Differential Gene Regulation by the SRC Family of Coactivators

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Differential gene regulation by the SRC family of coactivators Hua Zhang,1 Xia Yi,1 Xiaojing Sun, Na Yin, Bin Shi, Huijian Wu, Dan Wang, Ge Wu, and Yongfeng Shang2 Department of Biochemistry and Molecular Biology, Peking University Health Science Center, Beijing 100083, China SRCs (steroid receptor coactivators) are required for nuclear receptor-mediated transcription and are also implicated in the transcription initiation by other transcription factors, such as STATs and NF␬B. Despite phenotypic manifestations in gene knockout mice for SRC-1, GRIP1, and AIB1 of the SRC (Steroid Receptor Coactivator) family indicating their differential roles in animal physiology, there is no clear evidence, at the molecular level, to support a functional specificity for these proteins. We demonstrated in this report that two species of SRC coactivators, either as AIB1:GRIP1 or as AIB1:SRC-1 are recruited, possibly through heterodimerization, on the promoter of genes that contain a classical hormone responsive element (HRE). In contrast, on non-HRE-containing gene promoters, on which steroid receptors bind indirectly, either GRIP1 or SRC-1 is recruited as a monomer, depending on the cellular abundance of the protein. Typically, non-HRE-containing genes are early genes activated by steroid receptors, whereas HRE-containing genes are activated later. Our results also showed that SRC proteins contribute to the temporal regulation of gene transcription. In addition, our experiments revealed a positive correlation between AIB1/c-myc overexpression in ER+ breast carcinoma samples, suggesting a possible mechanism for AIB1 in breast cancer carcinogenesis. [Keywords: Gene regulation; coactivators; steroid receptors] Supplemental material is available at http://www.genesdev.org. Received February 16, 2004; revised version accepted May 21, 2004. Gene transcription activation by transcription factors which were shown to enhance nuclear receptor-medi- such as nuclear receptors is accomplished through the ated gene transcription as well as gene transactivation by recruitment of a series of coactivators. Coactivator pro- other transcription factors. teins fulfill their functions through protein–protein in- The physiological significance of the SRC family and teractions that bridge transcription factors and the basal the functional specificity of these proteins have been an transcription machinery and through their chromatin re- area of extensive study. In this context, AIB1 has been modeling activities that facilitate the assembly of a tran- found to be strongly amplified and/or overexpressed in scription initiation complex (Glass and Rosenfeld 2000). 64% of primary breast cancers as well as in some pri- Several general coactivators, such as CBP/p300 and mary ovarian tumors (Anzick et al. 1997; Bautista et al. p300/CBP-associated protein factor (pCAF), are recruited 1998); and translocation between the GRIP1 gene and by transcription factors to mediate their transcriptional the MOZ (monocytic zinc finger) gene encoding a HAT activities (Glass and Rosenfeld 2000). These proteins are protein (Champagne et al. 2001) has been identified in known to possess intrinsic histone acetyltransferase human acute myeloid leukemia (Carapeti et al. 1998), (HAT) activity and are capable of chromatin modifica- suggesting important functions of SRC proteins in physi- tion by histone acetylation. The general coactivators can ology. Genetic studies with gene ablation showed that, also be recruited by interaction with more specific coac- whereas both male and female SRC1-null mice are viable tivators, including members of the SRC (Steroid Recep- and fertile, they exhibit partial resistance to several hor- tor Coactivator) family (also referred to as p160 family) mones, including estrogen, progestin, androgen, and thy- SRC-1, TIF2/GRIP1/SRC-2 (hereafter referred to as roid hormones (Xu et al. 1998; Weiss et al. 1999); elimi- GRIP1), and pCIP/ACTR/AIB1/RAC3/TRAM1/SRC-3 nation of AIB1 has revealed that it is required for normal (hereafter referred to as AIB1; Glass and Rosenfeld 2000), mouse growth (Wang et al. 2000; Xu et al. 2000), as well as for some female reproductive functions (Xu et al. 2000); and, in contrast to SRC-1 and AIB1 knockout 1These authors contributed equally to this work. mice, there is impairment of fertility in both male and 2Corresponding author. female GRIP1-null mice (Gehin et al. 2002). A recent E-MAIL [email protected]; FAX 86-10-82801355. Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/ study showed that GRIP-null mice are protected against gad.1194704. obesity and display enhanced adaptive thermogenesis, GENES & DEVELOPMENT 18:1753–1765 © 2004 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/04; www.genesdev.org 1753 Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Zhang et al. whereas SRC-1-null mice are prone to obesity due to quickly activated and include c-Myc (Dubik and Shiu reduced energy expenditure (Picard et al. 2002). 1992) and IGF-I (Umayahara et al. 1994), whose promot- Despite the variation in phenotypic manifestations of ers do not contain a classical HRE. Analogously, genes these SRC-null mice, which suggests differential biologi- regulated through direct AR binding, such as PSA (pros- cal activities of the SRC proteins, there is as yet no clear tate specific antigen), typically harbor HREs with a con- evidence, at the molecular level, to indicate functional sensus sequence of 5Ј-GGTACAnnnTGTTCT-3Ј in their specificities for the three members of the SRC family. promoters (Cleutjens et al. 1996, 1997) and need a longer Structurally, SRC-1, GRIP1, and AIB1 share 40% overall time to be activated; genes regulated by binding AR in- sequence identity, and they all contain, in the N termi- directly are early genes such as c-Myc (Bieche et al. 2001; nus, a basic helix–loop–helix (bHLH) domain that is Silva et al. 2001), which does not contain a classical HRE known as a dimerization and DNA interaction domain in its promoter. In previous studies, we and others have as well as a PAS domain, which is known to be involved shown that SRC-1, GRIP1, and AIB1 are all implicated in in protein–protein interaction. Three LXXLL motifs, also both ER- and AR-mediated gene transcription (Shang et known as NR boxes (for nuclear receptor binding), are al. 2000, 2002; Louie et al. 2003). centrally located in all three proteins (Heery et al. 1997; To investigate whether there are any coactivation Darimont et al. 1998; McInerney et al. 1998). Although specificities for these three coactivators in ER- and AR- various biochemical approaches have implied that an in- mediated gene transcription, we first sought to investi- dividual member of the SRC family may possess func- gate the pattern of SRC-1, GRIP1, and AIB1 recruitment tional specificities in a manner of propensity or selectiv- on different gene promoters. The estrogen-dependent hu- ity for different types or isotypes of nuclear receptors or man mammary carcinoma cell line T-47D and the hu- other transcription factors (Kraichely et al. 2000; Issa et man endometrial carcinoma cell line ECC-1, and an an- al. 2001; Barkhem et al. 2002; Beischlag et al. 2002; Bom- drogen-responsive human prostate carcinoma cell line mer et al. 2002), most in vitro studies and transfection LnCAP, were used for this experiment. EBAG9 and c- experiments indicate that each member of the SRC fam- Myc were chosen to represent HRE-containing target ily is capable of interaction with multiple nuclear recep- genes and non-HRE-containing target genes, respec- tors, and that a particular nuclear receptor is able to in- tively, in ER-mediated transcription, and PSA and c-Myc teract with all three members of the SRC family. were chosen to represent HRE-containing target genes Nuclear receptors, especially steroid receptors such as and non-HRE-containing target genes, respectively, in ER and androgen receptor (AR), exhibit a bimodal pattern AR-mediated transcription. The temporal difference in of gene regulation in the presence of their ligands. Some steroid-induced expression of these genes was confirmed genes are activated quickly and others are only activated first in our experimental system. In these experiments, by prolonged stimulation with the ligands. In addition, T-47D cells and ECC-1 cells were grown in the absence tissue-specific activities have been well recognized for of estrogen, and LnCAP cells were grown in the absence nuclear receptors, and these clearly are a reflection of of androgen, for at least 3 d, followed by no treatment or their differential gene regulation in different tissues. treatment with saturating levels of 17␤-estradiol (E2) or However, how the precise regulation of gene expression dihydrotestosterone (DHT) for 6 h, and the mRNA ex- is achieved, and, as important players in nuclear receptor pression of c-Myc, EBAG9, and PSA was analyzed at dif- signaling, how SRC proteins, as a whole family, contrib- ferent times of treatments by real-time RT–PCR. These ute to the temporal regulation of transcription and to the experiments indicated that c-Myc activation occurred tissue-specific functions of nuclear receptors, are not un- much earlier and peaked at1hofE2orDHTtreatment derstood. in these cells, whereas EBAG9 and PSA activation de- In this report, we investigated the functional specific- veloped later and peaked at 4–6 h of E2 or DHT treat- ity of all three members of the SRC family and provided ment (Supplementary Fig. 1). We then investigated the the mechanistic and pathobiological insights into the coactivator recruitment on the promoter of these genes. temporal gene regulation by steroid receptors. In these experiments, T-47D cells and ECC-1 cells were grown in the absence of estrogen, and LnCAP cells were grown in the absence of androgen, for at least 3 d, fol- Results lowed by no treatment or treatment with saturating lev- Steroid receptors such as ER and AR regulate gene tran- els of E2 or DHT for 45 min.
Recommended publications
  • Chromosomal Aberrations in Head and Neck Squamous Cell Carcinomas in Norwegian and Sudanese Populations by Array Comparative Genomic Hybridization

