DOCSLIB.ORG

Growth Factor Family (Brain-Derived Neurotrophic Factor/Polymerase Chain Reaction/Neurotrophic Factor/Mrna) KEVIN R

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Growth Factor Family (Brain-Derived Neurotrophic Factor/Polymerase Chain Reaction/Neurotrophic Factor/Mrna) KEVIN R Proc. Nati. Acad. Sci. USA Vol. 87, pp. 8060-8064, October 1990 Neurobiology Molecular cloning of a human gene that is a member of the nerve growth factor family (brain-derived neurotrophic factor/polymerase chain reaction/neurotrophic factor/mRNA) KEVIN R. JONES AND Louis F. REICHARDT Howard Hughes Medical Institute, Room U426, University of California-San Francisco, San Francisco, CA 94143 Communicated by William A. Catterall, June 18, 1990 (received for review May 4, 1990) ABSTRACT Cell death within the developing vertebrate Y is a pyrimidine, and W is A or T) or 2B2 (TAYTTYTW- nervous system is regulated in part by interactions between YGARACNAARTG; where N is any nucleotide) and 4A1' neurons and their innervation targets that are mediated by (DATNCKDATRAANCKCCA; where D is G, A, or T and neurotrophic factors. These factors also appear to have a role K is G or T) were used at 5 ,uM to amplify 500 ng of human in the maintenance of the adult nervous system. Two neuro- genomic DNA in a 50-,ul PCR mixture (7). After 45 cycles of trophic factors, nerve growth factor and brain-derived neuro- amplification (temperature profile: 94TC for 1 min; 45TC for 2 trophic factor, share substantial amino acid sequence identity. min; 55TC for 15 sec; 72TC for 2 min), reaction products were We have used a screen that combines polymerase chain reaction separated on a 3% NuSieve agarose gel (FMC) and a band of amplification of genomic DNA and low-stringency hybridiza- tion with degenerate oligonucleotides to isolate human BDNF the expected molecular size (approximately 165 base pairs) and a human gene, neurotrophin-3, that is closely related to was excised. Approximately 10% of the volume of the gel both nerve growth factor and brain-derived neurotrophic slice (20 ILI) was added to a fresh PCR mixture (final volume, factor. mRNA products of the brain-derived neurotrophic 100 ul) containing either oligonucleotide 2B2 or 2C1 [5' factor and neurotrophin-3 genes were detected in the adult phosphorylated as described (8)] and oligonucleotide 4A1RI human brain, suggesting that these proteins are involved in the (AGAGAATTCDATNCKDATRAANCKCCA). After 15 maintenance of the adult nervous system. Neurotrophin-3 is cycles of PCR amplification, fresh dNTPs (all four dNTPs, also expected to function in embryonic neural development. each at a final concentration of 0.1 mM) and 5 units of Escherichia coli DNA polymerase I, Klenow fragment, were During normal vertebrate development, large percentages added. After incubation for 1 hr at 20TC, the reaction mixture (up to 80%) of the neurons born into diverse cell populations was phenol-extracted twice, ethanol-precipitated, and di- within the forming nervous system die (1, 2). This is thought gested with 10 units of EcoRI. Restriction fragments were to be a mechanism that ensures that adequate numbers of purified on a 3% NuSieve gel and ligated to Sma IlEcoRI- neurons establish appropriate innervation densities with ef- digested M13mpl9. Subsequent sequence analysis of the fector organs or other neuronal populations. In several in- NT-3 gene showed that oligonucleotides 2C1, 2B2, and 4A1' stances, the innervation target of a population of neurons has had zero, two-, and two-nucleotide mismatches, respec- been shown to have a crucial role in regulating the number of tively, with the NT-3 DNA sequence. Human genomic DNA surviving neurons (for review, see ref. 2). Many observations for use in the amplification reactions was purified as de- indicate that targets ofneuronal innervation produce a limited scribed (9), with K.R.J. providing source material. supply of neurotrophic factors and that competition between Plaque Hybridization Screening ofM13 Clones. Oligonucle- responsive neurons for these factors determines which neu- otides 