ii peptides; CBS, class II binding site of Ii; PBSite, promiscuous binding site of Ii; aa, 127 has been described previously (17). QASLALSYRLNMFTP is a pep- amino acids; TFR, transferrin receptor; MOMP, peptide from major outer membrane tide derived from the major outer membrane protein of Chlamydia tracho- protein of C. trachomatis; MAT, peptide from influenza virus matrix protein; matis (MOMP). The aa 81–87 (PKSAKPV) of Ii were designated the NEPHGE, nonequilibrated pH gradient electrophoresis. promiscuous binding site (PBSite). To obtain rIi MOMP, rIi spacer 1, rIi Copyright © 1998 by The American Association of Immunologists 0022-1767/98/$02.00 3356 PROMISCUOUS BINDING SITE OF INVARIANT CHAIN FIGURE 1. Amino acid sequences of the segment aa 70–140 of recombinant Ii. Single aa code is used. Inserted aa are shown in italics. Deleted sequences are indicated by dashes. PBSite, and rIi spacer 2, the aa shown in Figure 1 were introduced in Cell lines and transfections DIi81-127. For construction of rIi MOMP and rIi PBSite, the two oligo- nucleotides 59AGCTTCAAGCAAGTTTGGCTCTCTCTTACAGACT COS1 (CRL-1650; American Type Culture Collection (ATCC), Rockville, GAATATGTTCACTCCCA and 59AGCTTCCGAAATCTGCCAAAC MD) and COS7 (CRL-1651; ATCC) cells were cultivated in high glucose m CTGTGCTGCAGA were hybridized with their complementary strands, DMEM supplemented with 10% FCS, 100 g/ml penicillin, 100 U/ml thereby generating HindIII overlaps, and ligated into the HindIII restriction streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 2 mM L-glu- site of DIi81-127 (at position bp 4717 of the genomic sequence; Fig. 2). tamine. Transient transfections were performed by DEAE-mediated DNA m 3 6 Due to the cloning procedure, there is an additional C-terminal KL and transfer (10 g DNA/3 10 COS1 cells; 24 h), electroporation (210 m 3 6 LQKL that connects MOMP and Ii aa 81–87, respectively, to Ii aa 128. In V/1.2 mF, 25 g DNA/6 10 COS1 cells; 72 h), and liposome-aided m 3 5 the constructs rIi spacer 1 and rIi spacer 2, the oligonucleotides coding for transfer (1 g DNA/5 10 COS7 cells; 48 h) as described (35–37). MOMP and for PBSite were inserted in the inverse orientation, thereby Metabolic radiolabeling of proteins and immunoprecipitation encoding a nonrelated sequence with the same number of aa. Oligonucle- otides encoding aa 17–31 of the influenza virus matrix protein (MAT) After incubation of cells for1hat37°C in methionine-free RPMI 1640, sequence were introduced into genomic Ii DNA. The small fragment be- newly synthesized proteins were labeled for 10 min with 50 mCi [35S]me- tween the restriction sites HindIII (bp 4717 in exon 2) and NcoI (bp 4945 thionine (Amersham, Braunschweig, Germany) in methionine-free RPMI in exon 3) was replaced by the oligonucleotides AGCTTTCGGGCCC (supplemented with 10% dialysed FCS, 1 mM sodium pyruvate, 2 mM G GCTGAAGGCGGAGATC /ACGCAGCGCCTCGAGGACGTGTC. This glutamine, and 10 mM HEPES). The cells were lysed with 1% Nonidet resulted in replacement of aa 81–101 of Ii by MAT aa 17–31, with alanine P-40 in Tris-buffered saline in the presence of protease inhibitors (1 mM or threonine at residue 89 of rIiMAT. PMSF and 0.024 trypsin inhibitor units of aprotinin per ml). Lysates were FIGURE 2. Schematic representation of recombi- nant Ii constructs. The cDNA/genomic DNA fusion construct encoding the Ii deletion mutant DIi81-127 lacks exon 3 and part of exon 4. The deletion mutant was used for the generation of MOMP and PBSite derivatives.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    8 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us