DISTRIBUTION OF CULTURABLE VIBRIO SPECIES IN FRESHWATER RESOURCES OF CACADU, OR TAMBO AND CHRIS HANI DISTRICT MUNICIPALITIES

BY

GAQAVU SISIPHO

A dissertation submitted in fulfillment of the requirements for the degree of

MASTERS IN MICROBIOLOGY

DEPARTMENT OF BIOCHEMISTRY AND MICROBIOLOGY FACULTY OF SCIENCE AND AGRICULTURE UNIVERSITY OF FORT HARE ALICE, SOUTH AFRICA

SUPERVISOR: PROF A.I OKOH

2017

DECLARATION

I, the undersigned, declare that this dissertation entitled “Distribution of culturable Vibrio species in freshwater resources of Cacadu, OR Tambo and Chris Hani District Municipalities” submitted to the University of Fort Hare for the degree of Masters in Microbiology in the Faculty of

Science and Agriculture, School of Biological and Environmental Sciences, and the work contained herein is my original work with exemption to the citations and that this work has not been submitted at any other University in partial or entirely for the award of any degree.

Name: Sisipho Gaqavu

Signature:......

Date:……………………………………….

i

DEDICATION

I dedicate my dissertation work to my Lord “Jesus Christ”. Your mercy and faithfulness never cease to amaze me.

ii

ACKNOWLEDGEMENTS

I would like to thank God for giving me the power to finish this project.

I wish to express my profound gratitude to my supervisor, Professor Anthony Okoh, for providing me an opportunity of pursuing my Masters Degree, for guiding me throughout my studies. I appreciate his guidance, constructive comments, and constant support all the way through the writing of the dissertation. I am grateful to have him as my supervisor. I would also like to thank Dr Ben Iweriebor, who has been like a father; I want to thank him for his encouragement, mentorship and support.

I wish to express my gratitude to the National Research Foundation (NRF) for offering me

Bursary/ scholarship award to pursue the Masters degree. I would also like to thank my wonderful colleagues at the Applied Environmental Microbiology Research Group members more especially the cholera group for their support and mentorship.

To save the best for last, I am extremely grateful to my parents (Nomawethu Constance Gaqavu and Sithile Alfred Gaqavu). I appreciate your firm support, encouragement, your sacrifices and your prayers. You are the most wonderful gifts from God. To my sisters Amanda and Mihle and my brother Lubabalo, thank you for love and encouragement. To my best friend Zilungele Qolo, you have been a great blessing in my life.

iii

ABSTRACT

Freshwater resources are essential to the survival of all living organisms and are used for numerous purposes such as domestic, industrial, agricultural and recreational activities.

Nevertheless they are vulnerable to contamination including by pathogenic organisms. Among the pathogens distributed in water resources, diarrhoea causing pathogens such as Vibrio species are the most frequently encountered, hence, the aim of this study was to evaluate the incidence of pathogenic Vibrio species in freshwater resources in Cacadu, OR Tambo and Chris Hani District

Municipalities. Water samples were collected from four rivers located in Cacadu, OR Tambo and

Chris Hani District Municipalities in the Eastern Cape Province, South Africa. A total of 6 physicochemical parameterswere measured and includes: temperature, total dissolved solids

(TDS), dissolved oxygen, turbidity, pH and electrical conductivity. Samples were collected between March and May 2016and concentrated using the standard membrane filtration technique and plated on TCBS agar. Yellow and green colonies on TCBS agar were enumerated as presumptive Vibrio species and expressed as CFU/100ml for each river. The identification of the presumptive Vibrio species and their antibiogram characteristics were done using both culture based and molecular techniques.

The physicochemical qualities ranged as follows: pH (7.0-7.03), temperature (16 - 23 ºC), turbidity (15.6 – 43 NTU), electrical conductivity (61.1 – 835μS/cm), dissolved oxygen (7.34 –

8.73 mg/L), total dissolved solids (39.3 – 533.33 mg/L). Statistical analysis showed that pH, temperature, turbidity, dissolved oxygen were significantly different (P < 0.05), whereas the total

iv

dissolved solids were not significantly different (P ˃ 0.05) with respect to sampling sites. Vibrio densities ranged between 3.08 ×101-6.96 ×101 with Bloukrans River characterized by high counts compared to other rivers. Two hundred and three (203) positive Vibrio genus isolates were screened for speciation. Of these, the prevalent species found was V. cholerae (29%) followed by V. vulnificus (4%), V. fluvialis (4%) and the least was V. parahaemolyticus (3%).

The remaining unidentified 60% were alleged to belong to other Vibrio species not covered within the scope of this study. The antibiotic susceptibility profiles of confirmed Vibrio genus isolates recovered from the four rivers revealed that 83% of Vibrio isolates in this study exhibited resistance againstthree or more antimicrobial agents.

The presence of the following Vibrio pathogens V. fluvialis, V. cholerae, V. vulnificus and V. parahaemolyticus in water resources suggests that these water resources are significant reservoirs of Vibrio pathogens. Thus, there is a need for regular contamination monitoring programme of the selected water resources and other areas that might be of interest. In general, the results obtained from this study suggest that the river waters are not suitable for drinking, domestic or recreational use.

v

Table of Contents DEDICATION ...... ii ACKNOWLEDGEMENTS ...... iii ABSTRACT ...... iv LIST OF FIGURES ...... viii LIST OF TABLES ...... ix CHAPTER 1 ...... 1 GENERAL INTRODUCTION ...... 1 1.1 Background of the study ...... 1 1.2 Problem statement ...... 3 1.3 Hypothesis...... 5 1.4 Aim and objectives ...... 5 CHAPTER TWO ...... 6 LITERATURE REVIEW ...... 6 2.1 Vibrio species ...... 6 2.2 Human pathogenic Vibrio species ...... 7 2.2.1 Vibrio parahaemolyticus ...... 9 2.2.2 Vibrio vulnificus ...... 10 2.2.3 Vibrio fluvialis ...... 11 2.2.4 Vibrio cholerae ...... 12 2.3 Epidemiology ...... 14 2.4 Survival in the environment ...... 16 2.5 Freshwater resources as reservoir of Vibrio species...... 19 2.6 Sources of pollution in freshwater resources ...... 20 2.6.1 Final effluents of WWTP as one of the largest source of pollution ...... 21 2.7 Antibiotic resistance of Vibrio species ...... 23 CHAPTER 3 ...... 26 MATERIALS AND METHODS ...... 26 3.1 Reconnaissance visit of sampling sites ...... 26 3.2 Description of sampling site ...... 26

vi

3.3 Sampling and analytical procedures ...... 30 3.3.1 Physicochemical analyses ...... 30 3.3.2 Estimation of Vibrio densities ...... 30 3.3.3 Detection of Vibrio species in genomic DNA of the water samples ...... 31 3.3.4 Detection of Vibrio species among pure culture isolates from the water samples...... 32 3.4 Antibiotic susceptibility test...... 33 3.5 Statistical analysis ...... 34 CHAPTER 4 ...... 35 RESULTS ...... 35 4.1 Physiochemical parameters ...... 35 4.2Vibrio species distribution ...... 37 4.3 Molecular Identification ...... 39 4.4 Antibiotic susceptibility test...... 43 4.4.1 Multiple antibiotic resistance (MAR) phenotypes and MAR indices (MARI) ...... 48 CHAPTER 5 ...... 53 DISCUSSION ...... 53 Conclusion ...... 58 Recommendations ...... 59 REFERENCES ...... 61

vii

LIST OF FIGURES

Figure 2.1: Schematic showing classification of toxigenic and non-toxigenic V. cholerae serogroups………………………………………………………………………………………..13

Figure 3.1: A map showing the selected district municipalities in the Eastern Cape Province………………………………………………………………………………………….29

Figure 4.1: Mean values of Vibrio counts obtained for each sampling location………………..38

Figure 4.2: Gel picture representing molecular confirmation of the variable region around positions of 100 and 1325 within the 16S rRNA (for Vibrio genus) from the selected rivers…..40

Figure 4.3: Gel picture representing molecular confirmation of the ompW gene (for V. cholerae) from the selected rivers………………………………...... 41

Figure 4.4: Gel picture representing molecular confirmation of flaE gene (for V. parahaemolyticus) from the selected rivers …………………………………………………….41

Figure 4.5:Gel picture representing molecular confirmation of toxR gene (for V. fluvialis) from the selected rivers…………………………………………………………………………...... 42

Figure 4.6: Representative gel picture showing the presence of hsp60gene (for V. vulnificus) in Vibrio isolates from the selected rivers……………………………………...... 42

Figure 4.7: Antimicrobial resistance profiles of isolates from Mthatha River…………...... 44

Figure 4.8: Antimicrobial resistance profiles of isolates from Great Fish River…………...... 45

Figure 4.9: Antimicrobial resistance profiles of isolates from Tsomo River………………...,46

Figure 4.10: Antimicrobial resistance profiles of isolates from Bloukrans River…………...47

viii

LIST OF TABLES

Table 2.1: Association of Vibrio species with different clinical syndromes…………………...…8

Table 2.2: Summary of pollutants from different division and their impacts on human health and ecosystems………………………………………………………………...22

Table 3.1: Sampling points selected for Great Fish River and their coordinates………………..27

Table 3.2: Sampling points selected for Mthatha River and their coordinates……………...... 28

Table 3.3: Sampling points selected for Tsomo River and their coordinates……………… …...28

Table 3.4: Sets of primers used for identification andpathotyping of Vibrio species……...... 32

Table 4.1: The mean values of the measured physiochemical parameters of the selected rivers from Eastern Cape between March - May 2016………………………………...... 37

Table 4.2: Theincidences of Vibrio pathogens in the selected four rivers…………………..39-40

Table 4.3: Patterns of multiple antibiotic resistance phenotypes of Vibrio isolates from the four rivers…………………………………………………………………………...... 49-52

ix

CHAPTER 1

GENERAL INTRODUCTION

1.1 Background of the study

About 1.1 billion people lack access to safe drinking water worldwide (Harshfield et al., 2009).

Consequently, over three million people (mostly children) die yearly from water related diseases.

About two million of these deaths are a consequence of diarrheal diseases (UNICEF 2008) which have been documented as a leading global health problem in developing countries. Diarrheal diseases are associated with contaminated water by faecal matter and poor sanitation and hygiene

(UNICEF 2008) and is often endemic in areas that lack reliable water treatment and distribution systems (Clasen et al., 2006). The World Health Organization (2007) estimates that 94% cases of diarrhoea are preventable through increase in availability of potable water and improvement of hygiene and sanitation (WHO 2007a).

Substantial proportions of the people in sub-Saharan Africa and Oceania still use freshwater resources (e.g. rivers, streams, lakes, wetlands, and underground water reservoirs) for drinking, domestic activities, bathing, cultural and religious purposes. Also, massive majority of those that lack access to improved drinking water sources are situated in rural areas and about 93% of people using freshwater resources live in rural areas (WHO and UNICEF 2015). These water resources are vulnerable to pollution due to human activities such as population growth, urbanisation and development, agriculture; mining, climate change etc (Palaniappan et al.,2010), and communities relying on such waterbodies for their water needs are at risk of contracting waterborne diarrheal diseases (Ntema et al., 2010; Okoh et al.,2014).

1

Another factor that contributes to pollution in freshwater resourcesis the discharge of untreated or inadequately treated wastewater into such environments (Palaniappan et al., 2010; Okoh et al.,

2014) due mainly to poor operation and maintenance of wastewater treatment systems (Mema

2008). As such the treated wastewater effluents increase the load of pathogens in the receiving waterbodies such as rivers. Furthermore, Igbinosa et al., (2009) reported that inadequately treated wastewater effluents from wastewater treatment plants have been associated with death threatening diarrheal disease.

The leading causes of the diarrhoea arecorrelated to a wide range of bacteria (e.g. Yersinia enterocolitica, Campylobacter jejuni, Aeromonas spp., Escherichia coli, Salmonella spp., and Vibrio cholerae), enteroparasites (e.g. Criptosporidiumspp., Giardia spp., and Entamoeba histolytica), and viruses (e.g. Norwalk virus, adenovirus, and rotavirus). Among the diarrhoea- causing bacteria, Vibrio species account for a significant degree of morbidity and mortality worldwide (Obi et al., 2004). The genus Vibrio includes more than 60 species. Vibrio parahaemolyticus, Vibrio cholerae, Vibrio vulnificus and Vibrio fluvialis are notable Vibrio pathogens mainly transmitted to humans either through consumption of sewage contaminated water or seafood (Elhadi 2013; Okoh et al., 2014).

The most common clinical manifestation of V. parahaemolyticus infection is gastroenteritis with inflammatory diarrhoea. V. vulnificus causes severe wound infections and fulminant septicaemia.

V. fluvialis has been associated with sporadic outbreaks of diarrhoea (clinically similar to cholera). V. cholerae is one of the most significant waterborne pathogens (Fernández-delgado etal., 2015). There are 193 currently recognised O serogroups of V. cholera but only O1 and

O139 causes epidemics of cholera. Cholera is a severe diarrheal induced by an enterotoxin called cholera toxin secreted by V. cholerae (Deen et al., 2008).

2

However, some V. cholera non-O1and non-O139 serotypes are associated with gastroenteritis and extra-intestinal infections in humans (Dziejman et al., 2005).

Vibrio species are autochthonous to estuaries and marine environments (Chatterjee and Haldar

2012) and can be found associated with aquatic animals such as zooplankton, finfish, shellfish etc (Turner et al., 2009; Akoachere and Mbuntcha, 2014). A previous study have shown the presence of V. cholerae from aquatic animals such as fish, crab, shrimp and cuttle fish

(Maheshwari et al., 2011). Ingestion of raw or undercooked seafood and drinking water contaminated with V. cholerae is therefore a risk factor in human health (Maheshwari et al.,

2011). Vibrio species are found in the environment as free-living organisms and they are also associated with different biofilms which allow them to persist in the natural settings longer than free-living forms (Martinez-urtaza et al., 2011). The curiosity in Vibrio species abundance is therefore of epidemiological and ecological importance.

1.2 Problem statement

According to the World Health Organisation (2007a) unsafe water, poor sanitation and hygiene account for about 9.1 percent of the worldwide burden of diseases and 6.3 percent of all mortality. In South Africa, a significant proportion of communities in the Eastern Cape Province lack access to pipe-borne water, and as such depend on water resources such as streams, dams, rivers, groundwater for recreation, drinking and domestic purposes (Momba et al., 2006b). Many of these water resources are like polluted due to discharge of industrial and municipal wastewater effluents, lack of sanitation and overcrowding and therefore pose as a health hazard to communities that rely on them (Palaniappan et al., 2010).

3

Among the diseases associated with poor sanitation, hygiene and unsafe water, diarrheal disease

(such as cholera) is one of them and it largely affects those living in developing countries (WHO and UNICEF 2009). About 88% of diarrhoeal disease is caused by inadequate sanitation and hygiene, and unsafe water supply (WHO 2007a). Diarrheal disease is mostly devastating for children and is one of the leading causes of mortality and morbidity in children under 5 years old. Worldwide, 1.3 billion cases of diarrheal diseases occur yearly in children under the age of 5 years old (Samal et al., 2008). Enteric pathogens such as rotavirus, Salmonella spp., enteropathogenic E.coli (EPEC) and EAEC and Vibrio spp., are the causes of severe diarrhoea

(Petri et al., 2008). Among these, Vibrio infections continue to be a serious hazard to public health.

Increased occurrence of emerging Vibrio species has been associated with discharge of inadequately treated wastewater effluents into the receiving waterbodies (Igbinosa et al., 2009).

The discharge of inadequately treated wastewater effluents into receiving waterbodies have increased over the years in developing countries, which have resulted to the decline of the qualities of major rivers (Naidoo and Olaniran 2014).

In some rural areas of South Africa, the presence of toxigenic V. cholerae has been detected in environmental waters (Dungeni et al., 2010). Also, the presence of other notable Vibrio pathogens (V. parahaemolyticus, V. vulnificus and V. fluvialis) in treated wastewater effluents has been reported in the Eastern Cape Province (Igbinosa et al., 2011; Okoh and Igbinosa 2010;

Igbinosa et al., 2009). Even so, only very few such reports had been on not more than five communities in the Eastern Cape Province which is grossly inadequate to make an informed report on the distribution of these pathogens in the Province, and to the best of our knowledge,

4

there is no report on the incidence of pathogenic Vibrio species in freshwater resources in

Cacadu, OR Tambo and Chris Hani District Municipalities in South Africa.

