DOCSLIB.ORG

Analysis of the Mechanism of Zhichuanling Oral Liquid in Treating Bronchial Asthma Based on Network Pharmacology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Analysis of the Mechanism of Zhichuanling Oral Liquid in Treating Bronchial Asthma Based on Network Pharmacology Hindawi Evidence-Based Complementary and Alternative Medicine Volume 2020, Article ID 1875980, 10 pages https://doi.org/10.1155/2020/1875980 Research Article Analysis of the Mechanism of Zhichuanling Oral Liquid in Treating Bronchial Asthma Based on Network Pharmacology Ruiyin Wang1,2 and Jiangtao Lin 2 1Graduate School of Beijing University of Chinese Medicine, Beijing, China 2Respiratory and Critical Care Medicine, China-Japan Friendship Hospital, Beijing, China Correspondence should be addressed to Jiangtao Lin; [email protected] Received 17 September 2019; Revised 2 November 2019; Accepted 20 November 2019; Published 17 January 2020 Academic Editor: Hyunsu Bae Copyright © 2020 Ruiyin Wang and Jiangtao Lin. -is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Zhichuanling oral liquid (ZOL) as a preparation of traditional Chinese medicine is widely used for the treatment of asthma in China; therefore, it is necessary to systematically clarify bioactive chemical ingredients and the mechanism of action of ZOL. Information on ZOL ingredients and asthma-related targets was collected, and we used the latest systematic pharmacological methods to construct protein-protein interaction network and compound-target network and then visualized them. Finally, GO and KEGG pathway enrichment analysis was conducted through the clusterProfiler package in the R software. -e results showed that 58 bioactive ingredients and 42 potential targets of ZOL related to asthma were identified, following six important components and nine hub genes screened. Further cluster and enrichment analysis suggested that NF-κB signaling pathway, PI3K/Akt signaling pathway, IL-17 signaling pathway, Toll-like receptor signaling pathway, and TNF signaling pathway might be core pathways of ZOL for asthma. Our work successfully predicted the active ingredients and potential targets of ZOL and provided the explanation for the mechanism of action of ZOL for asthma through the systematic analysis, which suggested that ZOL played a major role in many ways including reducing airway inflammation and inhibiting airway remodeling and mucus secretion. Moreover, ZOL combined with glucocorticoids may have some effects on severe asthma. 1. Introduction Inhaled corticosteroids and long-acting β-receptor ag- onists are the first-line therapy in the treatment of asthma. Bronchial asthma is a chronic airway inflammatory dis- However, some people have poor compliance because of the ease involving a variety of inflammatory cells, inflam- adverse reactions of glucocorticoids, which leads to matory factors, and structural cells, affecting above 300 uncontrol of asthma in this part of population [7] and re- million people in the world [1]. In general, the prevalence peatedly seeks medical help, wasting large medical resources. of asthma is higher in developed countries than in de- Besides, some asthma patients have long-term regular veloping countries, which is a serious public health medications and usually have few symptoms, but there are problem in all ages [2, 3]. Current statistics have shown intermittent or mild asthma attacks [8]. Furthermore, a that the prevalence of asthma in adults was estimated to small number of asthma patients, namely, severe asthma, range from 1.24% in China to 21.0% in Australia, while accounting for 5–10% of the world’s asthma population, still from 3.4% in Albania to 37.6% in Costa Rica in children poorly controlled even with adequate medical treatment, [4, 5]. Furthermore, asthma has been found to correlate and these patients have a higher burden on the health system with work loss, miscalculation, anxiety, and depression, as due to deterioration of asthma and need of repeated hos- public health and clinical management priorities, which pitalization or other additional treatment [9]. has a great impact on people’s life and causes a widespread Traditional Chinese medicine is a comprehensive concern [6]. medicine system with potential utilization value in clinical 2 Evidence-Based Complementary and Alternative Medicine practice in China for thousands of years, which has the been found in the database. We set the indexes of OB ≥ 30% characteristics of multicomponents and multitargets, pre- and DL ≧ 0.18 as the