3C1P (RTCDATICCICKGCANCC; where I is ino- rons survive (1). Two distinct neurotrophic factors, nerve sine) and 3D1P (GCANTRNGARTTCCARTG) were 5'- growth factor (NGF) and brain-derived neurotrophic factor phosphorylated with [ty-32P]ATP and hybridized (8) with (BDNF), have been purified and are known to be sufficient nitrocellulose filter lifts of the M13 plaques obtained by in vivo to reduce the amount of naturally occurring neuronal transformation ofE. coli strain TG1 with the ligation reaction cell death in portions of the peripheral nervous system (3, 4). mixture described above. After washing three times at 20TC Evidence also suggests that NGF modulates neurotrans- and once at 30TC in 6x SSC (1x SSC is 150 mM NaCI/15 mM mitter synthesis and neuronal morphology in the adult ner- sodium citrate)/0.1% SDS, signals were visualized by auto- vous system (e.g., refs. 5, 6). radiography. The amino acid and nucleotide sequence similarity ofNGF Isolation and Sequencing of Genomic Clones. A human and BDNF suggested that these neurotrophic factors could genomic library [kindly provided by Mike Blanar (UCSF, San be part of a larger gene family. Other members of this family Francisco); constructed in the A DASH vector by using could have important roles in the development and mainte- leukocyte DNA] was screened with single-stranded probes nance ofthe nervous system. Therefore, to attempt to isolate containing BDNF or NT-3 PCR products by using standard genes related to NGF and BDNF, we initiated a screen hybridization methods (8). Restriction fragments [6-kilobase involving the polymerase chain reaction (PCR) (7). By using (kb) BamHI-EcoRI (NT-3) or 3-kb EcoRI (BDNF)J from the this screen, we have isolated and characterized* a third NT-3 and BDNF A phage clones thus isolated were subcloned member of the NGF family, neurotrophin-3 (NT-3), and the into pBluescript KS. DNA sequence was determined from human BDNF gene. these subclones by using reagents and protocols provided in a kit (United States Biochemical). MATERIALS AND METHODS RNA Isolation and Analysis. Total RNA was prepared from human 89-13 an PCR and Subcloning of PCR Products. Oligonucleotides frozen brain specimens (patients and 90-23, 2C1 (AARCARTAYTTYTWYGARAC; where R is a purine, Abbreviations: NGF, nerve growth factor; BDNF, brain-derived neurotrophic factor; NT-3, neurotrophin-3; PCR, polymerase chain The publication costs of this article were defrayed in part by page charge reaction. payment. This article must therefore be hereby marked "advertisement" *The sequences reported in this paper have been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession nos. M37762 and M37763). 8060 Downloaded by guest on September 30, 2021 Neurobiology: Jones and Reichardt Proc. Natl. Acad. Sci. USA 87 (1990) 8061 85-year-old male and a 73-year-old female, respectively) or TAACACAGACTCAGCTGCCAGAGCCTGCTCTTAACACCTGTGTTTCCTTTT 51 placenta by extraction with guanidine isothiocyanate and * H R L S C Q S LL L T P V F P F sedimentation through cesium chloride (8). Polyadenylylated CAGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTT 102 RNA was isolated (8), fractionated on a 1.5% agarose/ O I L 0 V N K V M S I L FY V I F -130 CTCGCTTATCTCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTG 153 formaldehyde gel (8), and transferred by capillary action to L A Y L R G I 0 G NN M OD R S' L -113 Hybond-N (Amersham). 94-750 of the Nucleotides NT-3 CCAGAAGACTCGCTCAATTCCCTCATTATTAAGCTGATCCAGGCAGATATT 204 sequence or nucleotides 42-741 of the human BDNF se- P E D S LN S L I I K L I Q A D, I -96 quence were amplified by using the PCR from plasmids TTGAAAAACAAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTLCAG 255 containing the NT-3 or BDNF genes (see above), subcloned L K N K L S K 0 M V D V K E N Y 0 -79 into M13mp19, and single-stranded probes were prepared AGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGGAGCGGGGAGGGCCC 306 from the resulting templates with [a-32P]dCTP (3000 Ci/ S T L P K A E A P R E P E R G G P -62 mmol; 1 Ci = 37 GBq; Amersham) by using standard