1.3 Hypothesis

I hypothesise that the selected freshwaters are not reservoirs of Vibrio pathogens.

1.4 Aim and objectives

The aim of the study is todetermine the pathogenic Vibrio species in freshwater resources in the

Cacadu, OR Tambo and Chris Hani district municipalities (DMs) in the Eastern Cape Province,

South Africa. In achieving this aim, the following specific objectives are set:

1. Carry out an overview of the freshwater resources in the three DMs.

2. Assess the incidences of the key presumptivepathogenic Vibrio species in the selected

freshwater resources.

3. Isolate, purify and characterize the presumptiveVibrio species.

4. Elucidate the phenotypic antibiotic susceptibilityprofiles of the characterized Vibrio species.

5

CHAPTER TWO

LITERATURE REVIEW

2.1 Vibrio species

The genus Vibrio is a Gram negative, asporogenous, curved rod shaped bacteria that is motile by means of single sheathed polar flagellum (Kim and Bang 2008). The bacteria belongs to the family Vibrionaceae, which also include the genera Aeromonas, Photobacterium and

Plesiomonas (Drake 2008). This genus includes more than 60 species (Asplund 2013) and its taxonomy is under constant amendment due to addition of new species. Vibrio species are facultative anaerobes capable of respiratory and fermentative metabolism (Igbinosa et al.,

2009). They produce many extracellular enzymes such as amylase, gelatinase, DNase and chitinase (Lamon 2013).

All Vibrio species utilize D-glucose as a sole or main source of energy and carbon. Species of the genus Vibrio can ferment carbohydrates without producing gas and are catalase positive.

Members of the genus Vibrio (with exception of V. metschnikovii and V. gazogene) are oxidase positive and reduce nitrates to nitrite.Vibrio species are mostly halophilic; sodium ions stimulate their growth and the concentration necessary is reflected in the salinity of their natural environment (Tantillo et al., 2004). Most Vibrio species need sea water base or a 2-3% NaCl for optimal growth (Lamon 2013).

6

Vibrio species are autochthonous to the estuarine and marine environments worldwide (Turner et al., 2009), however some Vibrio species are found in freshwater (West 1989). They can be found in the environment as free-living bacteria, in association with plankton (Martinez-urtaza et al.,

2011), particulate organic matter (POM), marine organisms, in sediment and can produce biofilms on surfaces. In the marine environment, Vibrio species play an important role for the remineralization of organic matter. However, the main attention brought to Vibrio species is related to its many pathogenic strains (Asplund 2013).

2.2 Human pathogenic Vibrio species

Vibrio infections are regarded as intestinal or extra-intestinal and the common clinical syndrome caused byVibrio pathogens include gastroenteritis; however primary septicemia and wound infection may also occur (see Table 2.1) (Daniels and Shafaie 2000). Vibrio infections are mainly categorized into two different groups: Vibrio cholera and non-cholera Vibrio infections

(Chandru et al., 2013). V. cholerae is a well-recognized pathogen (Alnaddawi et al., 2013) and serogroup O1 and O139 of V. cholerae are causative agents of cholera (Dalsgaard et al., 2000).

Non-cholera Vibrio species of medical significance include V. vulnificus, V. cholerae non-O1 , V. mimicus, V. fluvialis, V. parahaemolyticus, V. alginolyticus, V. metschnikovii, V. furnissii, V.

(Listonella) damselae, V. cincinnatiensis, V.(Grimontia) hollisae, and V. Harveyi (Maluping

2004).

Currently, there are at least 12 pathogenic Vibrio species recognized to cause human infections

(Asplund 2013), 8 of which are associated with food-borne diseases (Nsofor et al., 2014). The most notable Vibrio pathogens include V. parahaemolyticus, V. vulnificus, V. fluvialis and V. cholerae (Elhadi 2013).

7

Table 2.1 Association of Vibrio species with different clinical syndromes

ORGANISM GASTROENTERITIS WOUND PRIMARY INFECTION SEPTICAEMIA

+ ++ V. alginolyticus

V. cholerae nonO1 ++ ++ +

V. cholerae O1/O139 ++

V. damsela ++

V. fluvialis ++ (+) (+)

V. furnissii ++

V. hollisae ++ (+) (+)

(+) V. metschnikovii

V. mimicus ++ (+) (+)

V. parahaemolyticus ++ + (+)

V. vulnificus + ++ ++

Source: (Moyoshi 2013)

+, less common presentation: ++, common presentation: (+), rare presentation

8

2.2.1 Vibrio parahaemolyticus

V. parahaemolyticus was first isolated in 1950 in Japan during a large outbreak of gastroenteritis (Mahmuda et al.,2006). Since then V. parahaemolyticus has been recognized as one of the main causative agent of foodborne diseases that causes worldwide health problems

(Hara-Kudo et al., 2001). This bacterium is halophic and common in estuarine and marine settings (Qadri et al., 2005). Poor growth is observed in a media below 0.5% NaCl while optimal growth occurs at 2 - 4% NaCl, 37 oC temperature and a pH of 7.8 - 8.6 (Zulkifli et al.,

2009)

V. parahaemolyticus infection has been associated with the consumption of semi-cooked or raw seafood(Kim et al., 2012; Qadri et al., 2005; Su and Liu 2007). The main clinical manifestation of infection caused by this organism is gastroenteritis, characterized by watery diarrhoea and severe abdominal pains, fever, nausea and vomiting (Drake et al., 2007; Nair et al., 2007). It may also cause septicaemia that is life threatening to people with immune disorders. The total dose that may cause disease is greater than one million organisms (FEHD 2005). A study done in

Japan estimated that 2 × 105 to 3 ×107 cells have to be ingested for disease to manifest. This dose may be lessened by coincident consumption of antacids or most likely by food with buffering capacity (Rhamtulla et al., 2015). The pathogenicity of this bacterium in humans is associated with the presence of virulence factors such as tdh and trh genes which code for thermostable direct haemolysin (TDH) and TDH-relatedhaemolysin respectively (Rojas et al., 2011).

9

2.2.2 Vibrio vulnificus

V. vulnificus is regarded as one of the most invasive and dangerous waterborne pathogens

(Bisharat et al., 2005). This organism is a common inhabitant of seawater and is regarded as an emerging pathogen. V. vulnificus is divided into three biotypes based on phenotypic and genotypic differences, namely 1, 2 and 3.All the three biotypes have the capability to infect humans (Staley et al., 2013). This bacterium is very similar to V. parahaemolyticus in terms of cultural characteristics. However, it differs mainly in salt requirement and tolerance; V. vulnificus grows in media containing between 0.1 and 5% NaCl (FEHD 2005).

V. vulnificus infection is generally associated with consumption of contaminated raw or undercooked seafood or through exposure of skin wounds to seawater or marine animals (Hsueh et al., 2004; Stivers 2008). This opportunistic pathogen cause severe wound infections and primary septicaemia (Strom and Paranjpye 2000; Johnson et al., 2012). Wound infections range from mild wound to rapidly progressing cellulitis, erythema, and necrosis (Bisharat 2002).

Primary septicemia is characterized by chills, fever and hypotension. Patients with compromised immune systems, chronic liver disease are at high risk for fatal septicaemia (Stivers 2008).

Furthermore, clinical conditions associated with iron storage disorder or increased free iron (e.g. hemochomatosis) represents a key risk for dispersed infections since iron is an important growth factor for V. vulnificus (Jones and Oliver 2009; Horseman and Surani 2011). Factors such as capsule production, exoenzymes (collagenase, protease, elastase, phospholipase), exotoxins and a susceptible host have been associated with high virulence of V. vulnificus (Drake 2008; Al- assafi et al., 2014).

10

2.2.3 Vibrio fluvialis

V. fluvialis is one of the foodborne pathogenic bacteria and continue to be among those infectious diseases posing as possible serious hazard to public health (Penduka 2011). This bacterium was first identified in 1975 in Bahrain (Ahmed et al., 2004) and since its discovery, ithas been incriminated in sporadic cases of cholera-like diarrhoea (Khatri et al., 2013). V. fluvialis has been regarded as an emerging pathogen, usually found in coastal environment

(Ramamurthy 2014). This bacterium grows well when water temperature rises above 18 oC

(FEHD 2005).

V. fluvialis is transmitted to humans through drinking contaminated water or ingestion of raw or undercooked seafood. V. fluvialis infection usually causes watery diarrhoea with vomiting, dehydration and abdominal pain. What differentiates infections caused by V. fluvialis from cholera is the occurrence of bloody stools (Igbinosa and Okoh 2010). Other rarely documented clinical manifestations include, acute otitis, peritonitis, suppurative cholangitis and endophthalmitis (Ramamurthy et al., 2014). A seasonal pattern is demonstrated by V. fluvialis infections, with the majority of clinical illnesses occurring when salinity and temperature factors are most favourable for the bacteria’s abundance (Igbinosa and Okoh 2010).

Numerous toxins that may be important in the pathogenesis of V. fluvialis include lipase, protease, enterotoxin-like substance, hemolysin and cytotoxin. However, the precise role of the characterized pathogenic factors in producing the clinical symptoms is unclear and little definitive information about the pathogenic mechanism of V. fluvialis has been attained (Liang et al., 2013).

11

2.2.4 Vibrio cholerae

Among pathogenic Vibrio species, the most extensively studied species is V. cholerae because of its ability to cause cholera. V. cholerae is a mesophilic bacterium with optimum growth at 37°C.

This bacterium can grow in the salt range of 0.1 to 4.0% NaCl; however, optimum growth is observed at 0.5% NaCl at pH of 7.6 (FEHD 2005). Based on the somatic O antigen, V. cholerae is classified into more than 200 O-antigen serogroups (Miyoshi 2013). However, only two serogroups are reported to be the causative agents of cholera, which is V. cholerae O1 and O139 serogroup (Almagro-moreno and Boyd 2009).

Depending on the possession of three antigens, A, B and C, V. cholerae O1 can be serologically divided into three sub-types: Ogawa, Inaba and Hikojima. Inaba possesses antigens A and C;

Ogawa has antigen A and B and Hikojima possess all three antigens A, B and C .V.cholerae O1 serogroup is further divided into two biotypes designated classical and EI Tor (Tabatabaei and

Khorashad 2015). Toxigenic V. cholerae produce an enterotoxin called cholera toxin which causes the manifestation of the disease cholera (Mandal et al., 2011). Cholera causes dehydration, electrolytes loss, renal failure and death can occur within hours if no treatment is provided.Itis highly contagious, capable to occur in epidemic and pandemic forms and it is classified as the Category B bioterrorism by the Centres for Disease Control and Prevention

(Maheshwari et al., 2011).

V. cholerae belonging to other serogroups that are not linked with cholera epidemicare called non-O1 and non-O139. It has been reported that some non-O1 and non-O139 V.cholerae are pathogenic and have been associated with gastroenteritis and extra-intestinal infections in humans (Dziejman et al., 2005).

12

Vibrio cholerae

Serogroups that produce Serogroups that do not produce cholera toxin cholera toxin

Serogroups O1 and O139 non-O1 and non-O139 serogroups

Biotypes; classical; O139 Calcutta and EI Tor O139 Bengal

Serogroups

Ogawa Inaba Hikojima

Antigens

A and B A and C A,B, and C

Figure 2.1: Schematic showing classification of toxigenic and non-toxigenic

V.choleraeserogroups (Igbinosa and Okoh 2009)

13

2.3 Epidemiology

Pathogenic Vibrio species have emerged as a threat to human health and there has been a steep increase in their incidence globally (Steve et al., 2009). The curiosity in Vibrio species globally stems from the epidemiology and history of cholera.Cholera initiated thousands of years ago from Asia. Since 1817, seven major pandemics of cholera have been recognized and the seventh is ongoing (Dziejman et al., 2001; Didelot et al., 2015). The first pandemic occurred in 1826, 2nd in 1829-1851, 3rd in 1852-1860, 4th in 1863-1875, 5th in 1881-1896 and the 6thin 1899-1923. The continuing seventh pandemic started in 1961 in South Asia, extended toAfrica in 1971 and

America in 1991 (Adagbada et al., 2012). The causative agent was identified to be V. cholerae

O1 biotype El Tor. In 1992, V. cholera O139 Bengal was identified for the first time in

Bangladesh and rapidly spread to Asia and India (Finkelstein 1996).

Cholera is a key indicator of lack of socioeconomic development (Adagbada et al., 2012). It continues to be a global health concern (Maheshwari et al., 2011)despite ongoing efforts to control it (Thompson 2013) and its estimated to cause 120,000 deaths globally every year (Shittu et al., 2010). It has been reported that cholera is currently endemic in over 50 countries, affecting

3-5 million people annually (Ismail et al., 2013). Cholera was once common all over the world but it is now mainly limited to developing countries in the subtropics and tropics, mostly in

Africa, parts of Asia, South and Central America. Africa accounts for over 90% of the overall cases reported to the WHO (WHO 2007b; Kebede et al., 2010;Said et al., 2011) and it has been described as the homeland of cholera.Africais susceptible to cholera due to poor socio-economy, and lack of access to safe water and sanitation (Madoroba and Momba 2010).

14

In 2006, cholera killed at least 5000 people in Angola and its neighbouring countries (Olaniran etal., 2011). The major cholera outbreak ever reported in Africa occurred in 2008 to 2009 in

Zimbabwe, which spread rapidly through the entire country resulting in more than 100 000 cases and 4000 deaths (Rebaudet et al., 2013). Lack of access to safe, clean water and health services was the major explanation of this outbreak. Between 1991 and 2010, the reported cholera cases increased in Cameroon with 4026 cases in 1991, 5796 cases in 1996, 8005 cases in 2004 and

10759 cases in 2010(Djomassi et al., 2013). In Nigeria, cholera is highly common in northern part of the country due to poor sanitation (Dahiru and Enabulele 2015).

South Africa has not escaped the cholera attack. In 2000, South Africa experienced one of the worst cholera outbreaks in the country’s history, resulting in over 114, 000 cases and 260 reported deaths. The source of the outbreak was reported to be the Mhlathuze River, situated on the North coast of KwaZulu-Natal Province (Cottle 2002).Between 2000 and 2003, close to 130,

000 cholera cases were reported in South Africa with 396 fatalities. In 2004, the following cholera cases were reported in South Africa; 738 cases in Eastern Cape Province, 1773 in

Mpumalanga and 260 in North West(Roux 2004). In 2008, an outbreak of cholera that took place in Limpopo is one fatal example of inadequate water quality management (CSIR 2010).

Additionally, South Africa reported 3,907 cases and 22 deaths to the WHO the same year

(Madoroba and Momba 2010). On the 24thof January 2014, The SABC news online reported that

Fort Beaufort and its surrounding communities had an outbreak of diarrhoea and residents attributed the poor quality of municipal supplied water as the cause of the malady(http://article.wn.com/view/2014/01/27/45_hospitalised_in_diarrhoea_outbreak/).

15

Previous studies have concentrated on cholera causing Vibrio since it causes a severe disease.

However, several studies have included other Vibrio species of medical concern, some of which are referred as emerging pathogens capable of causing mild to severe human illnesses (Igbinosa and Okoh 2008). Emerging pathogens can be defined as those pathogens that have appeared in a new host population or have occurred before but are increasing in incidence as a consequence of long-term changes in its underlying epidemiology.Non-cholera Vibrio infections have been reported in the United State (Daniels and Shafaie 2000), Asia, Australia, Europe, The Middle

East North (Tantillo et al., 2004).

2.4 Survival in the environment

The common mechanisms by which different microorganisms increase their ability to survive in different environments include adhesionto and colonization of biotic and abiotic surfaces (Kirn etal.,2005). Therefore, it is not surprising that Vibrio species has been associated with zooplankton, particulate organic matter and sediment in the environment. The particulate organic matter and plankton represent a nutrient-rich habitatthat can selectively enrich Vibrio species and other heterotrophic bacteria (Turner 2010). It has been reported that numerous enzymes which can break down aquatic substrates have been recognized in several Vibrio species (Miyoshi

2013). These enzymes contribute to the survival of Vibrio species in the environment. For instance, the production of an extracellular enzyme called chitinase enables Vibrio species to utilize chitinous exoskeletons of some plankton as source of nitrogen and carbon (Tran et al.,

2011).

Additionally, association of Vibrio species with zooplankton and other aquatic environments may provide protection from environmental stresses (Martinez-urtaza et al., 2011). This allows

Vibrio species to persist in some aquatic environments for months to years (Akoachere and

16

Mbuntcha 2014). The associations with these biotic and abiotic surfaces range from a simple sporadic adhesion to the development of biofilms. It has been documented that bacteria involved in biofilm formations are more persistent to extreme environmental settings (Davey and Toole

2000).