screening criteria for active components senting synergistic effect on many diseases with fewer side [17, 18]. Briefly, components that satisfied the screening effects [10]. Zhichuanling oral liquid (ZOL), mainly com- threshold of OB and DL were regarded as the potential posed of Mahuang, Yangjinhua, bitter almond, and For- components. sythia, has the functions of Xuanfei Pingchuan, relieving cough and removing phlegm. ZOL has obvious antagonistic effects on airway hyperresponsiveness and ventilatory dis- 2.3. ,e Prediction of Putative Targets of the Ingredients. order caused by the cholinergic neurotransmitter acetyl- All the candidate compounds were retrieved in TSMSP choline and mast cell inflammatory mediator histamine, Database and PharmMapper Database (http://59.78.96.61/ relieves bronchial smooth muscle spasm, and improves lung pharmmapper/) to obtain related targets. We downloaded ventilation [11, 12]. Clinical research studies have shown the UniProt table that represented the UniProt Knowl- that ZOL effectively improved clinical symptoms such as edgebase of the potential protein targets that bound with cough and shortness of breath in patients with asthma active components. -en, the Retrieve/ID mapping tool in [13–15]. However, the intrinsic mechanism of ZOL in the UniProt was used to convert proteins into official symbol treatment of asthma has not been elucidated. Given the fact formats of gene targets (http://www.uniprot.org/). that ZOL contains hundreds of compounds and acts on a variety of cellular targets, it is difficult to systematically study 2.4. ,e Prediction of Known ,erapeutic Targets. Genes this mechanism using conventional methods. -erefore, associated with asthma were collected from the GeneCards new methods and strategies such as network pharmacology databases (http://www.genecards.org/), the Online Mende- are urgently needed to address this problem, which eluci- lian Inheritance in Man (OMIM) database (http://www. dates the synergistic effects and the underlying mechanism omim.org/), and NCBI (https://www.ncbi.nlm.nih.gov/ of multicomponents and multitargets [16] and provides gene). We searched for the keywords “asthma” with the other possibilities to understand the interactions among species limited as “Homo sapiens” through the above da- active interactions and relevant targets. tabases. Finally, we obtained asthma-related genes from 184 In this study, a network pharmacology strategy involving targets from OMIM, 607 targets from GeneCards, and 915 drug-likeness evaluation, oral bioavailability prediction, targets from the NCBI. After removing duplicates, 1166 multiple drug target prediction as well as other network genes were collected. Subsequently, asthma-related genes pharmacology techniques was adopted for investigating the were compared with potential gene targets of active com- mechanism of action underlying the effectiveness of ZOL ponents to obtain the potential target genes of ZOL that against asthma. played a major role in asthma. 2. Materials and Methods 2.5. Network Construction. In order to scientifically and 2.1. Chemical Ingredients Database Building. -e chemical reasonably explain the complex relationship between components of Mahuang, Yangjinhua, bitter almond, and asthma-related compounds and targets, network analysis Forsythia were identified from the Traditional Chinese was carried out. -e putative targets of ZOL, the asthma- Medicine Systems Pharmacology (TCMSP, http://lsp.nwu. related targets, and interactional proteins were connected edu.cn/tcmsp.php) database, TCM Database@Taiwan based on the protein-protein interactions (PPI). -en, the (TCMID, http://tcm.cmu.edu.tw/), and literature. TCMSP is drug-compound-target-disease network was constructed a unique systems pharmacology database of Chinese herbal and visualized in the Cytoscape software (version 3.7.1, medicines which captures the herbs, chemicals, targets, and Boston, MA, USA), which illustrated the relationship be- drug-target networks and TCMID is the most compre- tween the possible target of ZOL and the known target of hensive TCM database in the world. asthma. -e PPI network of ZOL acting on asthma was conducted in the string software (http://string-db.org/cgi/ input.pl), with species limited to “Homo sapiens” and a 2.2. Pharmacokinetic Prediction. Oral bioavailability (OB) confidence score ≥0.7, and the results were saved in TSV describes the ratio of the amount absorbed into systemic format and imported into the Cytoscape software to visu- circulation and is a good indicator of the efficiency of oral alize and analyze the interaction network. We used the administration for drug delivery into systemic circulation. Generate style from statistics tool in Cytoscape to set the Drug-like properties (DL) refers to the physical and node size and color settings reflecting the magnitude of the chemical properties, such as solubility, stability, and bio- degree and the thickness of the edge reflecting the size of the logical properties, which is associated with good clinical combined score to obtain the final protein interaction efficacy and has considerable indicative effects in the de- network. “Degree” refers
