Proc. Nati. Acad. Sci. USA Vol. 87, pp. 8060-8064, October 1990 Neurobiology Molecular cloning of a human gene that is a member of the nerve growth factor family (brain-derived neurotrophic factor/polymerase chain reaction/neurotrophic factor/mRNA) KEVIN R. JONES AND Louis F. REICHARDT Howard Hughes Medical Institute, Room U426, University of California-San Francisco, San Francisco, CA 94143 Communicated by William A. Catterall, June 18, 1990 (received for review May 4, 1990) ABSTRACT Cell death within the developing vertebrate Y is a pyrimidine, and W is A or T) or 2B2 (TAYTTYTW- nervous system is regulated in part by interactions between YGARACNAARTG; where N is any nucleotide) and 4A1' neurons and their innervation targets that are mediated by (DATNCKDATRAANCKCCA; where D is G, A, or T and neurotrophic factors. These factors also appear to have a role K is G or T) were used at 5 ,uM to amplify 500 ng of human in the maintenance of the adult nervous system. Two neuro- genomic DNA in a 50-,ul PCR mixture (7). After 45 cycles of trophic factors, nerve growth factor and brain-derived neuro- amplification (temperature profile: 94TC for 1 min; 45TC for 2 trophic factor, share substantial amino acid sequence identity. min; 55TC for 15 sec; 72TC for 2 min), reaction products were We have used a screen that combines polymerase chain reaction separated on a 3% NuSieve agarose gel (FMC) and a band of amplification of genomic DNA and low-stringency hybridiza- tion with degenerate oligonucleotides to isolate human BDNF the expected molecular size (approximately 165 base pairs) and a human gene, neurotrophin-3, that is closely related to was excised. Approximately 10% of the volume of the gel both nerve growth factor and brain-derived neurotrophic slice (20 ILI) was added to a fresh PCR mixture (final volume, factor. mRNA products of the brain-derived neurotrophic 100 ul) containing either oligonucleotide 2B2 or 2C1 [5' factor and neurotrophin-3 genes were detected in the adult phosphorylated as described (8)] and oligonucleotide 4A1RI human brain, suggesting that these proteins are involved in the (AGAGAATTCDATNCKDATRAANCKCCA). After 15 maintenance of the adult nervous system. Neurotrophin-3 is cycles of PCR amplification, fresh dNTPs (all four dNTPs, also expected to function in embryonic neural development. each at a final concentration of 0.1 mM) and 5 units of Escherichia coli DNA polymerase I, Klenow fragment, were During normal vertebrate development, large percentages added. After incubation for 1 hr at 20TC, the reaction mixture (up to 80%) of the neurons born into diverse cell populations was phenol-extracted twice, ethanol-precipitated, and di- within the forming nervous system die (1, 2). This is thought gested with 10 units of EcoRI. Restriction fragments were to be a mechanism that ensures that adequate numbers of purified on a 3% NuSieve gel and ligated to Sma IlEcoRI- neurons establish appropriate innervation densities with ef- digested M13mpl9. Subsequent sequence analysis of the fector organs or other neuronal populations. In several in- NT-3 gene showed that oligonucleotides 2C1, 2B2, and 4A1' stances, the innervation target of a population of neurons has had zero, two-, and two-nucleotide mismatches, respec- been shown to have a crucial role in regulating the number of tively, with the NT-3 DNA sequence. Human genomic DNA surviving neurons (for review, see ref. 2). Many observations for use in the amplification reactions was purified as de- indicate that targets ofneuronal innervation produce a limited scribed (9), with K.R.J. providing source material. supply of neurotrophic factors and that competition between Plaque Hybridization Screening ofM13 Clones. Oligonucle- responsive neurons for these factors determines which neu- otides 3C1P (RTCDATICCICKGCANCC; where I is ino- rons survive (1). Two distinct neurotrophic factors, nerve sine) and 3D1P (GCANTRNGARTTCCARTG) were 5'- growth factor (NGF) and brain-derived neurotrophic factor phosphorylated with [ty-32P]ATP and hybridized (8) with (BDNF), have been purified and are known to be sufficient nitrocellulose filter lifts of the M13 plaques obtained by in vivo to reduce the amount of naturally occurring neuronal transformation ofE. coli strain TG1 with the ligation reaction cell death in portions of the peripheral nervous system (3, 4). mixture described above. After washing three times at 20TC Evidence also suggests that NGF modulates neurotrans- and once at 30TC in 6x SSC (1x SSC is 150 mM NaCI/15 mM mitter synthesis and neuronal morphology in the adult ner- sodium citrate)/0.1% SDS, signals were visualized by auto- vous system (e.g., refs. 5, 6). radiography. The amino acid and nucleotide sequence similarity ofNGF Isolation and Sequencing of Genomic Clones. A human and BDNF