Environmental factors also influence the persistence of Vibrio species in the environment

(Thompson et al., 2004). The occurrence of Vibrio species in waterbodies depends on several environmental factors (Sterk et al., 2015). The relationship between abundance of Vibrio species and environmental factors has been demonstrated by several studies (Hsieh et al., 2007; Robles et al., 2013). Environmental parameters such as temperature, salinity, pH, oxygen content, turbidity has been reported to influence the survival of Vibrio species by directly affect their growth or indirectly through ecosystem interaction (Thompson et al., 2004; Johnson et al., 2012;

Sterk et al., 2015)

Zimmerman et al., (2007) hypothesized that high nutrient level linked with high turbid and polluted water may stimulate growth of Vibrio species. Positive correlation between turbidity and Vibrio species have been reported by previous studies (Parveen et al., 2008; Zimmerman et al., 2007). Also, positive correlation between Vibrio species abundance and dissolved oxygen was shown by Igbinosa et al., (2011), which was supported in another study conducted by

Robles et al.,(2013). However, this is in contrast with observations reported by Prasanthan etal.,

(2011), in which dissolved oxygen showed a negative correlation towards Vibrio species.

Prasanthan et al.,(2011) further stated that the genus Vibrio can tolerate low levels of oxygen since it is a facultative anaerobic group.

17

Vibrio species are acid sensitive and they grow well at neutral and alkaline pH 9 (Tantillo et al.,

2004;Shanthakumari et al., 2015). However, selective Vibrio species have reportedly undergone a protective system called acidic tolerance response, which allowed them to survive in acidic surroundings (Wang and Gu 2005). In the V. cholerae genome, several factors such as lysine antiporter and a lysine decarboxylase have been recognized to contribute to acid tolerance response (Merrell and Camilli, 2000).

The most notable environmental factors that influence the distribution and abundance of Vibrio include temperature and salinity (Thompson et al., 2004; Johnson et al., 2012; Froelich 2013).

Turner 2010 has reported temperature and salinity as Vibrio drivers. In general, Vibrio species are mainly common in warm water temperature (Asplund 2013; Robles et al., 2013), greater than

15oC and thrive in a range of salinities (Turner 2010). There is a marked seasonal distribution for Vibrio infections cases; most happen during summer and early fall, equivalent to the period of warmer temperature. Igbinosa et al., (2011) showed positive correlation of Vibrio species abundance with temperature and salinity.

Most Vibrio species are less frequently isolated when water temperature is below 10 °C (Tantillo et al., 2004; Igbinosa 2010). Due to harsh conditions, some Vibrio species enter into a viable, but non-culturable condition (VBNC), rather than die when exposed to conditions such as low temperature and nutrients deficiency. In the VBNC state, bacteria do not form colonies in conventional culture media but are metabolically active. Vibrio species can revert to the vegetative state for their growth and multiplication under favourable conditions. The VBNC state appears to be essential for survival of population under environmental stresses, thus posing a public health concern (Tantillo et al., 2004;Hsieh et al., 2007).

18

2.5 Freshwater resources as reservoir of Vibrio species.

Freshwater resources are essential to the survival of all living organisms and are potentially very valuable. Rivers, underground aquifers, lakes are used for numerous purposes such as irrigation,sanitation, source of drinking water, industrial and municipal water supplies, industrial and municipal waste disposal and aesthetic value (UN-Water 2011) while oceans offer habitat for a big share of the planet’s food supply. However, water resources are under stress in many regions and are facing a host of threats which are caused mainly by these following factors;urban growth, expansion of agriculture, damming, diversion, over-use, climate change, deforestation and pollution (Palaniappan et al., 2010). Water pollution is a major challenge and this problem is greatest in developing countries (Briggs 2003).

Human activities are primarily responsible for the unprecedented pollution of water resources and impact the quality of water resources (CSIR 2010). Water quality has a direct influence in the quality of life. Adequate water quality leads to improved human health by sustaining healthy ecosystem. On the other hand, poor water quality has a detrimental effect onthe environment and human well-being (UN-WATER/UNEP/FAOWATER 2010). Poor water quality reduces the availability of clean water for drinking and poses as a health risk to people and the ecosystem

(Palaniappan et al., 2010). Furthermore, polluted water may likely contain a wide range of pathogens, resulting in spread of waterborne diseases such as cholera, diarrhoea, hepatitis, typhoid etc (Cabral 2010).

Among the pathogens distributed in water resources, enteric pathogens such as Shigella spp.,

Salmonella spp., enterotoxigenic Escherichia coli, Vibrio species are the ones most often encountered and account for a variety of diseases such as enteric fever, diarrhoea and dysentery

19

(Poonia 2014). Vibrio species are incriminated in diarrhoeal cases which account for a significant degree of morbidity and mortality worldwide (Obi et al., 2004). Several studies have documented the presence of toxigenic V. cholerae in water resources found in some rural areas of South Africa (Dungeni et al., 2010; Ntema et al., 2010) and it is associated to faecal pollution

(Keshav and Potgieter 2010; Ntema et al., 2010; Akoachere and Mbuntcha 2014). The presence of Vibrio pathogens in water resources becomes a health risk and a possibility of contracting cholera and other Vibrio infections. Hence, the need for regular monitoring of water resources becomes imperative.

2.6 Sources of pollution in freshwater resources

Inadequate sanitation is a primary cause of pollution. As highlighted earlier, human activities impactthe water quality of the freshwater resources, therefore, exposing communities that directly rely on this water at high risk of contracting waterborne diseases (Anyona et al., 2014).

Major pollutants include mining (increased metal content), industries (chemicals and toxin), areas with insufficient sanitation services (microbial contamination), urban wash-off and effluent return flows (nutrients, salinity and microbiological) and agricultural drainage and wash-off

(irrigation return flows, residue, nutrients and agro-chemicals) (CSIR 2010; WFA 2010). The in- stream human activities such as bathing, swimming, washing of clothes and vehicles, waste disposal often add to water quality degradation (Anyona et al.,2014) . Also, population growth, climate change and urbanization are key processes that also impact water quality (Palaniappan et al., 2010). Globally, one of the largest sources of pollution in freshwater resources is the effluents that are discharged from wastewater treatment plants (Akpor 2011).

20

2.6.1 Final effluents of WWTP as one of the largest source of pollution

Reuse of wastewater has been augmented in recent years, mainly due to lack of water resources and poor economic structures (Mounaouer and Abdennaceur 2015). Treating wastewater is significant in order to prevent contamination of waterways and also decrease the spread of infectious disease (Sadi and Adebitan 2014). Even though certain developing countries treat their wastewater, the discharge of untreated/inadequately treated effluents still remain a major concern. Several wastewater treatment systems still discharge substantial amount of pathogenic microorganisms, causing decrease in the quality of the receiving waterbodies such as rivers, ponds, streams and lakes (Nongogo and Okoh 2014). Studies have indicated that wastewater and final effluent from wastewater treatment plants is a major source of pollution in water resources causing increased number of contaminants. The reduced quality of these treated effluents is usually caused by inadequate operation and maintenance of wastewater treatment infrastructures, i.e. design weakness, faulty equipment and machinery, overloading capacity (Momba et al.,

2006a).

The South African Water Act (Act 54 of 1956), made it obligatory that wastewater effluent be treated to acceptable standards and returned to the waterbodies from where the water was initially obtained (Mema 2008). The Green Drop Progress Report (2012) shows that there is still wastewater treatment plants that discharge poorly treated effluents throughout South Africa

(Gopo 2013). The weakening state of municipal wastewater treatment plants in South Africa is one of the main causative factors to human health problems in poor communities, as shown by previous epidemics of cholera (Mema 2004). Practically no cholera cases have been seen in industrialized countries for over a century due to their well-developed water and sewage treatment infrastructure (Ali et al., 2012).

21

In the Eastern Cape Province, several studies have reported presence of Vibrio pathogens in final

effluents of WWTPs which suggests the inefficiency of the WWTPs to sufficiently eliminate

pathogens from wastewater (Okoh et al., 2014; Nongogo and Okoh 2014). Therefore, the treated

wastewater effluents are likely to enrich the receiving waterbodies with Vibrio pathogen (Mema

2008). Unfortunately, this serves as a threat to humans and animal health upon contact

withcontaminated water resources (Naidoo and Olaniran 2014).

Table 2.2: Summary of pollutants from different divisions and their impacts on human health and

ecosystems (UN-WATER/UNEP/FAOWATER, 2010).

Drivers of water Type of pollution Nature of water Impact on humans and quality degradation quality deterioration ecosystems

Human settlement Sewage effluent Increase in persistent, Outbreaks of gastrointestinal Solid waste toxic chemicals, diseases, eutrophication of Storm water increase in total and fresh water resources (such as faecal coliform lakes, rivers) and detrimental algae blooms Agriculture Runoff with Increased pesticides, Health problems associated to pesticides, fertilizer pathogens, suspended pesticide and faecal and organic matter solids, nutrients, contamination of freshwater salinity, BOD bodies, eutrophication of fresh water resources and detrimental hypoxia and algoa blooms Industry Industrial effluents Increased Increase of pollutants contaminants such as chemicals in the food chain,

22

heavy metals, atmospheric deposition and chemicals, increased biodiversity change. BOD and COD Tourism & Recreation Litter Increased chemicals, Closed beaches, boating Sewage effluent nutrients and restrictions and effects on pathogens other water uses

2.7 Antibiotic resistance of Vibrio species

The discovery of penicillin in the 1940s was followed by manufacturing of new antibiotics

(Penesyan et al., 2015). This played a remarkable role in human medicine in terms of managing

diseases (IDSA 2004). Antibiotics work by targeting the essential physiological or metabolic

functions of a bacterial cell. Antibiotic action against bacterial cell includes; inhibition of cell

wall synthesis, inhibition of protein synthesis, inhibition of nucleic acid synthesis, inhibition of

cell wall synthesis and antimetabolite activity (Kohanski et al., 2010). Nevertheless, antibiotic

resistance among bacteria have become a major global challenge in the 21stcentury(State 2011).

Antibiotic resistance occurs when an antibiotic loses its ability to effectively kill or inhibit

bacterial growth.Antibiotics such as doxycycline, erythromycin, tetracycline, and streptomycin

are generally used in the treatment of different bacterial infections, but resistance has been

reported in many bacteria such as Vibrio (Raissy et al., 2012).

The treatment of infections caused by Vibrio species may require aggressive use of antibiotics

and support care depending on the severity of the disease.For prevention of rapid dehydration in

cases of diarrhoea, oral or intravenous fluids can be recommended for rehydration. For mild

23

Vibrio infections, there is no need for antibiotics to be taken for treatment. For moderate to severeVibrio infections, antibiotics that are used for treatment include tetracyclines, fluoroquinolones, doxycycline, cephalosporins and aminoglycosides (Sharma et al., 2009).

Antibiotic treatment has been shown to reduce the period and severity of Vibrio infections.

However, antibiotic resistant of Vibriospecieshas been reported by previous studies (Rafi et al.,

2004; Okoh and Igbinosa 2010; Mandal et al., 2012; Raissy et al., 2012;Yu et al., 2012;Scarano et al., 2014).

The overuse and misuse of antibiotics by hospitalised and non-hospitalised patients is one of the factors that contribute to antibiotic resistance.Antibiotic resistance cripples the ability to fight and manage infectious diseases. It also results in prolonged illnesses, use of more expensive and toxic drugs and increased morbidity (Odonkor and Addo 2011). Antibiotic resistance in Vibrio isolates have been reported in Brazil (Rebouc et al., 2011), Italy (Scarano et al., 2014),

Mozambique (Mandomando et al. 2007), Nigeria (Chikwendu et al. 2014). In 2009, the Enteric

Disease Research Unit (EDRU) analysed 570 V. cholerae O1 isolates connected with the epidemic of cholera that occurred during the period of January 2008-May 2009 in South Africa.

Antimicrobial susceptibility testing showed that 100% of the isolates showed resistance to co- trimoxazole and nalidixic acid. For chloramphenicol, 48% of the isolates showed resistance, 3% showed resistance to tetracycline and 39% showed resistance to erythromycin (Malla et al.,

2014).

Bacteria acquire antibiotic resistance by means of the horizontal exchange of genetic material or chromosomal mutations (Furuya and Lowy 2006). Many resistant determinants are situated on mobile genetic elements e.g. plasmids, transposons and integrons which act as vectors for these

24

resistant genes, promoting their dissemination (Szczepanowski et al., 2009).Antibiotic resistant genes in V. cholerae have been usually found on plasmids. In few cases, these resistant genes have also been found on a novel conjugative transposable element (SXT) and integrons (Amita etal., 2003).

Antibiotic resistant bacteria can be directly transmitted to humans via the food chain. They also have the potential to transfer the antibiotic resistance gene to human pathogens by mobile genetic elements (Goel and Jiang 2010; Scarano et al., 2014). Thus, this pose as a threat to human health

(Malla et al., 2014).

25

CHAPTER 3

MATERIALS AND METHODS

3.1 Reconnaissance visit of sampling sites

Prior to sample collection, reconnaissance visits to the freshwater resources was done in Cacadu,

OR Tambo and Chris Hani District Municipalities (DMs) in the Eastern Cape Province. Within the stated District Municipalities, four important rivers which include Great Fish River (Chris

Hani DM), Mthatha River (OR Tambo DM), Tsomo River (Chris Hani DM) and Bloukrans

River (Cacadu DM) were considered. Furthermore, sites along the rivers that have close proximity to human settlements and farming communities were identified and prioritized.

3.2 Description of sampling site

Great Fish River

The Great Fish River (Afrikaans: Groot-Visrivier) is a river running 644 km (400 mi) through the South African Province of the Eastern Cape. The Great Fish River runs through Cradock and it originates east of Graaff-Reinet. The main tributaries of this river are the Tarka River, Groot

Brak River, and Kap River on the left side, and the Little Fish River on the right side. This river is used for numerous purposes such as; source of potable water, recreation and also there is an experimental farm that uses this river water for irrigation. Four sampling points that are close to human settlements and farms were selected.

26

Table 3.1 Sampling points selected for Great Fish River and their coordinates

Sampling point Coordinates

Point1 32°10'14.2"S 25°36'50.3"E

Point 2 32°10'31.0"S 25°36'56.0"E

Point 3 32°10'43.0"S 25°37'15.9"E

Point 4 32°10'45.0"S 25°37'18.9"E

Mthatha River

The Mthatha River is situated in the Eastern Cape Province in South Africa and it is named after the Mthatha Town (Umtata). This river flows into the Indian Ocean in a river mouth located near

Coffee Bay. The Mthatha River flows in a South Eastern direction and is about 250 km long with a catchment area of 2,600 km². The main tributaries of this river are the Cicira River and

Ngqungqu River. Communities in Transkei, most of which is rural uses water from Mthatha

River for several human related activities such as irrigation, hydroelectric generation, source of potable water, cultural purposes. The state of the water quality of the river is very poor due to discharge of raw wastewater effluents, rubbish dumping and improper sanitation practises. Two points along the River in the centre of the town close to a major wastewater works were selected.

27

Table 3.2 Sampling points selected for Mthatha River and their coordinates

Sampling point Coordinates

Point 1 31°34'58.2"S 28°47'26.6"E

Point 2 31°34'58.1"S 28°47'25.8"E

Tsomo River

The Tsomo River is located in Tsomo town and it is under Chris Hani District Municipality. This river is a tributary of Great Kei River. It originates about 10 km to the North West of Elliot town and flows southward to meet the right-hand bank of the Great Kei River. Towns situated on the banks of Tsomo River include Cala, Ncora and Tsomo. This river is used for domestic purposes and irrigation. Two points that are close to human settlement along the river were selected.

Table 3.3 Sampling points selected for Tsomo River and their coordinates

Sampling point Coordinates

Point 1 32°02'38.5"S 27°49'20.2"E

Point 2 32°02'36.9"S 27°49'22.8"E

28

Bloukrans River

The Broukrans River is located near Grahamstown and stretches to Port Alfred. This river rises near Grahamstown and then flows in a south-easterly direction, later joining the Kowie River.