Load more

Recommended publications
  • Cyclin-Dependent Kinases and Rare Developmental Disorders Pierre Colas
    Colas Orphanet Journal of Rare Diseases (2020) 15:203 https://doi.org/10.1186/s13023-020-01472-y REVIEW Open Access Cyclin-dependent kinases and rare developmental disorders Pierre Colas Abstract Extensive studies in the past 30 years have established that cyclin-dependent kinases (CDKs) exert many diverse, important functions in a number of molecular and cellular processes that are at play during development. Not surprisingly, mutations affecting CDKs or their activating cyclin subunits have been involved in a variety of rare human developmental disorders. These recent findings are reviewed herein, giving a particular attention to the discovered mutations and their demonstrated or hypothesized functional consequences, which can account for pathological human phenotypes. The review highlights novel, important CDK or cyclin functions that were unveiled by their association with human disorders, and it discusses the shortcomings of mouse models to reveal some of these functions. It explains how human genetics can be used in combination with proteome-scale interaction databases to loom regulatory networks around CDKs and cyclins. Finally, it advocates the use of these networks to profile pathogenic CDK or cyclin variants, in order to gain knowledge on protein function and on pathogenic mechanisms. Keywords: CDKs , Cyclins , Developmental disorders , Regulatory networks , Interaction profiling Introduction Overexpression and/or dysfunction of CDKs or cyclins Cyclin-dependent kinases (CDKs) form a family of 20 have been reported in a very large number of human serine/threonine protein kinases that exert pivotal func- cancers and other diverse pathologies. These protein ki- tions in fundamental cellular and molecular processes, nases are thus considered as valuable therapeutic targets such as cell division, migration, senescence, death, gene for drug development.
    [Show full text]
  • TET1 Contributes to Allergic Airway Inflammation and Regulates
    www.nature.com/scientificreports OPEN TET1 contributes to allergic airway infammation and regulates interferon and aryl hydrocarbon Received: 6 July 2018 Accepted: 1 May 2019 receptor signaling pathways in Published: xx xx xxxx bronchial epithelial cells J. D. Burleson1, Dylan Siniard1,2, Veda K. Yadagiri1, Xiaoting Chen3, Matthew T. Weirauch 3,4,5, Brandy P. Ruf1, Eric B. Brandt1, Gurjit K. Khurana Hershey1,5 & Hong Ji1,2,5,6,7 Previous studies have suggested a role for Tet1 in the pathogenesis of childhood asthma. However, how Tet1 contributes to asthma remains unknown. Here we used mice defcient for Tet1 in a well-established model of allergic airway infammation and demonstrated that loss of Tet1 increased disease severity including airway hyperresponsiveness and lung eosinophilia. Increased expression of Muc5ac, Il13, Il33, Il17a, Egfr, and Tf2 were observed in HDM-challenged Tet1-defcient mice compared to Tet1+/+ littermates. Further, transcriptomic analysis of lung RNA followed by pathway and protein network analysis showed that the IFN signaling pathway was signifcantly upregulated and the aryl hydrocarbon receptor (AhR) pathway was signifcantly downregulated in HDM-challenged Tet1−/− mice. This transcriptional regulation of the IFN and AhR pathways by Tet1 was also present in human bronchial epithelial cells at base line and following HDM challenges. Genes in these pathways were further associated with changes in DNA methylation, predicted binding of transcriptional factors with relevant functions in their promoters, and the presence of histone marks generated by histone enzymes that are known to interact with Tet1. Collectively, our data suggest that Tet1 inhibits HDM-induced allergic airway infammation by direct regulation of the IFN and AhR pathways.