pro- GCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGCTGCGA 357 cedures (8). Hybridizations were performed at 650C in 5x A K S A F 0 P V I A M D T E LL R -45 SSC/5 x Denhardt's solution/0.5% SDS/salmon-sperm CAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCC 408 DNA (200 ,ug/ml). (lx Denhardt's solution is 0.02% poly- 0 0 R R Y N S P R V L L S D S T P -28 TTGGAGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTG 459 vinylpyrrolidone/0.02% Ficoll/0.02% bovine serum albu- LE P P P L Y L M E D Y V G S P V -11 min.) After washing for a total of 60 min in four changes of GTGGCGAACAGAACATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCAC 510 0.5x SSC/0.1% SDS at 650C, signals were detected by V A N R T S R R K R Y A E H K SH +7 autoradiography at -70'C with an intensifying screen. To * -l1t+1 compare RNA amounts in the various samples, we used a CGAGGGGAGTACTCGGTATGTGACAGTGAGAGTCTGTGGGTGACCGACAAG 561 restriction fragment from the human p2-tubulin 3' untrans- R G E Y S V C 0 S E S L W V T D K +24 lated region (10). TCATCGGCCATCGACATTCGGGGACACCAGGTCACGGTGCTGGGGGAGATC 612 S S A I D I R G H 0 V T V L G E I +41 RESULTS AAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAACGCGATGTAAG 663 K T G N S P VK 0 Y F Y E T R C K +58 Isolation of Neurotrophic Factor Genes. Degenerate oligo- GAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACTGG 714 nucleotides having sequences derived from the amino acid E A R P VK N G C R G I D D K H W +75 sequence conserved between NGF from several species and AACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAG 765 porcine BDNF (oligonucleotides 2C1, 2B2, and 4A1', see N S 0 C K T S 0 T Y V R A L T S E +92 Fig. 3) were used to amplify human genomic DNA in PCRs.
Load more

Recommended publications
  • Signalings and Roles in Central Nervous System
    Volume 9, Number 3; 537-552, June 2018 http://dx.doi.org/10.14336/AD.2017.0702 Review Mammalian Sterile20-like Kinases: Signalings and Roles in Central Nervous System Sheng Chen1, #, *, Yuanjian Fang1, #, Shenbin Xu1, Cesar Reis2, 3, Jianmin Zhang1, 4, * 1Department of Neurosurgery, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, China. 2Department of Physiology and Pharmacology, Loma Linda University, Loma Linda, California, USA. 3Brain Research Institute, Zhejiang University, Hangzhou, Zhejiang, China. 4Collaborative Innovation Center for Brain Science, Zhejiang University, Hangzhou, Zhejiang, China. [Received May 30, 2017; Revised June 16, 2017; Accepted July 2, 2017] ABSTRACT: Mammalian Sterile20-like (MST) kinases are located upstream in the mitogen-activated protein kinase pathway, and play an important role in cell proliferation, differentiation, renewal, polarization and migration. Generally, five MST kinases exist in mammalian signal transduction pathways, including MST1, MST2, MST3, MST4 and YSK1. The central nervous system (CNS) is a sophisticated entity that takes charge of information reception, integration and response. Recently, accumulating evidence proposes that MST kinases are critical in the development of disease in different systems involving the CNS. In this review, we summarized the signal transduction pathways and interacting proteins of MST kinases. The potential biological function of each MST kinase and the commonly reported MST-related diseases in the neural system
    [Show full text]
  • Both Systemic and Local Application of Granulocyte-Colony Stimulating
    BMC Neuroscience BioMed Central Research article Open Access Both systemic and local application of Granulocyte-colony stimulating factor (G-CSF) is neuroprotective after retinal ganglion cell axotomy Tobias Frank†1, Johannes CM Schlachetzki†1, Bettina Göricke1,2, Katrin Meuer1, Gundula Rohde1,2, Gunnar PH Dietz1,2,3, Mathias Bähr1,2, Armin Schneider4 and Jochen H Weishaupt*1,2 Address: 1Department of Neurology, University Medical Center Göttingen, Robert-Koch-Strasse 40, 37075 Göttingen, Germany, 2DFG-Research Center for Molecular Physiology of the Brain (CMPB), Humboldtallee 23, Göttingen, Germany, 3H Lundbeck A/S, 2500 Valby, Denmark and 4Sygnis