The Grahamstown sewage treatment plant releases its final effluents to the Broukrans River. One accessible point was selected and its coordinate includes 33°23'27.9"S 26°42'26.1"E

Fig. 3.1: A map showing the selected district municipalities in the Eastern Cape Province. source:http://www.localgovernment.co.za/img/provinces/EasternCape_small.jpg

29

3.3 Sampling and analytical procedures

Water sample were collected from the above listed rivers between March 2016 and May 2016 using sterile 1L bottles. All the water samples were transported on ice from the sampling sites to the AEMREG (Applied and Environmental Microbiology Research Group) laboratory at the

University of Fort Hare, Alice for microbiological analysis. All the water samples were processed within 6 hours of collection. Sampling was done monthly. One sample was collected per site.

3.3.1 Physicochemical analyses

The physicochemical parameters that are related to the survival of Vibrio species in the environment such as turbidity, dissolved oxygen, temperature, total suspended solids, conductivity and pH were determined. All field meters and equipment were calibrated according to the manufactures specification. Temperature, pH, dissolved oxygen, conductivity and total suspended solids were determined on site using a multiparameter ion specific meter (Hanna instruments, version HI9828). Turbidity was measured on site using a microprocessor turbidimeter (HACH Company, model 2100P).

3.3.2 Estimation of Vibrio densities

For direct plate count analyses, the samples were serially diluted and 100 mL of each diluted was filtered through a membrane filter with pore size of 0.45μm (Millipore Corporation) under PALL vacuum/pressure pump. After the incubation period (24h-48h at 37 °C),yellow and green

30

colonies were considered as total presumptive Vibrio colonies and expressed as colony forming units per 100ml (CFU/100ml).

3.3.3 Detection of Vibrio species in genomic DNA of the water samples

The samples collected from the different rivers were evaluated for the presence of Vibrio species.

The water samples were firstly concentrated by membrane filtration technique. A volume of 100 mL of each water sample was filtered through a membrane filter with pore size of 0.45μm

(Millipore Corporation) under PALL vacuum/pressure pump. The samples were enriched by using alkaline peptone water (APW), followed by incubation at 37 °C for 18-24 hours. After incubation, totalgenomic DNA was extracted.

DNA extraction method was carried out as described by Maugeri et al., (2006) with minor modification. A volume of 1 ml of the enriched culture was transferred into sterile 2 ml

Eppendorf tubes. The Eppendorf tubes were then centrifuged at 11000 × g for 10 min. The supernatant was discarded, and the pellet was suspended in 200 μl of sterile nuclease free water and vortexed. Subsequently the cells were lysed by boiling at 100 °C for 10 minutes using an

AccuBlock (Digital dry bath, Labnet). The cell debris was removed by centrifugation at

11,000×g for 10 min using a Mini-Spinmicro-centrifuge (LASEC, RSA).The supernatant (10 μl) was transferred into new sterile Eppendorf tubes and then used as template DNA in the

Polymerase chain reaction (PCR) assays immediately after extraction.

31

3.3.4 Detection of Vibrio species among pure culture isolates from the water samples

After enrichment of the membrane filtered samples with alkaline peptide water (APW) followed

by incubation at 37°C for 18 h – 24 h, a loopfull of the enriched broth was streaked onto

thiosulphate citrate bile salts sucrose (TCBS) agar plates and incubated at 37 °C for up to 48 h.

At the end of the incubation period, typical yellow and green colonies were considered as

presumptive Vibrio species. Five to ten colonies per plate were then randomly picked and

subsequently sub-cultured on sterile TCBS agar plates for purity and molecular

identificationusing specific primers listed in Table 3.4

Table 3.4: Sets of primers used for identification and pathotyping of Vibrio species.

Target species Primer sequence (5’- 3’) Target gene Amplicon References size (bp)

All Vibrio spp. CGG TGA AAT GCG TAG AGA T 16SrRNA 663 Kwok et al., 2002

TTA CTA GCG ATT CCG AGT TC

V. cholerae CACCAAGAAGGTGACTTTATTGTG ompW 304 Alamet al., 2003 GGTTTGTCGAATTAGCTTCACC

V. parahaemolyticus GCA GCT GAT CAA AAC GTT GAG T flaE 897 Tarret al., 2007 ATT ATC GAT CGT GCC ACT CAC

V. vulnificus GTC TTA AAG CGG TTG CTG C hsp60 410 Wong and Chow 2002 CGC TTC AAG TGC TGG TAG AAG

V. fluvialis GAC CAG GGC TTT GAG GTG GAC GAC toxR 217 Osorio and Klose 2000 AGG ATA CGG CAC TTG AGT AAG ACTC

32

The thermal cycling profile for all Vibrio spp was as follows: a 15 min denaturation at 93 °C followed by 35 cycles at 92 °C for 40 s, 57 °C for 1 min and 72 °C for 1.5 min and final extension at 72 °C for 7 min.The thermal cycling profile for Vibrio vulnificus, Vibrio choleae,

Vibrio fluvialis and Vibrio parahaemolyticus was as follows: a 15 min denaturation at 93 °C followed by 35 cycles at 92 °C for 40 s, 60 °C for 1 min and 72 °C for 1.5 min and final extension at 72 °C for 7 min. The amplified products were held at 4 °C after completion of the cycles and electrophoresed using 2.0% agarose and viewed using a UV transluminator

(ALLIANCE 4.7).

3.4 Antibiotic susceptibility test

The antibiotic susceptibility test was performed to all the confirmed Vibrio isolates using the disc diffusion method on Mueller Hinton agar as described by Clinical Laboratory Standards

Institute (CLSI 2012). A total of 12 antibiotic discs (Mast Diagnostics, Merseyside, United

Kingdom) were employed which includes gentamicin (10µg),chloramphenicol (30µg), ciprofloxacin (5µg), ampicillin (25µg), penicillin G (10 µg), nalidixic acid (30µg), vancomycin

30 (µg), erythromycin (15µg), imipenem (10 µg), tetracycline (30µg), cefotaxime (30µg), cotrimoxazole (25 μg) which are the antibiotics usually prescribed to cholera patients and for which Vibrio is known to be developing resistance (Marin et al., 2013). The sensitivity of the isolates to the antibiotics was determined by measuring inhibitory zone and the Clinical

Laboratory Standard Institute (CLSI 2012) was used to interpret the results. Multiple antibiotic resistance (MAR) phenotypes, patterns and indexing were generated for the isolates that showed resistance to three or more antimicrobials. The MAR index of individual isolates was calculated using the formula described by Krumperman (1983). MAR index of isolate = No. of antibiotics

33

to which isolate was resistant / Total no. of antibiotics to which isolate was exposed. A MAR index of ≥ 0.2 indicate high risk environment where antibiotics are often used (Osundiya et al.,

2013).

3.5 Statistical analysis

Data were captured into Microsoft excel sheet 2010 and simple descriptive statistics of Statistical

Package for Social Sciences (SPSS) version 22 was used in analysing the data.

34

CHAPTER 4

RESULTS

4.1 Physiochemical parameters

The physicochemical parameters obtained from the four selected rivers in this study were compared with the South African recommended standards for domestic use and the results are shown in Table 4.1. The pH of the water samples from the different rivers varied significantly

(p<0.05). The average values of the pH from each river was 7.0 and were all within the South

African permissible limits for the pH (6.0-9.0) for domestic use (DWAF 1996).

The turbidity for Great Fish River samples varied between 15.6-18.43 NTU, while it varied between 20.73-22.27 NTU for Mthatha River and 40.8-43 NTU for Tsomo River. The variations were significant (p<0.05).The turbidity values of all the water samples from the four rivers exceeded the permissible limit of 0–1 NTU for domestic use (DWAF 1996).

The temperature for Great Fish River varied between 21 - 23 °C, while it varied between 23 -24

°C at Mthatha River and 17-18 °C at Tsomo River. The variations were significant (p<0.05).The recommended temperature for no risk is 25-30 °C for domestic use. All the water samples from the four rivers were not complying with the permissible limits for the temperature.

Dissolved oxygen concentrations varied significantly (P<0.05) at 7.61-8.4 mg/L for Great Fish

River; 7.24-7.34 mg/L for Mthatha River; and 8.30-8.54 mg/Lf or Tsomo River as shown in

Table 4.1.

35

The conductivity of the water sample did not vary significantly but ranged as follows: Great Fish

River (150.73μS/cm); Mthatha River (61.1 μS/cm- 64.3 μS/cm); and Tsomo River (131.1 μS/cm

-147.93 μS/cm). All the water samples were within the South African permissible 0-700 μS/cm, with the exception of the samples obtained from the Bloukrans River as shown in Table 4.1.

The total dissolved solids on the other hand ranged between 95.57-103.93 mg/L for Great Fish

River, 39.30-41.2 mg/L for Mthatha River and 83.5-84.03 mg/L for Tsomo River as shown in

Table 4.1. All the water samples were within the South African permissible Total Dissolved

Solids (TDS) limit of 0 – 450 mg/L except for Bloukrans River as shown in Table 4.1 and the differences in the data were not significant.

36

Table4.1: The mean values of the measured physiochemical parameters of the selected rivers from Eastern Cape between March - May 2016.

Parameters Limits Sampling site P value

(DWAF, 1996) Great fish Mthatha Bloukrans Tsomo River river river river

pH 6.0 - 9.0 7 ± 0.0 7 ± 0.0 7 ± 0 7 ± 0.0 0.000

Temp (°C) 25-30 22 ± 0.9 23 ± 0. 0 16.17 18 ± 0.7 0.001

EC (μS/cm) 0-700 152.59 62.7 ±2.3 835 ± 1.73 139.51 ±11.9 0.197 ±2.7

Turbidity 0-1 16.86 ± 1.2 21.5 ± 1.9 26 ± 0.40 41.9 ± 1.6 0.016 (NTU)

TDS (mg/L) 0 – 450 98.33 40.25 ± 1.3 533 ± 1.53 83.77 ± 0.4 0.200

DO (mg/L ) 8-10 at 25 °C 7.98 7.29±0.1 8.73 ± 0.13 8.42 ±0.2 0.000

4.2Vibrio species distribution

The presumptive Vibrio counts from each of the rivers are shown in Figure 4.1 below. The guideline for faecal coliforms was used as the base limit for the assessment of the Vibrio species.

For domestic use, the target water quality range for faecal coliforms is 0 (DWAF, 1996).

37

For Great Fish River, the presumptive Vibrio counts range varied between 1.03-8.9

×101CFU/100ml.For Tsomo River, the Vibrio counts range was 5.75-5.8 ×101CFU/100ml while for Mthatha River the range was 3.06-3.1 ×101CFU/100ml. The counts for Bloukrans River was

6.96 ×101CFU/100ml. Based on the calculated average for presumptive Vibrio spp, all the rivers did not comply with the target water quality range for faecal coliforms.

80

70

60

50

counts (cfu/100ml) 40 Vibrio 30

Mean totalMean 20

10

0 Great Fish River Tsomo River Mthatha River Bloukrans river

SAMPLING SITES Figure 4.1: Mean values of Vibrio counts obtained for each sampling location.

38

4.3 Molecular Identification

The total number of isolates obtained was 215, of which 203 were positive for Vibrio genus. All the isolates obtained from the Tsomo River were positive for the Vibrio genus, while 90 out of the 95 (95%) presumptive isolates obtained from Great Fish River were confirmed to belong to the Vibrio genus. In addition, 86% of the presumptive Vibrio isolates obtained from the Mthatha

River were confirmed to belong to the Vibrio genus. Of the 25 recovered isolates from Broukrans

River, 92% belonged to the Vibrio genus. Furthermore, the speciation of the positive Vibrio genus isolates showed that V. cholerae was recovered in all the four study rivers, while V. vulnificus and V. parahaemolyticus was recovered only in the Great Fish River. V. fluvialis was only recovered from the Mthatha River and absent in the other three rivers.

Table 4.2: The incidences of Vibrio pathogens in the selected four rivers.

Water Total Isolates sample number positive for V. cholerae V. vulnificus V.parahaemol V. fluvialis sources of Vibrio genus yticus isolates

Great fish 95 90 (95%) 23 (26%) 8 (9%) 5 (6%) 0 river

Mthatha 35 30 (86%) 9 (30%) 0 0 8 (9%) river Tsomo 60 60 (100%) 5 (8.3%) 0 0 0 river

39

Broukrans 25 23 (92%) 22 (96%) 0 0 0 river

Total 215 203 (94%) 59 (29%) 8 (4%) 5 (3%) 8 (4%)

L PC NC 1 2 3 4 5 6 7 8 9 10

663

Figure 4.2: Gel picture representing molecular confirmation of the variable region around

positions of 100 and 1325 within the 16S rRNA (for Vibrio genus) from the selected rivers.

L: ladder (Molecular Marker Thermo scientific, 100 bp), PC: positive control (V. parahaemolyticus-DSM

10027), NC: negative control (water + all PRC components), lane 1-10: isolates.

40

L PC NC 1 2 3 4 5 6 7 8 9 10 11

304

Fig 4.3: Gel picture representing molecular confirmation of the ompW gene (for V.

cholerae) from the selected rivers. L: ladder (Molecular Marker Thermo scientific, 100 bp), PC:

positive control (Vibrio cholerae serotype O1-DSM 10027), NC: negative control (water + all PRC

components), lane 1-11: isolates.

L PC NC 1 2 3 4 5

897

Figure 4.4: Gel picture representing molecular confirmation of flaE gene (for V.

parahaemolyticus) from the selected rivers. L: ladder (Molecular Marker Thermo scientific, 100

bp), PC: positive control (V. parahaemolyticus-DSM 10027), NC: negative control (water + all PRC

components), lane 1-5: Isolates

41

L PC N 1 2 3 4 5

217

Figure 4.5:Gel picture representing molecular confirmation of toxR gene (forV. fluvialis)

from the selected rivers. L: ladder (Molecular Marker Thermo scientific, 100 bp), PC: positive control

(V. fluvialis-DMS 19283), NC: negative control (water + all PRC components), lane 1-5: isolates

L PC N 1 2 3 4 5 6 7

410

Figure 4.6:Representative gel picture showing the presence of hsp60 gene (for V. vulnificus)

in Vibrio isolates from the selected rivers. L: ladder (Molecular Marker Thermo scientific, 100 bp),

PC: positive control (V. vulnificus- DSM 10143), NC: negative control (water + all PRC components),

lanes 1-7: isolates.

42

4.4 Antibiotic susceptibility test

The 203 confirmed Vibrio genus isolates were profiled for their antibiotics susceptibility pattern against a panel of 12 different antibiotics. The percentages of the isolates recovered from

Mthatha River that showed resistance against the antibioticsfollow the orders: gentamycin

(30%), ciprofloxacin (27%), tetracycline (40%), imipenem (37%), chloramphenicol (100%), cefotaxime (90%), ampicillin (27%), penicillin G (100%), trimethoprim-Sulfamethoxazole

(13%), nalidix acid (90%), vancomycin (83%) and erythromycin (67%) (Figure 4.7) while those recovered from Great Fish River followed the order: gentamycin(21%), ciprofloxacin (6%), tetracycline (42%), imipenem (72%), chloramphenicol (35%), cefotaxime (89%), ampicillin

(59%), pencillin G (100%), trimethoprim-Sulfamethoxazole (18%), nalidix acid (97%), vancomycin (97%) and erythromycin (82%) (Figure 4.8).

43

100

90

80

70

60

50 Resistance 40 Intermediate

30 Susceptibility

20 %Resistance/Intermidiate/Susceptibility 10

0

Antibiotics

Figure 4.7: Antimicrobial resistance profiles of isolates from Mthatha River. GM10 =

Gentamicin 10µg, C30 = Chloramphenicol (30 µg), CIP5= Ciprofloxacin 5µg, AP25= Ampicillin 25 µg,

PG 10 = Penicillin 10 µg, IMI10= Imipenem 10 µg, T30= Tetracycline, CTX30= Cefotaxime 30 µg,

TS25= Trimethoprim-Sulfamethoxazole 25µg, NA30= Nalidixic acid 30 µg, VA30= Vancomycin, E30=

Erythromycin 30 µg

44

100

90

80

70

60

50 Resistance 40 Intermediate Susceptibility

30

Resistance/Intermidiate/Susceptibility % 20

10

0

Antibiotics

Figure 4.8: Antimicrobial resistance profiles of isolates from Great Fish River. GM10 =

Gentamicin 10µg, C30 = Chloramphenicol (30 µg), CIP5= Ciprofloxacin 5µg, AP25= Ampicillin 25 µg,

PG 10 = Penicillin 10 µg, IMI10= Imipenem 10 µg, T30= Tetracycline, CTX30= Cefotaxime 30 µg,

TS25= Trimethoprim-Sulfamethoxazole 25µg, NA30= Nalidixic acid 30 µg, VA30= Vancomycin, E30=

Erythromycin 30 µg

Also, the percentages of the isolates recovered from Tsomo River exhibiting resistance against the antibiotics were as follows: gentamycin (60%), ciprofloxacin (55%), tetracycline (45%), imipenem (68%), chloramphenicol (77%), cefotaxime (23%), ampicillin (60%), pencillin G

(100%), trimethoprim-Sulfamethoxazole (28%), nalidix acid (92%), vancomycin (100%) and erythromycin (95%) (Figure 4.9); while those from Bloukrans River were: gentamycin (26%),

45

ciprofloxacin (57%), tetracycline (65%), imipenem (43.5%), chloramphenicol (48%), cefotaxime

(70%), ampicillin (61%), pencillin G (96%), trimethoprim-Sulfamethoxazole (13%), nalidix acid

(78%), vancomycin (96%) and erythromycin (87%) (Figure 4.10).