    [Show full text]
  • Genetic Background of Ataxia in Children Younger Than 5 Years in Finland E444
    Volume 6, Number 4, August 2020 Neurology.org/NG A peer-reviewed clinical and translational neurology open access journal ARTICLE Genetic background of ataxia in children younger than 5 years in Finland e444 ARTICLE Cerebral arteriopathy associated with heterozygous variants in the casitas B-lineage lymphoma gene e448 ARTICLE Somatic SLC35A2 mosaicism correlates with clinical fi ndings in epilepsy brain tissuee460 ARTICLE Synonymous variants associated with Alzheimer disease in multiplex families e450 Academy Officers Neurology® is a registered trademark of the American Academy of Neurology (registration valid in the United States). James C. Stevens, MD, FAAN, President Neurology® Genetics (eISSN 2376-7839) is an open access journal published Orly Avitzur, MD, MBA, FAAN, President Elect online for the American Academy of Neurology, 201 Chicago Avenue, Ann H. Tilton, MD, FAAN, Vice President Minneapolis, MN 55415, by Wolters Kluwer Health, Inc. at 14700 Citicorp Drive, Bldg. 3, Hagerstown, MD 21742. Business offices are located at Two Carlayne E. Jackson, MD, FAAN, Secretary Commerce Square, 2001 Market Street, Philadelphia, PA 19103. Production offices are located at 351 West Camden Street, Baltimore, MD 21201-2436. Janis M. Miyasaki, MD, MEd, FRCPC, FAAN, Treasurer © 2020 American Academy of Neurology. Ralph L. Sacco, MD, MS, FAAN, Past President Neurology® Genetics is an official journal of the American Academy of Neurology. Journal website: Neurology.org/ng, AAN website: AAN.com CEO, American Academy of Neurology Copyright and Permission Information: Please go to the journal website (www.neurology.org/ng) and click the Permissions tab for the relevant Mary E. Post, MBA, CAE article. Alternatively, send an email to [email protected].
    [Show full text]
  • Setd1 Histone 3 Lysine 4 Methyltransferase Complex Components in Epigenetic Regulation
    SETD1 HISTONE 3 LYSINE 4 METHYLTRANSFERASE COMPLEX COMPONENTS IN EPIGENETIC REGULATION Patricia A. Pick-Franke Submitted to the faculty of the University Graduate School in partial fulfillment of the requirements for the degree Master of Science in the Department of Biochemistry and Molecular Biology Indiana University December 2010 Accepted by the Faculty of Indiana University, in partial fulfillment of the requirements for the degree of Master of Science. _____________________________________ David Skalnik, Ph.D., Chair _____________________________________ Kristin Chun, Ph.D. Master’s Thesis Committee _____________________________________ Simon Rhodes, Ph.D. ii DEDICATION This thesis is dedicated to my sons, Zachary and Zephaniah who give me great joy, hope and continuous inspiration. I can only hope that I successfully set a good example demonstrating that one can truly accomplish anything, if you never give up and reach for your dreams. iii ACKNOWLEDGEMENTS I would like to thank my committee members Dr. Skalnik, Dr. Chun and Dr. Rhodes for allowing me to complete this dissertation. They have been incredibly generous with their flexibility. I must make a special thank you to Jeanette McClintock, who willingly gave her expertise in statistical analysis with the Cfp1 microarray data along with encouragement, support and guidance to complete this work. I would like to thank Courtney Tate for her ceaseless willingness to share ideas, and her methods and materials, and Erika Dolbrota for her generous instruction as well as the name of a good doctor. I would also like to acknowledge the superb mentorship of Dr. Jeon Heong Lee, PhD and the contagious passion and excitement for the life of science of Dr.