Bioscience, Im Neuenheimer Feld 515, 69120 Heidelberg, Germany Email: Tobias Frank - [email protected]; Johannes CM Schlachetzki - [email protected]; Bettina Göricke - [email protected]; Katrin Meuer - [email protected]; Gundula Rohde - [email protected]; Gunnar PH Dietz - [email protected]; Mathias Bähr - [email protected]; Armin Schneider - [email protected]; Jochen H Weishaupt* - [email protected] * Corresponding author †Equal contributors Published: 14 May 2009 Received: 10 November 2008 Accepted: 14 May 2009 BMC Neuroscience 2009, 10:49 doi:10.1186/1471-2202-10-49 This article is available from: http://www.biomedcentral.com/1471-2202/10/49 © 2009 Frank et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The hematopoietic Granulocyte-Colony Stimulating Factor (G-CSF) plays a crucial role in controlling the number of neutrophil progenitor cells.
    [Show full text]
  • 8667.Full-Text.Pdf
    The Journal of Neuroscience, November 15, 1997, 17(22):8667–8675 Brain-Derived Neurotrophic Factor, Neurotrophin-3, and Neurotrophin-4 Complement and Cooperate with Each Other Sequentially during Visceral Neuron Development Wael M. ElShamy and Patrik Ernfors Department of Medical Biochemistry and Biophysics, Laboratory of Molecular Neurobiology, Doktorsringen 12A, Karolinska Institute, 171 77 Stockholm, Sweden The neurotrophins nerve growth factor (NGF), brain-derived they are essential in preventing the death of N/P ganglion neurotrophic factor (BDNF), neurotrophin-3 (NT3), and neurons during different periods of embryogenesis. Both NT3 neurotrophin-4 (NT4) are crucial target-derived factors control- and NT4 are crucial during the period of ganglion formation, ling the survival of peripheral sensory neurons during the em- whereas BDNF acts later in development. Many, but not all, of bryonic period of programmed cell death. Recently, NT3 has the NT3- and NT4-dependent neurons switch to BDNF at later also been found to act in a local manner on somatic sensory stages. We conclude that most of the N/P ganglion neurons precursor cells during early development in vivo. Culture stud- depend on more than one neurotrophin and that they act in a ies suggest that these cells switch dependency to NGF at later complementary as well as a collaborative manner in a devel- stages. The neurotrophins acting on the developing placode- opmental sequence for the establishment of a full complement derived visceral nodose/petrosal (N/P) ganglion neurons are
    [Show full text]
  • Journal of Neuroinflammation Biomed Central
    Journal of Neuroinflammation BioMed Central Research Open Access Immune modulation and increased neurotrophic factor production in multiple sclerosis patients treated with testosterone Stefan M Gold1,2, Sara Chalifoux1, Barbara S Giesser1 and Rhonda R Voskuhl*1 Address: 1Department of Neurology, Neuroscience Research Building 1, 635 Charles E. Young Drive South, University of California Los Angeles, CA, 90095, USA and 2Cousins Center, 300 Medical Plaza, University of California Los Angeles, CA, 90095, USA Email: Stefan M Gold - [email protected]; Sara Chalifoux - [email protected]; Barbara S Giesser - [email protected]; Rhonda R Voskuhl* - [email protected] * Corresponding author Published: 31 July 2008 Received: 29 May 2008 Accepted: 31 July 2008 Journal of Neuroinflammation 2008, 5:32 doi:10.1186/1742-2094-5-32 This article is available from: http://www.jneuroinflammation.com/content/5/1/32 © 2008 Gold et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Multiple sclerosis is a chronic inflammatory disease of the central nervous system with a pronounced neurodegenerative component. It has been suggested that novel treatment options are needed that target both aspects of the disease. Evidence from basic and clinical studies suggests that testosterone has an immunomodulatory as well as a potential neuroprotective effect that could be beneficial in MS. Methods: Ten male MS patients were treated with 10 g of gel containing 100 mg of testosterone in a cross-over design (6 month observation period followed by 12 months of treatment).