100

90

80

70

60

50 Resistance

40 Intermediate Susceptibility 30

%Resistance/Intermidiate/Susceptibility 20

10

0

Antibiotics

Figure 4.9: Antimicrobial resistance profiles of isolates from Tsomo River. GM10 =

Gentamicin 10µg, C30 = Chloramphenicol (30 µg), CIP5= ciprofloxacin 5µg, AP25= Ampicillin 25 µg,

PG 10 = Penicillin 10 µg, IMI10= Imipenem 10 µg, T30= tetracycline, CTX30= Cefotaxime 30 µg,

TS25= Trimethoprim-Sulfamethoxazole 25µg, NA30= Nalidixic acid 30 µg, VA30= vancomycin, E30=

Erythromycin 30 µg

46

100

90

80

70

60

50 Resistance 40 Intermediate Susceptibility 30

%Resistance/Intermidiate/Susceptibility 20

10

0

Antibitics

Figure 4.10: Antimicrobial resistance profiles of isolates from Bloukrans River. GM10 =

Gentamicin 10µg, C30 = Chloramphenicol (30 µg), CIP5= ciprofloxacin 5µg, AP25= Ampicillin 25 µg,

PG 10 = Penicillin 10 µg, IMI10= Imipenem 10 µg, T30= tetracycline, CTX30= Cefotaxime 30 µg,

TS25= Trimethoprim-Sulfamethoxazole 25µg, NA30= Nalidixic acid 30 µg, VA30= vancomycin, E30=

Erythromycin 30 µg

47

4.4.1 Multiple antibiotic resistance (MAR) phenotypes and MAR indices (MARI)

The multiple antibiotic resistant (MAR) phenotype and MAR indices (MARI) of the Vibrio isolates obtained from the four rivers are shown in Table 4.4. The MAR phenotypes show that about 83% of Vibrio isolates in this study displayed resistance against three or more antimicrobial agents.

For Great Fish River: 1, 11, 14, 34, 19,11, 6 and 3% of the isolates showed multiple antibiotic resistance to four, five, six, seven, eight, nine, ten and eleven antimicrobials respectively. The

MAR indices ranged between 0.3 – 0.91. For Bloukrans River: 4,9, 17,13, 26, 22 and 9 % of the isolates showed multiple antibiotic resistance to four, five, six, seven, eight, nine and ten antimicrobials respectively. The MAR indices ranged between 0.3 – 0.83. Whereas for Mthatha

River: 13, 10, 20,17, 20, 10 and 10% of the isolates showed multiple antibiotic resistance to four, five, six, seven, eight, nine and ten antimicrobials respectively. The MAR indices ranged between 0.3 – 0.83. For Tsomo River: 4, 2, 31, 29,16, 16 and 2% of the isolates showed multiple antibiotic resistance to five, six, seven, eight, nine, ten and eleven antimicrobials respectively.

The MAR indices ranged between 0.42 – 0.91.

48

Table 4.3 Patterns of multiple antibiotic resistance phenotypes (MARPs) of Vibrio isolates from the four rivers.

Great Fish River (N=71)

No. of No. of antibi antibi- otics MARI MARI pattern otics MARI MAR pattern VA-E-PG-NA 4 0.33 E-AP-TS-T-CTX-PG-NA 7 0.580.58 IMI-VA-AP-CTX-PG 5 0.42 IMI-VA-E-AP-CIP-PG-NA 7 0.580.58 IMI-VA-CTX-PG-NA 5 0.42 VA-E-AP-CIP-CTX-PG-NA 7 0.580.58 IMI-VA-GM-PG-NA 5 0.42 IMI-VA-E-AP-CTX-PG-NA 7 0.580.58 VA-E-CTX-PG-NA 5 0.42 IMI-VA-E-C-CTX-PG-NA 7 0.58 VA-E-T-PG-NA 5 0.42 0.42 IMI-VA-E-CIP-CTX-PG-NA 7 0.58 VA-E-CTX-PG-NA 5 0.42 0.42 IMI-VA-E-T-CTX-PG-NA 7 0.58 IMI-VA-E-CTX-NA 5 0.42 0.42 IMI-VA-E-CIP-CTX-PG-NA 7 0.58 VA-CTX-GM-PG-NA 5 0.42 0.42 IMI-VA-E-T-CTX-PG-NA 7 0.58 IMI-VA-E-CTX-PG-NA 6 0.5 0.5 IMI-VA-AP-T-CTX-PG-NA 7 0.58 VA-C-T-CTX-PG-NA 6 0.5 0.5 IMI-VA-E-CIP-CTX-PG-NA 7 0.58 VA-E-AP-CTX-PG-NA 6 0.5 0.5 IMI-VA-E-C-CTX-PG-NA 7 0.58 IMI-VA-E-T-PG-NA 6 0.5 0.5 IMI-VA-E-T-CTX-PG-NA 7 0.58 IMI-E-AP-CTX-PG-NA 6 0.5 0.5 IMI-VA-E-AP-CTX-PG-NA 7 0.58 IMI-VA-E-AP-PG-NA 6 0.5 0.5 VA-E-AP-T-CTX-PG-NA 7 0.58 VA-E-AP-CTX-PG-NA 6 0.5 0.5VA -E-AP-T-CTX-PG-NA 7 0.58 IMI-VA-E-CTX-PG-NA 6 0.5 0.5VA -E-AP-T-CTX-PG-NA 7 0.58 IMI-VA-CTX-GM-PG-NA 6 0.5 VA-E-AP-C-CTX-PG-NA 7 0.58 VA-E-AP-CTX-PG-NA 6 0.5 IMI-VA-C-T-CTX-PG-NA 7 0.58 IMI-VA-AP-T-CTX-PG-NA 7 0.58 IMI-VA-E-T-CTX-PG-NA 7 0.58 IMI-VA-E-C-CTX-PG-NA 7 0.58 IMI-VA-E-AP-CTX-PG-NA 7 0.58 VA-E-AP-C-CTX-PG-NA 7 0.58 IMI-VA-E-CIP-TS-PG-NA 7 0.58 VA-E-AP-T-CTX-PG-NA 7 0.58 IMI-VA-E-C-T-GM-PG-NA 8 0.67 IMI-VA-E-AP-CTX-PG-NA 7 0.58 IMI-VA-E-AP-C-CTX-GM-PG-NA 9 0.75 0.75 IMI-VA-E-AP-T-PG-NA 7 0.58 VA-E-AP-C-T-CTX-GM-PG-NA 9 0.75 0.75 49 VA-E -C-TS-T-CTX-PG-NA 8 0.67 IMI-VA-E-AP-C-T-CTX-PG-NA 9 0.75 0.75 IMI-VA-E-AP-T-CTX-PG-NA 8 0.67 IMI-VA-E-AP-C-TS-CTX-PG-NA 9 0.75 0.75 VA-E-AP-T-CTX-GM-PG-NA 8 0.67 IMI-VA-E-TS-T-CTX-GM-PG-NA 9 0.75 0.75

VA-AP-C-TS-CTX-GM-PG-NA 8 0.67 IMI-VA-E-AP-C-CTX-GM-PG-NA 9 0.75 0.75 IMI-VA-E-AP-CTX-GM-PG-NA 8 0.67 IMI-VA-E-CIP-TS-T-CTX-PG-NA 9 0.75 IMI-VA-E-AP-T-CTX-PG-NA 8 0.67 VA-E-AP-TS-T-CTX-GM-PG-NA 9 0.75 IMI-VA-E-CIP-C-GM-PG-NA 8 0.67 GM-C-AP-PG-NA-VA-E-IMI-CTX-TS 10 0.83 IMI-VA-E-AP-T-CTX-PG-NA 8 0.67 IMI-VA-E-AP-C-TS-T-CTX-PG-NA 10 0.83 IMI-VA-E-C-T-CTX-PG-NA 8 0.67 IMI-VA-E-AP-C-T-CTX-GM-PG-NA 10 0.83 IMI-VA-E-AP-T-CTX-PG-NA 8 0.67 IMI-VA-E-AP-C-TS-T-CTX-GM-PG-NA 11 0.91 IMI-VA-AP-C-CTX-GM-PG-NA 8 0.67 GM-C-CIP-AP-PG-NA-VA-E-IMI-T-E 11 0.91 0.75 IMI-E-AP-C-TS-CTX-PG-NA 8 0.67

Bloukrans River ( N=23)

MAR pattern No. of MARI MARI pattern No. of MARI antibioti antibi cs otics PG-CTX-NA-VA 4 0.33 C-T-E-CTX-NA-VA 6 0.5 AP-PG-CTX-NA-VA 5 0.42 0.42 CIP-AP-PG-T-E-CTX-VA 7 0.580.58 CIP-PG-E-NA-VA 5 0.42 AP-PG-E-CTX-NA-IMI-VA 7 0.580.58 AP-PG-T-E-CTX-NA 6 0.5 0.5 AP-PG-T-E-NA-IMI-VA 7 0.58 AP-C-PG-CTX-NA-VA 6 0.5 0.5 AP-GM-PG-E-CTX-NA-VA-TS 8 0.670.67 CIP-PG-E-CTX-NA-VA 6 0.5 0.5 AP-GM-PG-T-E-CTX-NA-VA 8 0.67 CIP-GM-PG-T-E-CTX-IMI-VA-TS 9 0.75 CIP-AP -PG-E-T-IMI-VA-TS 8 0.67 AP-GM-C-PG-E-CTX-NA-IMI-VA 9 0.75 CIP-AP-C-PG-T-E-IMI-VA 8 0.67 CIP-AP-C-PG-T-E-CTX-NA-VA 9 0.75 CIP-C-PG-T-E-CTX-NA-IMI-VA 9 0.75 CIP-AP-C-PG-T-E-NA-VA-TS 9 0.75 CIP-GM-C-PG-T-E-CTX-NA-IMI-VA 10 0.83 0.83 CIP-AP-C-PG-T-E-NA-IMI-VA-TS 10 0.83

Tsomo river (N=44) MAR pattern No. of MARI MARI pattern No. of MARI antibioti antibi cs otics C-PG-E-NA-VA 5 0.42 AP-GM-C-PG-E-NA-IMI-VA 7 0.58 C-PG-E-NA-IMI 5 0.42 CIP-GM-C-PG-E-NA-IMI-VA 8 0.67 GM-C-PG-T-E-VA 6 0.5 AP-C-PG-T-E-NA-IMI-VA 8 0.67 AP-PG-T-E-CTX-IMI-VA 7 0.58 AP-C-PG-T-E-CTX-NA-VA 8 0.67 C-PG-E-NA-IMI-VA-TS 7 0.58 CIP-C-PG-T-E-NA-IMI-VA 8 0.67 GM-PG-E-CTX-NA-IMI-VA 7 0.58 AP-C-PG-E-NA-IMI-VA-TS 8 0.67

50

AP-C-PG-E-NA-IMI-VA 7 0.58 AP-C-PG-T-E-CTX-IMI-VA 8 0.67 CIP-AP-C-PG-E-NA-VA 7 0.58 CIP-GM-C-PG-E-NA-IMI-VA 8 0.67 CIP-AP-PG-T-E-NA-VA 7 0.58 0.58CIP -GM-C-PG-E-CTX-NA-IMI 8 0.67 AP-GM-PG-E-NA-IMI-VA 7 0.58 CIP-AP-C-PG-E-NA-IMI-VA 8 0.67 AP-GM-PG-T-NA-IMI-VA 7 0.58 CIP-C-PG-T-E-CTX-NA-VA 8 0.67 GM-PG-T-E-CTX-NA-VA 7 0.58 CIP-AP-GM-PG-E-NA-IMI-VA 8 0.67 CIP-PG-T-E-NA-VA-TS 7 0.58 AP-GM-C-PG-T-E-NA-VA 8 0.67 CIP-AP-GM-PG-E-NA-VA 7 0.58 CIP-AP-GM-C-PG-T-E-IMI-VA 9 0.75 AP-GM-C-PG-E-NA-IMI 7 0.58 CIP -AP-GM-C-PG-T-NA-IMI-VA 9 0.75 CIP-AP-C-PG-E-NA-IMI 7 0.58 CIP-AP-GM-C-PG-E-NA-VA-TS 9 0.75 CIP-C-PG-E-NA-VA-TS 7 0.58 CIP-AP-GM-C-PG-E-CTX-NA-VA 9 0.75 AP-GM-PG-T-E-CTX-NA-VA-TS 9 0.75 CIP-AP-GM-C-PG-E-NA-IMI-VA 9 0.75 CIP-GM-C-PG-T-E-NA-IMI-VA-TS 10 0.83 CIP-GM-C-PG-E-NA-IMI-VA-TS 9 0.75 CIP-AP-GM-C -PG-T-E-CTX-NA- 10 0.83 CIP-AP-GM-C-PG-E-CTX-NA-IMI-TS 10 0.83 VA CIP-AP-GM-C-PG-T-E-NA-IMI-VA 10 0.83 CIP-AP-GM-C-PG-E-NA-IMI-VA- 10 0.83 CIP-AP-GM-PG-E-CTX-NA-IMI-VA-TS 10 0.83 TS CIP-AP-GM-C-PG-T-E-NA-IMI-VA-TS 11 0.91

51

Mthatha River (N=30) MAR pattern No. of MARI MAR pattern No. of MARI antibioti antibi cs otics C-PG-NA-VA 4 0.33 C-PG-NA-VA-E-IMI-CTX 7 0.58 C-PG-VA-E 4 0.33 C-AP-PG-NA-VA-E-IMI 7 0.580.58 C-PG-IMI-CTX 4 0.33 0.33C-PG -NA-VA-E-T-CTX 7 0.58 C-PG-VA-CTX 4 0.33 C-CIP-PG-NA-VA-E-CTX-TS 8 0.670.67 C-PG-NA-VA-CTX 5 0.42 C-PG-NA-E-IMI-T-CTX-TS 8 0.670.67 IMI-E-CTX-PG-NA 5 0.42 C-PG-NA-VA-E-IMI-T-CTX 8 0.670.67 VA-E-GM-PG-NA 5 0.42 C-CIP-AP-PG-NA-VA-E-CTX 8 0.670.68 C-AP-PG-NA-VA-CTX 6 0.5 0.5GM -C-PG-NA-VA-E-IMI-CTX 8 0.670.68 C-PG-NA-VA-T-CTX 6 0.5 0.5C -AP-PG-NA-VA-E-T-CTX 8 0.67 GM-C-PG-NA-VA-CTX 6 0.5 0.5GM -C-CIP-PG-NA-VA-E-T-CTX 9 0.75 C-PG-NA-VA-IMI-CTX 6 0.5 C-CIP-PG-NA-VA-E-IMI-T-CTX 9 0.75 GM-C-PG-NA-VA-CTX 6 0.5 0.5C -CIP-AP-PG-NA-VA-E-T-CTX 9 0.75 C-PG-NA-VA-E-CTX 6 0.5 C-CIP-AP-PG-NA-VA-E-IMI-T-CTX 10 0.83 GM-C-CIP-PG-NA-VA-CTX 6 0.5 GM-C-CIP-AP-PG-NA-VA-E-IMI-T 10 0.83 GM-C-PG-VA-E-T-CTX 6 0.5 GM-C-CIP-PG-NA-VA-E-T-CTX-TS 10 0.83

GM = Gentamicin, C = Chloramphenicol, CIP= Ciprofloxacin, AP= Ampicillin, PG = Penicillin, IMI= Imipenem, T= Tetracycline, CTX= Cefotaxime, TS= Trimethoprim-Sulfamethoxazole 25, NA= Nalidixic acid, VA= Vancomycin, E= Erythromycin

52

CHAPTER 5

DISCUSSION

Water pollution is one of the key environmental problems worldwide. It has been reported that more people die annually from the implication of unsafe water than from all forms of violence such as war (Corcoran et al., 2010). One of the most common contaminants, particularly in areas where there is limited access to clean and safe water, is pathogenic organisms. Among the pathogens distributed in water resources,diarrhoea causing pathogens such as Vibrio species are the most frequently encountered (Poonia 2014).