    [Show full text]
  • Transcriptome Profiling Reveals the Complexity of Pirfenidone Effects in IPF
    ERJ Express. Published on August 30, 2018 as doi: 10.1183/13993003.00564-2018 Early View Original article Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska, Anna Gungl, Jochen Wilhelm, Leigh M. Marsh, Helene Thekkekara Puthenparampil, Katharina Sinn, Miroslava Didiasova, Walter Klepetko, Djuro Kosanovic, Ralph T. Schermuly, Lukasz Wujak, Benjamin Weiss, Liliana Schaefer, Marc Schneider, Michael Kreuter, Andrea Olschewski, Werner Seeger, Horst Olschewski, Malgorzata Wygrecka Please cite this article as: Kwapiszewska G, Gungl A, Wilhelm J, et al. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF. Eur Respir J 2018; in press (https://doi.org/10.1183/13993003.00564-2018). This manuscript has recently been accepted for publication in the European Respiratory Journal. It is published here in its accepted form prior to copyediting and typesetting by our production team. After these production processes are complete and the authors have approved the resulting proofs, the article will move to the latest issue of the ERJ online. Copyright ©ERS 2018 Copyright 2018 by the European Respiratory Society. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska1,2, Anna Gungl2, Jochen Wilhelm3†, Leigh M. Marsh1, Helene Thekkekara Puthenparampil1, Katharina Sinn4, Miroslava Didiasova5, Walter Klepetko4, Djuro Kosanovic3, Ralph T. Schermuly3†, Lukasz Wujak5, Benjamin Weiss6, Liliana Schaefer7, Marc Schneider8†, Michael Kreuter8†, Andrea Olschewski1,
    [Show full text]
  • Study of the Regulation and Signalling of Cdk2-Cyclin O Complexes During Apoptosis
    STUDY OF THE REGULATION AND SIGNALLING OF CDK2-CYCLIN O COMPLEXES DURING APOPTOSIS Doctoral thesis This thesis is inscribed in the Departament de Ciències Experimentals i de la Salut of the Universitat Pompeu Fabra and the work described has been carried out in the IMIM-Hospital del Mar under the supervision of Dr. Gabriel Gil Gómez Barcelona, 2008 Ramon Roset i Huguet Dr. Gabriel Gil Gómez Doctorand Director 1 2 Als meus pares, infatigables! 3 4 Abstract The aim of this thesis is the characterization of a protein involved in apoptosis. Our group has identified an early step common to different forms of intrinsic apoptosis stimuli. This step requires de novo synthesis of a novel Cyclin, Cyclin O, that upon apoptosis induction in lymphoid cells forms active complexes, primarily with Cdk2. Cyclin O expression precedes glucocorticoid and gamma radiation-induced apoptosis in vivo in mouse thymus and its overexpression induces apoptosis in cultured cells. Knocking down the endogenous expression of Cyclin O by shRNA leads to the inhibition of glucocorticoid and DNA damage-induced apoptosis while leaving CD95 death receptor mediated apoptosis intact. This data demonstrates that apoptosis induction in lymphoid cells is one of the physiological roles of Cyclin O and it does not act by perturbing a normal cellular process such as the cell cycle. In addition we have identified c-Myb a substrate of Cdk2-Cyclin O complexes and we show that c-Myb is downregulated during apoptosis of lymphoid cells. 5 6 INDEX 7 8 I. INTRODUCTION ............................................................. 11 1. Introduction to the molecular mechanisms of apoptosis .......................
    [Show full text]
  • Transcriptomic Features of Pecten Maximus Oocyte Quality and Maturation Marianna Pauletto, Massimo Milan, Arnaud Huvet, Charlotte Corporeau, Marc Suquet, Josep V
    Transcriptomic features of Pecten maximus oocyte quality and maturation Marianna Pauletto, Massimo Milan, Arnaud Huvet, Charlotte Corporeau, Marc Suquet, Josep V. Planas, Rebeca Moreira, Antonio Figueras, Beatriz Novoa, Tomaso Patarnello, et al. To cite this version: Marianna Pauletto, Massimo Milan, Arnaud Huvet, Charlotte Corporeau, Marc Suquet, et al.. Tran- scriptomic features of Pecten maximus oocyte quality and maturation. PLoS ONE, Public Library of Science, 2017, 12 (3), pp.e0172805. 10.1371/journal.pone.0172805. hal-01510338 HAL Id: hal-01510338 https://hal.univ-brest.fr/hal-01510338 Submitted on 19 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. RESEARCH ARTICLE Transcriptomic features of Pecten maximus oocyte quality and maturation Marianna Pauletto1*, Massimo Milan1, Arnaud Huvet2, Charlotte Corporeau2, Marc Suquet2, Josep V. Planas3, Rebeca Moreira4, Antonio Figueras4, Beatriz Novoa4, Tomaso Patarnello1, Luca Bargelloni1 1 Department of Comparative Biomedicine and Food Science, University of Padova, Legnaro, Padova, Italy, 2
    [Show full text]