    [Show full text]
  • Deficiency in Androgen Receptor Aggravates the Depressive-Like
    cells Article Deficiency in Androgen Receptor Aggravates the Depressive-Like Behaviors in Chronic Mild Stress Model of Depression Yi-Yung Hung 1,2, Ya-Ling Huang 1, Chawnshang Chang 3,* and Hong-Yo Kang 2,4,* 1 Department of Psychiatry, Kaohsiung Chang Gung Memorial Hospital, and Chang Gung University College of Medicine, Kaohsiung 833, Taiwan 2 Graduate Institute of Clinical Medical Sciences, College of Medicine, Chang Gung University, Kaohsiung 833, Taiwan 3 George Whipple Lab for Cancer Research, Departments of Pathology, Urology and Radiation Oncology, and The Wilmot Cancer Center, University of Rochester Medical Center, Rochester, NY 14646, USA 4 Department of Obstetrics and Gynecology, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833, Taiwan * Correspondence: [email protected] (C.C.); [email protected] (H.-Y.K.); Tel.: +886-7-731-7123 (ext. 8898) (H.-Y.K.) Received: 11 July 2019; Accepted: 28 August 2019; Published: 2 September 2019 Abstract: While androgen receptor (AR) and stress may influence the development of the major depressive disorder (MDD), the detailed relationship, however, remains unclear. Here we found loss of AR accelerated development of depressive-like behaviors in mice under chronic mild stress (CMS). Mechanism dissection indicated that AR might function via altering the expression of miR-204-5p to modulate the brain-derived neurotrophic factor (BDNF) expression to influence the depressive-like behaviors in the mice under the CMS. Adding the antiandrogen flutamide with the stress hormone corticosterone can additively decrease BDNF mRNA in mouse hippocampus mHippoE-14 cells, which can then be reversed via down-regulating the miR-204-5p expression.
    [Show full text]
  • Neuronal Caspase-3 Signaling: Not Only Cell Death
    Cell Death and Differentiation (2010) 17, 1104–1114 & 2010 Macmillan Publishers Limited All rights reserved 1350-9047/10 $32.00 www.nature.com/cdd Review Neuronal caspase-3 signaling: not only cell death M D’Amelio*,1,2, V Cavallucci1,2 and F Cecconi*,1,2 Caspases are a family of cysteinyl aspartate-specific proteases that are highly conserved in multicellular organisms and func- tion as central regulators of apoptosis. A member of this family, caspase-3, has been identified as a key mediator of apoptosis in neuronal cells. Recent studies in snail, fly and rat suggest that caspase-3 also functions as a regulatory molecule in neurogenesis and synaptic activity. In this study, in addition to providing an overview of the mechanism of caspase-3 activation, we review genetic and pharmacological studies of apoptotic and nonapoptotic functions of caspase-3 and discuss the regulatory mechanism of caspase-3 for executing nonapoptotic functions in the central nervous system. Knowledge of biochemical pathway(s) for nonapoptotic activation and modulation of caspase-3 has potential implications for the understanding of synaptic failure in the pathophysiology of neurological disorders. Fine-tuning of caspase-3 lays down a new challenge in identifying pharmacological avenues for treatment of many neurological disorders. Cell Death and Differentiation (2010) 17, 1104–1114; doi:10.1038/cdd.2009.180; published online 4 December 2009 The role of caspases in programmed cell death has been inhibited by Smac/Diablo and Omi/HtrA2, which are released reviewed many times.1–3 It is widely accepted that, in mam- from the intermembrane space when mitochondria are mals, two main pathways (Figure 1) have evolved for damaged.