suggested that these neurotrophic factors could genomic library [kindly provided by Mike Blanar (UCSF, San be part of a larger gene family. Other members of this family Francisco); constructed in the A DASH vector by using could have important roles in the development and mainte- leukocyte DNA] was screened with single-stranded probes nance ofthe nervous system. Therefore, to attempt to isolate containing BDNF or NT-3 PCR products by using standard genes related to NGF and BDNF, we initiated a screen hybridization methods (8). Restriction fragments [6-kilobase involving the polymerase chain reaction (PCR) (7). By using (kb) BamHI-EcoRI (NT-3) or 3-kb EcoRI (BDNF)J from the this screen, we have isolated and characterized* a third NT-3 and BDNF A phage clones thus isolated were subcloned member of the NGF family, neurotrophin-3 (NT-3), and the into pBluescript KS. DNA sequence was determined from human BDNF gene. these subclones by using reagents and protocols provided in a kit (United States Biochemical). MATERIALS AND METHODS RNA Isolation and Analysis. Total RNA was prepared from human 89-13 an PCR and Subcloning of PCR Products. Oligonucleotides frozen brain specimens (patients and 90-23, 2C1 (AARCARTAYTTYTWYGARAC; where R is a purine, Abbreviations: NGF, nerve growth factor; BDNF, brain-derived neurotrophic factor; NT-3, neurotrophin-3; PCR, polymerase chain The publication costs of this article were defrayed in part by page charge reaction. payment. This article must therefore be hereby marked "advertisement" *The sequences reported in this paper have been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession nos. M37762 and M37763). 8060 Downloaded by guest on September 30, 2021 Neurobiology: Jones and Reichardt Proc. Natl. Acad. Sci. USA 87 (1990) 8061 85-year-old male and a 73-year-old female, respectively) or TAACACAGACTCAGCTGCCAGAGCCTGCTCTTAACACCTGTGTTTCCTTTT 51 placenta by extraction with guanidine isothiocyanate and * H R L S C Q S LL L T P V F P F sedimentation through cesium chloride (8). Polyadenylylated CAGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTT 102 RNA was isolated (8), fractionated on a 1.5% agarose/ O I L 0 V N K V M S I L FY V I F -130 CTCGCTTATCTCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTG 153 formaldehyde gel (8), and transferred by capillary action to L A Y L R G I 0 G NN M OD R S' L -113 Hybond-N (Amersham). 94-750 of the Nucleotides NT-3 CCAGAAGACTCGCTCAATTCCCTCATTATTAAGCTGATCCAGGCAGATATT 204 sequence or nucleotides 42-741 of the human BDNF se- P E D S LN S L I I K L I Q A D, I -96 quence were amplified by using the PCR from plasmids TTGAAAAACAAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTLCAG 255 containing the NT-3 or BDNF genes (see above), subcloned L K N K L S K 0 M V D V K E N Y 0 -79 into M13mp19, and single-stranded probes were prepared AGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGGAGCGGGGAGGGCCC 306 from the resulting templates with [a-32P]dCTP (3000 Ci/ S T L P K A E A P R E P E R G G P -62 mmol; 1 Ci = 37 GBq; Amersham) by using standard pro- GCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGCTGCGA 357 cedures (8). Hybridizations were performed at 650C in 5x A K S A F 0 P V I A M D T E LL R -45 SSC/5 x Denhardt's solution/0.5% SDS/salmon-sperm CAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCC 408 DNA (200 ,ug/ml). (lx Denhardt's solution is 0.02% poly- 0 0 R R Y N S P R V L L S D S T P -28 TTGGAGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTG 459 vinylpyrrolidone/0.02% Ficoll/0.02% bovine serum albu- LE P P P L Y L M E D Y V G S P V -11 min.) After washing for a total of 60 min in four changes of GTGGCGAACAGAACATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCAC 510 0.5x SSC/0.1% SDS at 650C, signals were detected by V A N R T S R R K R Y A E H K SH +7 autoradiography at -70'C with an intensifying screen. To * -l1t+1 compare RNA amounts in the various samples, we used a CGAGGGGAGTACTCGGTATGTGACAGTGAGAGTCTGTGGGTGACCGACAAG 561 restriction fragment from the human p2-tubulin 3' untrans- R G E Y S V C 0 S E S L W V T D K +24 lated region (10). TCATCGGCCATCGACATTCGGGGACACCAGGTCACGGTGCTGGGGGAGATC 612 S S A I D I R G H 0 V T V L G E I +41 RESULTS AAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAACGCGATGTAAG 663 K T G N S P VK 0 Y F Y E T R C K +58 Isolation of Neurotrophic Factor Genes. Degenerate oligo- GAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACTGG 714 nucleotides having sequences derived from the amino acid E A R P VK N G C R G I D D K H W +75 sequence conserved between NGF from several species and AACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAG 765 porcine BDNF (oligonucleotides 2C1, 2B2, and 4A1', see N S 0 C K T S 0 T Y V R A L T S E +92 Fig. 3) were used to amplify human genomic DNA in PCRs.