  • Enhanced DNA Repair Pathway Is As- Sociated with Cell Proliferation and Worse Survival in Hepato- Cellular Carcinoma (HCC)
    Cancers 2020, 13 S1 of S7 Supplemental Materials: Enhanced DNA Repair Pathway is As- sociated with Cell Proliferation and Worse Survival in Hepato- cellular Carcinoma (HCC) Masanori Oshi, Tae Hee Kim, Yoshihisa Tokumaru, Li Yan, Ryusei Matsuyama, Itaru Endo, Leonid Cherkassky and Kazuaki Takabe Figure S1. The correlation of the DNA repair score with expression of BRCA1 and BRCA2 genes in the TCGA cohort. Correlation plots of the DNA repair score with expression of the BRCA1 and BRCA2 genes. Spearman’s rank correlation coefficient was used to calculate the p-value. Figure S2. Gene set enrichment analysis (GSEA) of the KEGG MAPK signaling gene sets by high vs low DNA repair score of HCC in the TCGA cohort. Enrichment plots along with normalized enrichment score (NES) and false discovery rate (FDR) for the KEGG MAPK signaling gene set. An FDR of 0.25 was used to deem statistical Scheme 3. The correlation of the DNA repair score with drug sensitivity of Lenvatinib, Cabozantinib, Sorafenib, and Regorafenib in HCC cell lines. The correlation plots are between the DNA repair score and the level of drug sensitivity area un- der curve (AUC) of Lenvatinib, Cabozantinib, Sorafenib, and Regorafenib in HCC cell lines. Gene expression data of the HCC cell lines and response to drugs were obtained from the DepMap 1 portal, which were HEP3B217, HLF, HUH1, HUH7, JHH2, JHH4, JHH5, JHH6, JHH7, PLCPRF5, SKHEP1, SNU182, SNU387, SNU398, SNU423, SNU449, SNU475, SNU761, SNU878, and SNU886. Spearman correlation statistics were used for the analysis. Table S1. Genes included in the Molecular Signatures Database (MSigDB) Hallmark DNA repair gene set.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name cyclin O Gene Symbol CCNO Organism Human Gene Summary This gene which has a previous symbol of UNG2 was erroneously identified as a uracil DNA glycosylase in PubMed ID: 2001396. A later publication PubMed ID: 8419333 identified this gene's product as a cyclin protein family member. The UNG2 term is also used as a specific protein isoform name for the UNG gene (GeneID 7374) so confusion exists in the scientific literature and in some databases for these two genes. Gene Aliases CCNU, FLJ22422, UDG2, UNG2 RefSeq Accession No. NC_000005.9, NT_006713.15 UniGene ID Hs.3041 Ensembl Gene ID ENSG00000152669 Entrez Gene ID 10309 Assay Information Unique Assay ID qHsaCEP0024329 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000282572 Amplicon Context Sequence GGAGGGAAGGGGAGTAGCTGGTGAAGGCATAGTCGGCCAGACTCAGCTCTGCC ACCCCCCGCGCCAGGGCTTGCGCTTCCAGAGCTTCGGAGGCCTCAGCCTGCCC CGCCTCCACGCGAGCGTGCGTGAAATGCTCCAGGAAGAAGCTAATGGTGGGCG CACCCAGG Amplicon Length (bp) 137 Chromosome Location 5:54527409-54527575 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 98 R2 0.9991 cDNA Cq 23.61 cDNA Tm (Celsius) 90 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 24.26 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report CCNO, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
    [Show full text]
  • Kathi Künnemann
    Expression and role of Cyclin O in colorectal cancer Kathi Künnemann TESI DOCTORAL UPF / 2013 DIRECTOR DE LA TESI Dr. Gabriel Gil Gómez TUTOR DE LA TESI Dr. Pura Muñoz Cànoves (Department of Experimental and Health Sciences, UPF) Programa de Recerca en Càncer – IMIM Hospital del Mar ii Für meine Eltern iii iv Acknowledgements, Danksagung 4 years have gone since I arrived in Barcelona and started the thesis passing through good and not so good moments. Many people contributed to this work and made it possible for me to finally reach the end of this long journey. First of all, I would like to thank Dr. Gabriel Gil Gómez for incorporating me in his group and letting me work on this project and perform the experiments, for his critical suggestions, for his patience with teaching me and his trust in me with this work. I would like to thank Dr. Pura Muñoz for her help and support in finding a PhD project, the fellowship and in general. I would also like to thank all the members of my PhD committee for having the time to meet and give their support and kind suggestions on this project. I would like to thank the Generalitat de Catalunya for giving me the FI PhD fellowship in order to finance this thesis during 3 years. Additionally, I would like to thank the IMIM for the financial help in order to publish this thesis. With Marta, Alex, Marc and Lara, and also Laura O. and Mercè, I could not have had better labmates during these 3 years of the thesis.