    [Show full text]
  • Review Article Protective Action of Neurotrophic Factors and Estrogen Against Oxidative Stress-Mediated Neurodegeneration
    Hindawi Publishing Corporation Journal of Toxicology Volume 2011, Article ID 405194, 12 pages doi:10.1155/2011/405194 Review Article Protective Action of Neurotrophic Factors and Estrogen against Oxidative Stress-Mediated Neurodegeneration Tadahiro Numakawa,1, 2 Tomoya Matsumoto,2, 3 Yumiko Numakawa,4 Misty Richards,1, 5 Shigeto Yamawaki,2, 3 and Hiroshi Kunugi1, 2 1 Department of Mental Disorder Research, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo 187-8502, Japan 2 Core Research for Evolutional Science and Technology Program (CREST), Japan Science and Technology Agency (JST), Saitama 332-0012, Japan 3 Department of Psychiatry and Neurosciences, Division of Frontier Medical Science, Graduate School of Biomedical Sciences, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan 4 Peptide-prima Co., Ltd., 1-25-81, Nuyamazu, Kumamoto 861-2102, Japan 5 The Center for Neuropharmacology and Neuroscience, Albany Medical College, Albany, NY 12208, USA Correspondence should be addressed to Tadahiro Numakawa, [email protected] Received 11 January 2011; Revised 28 February 2011; Accepted 29 March 2011 Academic Editor: Laurence D. Fechter Copyright © 2011 Tadahiro Numakawa et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Oxidative stress is involved in the pathogenesis of neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease. Low levels of reactive oxygen species (ROS) and reactive nitrogen species (RNS) are important for maintenance of neuronal function, though elevated levels lead to neuronal cell death.
    [Show full text]
  • Ciliary Neurotrophic Factor Prevents Degeneration of Adult
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 6315-6319, July 1993 Neurobiology Ciliary neurotrophic factor prevents degeneration of adult rat substantia nigra dopaminergic neurons in vivo (neuronal death/axotomy/trophic factor/tyrosine hydroxylase/Parkinson disease) THEO HAGG* AND SILVIO VARON Department of Biology, University of California, San Diego, La Joila, CA 92093-0601 Communicated by Dominick P. Purpura, March 29, 1993 (receivedfor review December 10, 1992) ABSTRACT We have investigated the neuroprotective ef- effect was seen for their transmitter enzyme, choline acetyl- fects of recombinant human ciliary neurotrophic factor transferase (ChAT). In the present study, we investigated in (CNTF) for injured dopaminergic neurons of the adult rat adult rats whether CNTF could also have protective effects substantia nigra compacta. Fourteen days after a unilateral for injured and degenerating dopaminergic neurons of the ansetion of the nigrostriatal pathway two-thirds of the substantia nigra compacta. neurons (identiffed by retograde labeling) had degenerated. In sharp contrast, 73% (a few cases, >90%) of this ceil loss was prevented by continuous infusion of CNTF close to the injured METHODS neurons. However, CNTF did not prevent the disappearance of Nigrostriatal Transection. Female Sprague-Dawley rats the transmitter-synthesizing enzyme tyrosine hydroxylase. (200 g; Bantin & Kingman, Fremont, CA; housed and cared Thus, CNTF has potent neurotrophic effects for injured adult for according to National Institutes of Health and U.S. rat dopaminergic
    [Show full text]
  • Nerve Growth Factor and Related Substances: a Brief History and an Introduction to the International NGF Meeting Series