In this study, physicochemical qualities of the rivers (Table 4.1) suggest that the pH values were within the South African permissible limits.There are a number of factors that can affect the pH of the water. These include respiration, photosynthesis, agricultural runoff etc. Furthermore the taste of water is influenced by pH and water may taste sour at low pH whereas at high pH water tastes bitter or soapy (Conceicaoneta et al., 2007).

Water temperature is a significant factor that influences the speed of all biological behaviour and it plays an essential role in affecting metabolic rates in aquatic animals (Nishizaki and Carrington

2014). Due to the lack of regulatory standards, the temperature in this study was compared against the World Health Organization standard, as there is no set limit for this parameter in SA.

The results obtained were not within the acceptable limit (25 – 30 °C) for domestic water uses.

Change in natural water temperature cycles can result inlasting population declines in fisheries

53

and other classes of organisms by damaging the reproductive success and growth patterns (Ficke et al., 2005).

Turbidity is a determination of the light-scattering ability of water and is indicative of the concentration of suspended matter in water (DWAF 1996). The causes of turbidity include presence of suspended matter consisting of a mixture of inorganic and organic matter. The turbidity results obtained from this study were not within the South African acceptable limit (0-1

NTU) for domestic water uses. High turbidity is linked with poorer water quality. One of its negative effects includes drastically increasing water treatment costs because of the amount of flocculants needed to clarify the water. Furthermore, microorganisms such as Vibrio spp. are frequently linked with turbidity; hence low turbidity reduces the possibility for transmission of infectious diseases (Pfeffer et al., 2003; Parveen et al., 2008; Zimmerman et al., 2007).

Electrical conductivity (EC) is an evaluation of the ability of water to conduct an electrical current (DWAF 1996). All the water samples were within the South African permissible (0-700

μS/cm), with the exception of those from Bloukrans River. The low EC values obtained in the three rivers indicate the presence of low quantity of dissolved inorganic substances in the samples and the high EC value obtained in Bloukrans River indicates high amount of dissolved inorganic solvents.Short-term health effects can be expected inpeople who drink water with high

EC. Such effects include disturbance of the body's salt concentration and/or scaling balance. It has been reported that sewage disposal tend to increase the EC levels of the receiving water body due to high concentrations of salts and ions in the sewage (Morrison et al., 2001). Similar results have been observed by Igbinosa and Okoh (2009).

54

The total dissolved solid (TDS) is an evaluation of the quantity of a variety of inorganic salts dissolved in water. The TDS concentration is directly proportional to the EC of water. EC is usually used as an estimate of the TDS concentration since EC is much easier to measure than

TDS (DWAF 1996). All the water samples were within the South African permissible (0 – 450 mg/L), with the exception of those from the Bloukrans River. Even though high TDS concentration may not imply that the water is dangerous to health, however it does suggest that the water may cause nuisance problems. These problems could include staining, taste, or precipitation. Furthermore, high TDS may indicate the presence of high levels of toxic metals.

The presumptive Vibrio counts from each of the rivers (Figure 4.1) were interpreted using the guideline for faecal coliforms as the base limit for the assessment of the Vibrio species. All the rivers did not comply with the target water quality range for faecal coliforms. The non- compliance in the selected rivers shows a disappointing picture of the conditions of these rivers and this may have a detrimental effect on the health of aquatic system. The Bloukrans River had high Vibrio counts compared to the other rivers (Figure 4.1). The values of physicochemical parameters measured for Bloukrans are high and thus provides a suitable milieu for the microbial population to proliferate in the river. This comes as no surprise since poor water quality in

Bloukrans River has been reported in another study. The discharge of inadequately treated wastewater effluent (from Belmont Valley wastewater treatment plant) is one of the identified sources of contamination in the Bloukrans River (Diko 2013).

55

The positive results for Vibrio species from all the study areas exposed the occurrence of potentially pathogenic strains for humans and animals. In the process of speciation, the following targeted species were detected: V. cholerae, V. parahaemolyticus, V. vulnificus and V. fluvialis.

The most prevalent species detected was V. cholerae followed by V. vulnificus, V. fluvialis and

V. parahaemolyticus in that order (Table 4.2). Several similar studies have also reported presence of V. cholerae in water resources found in some rural areas of South Africa (Dungeni et al.,

2010; Ntema et al., 2010) and it is associated to faecal pollution (Keshav and Potgieter 2010;

Ntema et al., 2010; Akoachere and Mbuntcha 2014).

The presence of the following Vibrio pathogens V. fluvialis, V. cholerae, V. vulnificus and V. parahaemolyticus in water resources suggests that these water resources are significant reservoirs of Vibrio pathogens. This becomes a health risk and a possibility of contracting cholera and other Vibrio infections. Our finding show that water resources selected in this study could pose a significant health and environmental risk to communities who rely on them for several activities such as swimming, bathing and when undertaking religious rite like baptisms.

Piped water in rural areas of most developing countries is limited and in some areas its non- existence, as a result communities rely on rivers/stream for drinking and other domestic use.

Thus this becomes a major public health time bomb in underdeveloped areas like the Eastern

Cape where, where by 36 % of the population still drink water directly from rivers as of

2011(ECSECC 2011).

In November 2015, the Health 24news reported that thirteen people together with two four-year olds were treated at Cradock hospital for gastroenteritis due to alleged contaminated water. It

56

was further reported that wastewater treatment plant in Cradock is working at less than 50% of its full capacity, with raw sewage being frequently spilled into the Great Fish River (Ismail

2015). In our results, the diarrhea causing Vibrio pathogens were detected in the Great Fish River and thus it is highly possible these pathogens are the main cause of the incidence that took place in Cradock. To our knowledge there have been no recent gastroenteritis cases due to suspected contaminated water in the other used areas in this study. However, results obtained in this study strongly points to the possibility of either unreported irregular incidences of infection within the communities or the presence of healthy Vibrio carriers sporadically shedding Vibrio species into the environment.

The occurrence of these Vibrio pathogens suggest that the environmental state in freshwater resources are supportive for their growth and may possibly support the growth of cholera causing

V. cholerae (V.cholerae O1 and O139). Furthermore, it has been reported that Vibrio pathogens can adapt to themselves to unfavourable conditions e.g. adhering to diverse substrata in environments with limited organic matter, therefore survival of Vibrio pathogens in water resources is possible (Lutz et al., 2013). Besides being present in some water resources, it has been reported that Vibrio species can be found concentrated in the gut of filter feeders such as clams, oysters and mussels. Ingestion of raw or undercooked seafood and consumption of water contaminated with Vibrio pathogens is therefore a risk factor in human health (Maheshwari et al., 2011).Indirect contact to Vibrio pathogens include consumption of filter feeders which concentrate disease causing microorganisms found in polluted water.

57

The antibiotic susceptibility profiles of confirmed Vibrio genus isolates recovered from the four rivers are shown in Figures4.2, 4.3, 4.4 and 4.4. The results obtained are alarming; the antibiogram outcome in this research reveals that 83% of Vibrio isolates in this study displayed resistance from three or more antimicrobial agents. Antibiotic resistance in Vibrio species has been reported by previous studies (Rafi et al., 2004; Okoh and Igbinosa, 2010; Mandal et al.,

2012; Raissy et al., 2012;Yu et al., 2012;Scarano et al., 2014). The overuse and/or misuse of antibiotics by hospitalised and non-hospitalised patients are some of the factors that contribute to antibiotic resistance.

One of the common popular antibiotics that are employed in aquaculture for its efficiency over a broad spectrum of pathogens and its cheap cost is tetracycline (Neela et al., 2007). Yet, in this study it was not effective against some of the test organisms. This suggests that the antimicrobial susceptibility profiles are on constant change with the current emergence of multi-antibiotic resistant strains in most bacteria. The increasing emergence of multi-antibiotics resistant bacteria in recent years is a serious concern, and this has a negative effect on human well-being: it causes limited therapeutic options to clinicians, and also leads to prolonged illnesses, use of more expensive and toxic drugs and increased morbidity (Odonkor and Addo 2011).

Conclusion

This work has examined the physicochemical properties of some rivers located in Cacadu, OR

Tambo and Chris Hani District Municipalities. Even though, the results showed that some of the physicochemical parameters of the sampled rivers fell within the acceptable limits for domestic use, those that did not comply with the set limits cannot be overlooked. Also, the microbiological quality of the rivers suggest possible health hazard if consumed. The presence of Vibrio species

58

in water resources continues to be a potential public threat following isolation of V. cholerae,

V.parahaemolyticus, V. fluvialis and V. vulnificus in this study. Four Vibrio pathogens were identified for the purpose of this study but other species within the genus could also be present in these rivers. Lastly, the antibiotic results suggest a high incidence of antimicrobial resistance in

Vibrio species towards the normally used antibiotics.

Recommendations

There is a necessity for regular contamination monitoring programme of the selected

water resources and other areas that might be of interest. The monitoring of Vibrio

pathogens is significant in monitoring the dynamics of this pathogen and alertness of a

possible cholera epidemic and other Vibrio infections.

Furthermore, the provincial government and other relevant authorities in South Africa

concerned with environmental matter must and will be informed about the results of this

study.

In order to limit emerging resistant bacterial strains, there should be a community

awareness programs together with enforcement of legislation that restrict the prescription

and supply of antimicrobials to only qualified professionals.

Additionally, monitoring Vibrio pathogens in treated wastewater effluents can be

essential for safety of public health since one of the largest sources of pollution in

freshwater resources is the effluents that are discharged from wastewater treatment plants

(Akpor, 2011).

59

Several studies have reported presence of Vibrio pathogens in final effluents of WWTPs

(Okoh et al., 2014; Nongogo and Okoh 2014) and thus the treated wastewater effluents are likely to enrich the receiving waterbodies with Vibrio pathogen (Mema 2008).

60

REFERENCES

Adagbada, A.O., Adesida, S.A., Nwaokorie, F.O., Niemogha, M.T., Akitoye C.O. (2012).

Cholera Epidemiology in Nigeria: an overview. The Pan African Medical Journal 59: 1–12.

Ahmed, A. M., Nakagawa, T., Arakawa, E., Ramamurthy, T., Shinoda, S., Shimamoto, T.

(2004). New aminoglycoside acetyltransferase gene, aac(3)-Id, in a class 1 integron from a multiresistant strain of Vibrio fluvialis isolated from an infant aged 6 months. Journal of

Antimicrobial Chemotherapy 53: 947–951.

Akoachere, J.F.T.K. and Mbuntcha, C.K.P. (2014). Water sources as reservoirs of Vibrio cholerae O1 and non-O1 strains in Bepanda, Douala (Cameroon): relationship between isolation and physico-chemical factors. BMC infectious diseases 14(1) : 421-432

Akpor, O.(2011). Wastewater effluent discharge: Effects and treatment processes. 3rd

International Conference on Chemical, Biological and Environmental Engineering 20:85–91.

Al-assafi, M. M. K., Mutalib, S. A., Ghani, A., Aldulaimi, M. (2014). A Review of Important

Virulence Factors of Vibrio vulnificus. Research Journal of Biological Sciences6(2):76–88.

Ali, M., Lopez,A., You, Y.,Kim, Y., Sah, B., Maskery, B., Clemens, J. (2012). The global burden of cholera.Bulletin of the World Health Organization 90(3): 209–218.

Alam M.J, Miyoshi S.I, and Shinoda S. (2003). Studies on pathogenic Vibrio parahaemolyticus during a warm weather season in the Seto Inland Sea, Japan. Environmental microbiology, 5(8):

706-710.

61

Almagro-moreno, S., Boyd, E.F.(2009). Sialic acid catabolism confers a competitive advantage to pathogenic Vibrio cholerae in the mouse intestine.Infection and Immunity 77(9): 3807–3816.

Alnaddawi, T.S., Alkaabi, S.G., Muslem, W.F. (2013). Rapid Screening of toxigenic and non- toxigenic V. cholerae from clinical and environmental samples in Iraq by PCR. Academic

Scientific Journal 13: 100–104.

Amita, S., Chowdhury, R. M., Thungapathra, T.G.R., Balakrish, N., Ghosh, A. (2003). Class I

Integrons and SXT elements in El Tor Strains isolated before and after 1992 Vibrio cholerae

O139 Outbreak, Calcutta, India. Emerging Infectious Diseases 9:500–502.

Anyona, D. N., Dida, G.O., Abuom, P.O., Onyuka, J.O., Matano, A., Kanangire, C.K., Ofulla,

A.V.O. (2014). Influence of anthropogenic activities on microbial and nutrient levels along the

Mara river tributaries, Kenya.EurAsian Journal of BioSciences8:1–11.

Asplund, M. (2013). Ecological aspects of marine Vibrio bacteria-Exploring relationships to other organisms and a changing environment.Doctoral thesis. Gothenburg University, Sweden.

Bisharat, N (2002). Vibrio vulnificus infection can be avoided. Israel Medical Association

Journal 4:613-663

Bisharat, N., Cohen, D.I., Harding, R.M., Falush, D., Crook, D.W., Peto, T., Maiden, M.C.

(2005). Hybrid Vibrio vulnificus. Emerging Infectious Diseases11(1):30-35.

Briggs, D.(2003). Environmental pollution and the global burden of disease. British medical bulletin 68:1–24

62

Cabral, J.P.S. (2010). Water microbiology: bacterial pathogens and water.International Journal of Environmental Research and Public Health7(10):3657-3703.

Chandru S., Jenitta Hephzibah A., Rajesh P., Rajesh K.V. (2013). Screening, evaluation of vibriocidal activity and characterization of bioactive substance from marine cyanobacteria.African Journal of Microbiology research 7(17): 1681–1687.

Chatterjee, S., and Haldar, S. (2012). Vibrio related diseases in aquaculture and development of rapid and accurate identification methods.Journal of Marine Science: Research and

DevelopmentS1:002. doi:10.4172/2155-9910.

Chikwendu, C.I., Ibe, S.N., Okpokwasili, G.C.(2014). Multiple antimicrobial resistance in Vibrio species Isolated from river and aquaculture water sources in Imo State. British Microbiology

Research Journal 4(5): 560-569.

Clasen, T., Roberts, I., Rabie, T., Schmidt, W., Cairncross, S. (2006).Interventions to improve water quality for preventing diarrhoea: systematic review and meta-analysis. British Medical

Journal34(7597):1-12.

CLSI. (2012). Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Second

Informational Supplement. Clinical and Laboratory Standards Institute32(3):1–188.

Conceicaoneta, E. R., S.D. Johanningsmeier, M. A. D., Mcfeeters, R. F. (2007). A Chemical

Basis for Sour Taste Perception of Acid Solutions and Fresh-Pack Dill Pickles, Journal of Food

Science72(6): 352-357.

63

Corcoran, E., Nellemann, C., Baker, E., Bos, R., Osborn, D., Savelli, H. (2010). Sick water˃?

The central role of wastewater management in sustainable development.

Cottle, E.(2002). The Cholera Outbreak˃: A 2000-2002 case study of the source of the outbreak in the Madlebe Tribal authority areas, uThungulu Region, KwaZulu-Natal. pp 1-80. Health

Systems Trust, 401 Maritime House, Salmon Grove Victoria Embankment, Durban, South

Africa.

CSIR (2010). A CSIR perspective on water in South Africa. pp 1-40.[available online] http://www.csir.co.za/nre/docs/CSIR%20Perspective%20on%20Water_2010.PDF [accessed on

30/05/2016]

Dahiru, M., Enabulele, O.I. (2015). Occurrence and diversity of Vibrios on lettuce irrigated with wastewater in Kano.Annals of Experimental Biology 3 (1):39-44

Dalsgaard, A., Forslund, A., Hesselbjerg, A., Bruun, B. (2000). Clinical manifestations and characterization of extra-intestinal Vibrio cholerae non-O1, non-O139 infections in Denmark.

Clinical Microbiology and Infection6(11): 625–627.

Daniels, N.A., Shafaie, A. (2000). A review of pathogenic Vibrio infections for clinicians.

Infections in Medicine, 17(10): p.665.

Davey, M. E., Toole, G.A.O. (2000). Microbial Biofilms˃: from Ecology to Molecular

Genetics. Microbiology and Molecular Biology Reviews 64(4): 847–867.