    [Show full text]
  • Transcriptomics Identified a Critical Role for Th2 Cell-Intrinsic Mir-155 In
    Supplementary Appendix; Figures S1-S16. Supplementary Appendix; Figure S1. FACS-Purified reporter+ T cells reveal greater transcriptional resolution than bulk CD4 cells. CD4 T cells were purified and polarised under Th1, Th2, Th9, Th17 and iTreg conditions in-vitro. Either all cells (Bulk) or FACS-purified Ifnγyfp+, Il4gfp+, Il9CreR26eYFP+ Il17aCreR26eFP635 reporter positive cells were isolated, RNA extracted and used for miRNA and mRNA transcriptional analysis. The mean of 3-5 biological replicates per T cell subset are represented in each heat map. a, Hallmark Th and Treg genes are shown. b, Venn diagrams (top) depicting numbers of common and exclusive mRNA and miRNAs expressed in bulk and purified Th2 cells (2-fold change). Bottom: Heat maps showing expression of mRNA and miRNAs in Th2 cells, relative to un-polarised cells. Supplementary Appendix; Figure S2. FACS-Purified reporter+ T cells reveal significant IL-4-signaling resolution. CD4 T cells were purified and polarised under Th1, Th2, Th9, Th17 and iTreg conditions in vitro, using cytokine reporter cells. Either all cells (Bulk) or FACS-purified Ifnγyfp+, Il4gfp+, Il9CreR26eYFP+ Il17aCreR26eFP635 reporter positive cells were isolated (a). Using Ingenuity pathways analysis, the IL-4 signaling pathway was overlaid with the gene expression profile of bulk, or cytokine- reporter purified cells (b, c). Supplementary Appendix; Figure S3. Naïve CD4 T cells were polarised in vitro, as described in methods, with mRNA and miRNA transcriptional profiles used for comparative analysis. a, Comparative analysis showing common and unique mRNA (left) and miRNA (right) transcripts in each T cell subset (>5 fold-change). Unique transcripts in Th2 cells highlighted in red square.
    [Show full text]
  • Can Sequencing Shed Light on Cell Cycling?
    analysis Can sequencing shed light on cell cycling? Andrew W. Murray*† & Debora Marks‡ *Center for Genomics Research, and †Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts 02138, USA ‡ BCMP and Cell Biology, Harvard Medical School, Boston, Massachusetts 02115, USA ............................................................................................................................................................................................................................................................................ Every organism must have cells that can replicate indefinitely. Can the draft human genome sequence tell us how the cell cycle works and how it evolved? We studied two protein families—the cyclins and their partners the cyclin-dependent kinases (Cdks)— and a conserved regulatory circuit, the spindle checkpoint. Disappointingly, we discovered a few novel cyclins and no new Cdks or components of the spindle checkpoint, and could shed little light on the organization of the cell cycle. scillations in the activity of the Cdk family of protein complexes2. There is no homologue of Cak1 in the human genome, kinases drive the eukaryotic cell cycle. These enzymes suggesting that humans and budding yeast use different kinases for consist of a catalytic (Cdk) and a regulatory subunit the same reaction. It appears that this step is not an important way (cyclin)1. Their activity is regulated by phosphoryla- of regulating Cdk activity, as no physiological regulation of Cdk7/ tion of Cdks, binding of stoichiometric kinase inhibi- cyclin H or Cak1 has been found. Otors and regulated proteolysis of the cyclins. Cdk activity is The sequences of the cyclins are less well conserved than those of regulated by events inside and outside the cell and controls DNA the Cdks. Cyclins have been found by three approaches: character- replication, chromosome segregation and cell division.
    [Show full text]