    International Journal of Molecular Sciences Editorial Nerve Growth Factor and Related Substances: A Brief History and an Introduction to the International NGF Meeting Series Ralph A. Bradshaw 1,2, William Mobley 3 and Robert A. Rush 4,* 1 Department of Physiology and Biophysics, University of California, Irvine, CA 92697, USA; [email protected] 2 Department of Pharmacology, University of California, San Diego, La Jolla, CA 92093, USA 3 Department of Neuroscience, University of California, San Diego, La Jolla, CA 92093, USA; [email protected] 4 Department of Human Physiology, Flinders University, Adelaide, SA 5001, Australia * Correspondence: robert.rush@flinders.edu.au; Tel.: +61-4-1419-0126 Academic Editors: Margaret Fahnestock and Keri Martinowich Received: 12 April 2017; Accepted: 10 May 2017; Published: 26 May 2017 Abstract: Nerve growth factor (NGF) is a protein whose importance to research and its elucidation of fundamental mechanisms in cell and neurobiology far outstrips its basic physiological roles. It was the first of a broad class of cell regulators, largely acting through autocrine and paracrine interactions which will be described herein. It was of similar significance in establishing the identity and unique roles of neurotrophic factors in the development and maintenance of the peripheral and central nervous systems. Finally, it contributed to many advances in the elaboration of cell surface receptor mechanisms and intracellular cell signaling. As such, it can be considered to be a “molecular Rosetta Stone”. In this brief review, the highlights of these various studies are summarized, particularly as illustrated by their coverage in the 13 NGF international meetings that have been held since 1986.
    [Show full text]
  • BDNF and Cortisol Integrative System – Plasticity Vs. Degeneration
    Frontiers in Neuroendocrinology 55 (2019) 100784 Contents lists available at ScienceDirect Frontiers in Neuroendocrinology journal homepage: www.elsevier.com/locate/yfrne BDNF and Cortisol integrative system – Plasticity vs. degeneration: ☆ Implications of the Val66Met polymorphism T ⁎ Gilmara Gomes de Assisa,b, , Eugene V. Gasanovc a Department of Applied Physiology, Mossakowski Medical Research Centre Polish Academy of Sciences, Warsaw, Poland b Lab. of Behavioral Endocrinology, Brain Institute, Federal University of Rio Grande do Norte, Natal, Brazil c Laboratory of Neurodegeneration, International Institute of Molecular and Cell Biology in Warsaw, Poland ARTICLE INFO ABSTRACT Keywords: BDNF is the neurotrophin mediating pro-neuronal survival and plasticity. Cortisol (COR), in turn, is engaged in Brain-derived neurotrophic factor the coordination of several processes in the brain homeostasis. Stress-responsive, both factors show an in- Cortisol tegrative role through their receptor’s dynamics in neurophysiology. Furthermore, the Val66Met BDNF poly- Val66Met polymorphism morphism may play a role in this mechanism. Aim: to investigate BDNF-COR interaction in the human neu- Depression rophysiology context. Methods: We collected all papers containing BDNF and COR parameters or showing COR Exercise analyses in genotyped individuals in a PubMed search – full description available on PROSPERO – CRD42016050206. Discussion: BDNF and COR perform distinct roles in the physiology of the brain whose systems are integrated by glucocorticoid receptors dynamics. The BDNF polymorphism appears to have an in- fluence on individual COR responsivity to stress. BDNF and COR play complementary roles in the nervous system where COR is a regulator of positive/negative effects. Exercise positively regulates both factors, regardless of BDNF polymorphism. 1.