64

Deen, J.L., Seidlein, L.V., Sur, D., Agtini, M., Lucas, M.E.S., Lopez, A.L., Kim, D.R., Ali, M.,

Clemens, J.D. (2008). The High Burden of Cholera in Children˃: Comparison of Incidence from

Endemic Areas in Asia and Africa. PLoS Neglected Tropical Diseases2(2):1-5.

Didelot, X., Pang, B., Zhou, Z., McCann, A., Ni, P.,Li, D., Achtman, M., Kan, B. (2015). The role of China in the global spread of the current cholera pandemic. PLoS Genetics11(3): 1-14.

Diko, A.M. (2013). Sewage time bomb threatens community. [Available online] http://www.grocotts.co.za/content/sewage-time-bomb-threatens [Accessed on 06-05-2015].

Djomassi, L. D., Gessner, B. D., Andze, G. O., Mballa, G. A. E. (2013). National Surveillance

Data on the Epidemiology of Cholera in Cameroon. The Journal of Infectious Diseases 208:92-

97.

Drake, S.L.(2008). The Ecology Vibrio vulnificus and Vibrio parahaemolyticus from Oyster

Harvest Sites in the Gulf of Mexico. Doctoral thesis. North Carolina State University, North

Carolina.

Drake, S.L., Depaola, A., Jaykus, L.A. ( 2007). An overview of Vibrio vulnificus and Vibrio parahaemolyticus. Comprehensive Reviews in Food Science and Food Safety 6: 120–144.

Dungeni, M., van Der Merwe, R.R., Momba, M.N.B. (2010). Abundance of pathogenic bacteria and viral indicators in chlorinated effluents produced by four wastewater treatment plants in the

Gauteng Province, South Africa. Water SA 36(5): 607–614.

DWAF (Department of Water Affairs and Forestry) (1996). South African WaterQuality

Guidelines for Recreational Use, Vol. 2, 2nd edn. Pretoria.

65

Dziejman, M., Serruto, D., Tam, V. C., Sturtevant, D., Diraphat, P., Faruque, S. M., Rahman,

M.H., Heidelberg, J.F., Decker, J., Li, L., Montgomery, K.T., Grills, G., Kucherlapati, R.,

Mekalanos, J. J. (2005). Genomic characterization of non-O1, non-O139 Vibrio cholerae reveals genes for a type III secretion system. Proceedings of the National Academy of Sciences of the

United States of America102:3465–3470.

ECSECC (2011) District demographic and socio-economic indicators: census 1996; 2001; 2011.

[Available online] http://www.ecsecc.org/files/library/ documents/ECSECC_Census. [Accessed on 01 June 2015]

Elhadi, N. (2013). Occurence of potential human pathogenic Vibrio Species in the coastal water of the Eastern Province of Saudi Arabia.Research Journal of Microbiology 8(1): 1-12.

FEHD (2005). Vibrio species in seafood. pp 1-25. Food and Environmental Hygiene Department

43/F, Queensway Government Offices, 66 Queensway, Hong Kong.

Fernández-delgado, M., García-amado, M.A., Contreras, M., Incani, R.N., Chirinos, H., Rojas,

H.,Paula, S. (2015). Survival, induction and resuscitation of Vibrio cholerae from the viable but non-culturable state in the southern caribbean sea. Journal of the São Paulo Institute of Tropical

Medicine57(1):21-26.

Ficke, A. A., Myrick, C. A., and Hansen, L. J. (2005). Potential impact of global climate change on freshwater fisheries. WWF-World Wide Fund For Nature.

66

Finkelstein, R.A.(1996). Chapter 24: Cholera, Vibrio cholerae O1 and O139, and other pathogenic Vibrios. Medical Microbiology.4th edition. [Available online] http://www.ncbi.nlm.nih.gov/books/NBK8407/ [accessed on 30/05/2016]

Froelich, B. (2013). Mechanistic and statistical models of total Vibrio abundance in the Neuse

River Estuary.Water Research 47: 5783–5793.

Furuya, E.Y., Lowy, F.D. (2006). Antimicrobial-resistant bacteria in the community setting.Nature Reviews Microbiology 4: 36-45.

Goel, A.K., Jiang, S.C.(2010). Infection, genetics and evolution genetic determinants of virulence, antibiogram and altered biotype among the Vibrio cholerae O1 isolates from different cholera outbreaks in India. Infection, Genetics and Evolution 10(6): pp.815–819.

Gopo, Q.N. (2013). Regulation of wastewater treatment plants in the Ba-Phalaborwa

Municipality.http://dspace.nwu.ac.za/bitstream/handle/10394/11549/Gopo_QN.pdf?sequence=1

&isAllowed=y [30/05/2016]

Hara-Kudo, Y., Nishina, T., Nakagawa, H., Konuma, H., Hasegawa, T., Kumagai S. (2001).

Improved method for detection of Vibrio parahaemolyticus in seafood. Applied and environmental microbiology 67(12):5819–5823.

Harshfield, E., Jemec, A., Ramarumo, E.,Makhado, O. (2009). Water Purification in Rural South

Africa˃: Ethical Analysis and Reflections on Collaborative Community Engagement Projects in

Engineering. International Journal for Service Learning in Engineering 4: 1–14.

67

Horseman, M.A., Surani, S. (2011). A comprehensive review of Vibrio vulnificus: an important cause of severe sepsis and skin and soft-tissue infection. International Journal of Infectious

Diseases 15(3): 157–166.

Hsieh, J.L., Fries, J.S., Noble, R.T.(2007). Vibrio and phytoplankton dynamics during the summer of 2004 in a eutrophying estuary. Ecological Society of America 17:102–109.

Hsueh, P., Lin, C., Tang, H., Lee, H., Liu, J. (2004). Vibrio vulnificus in Taiwan.Emerging

Infectious Diseases 10:1363–1368.

IDSA (2004). BAD BUGS, NO DRUGS: As Antibiotic Discovery Stagnate: A Public Health

Crisis Brews.pp 1-38. 66 Canal Center Plaza, Suite 600, Alexandria.

Igbinosa, E.O. (2010). Surveillance of invasive Vibrio species in discharged aqueous effluents of wastewater treatment plants in the Eastern Cape Province of South Africa. Doctoral thesis.

University of Fort Hare, South Africa.

Igbinosa, E.O., Obi, L.C., Okoh, A.I.(2009). Occurrence of potentially pathogenic vibrios in final effluents of a wastewater treatment facility in a rural community of the Eastern Cape Province of

South Africa. Research in microbiology 160(8): 531–7.

Igbinosa, E.O., Okoh, A.I. (2008). Emerging Vibrio species: an unending threat to public health in developing countries. Research in Microbiology 159(7-8): 495-506.

Igbinosa, E.O., Okoh A.I. (2009). Toxigenic Vibrio cholerae strains and their associated malaises. African Journal of Microbiology 3(5): 200-211.

68

Igbinosa, E.O., Okoh, A.I.(2010). Vibrio Fluvialis: An unusual enteric pathogen of increasing public health concern. International Journal of Environmental Research and Public

Health7(10):3628-3643.

Igbinosa, E.O., Obi, C.L., Okoh, A.I. (2011). Seasonal abundance and distibution of Vibrio

Species in the treated effluents of wastewater treatment facilities in suburban and urban communities of Eastern Cape Province, South Africa. Journal of Microbiology 49: 224–232.

Ismail, A., (2015). Toxic water scarce rocks Cradock as several fall ill. health 24. hppt://m.health

24.com/health24/News/Public-Health/Toxic-water-scare-rocks-Cradock-as-severe falls ill-

20151104 [ accessed on 02/13/2016]

Ismail, H., Smith, A. M., Tau, N. P., Sooka, A., Keddy, K. H. (2013). Cholera outbreak in South

Africa 2008-2009: laboratory analysis of Vibrio cholerae O1 strains. The Journal of Infectious

Diseases208: 39–45.

Johnson, C. N., Bowers, J. C., Griffitt, K. J., Molina, V., Clostio, R. W., Pei, S., Laws, E.,

Paranjpye, R.N., Strom, M.S., Chen, A., Hasan, N.A., Huq, A., Nicholas F. N., Grimes, D. J.,

Rita R.C. (2012).Ecology of Vibrio parahaemolyticus and Vibrio vulnificus in the coastal and

Estuarine Waters of Louisiana, Maryland, Mississippi and Washington (United States).Applied and Enviromental Microbiology78(20):7249–7257.

Jones, M.K., Oliver, J.D.(2009). Vibrio vulnificus: Disease and Pathogenesis. Infection and

Immunity 77(5):1723–1733.

69

Kebede, S., Duale, S., Yokouide, A., Alemu, W. (2010). Trends of major disease outbreaks in the African region, 2003-2007. Joumal of Public Health 7: 20-28.

Keshav, V., Potgieter, N. (2010). Detection of Vibrio cholerae O1 in animal stools collected in rural areas of the Limpopo Province. Water SA 36:167-171.

Khatri, I., Mahajan, S., Dureja, C., Subramanian, S., Raychaudhuri, S. (2013). Evidence of a new metabolic capacity in an emerging diarrheal pathogen˃: lessons from the draft genomes of

Vibrio fluvialis strains PG41 and I21563. Gut Pathogens5(1): 1-7.

Kim, M.N., Bang, H.J.(2008). Detection of marine pathogenic bacterial Vibrio species by multiplex polymerase chain reaction (PCR). Journal of Environmental Biology29(4):543–546.

Kim, Y. W., Lee, S. H., Hwang, I. G., Yoon, K. S. (2012). Effect of Temperature on Growth of

Vibrio paraphemolyticus and Vibrio vulnificus in Flounder, Salmon Sashimi and Oyster Meat.

International Journal of Environmental Research and Public Health9(12): 4662-4675.

Kirn, T.J., Jude, B.A., Taylor, R.K. (2005). A colonization factor links Vibrio cholerae environmental survival and human infection. Nature 438: 863-866.

Kohanski, M.A., Dwyer, D.J., Collins, J.J. (2010). How antibiotics kill bacteria˃: from targets to networks. Nature Review Microbiology8(6): 423–435.

Krumperman, P. H. (1983). Multiple antibiotic resistance indexing of Escherichia coli to identify high-Risk Sources of fecal Contamination of foods. Applied and Environmental Microbiology,

46(1): 165–170.

70

Kwok A.Y, Wilson J.T, Coulthart M, Ng L.K, Mutharia L, Chow A.W (2002). Phylogenetic study and identification of human pathogenic Vibrio species based on partial hsp60 gene sequences. Canadian Journal of Micriobiology 48: 903-910.

Lamon, S. (2013). Prevalence, distribution and pathogenic profile of Vibrio parahaemolitycus and Vibrio spp. core in shellfish (Mytilus galloprovincialis and Ruditapes decussatus) collected in Sardinia (Italy): molecular fingerprinting using three pcr- based methods: BOX-pcr, REP-pcr and ERIC- pcr. Doctoral thesis, University of Sassari, Italy.

Liang, P., Cui, X., Du, X., Kan, B., Liang, W. (2013). The virulence phenotypes and molecular epidemiological characteristics of Vibrio fluvialis in China. Gut Pathogens5: 1–11.

Lutz, C., Erken,M., Noorian, P., Sun, S., and McDougald, D. (2013). Environmental reservoirs and mechanisms of persistence of Vibrio cholerae.Front Microbiology.4: P 1-15

Madoroba, E., Momba, M.N.B. ( 2010). Prevalence of Vibrio cholerae in rivers of Mpumalanga province, South Africa as revealed by polyphasic characterization.African Journal of

Biotechnology 9(43): 7295-7301

Maheshwari, M., Krishnaiah, N. and Ramana, D.B. V.(2011). Evaluation of polymerase chain reaction for the detection of Vibrio cholerae in contaminants. Annals of Biological Research

2(4):212–217.

71

Mahmuda, Z.H., Kassua, A., Mohammada, A., Yamatoa, M., Bhuiyanb, N.A., Balakrish G.,

Nairb, F.O. (2006). Isolation and molecular characterization of toxigenic Vibrio parahaemolyticus from the Kii Channel, Japan.Microbiological Research, 161:25–37.

Malla, S., Dumre, S. P., Shakya, G., Kansakar, P., Rai, B., Hossain, A., Nair, G.B., Albert, M.J.,

Sack, D., Baker, S., Rahman, M. (2014). The challenges and successes of implementing a sustainable antimicrobial resistance surveillance programme in Nepal. BMC Public Health14(1):

1-7.

Maluping, R.P.(2004). Potential Aquatic Bacterial Pathogens in the Philippines and

Thailand.Master of Science Programme for International Students. Swedish University of

Agricultural Sciences (SLU), Sweden.

Mandal, J., Dinoop, K.P., Parija, S.C. (2012). Increasing antimicrobial resistance of Vibrio cholerae OI biotype E1 tor strains isolated in a tertiary-care centre in India. Journal of health, population and nutrition 30(1): 12–6.

Mandal, S., Mandal, M.D., Pal, N.K.(2011). Cholera: A great global concern. Asian Pacific

Journal of Tropical Medicine 4(7):573–580.

Mandomando, I., Espasa, M., Valle, X., Sacarlal, J., Sigau, B., Ruiz, J., Alonso, P. (2007).

Antimicrobial resistance of Vibrio cholerae O1 serotype Ogawa isolated in Manhic District

Hospital, Southern Mozambique. Journal of Antimicrobial Chemotherapy 60: 662–664

72

Marin, M.A., Thompson, C., Freitas, F.S, Fonseca, E.L, Aboderin, A.O, Zailani, S.B, Quartey

E, Iruka N. Okeke, I.N., and Vicente A.C.P (2013). Cholera Outbreaks in Nigeria are associated with Multidrug Resistant Atypical El Tor and Non-O1/Non-O139 Vibrio cholerae. PLoS Negl

Trop Dis. 7(2): 1-9.

Martinez-urtaza, J., Blanco-abad, V., Rodriguez-castro, A., Ansede-bermejo, J., Miranda, A.,

Rodriguez-alvarez, M.X. (2011). Ecological determinants of the occurrence and dynamics of

Vibrio parahaemolyticus in offshore areas.ISMEJournal6(5): 994–1006.

Maugeri T.L, Carbone M, Fera M.T,Gugliandolo C (2006).Detection and differentiation of

Vibrio vulnificus in seawater and plankton of a coastal zone of the Mediterranean Sea. Research in Microbiology157: 194–200.

Mema, V. (2008). Impact of poorly maintained wastewater and sewage treatment plants˃: lessons from South Africa. Built Environment, Council for Scientific and Industrial Research

(CSIR), Pretoria, 0001, South Africa

Merrell, D. S., Camilli, A. (2000). Regulation of Vibrio cholerae genes required for acid tolerance by a member of the “ ToxR-Like ” family of transcriptional regulators. Journal of

Bacteriology182(19): 5342–5350.

Miyoshi, S.I. (2013). Extracellular proteolytic enzymes produced by human pathogenic Vibrio species. Frontiers in microbiology 4: 1-8.

73

Momba, M. N.B., Osode, A.N., Sibewu, M. (2006a). The impact of inadequate wastewater treatment on the receiving water bodies – Case study˃: Buffalo City and Nkokonbe

Municipalities of the Eastern Cape Province. Water SA32:687–692.

Momba, M., Tyafa, Z., Makala, N., Brouckaert, B., Obi, C. (2006b). Safe drinking water still a dream in rural areas of South Africa . Case Study˃: The Eastern Cape Province. Water SA32(5):

715–720.

Morrison, G., Fatoki, O. S., Persson, L., and Ekberg, A. (2001). Assessment of the impact of point source pollution from the Keiskammahoek Sewage Treatment Plant on the Keiskamma

River - pH , electrical conductivity , oxygen- demanding substance ( COD ) and nutrients. Water

SA27(4): 475–480.

Mounaouer, B., Abdennaceur, H.(2015). Environmental health bacteriological quality of effluent submitted consecutively to a macrofiltration and ultraviolet light systems in the Tunisian conditions.Journal of Environmental Health Science and Engineering 13:1–9.

Naidoo, S., Olaniran, A.O. (2014). Treated wastewater effluent as a source of microbial pollution of surface water resources. International Journal of Environmental Research and Public Health

11(1):249-270.

Nair, G. B., Ramamurthy, T., Bhattacharya, S.K., Dutta, B., Takeda, Y., Sack, David (2007).

Global dissemination of Vibrio parahaemolyticus serotype O3:K6 and its serovariants. Clinical

Microbiology Reviews 20(1): 39-48.

74

Neela, F.A., Nonaka,L., and Suzuki, S., (2007). The diversity of multi-drug resistance profiles in tetracycline-resistant Vibrio species isolated from coastal sediments and seawater. J. Microbiol.

45: 64–68

Nishizaki, M. T., and Carrington, E. (2014). The effect of water temperature and flow on respiration in barnacles˃: patterns of mass transfer versus kinetic limitation. The Journal of

Experimental Biology 217: 2101-2109

Nongogo, V., Okoh, A.I. (2014). Occurrence of Vibrio Pathotypes in the Final Effluents of Five

Wastewater Treatment Plants in Amathole and Chris Hani District Municipalities in South

Africa. International Journal of Enviromental Reseach and Public Health11(8):7755-7766.

Nsofor, C.A., Kemajou, S.T., Nsofor, C.M. (2014). Incidence and antibiotic susceptibility pattern of Vibrio species isolated from sea foods sold in Port-Harcourt, Nigeria. Journal of

Bacterialogical Research 6:(2): 13–16.

Ntema, V.M., Potgieter, N., Barnard, T.G.(2010). Detection of Vibrio cholerae and Vibrio parahaemolyticus by molecular and culture based methods from source water to household container-stored water at the point-of-use in South African rural communities. Water Science and Technology 61:3091–3101.

Obi, C. L., Bessong, P. O., Momba, M. N. B., Potgieter, N., Samie, A., and Igumbor, E. O.

(2004). Profiles of antibiotic susceptibilities of bacterial isolates and physico-chemical quality of water supply in rural Venda communities, South Africa. Water SA30: 515–520.

75

Odonkor, S.T., Addo, K.K.(2011). Review article bacteria resistance to antibiotics˃: recent trends and challenges. International Journal of Biological and Medical Research 2(4): 1204–

1210.

Okoh, A. I., Sibanda, T., Nongogo, V., Adefisoye, M., Olayemi, O. O., Nontongana, N. (2014).

Prevalence and characterisation of non-cholerae Vibrio spp. in final effluents of wastewater treatment facilities in two districts of the Eastern Cape Province of South Africa˃: implications for public health. Environmental Science and Pollution Research 22: 2008–2017.

Okoh, A.I., and Igbinosa, E.O. (2010). Antibiotic susceptibility profiles of some Vibrio strains isolated from wastewater final effluents in a rural community of the Eastern Cape Province of

South Africa.BMC Microbiology 10:1-6.

Olaniran, A.O., Naicker, K., Pillay, B. (2011). Toxigenic Escherichia coli and Vibrio cholerae:

Classification, pathogenesis and virulence determinants. Molecular Biology 6: 94–100.

Osorio C. R and Klose K. E (2000). A Region of the Transmembrane Regulatory Protein ToxR

That Tethers the Transcriptional Activation Domain to the Cytoplasmic Membrane Displays

Wide Divergence among Vibrio Species. Journal of bacteriology 182(2): 526-528.

Osundiya, O. O., Oladele, R. O., and Oduyebo, O. O. (2013). Multiple antibiotic resistance

(MAR) indices of Pseudomonas and Klebsiella species isolates in Lagos University Teaching

Hospital. African Journal of Clinical and Experimental Microbiology14(3): 164–168.

Palaniappan, M., Gleick, P. H., Allen, L., Cohen, M. J., Christian-Smith, J., Smith, C.

(2010).Clearing the waters: A focus on water quality solutions. Pacific Institute , 654 13th Street

Preservation Park Oakland. http://www.unep.org/PDF/Clearing_the_Waters.pdf [31/05/2016]

76

Parveen, S., Hettiarachchi, K. A., Bowers, J.C., Jones, J.L., Tamplin, M.L., Mckay, R., Beatty,

W., Brohawn, K., Dasilva, L.V., Depaola, A. (2008). Seasonal distribution of total and pathogenic Vibrio parahaemolyticus in Chesapeake Bay oysters and waters. International

Journal of Food Microbiology128(2): 354–361.

Prasanthan, V., Udayakumar, P., Ouseph, P.P. (2011). Influence of abiotic environmental factors on the abundance and distribution of Vibrio species in coastal waters of Kerala, India. Indian

Journal of Geo-Marine Sciences 40: 587-592.

Penduka, D.(2011). In-vitro anti-vibrio activities of crude extracts of garcinia kola seeds.Molecules 16(4):2754-2765.

Penesyan, A., Gillings, M., Paulsen, I.T. (2015). Antibiotic discovery: combatting bacterial resistance in cells and in biofilm communities.Molecules20(4):5286-5298

Petri, W. A., Miller, M., Binder, H. J., Levine, M. M., Dillingham, R., Guerrant, R. L. (2008).

Enteric infections, diarrhea, and their impact on function and development.The Journal of

Clinical Investigation 118(4):1277-1290.

Pfeffer, M.A., McMurray J.J., Velazquez E.J., Rouleau J.L., Køber, L., Maggioni,

A.P., Solomon, S.D., Swedberg K, Van de Werf, F., White, H., Leimberger, J.D., Henis,

M., Edwards, S., Zelenkofske, S., Sellers, M.A., and Califf RM (2003). Valsartan, captopril, or both in myocardial infarction complicated by heart failure, left ventricular dysfunction, or both.

N Engl J Med. 349(20):1893-906.

77

Poonia, S., Singh, T.S., Tsering, D.C. (2014). Antibiotic susceptibility profile of bacteria isolated from natural sources of water from rural areas of East Sikkim.Indian Journal of Community

Medicine 39(3): 156-160.

Prasanthan, V., Udayakumar, P., Ouseph, P.P. (2011). Influence of abiotic environmental factors on the abundance and distribution of Vibrio species in coastal waters of Kerala, India. Indian

Journal of Geo-Marine Sciences 40:587–592.

Qadri, F., Chowdhury, N. R., Takeda, Y., Nair, G. B. (2005). Vibrio parahaemolyticus - Seafood safety and associations with higher organisms. Oceans and Health: Pathogens in the Marine

Environment.pp277–295.http://link.springer.com/chapter/10.1007%2F0-387-23709-7_11

[31/05/2016]

Rafi, S., Qureshi AH., Saeed, W., Ali, A., Ahmadani, M., Khawaja, S.A. (2004). Changing epidemiology and sensitivity pattern ofVibrio cholerae at Rawalpindi. Pakistan Journal of

Medical Sciences 20(4): 357-360

Raissy, M., Moumeni, M., Ansari, M., Rahimi, E. (2012). Antibiotic resistance pattern of some

Vibrio strains isolated from seafood.Iranian Journal of Fisheries 11: 618–626.

Ramamurthy, T., Chowdhury, G., Gururaja, P., Shinoda, S. (2014). Vibrio fluvialis: an emerging human pathogen.Frontiers in Microbiology5: 1–8.

Rebaudet, S., Sudre, B., Faucher, B., Piarroux, R. (2013). Environmental determinants of cholera outbreaks in inland Africa˃: A systematic review of main transmission foci and propagation routes. Journal of Infectious Diseases 1:46-54.

78

Rebouc, R. H., Viana, O., Sousa, D., Sousa, A., Roger, F., Barroso, P., Carvalho, D., Helena, R.,

Vieira, F. (2011). Antimicrobial resistance profile of Vibrio species isolated from marine shrimp farming environments (Litopenaeus vannamei) at Ceara. Indian Journal of Community

Medicine111: 21–24.

Rhamtulla, S., Ramana, C.V., Reddy, T.B. (2015). Isolation of Vibrio parahaemolyticus from the gut of Octopus (Octopus spp) and mussel (Perna indica). International Journal of Current

Microbiology and Applied Science 4(1): 543–551.

Robles, A. L., Félix, E. A., Gomez-Gil, B., Ramírez, E. I. Q., Nevárez-Martínez, M., Noriega-

Orozco, L. (2013). Relationship of aquatic environmental factors with the abundance of Vibrio cholerae , Vibrio parahaemolyticus , Vibrio mimicus and Vibrio vulnificus in the coastal area of

Guaymas. Journal of Water Health 11(4):700-712.

Rojas, M.V.R., Matté, M.H., Dropa, M., Silva, M. L. Da., Matté, G.R. (2011). Characterization of Vibrio parahaemolyticus isolated from oysters and mussels in São Paulo, Brazil. Revista Do

Instituto de Medicina Tropical de Sao Paulo53:201–205.

Roux, C.S.(2004). Dealing with cholera: exclusively the domain of environmental health practitioners? Health SA Gesondheid9: 55–65.

Sadi, I.A., Adebitan, E.O. (2014). Waste water recycling in the hospitality industry. Academic

Journal of Interdisciplinary Studies 3:87–95.

SABS news online (2014). Fort Beaufort residents hit by an outbreak of diarrhoea. http://article.wn.com/view/2014/01/27/45_hospitalised_in_diarrhoea_outbreak. [5/05/2015]

79

Said, M. D., Funke, N., Jacobs, I., Steyn, M., Nienaber, S. (2011). The case of cholera preparedness, response and prevention in the SADC region: A need for proactive and multi-level communication and co-ordination. Water SA37(4): 559–566.

Samal, S. K., Khuntia, H. K., Nanda, P. K., Satapathy, C. S., Nayak, S. R., Sarangi, A. K., Pal,

B. B. (2008). Incidence of Bacterial Enteropathogens among Hospitalized Diarrhea Patients from

Orissa India. Japanese Journal of Infectious Diseases61(5):350-355.

Scarano, C., Spanu, C., Ziino, G., Pedonese, F., Dalmasso, A., Spanu, V., Virdis, S., Santis, E. P.

L. De. (2014). Antibiotic resistance of Vibrio species isolated from Sparus aurata reared in

Italian mariculture. New Microbiologica 37(3):329-37.

Shanthakumari, A.R., Nagalakshmi, R., Ramesh, S. (2015). Scaleup and media optimization of protease by Vibrio alginolyticus.Journal of Ecobiotechnology 2(2):17-25.

Sharma, A., Bora, C. R., Chaurasia, R. K., Sahu, V. (2009). Antibiotic Susceptibility and Genetic

Analysis of Vibrio Species Isolated from Reverine Environment.Current Research in

Bacteriology 2(2): 36-49.

Shittu, O.B., Akpan, I., Popoola, T.O.S., Oyedepo, J.A., Ogunshola, E.O. (2010).

Epidemiological features of a GIS-supported investigation of cholera outbreak in Abeokuta,

Nigeria. Journal of Public Health and Epidemiology 2(7): 152-162

Staley, C., Chase, E., Chase E., Harwood, V.J. (2013). Detection and differentiation of Vibrio vulnificus and V . sinaloensis in water and oysters of a Gulf of Mexico estuary. Enviromental

Microbiology 15(2):623-33.

80

State, E.O., (2011). Antibiotic resistance pattern of bacteria spp isolated from hospital waste water in Ede South Western , Nigeria, .66–71.

Sterk, A., Schets, F. M., Maria, A., Husman, D. R., Nijs, T., Schijven, J.F. (2015). Effect of climate change on the concentration and associated risks of Vibrio Spp. in Dutch recreational waters.Risk analysis 35(9):1717–1729.

Steve, J., Megan, S., Jennifer, M., Vaughn, C., Cheryl, W. (2009). Incidence and abundance of pathogenic Vibrio Species in the Great Bay Estuary. pp 1–10.Nantes, France.

Stivers, T.L. (2008). Diagnosing and treating deadly Vibrio vulnificus infection. Journal of

Emergency Nursing 34:139–141.

Strom, M.S., Paranjpye, R.N. (2000). Epidemiology and pathogenesis of Vibrio vulnificus.

Microbes and Infection2:177–188

Su, Y.C., Liu, C. (2007). Vibrio parahaemolyticus: A concern of seafood safety. Food

Microbiology 24: 549–558.

Szczepanowski, R., Linke, B., Krahn, I., Gartemann, K., Gu, T., Eichler, W., Pu, A and Schlu, A.

(2009). Detection of 140 clinically relevant antibiotic- resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology 155:2306-2319.

Tabatabaei, S.M., Khorashad, A.S. (2015). Antimicrobial resistance patterns of Vibrio cholera strains isolated from Afghan and Iranian patients in Iran. International Journal of Infection

2(1):1–6.

81

Tantillo, G. M., Fontanarosa, M., Pinto, A. Di., Musti, M. (2004). Updated perspectives on emerging Vibrios associated with human infections. 117–126.Letters in Applied Microbiology

39(2):117-126.

Tarr C.L, Patel J.S, Puhr N.D, Sowers E.G, Bopp C.A, Strockbine N.A (2007). Identification of

Vibrio isolates by a multiples PCR assay and rpoB sequence determination. Journal of Clinical

Microbiology 45 (1): 134-140.

Thompson, K. (2013). Managing cholera as a preventable global threat. Journal of Vaccines and

Vaccination 4:1-4.

Thompson, J. R., Randa, M. A., Marcelino, L. A., Tomita-mitchell, A., Lim, E., Polz, M. F.

(2004). Diversity and dynamics of a North Atlantic coastal Vibrio community. Applied and

Environmental Microbiology70(7): 4103–4110.

Tran, H.T., Barnich, N., Mizoguchi, E. (2011). Potential role of chitanases and chitin-binding proteins in host microbial interactions during the development of intestional inflammation.

Histology and Histopathology 26(11): 1453–1464.

Turner, J.W. (2010). Environmental factors and reservoir shifts contribute to the seasonality of pathogenic. Doctoral thesis. The University of Georgia, Georgia.

Turner, J. W., Good, B., Cole, D., Lipp, E. K. (2009). Plankton composition and environmental factors contribute to Vibrio seasonality. The ISME Journal, 3(9):1082–1092.

UNICEF (2008). Unicef on Water Quality. pp.1–191. Water, environment and sanitation section programme division. United Nations Plaza New York, USA

82

UN-Water(2011). Water Quality. [Available online] hppt://www.unwater.org/downloads/waterquality_policybrief.pdf [accessed on 31/05/2016]

UN-WATER/UNEP/FAOWATER (2010). Clean Water for a Healthy

World.http://www.unwater.org/wwd10/downloads/WWD2010_LOWRES_BROCHURE_EN.pd f [31/05/2016]

Wang, Y., Gu, J.D. (2005). Influence of temperature , salinity and pH on the growth of environmental Aeromonas and Vibrio species isolated from Mai Po and the Inner Deep Bay nature reserve Ramsar Site of Hong Kong. Journal of Basic Microbiology 45(1):83-93.

West, P.(1989). The human pathogenic vibrios--a public health update with environmental perspectives. Epidemiology and infection 103:1–34.

WFA, 2010. Review of Water Quality Reports and Catchment Management Plans. http://www.dti.gov.za/industrial_development/docs/fridge/Water_Quality_Risks.pdf

[18/05/2016]

WHO (2007a).Combatingwaterborne disease at the household level.World Health Organization,

20 Avenue Appia, 1211 Geneva 27, Switzerland.

WHO (2007b). Region: resurgence of cholera in the who african forward, current situation and way. http://apps.who.int/iris/handle/10665/92252?mode=full [31/05/2016]

WHO and UNICEF (2009). Diarrhoea: Why children are still dying and what can be done.

World Health Organisation, 20 Avenue Appia, 1211 Geneva 27, Switzerland.

83

Wong R.S, Chow A.W (2002). Identification of enteric pathogens by heat shock protein 60kDa

(HSP60) gene sequesnces FEMS Microbiology Letters, 206: 107-113.

Yu, L., Zhou, Y., Wang, R., Lou, J., Zhang, L., Li, J., Bi, Z., Kan, B. (2012). Multiple Antibiotic

Resistance of Vibrio cholerae Serogroup O139 in China from 1993 to 2009. PLoS ONE 7(6): 1–

9.

Zimmerman, A. M., Depaola, A., Bowers, J. C., Krantz, J. A., Nordstrom, J. L., Johnson, C. N., and Grimes, D J(2007). Variability of total and pathogenic Vibrio parahaemolyticus densities in

Northern Gulf of Mexico Water and Oysters. Applied and Environmental Microbiology73(23):

7589–7596.

Zulkifli, Y., Alitheen, N. B., Son, R., Yeap, S. K., Lesley, M. B., Raha, A. R. (2009).

Identification of Vibrio parahaemolyticus isolates by PCR targeted to the toxR gene and detection of virulence genes. International Food Research Journal 16: 289–296.

URL 1: (http://article.wn.com/view/2014/01/27/45_hospitalised_in_diarrhoea_outbreak/).

[Accessed on the 23rd of March 2016]

URL 2: http://www.localgovernment.co.za/img/provinces/EasternCape_small.jpg

[Accessed on the 2nd of May 2016]

84