    [Show full text]
  • Potential Ciliary Neurotrophic Factor Application in Dental Stem Cell Therapy Patrick Suezaki University of the Pacific
    University of the Pacific Scholarly Commons Dugoni School of Dentistry Faculty Articles Arthur A. Dugoni School of Dentistry 2-2017 Potential Ciliary Neurotrophic Factor Application in Dental Stem Cell Therapy Patrick Suezaki University of the Pacific Nan (Tori) Xiao University of the Pacific, [email protected] Follow this and additional works at: https://scholarlycommons.pacific.edu/dugoni-facarticles Part of the Dentistry Commons Recommended Citation Suezaki, P., & Xiao, N. (2017). Potential Ciliary Neurotrophic Factor Application in Dental Stem Cell Therapy. Journal of Dentistry and Oral Biology, 2(3), 1–2. https://scholarlycommons.pacific.edu/dugoni-facarticles/415 This Article is brought to you for free and open access by the Arthur A. Dugoni School of Dentistry at Scholarly Commons. It has been accepted for inclusion in Dugoni School of Dentistry Faculty Articles by an authorized administrator of Scholarly Commons. For more information, please contact [email protected]. Mini Review Journal of Dentistry and Oral Biology Published: 08 Feb, 2017 Potential Ciliary Neurotrophic Factor Application in Dental Stem Cell Therapy Patrick Suezaki1 and Nan Xiao2* 1Doctor of Dental Surgery Program, Arthur A. Dugoni School of Dentistry University of the Pacific, USA 2Department of Biomedical Sciences, Arthur A. Dugoni School of Dentistry University of the Pacific, USA Abstract Neurotrophic factors have long been considered growth factors that promote survival and growth of various neuronal tissues. Recent studies showed that neurotrophic factors are also present in dental pulp and periodontal ligament. This paper reviews the literature about the ciliary neurotrophic factor (CNTF), a member of the neurotrophic factor family, and indicates the potential clinical application of CNTF in dental stem cell therapy.
    [Show full text]
  • Expression of Selected Genes Involved in Neurogenesis in the Etiopathogenesis of Depressive Disorders
    Journal of Personalized Medicine Article Expression of Selected Genes Involved in Neurogenesis in the Etiopathogenesis of Depressive Disorders Katarzyna Bli´zniewska-Kowalska 1,* , Piotr Gałecki 1 , Janusz Szemraj 2 and Monika Talarowska 3 1 Department of Adult Psychiatry, Medical University of Lodz, 91-229 Lodz, Poland; [email protected] 2 Department of Medical Biochemistry, Medical University of Lodz, 92-215 Lodz, Poland; [email protected] 3 Department of Clinical Psychology, Institute of Psychology University of Lodz, 91-433 Lodz, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-608-203-624 Abstract: (1) Background: The neurogenic theory suggests that impaired neurogenesis within the dentate gyrus of the hippocampus is one of the factors causing depression. Immunology also has an impact on neurotrophic factors. The aim of the study was to assess the importance of selected genes involved in the process of neurogenesis i.e., nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), glial-derived neurotrophic factor (GDNF) and neuron-restrictive silencer factor (REST gene) in the etiopathogenesis of depressive disorders. (2) Methods: A total of 189 subjects took part in the study (95 depressed patients, 94 healthy controls). Sociodemographic data were collected. The severity of depressive symptoms was assessed using the Hamilton Depression Rating Scale (HDRS). RT-PCR was used to assess gene expression at the mRNA levels, while Enzyme-Linked Immunosorbent Assay (ELISA) was used to assess gene expression at the protein level. (3) Results: Expression of NGF, BDNF, REST genes is lower in depressed patients than in the control group, Citation: Bli´zniewska-Kowalska,K.; Gałecki, P.; Szemraj, J.; Talarowska, M.
    [Show full text]