    Chromosomal Aberrations in Head and Neck Squamous Cell Carcinomas in Norwegian and Sudanese Populations by Array Comparative Genomic Hybridization

    825-843 12/9/08 15:31 Page 825 ONCOLOGY REPORTS 20: 825-843, 2008 825 Chromosomal aberrations in head and neck squamous cell carcinomas in Norwegian and Sudanese populations by array comparative genomic hybridization ERIC ROMAN1,2, LEONARDO A. MEZA-ZEPEDA3, STINE H. KRESSE3, OLA MYKLEBOST3,4, ENDRE N. VASSTRAND2 and SALAH O. IBRAHIM1,2 1Department of Biomedicine, Faculty of Medicine and Dentistry, University of Bergen, Jonas Lies vei 91; 2Department of Oral Sciences - Periodontology, Faculty of Medicine and Dentistry, University of Bergen, Årstadveien 17, 5009 Bergen; 3Department of Tumor Biology, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Center, Montebello, 0310 Oslo; 4Department of Molecular Biosciences, University of Oslo, Blindernveien 31, 0371 Oslo, Norway Received January 30, 2008; Accepted April 29, 2008 DOI: 10.3892/or_00000080 Abstract. We used microarray-based comparative genomic logical parameters showed little correlation, suggesting an hybridization to explore genome-wide profiles of chromosomal occurrence of gains/losses regardless of ethnic differences and aberrations in 26 samples of head and neck cancers compared clinicopathological status between the patients from the two to their pair-wise normal controls. The samples were obtained countries. Our findings indicate the existence of common from Sudanese (n=11) and Norwegian (n=15) patients. The gene-specific amplifications/deletions in these tumors, findings were correlated with clinicopathological variables. regardless of the source of the samples or attributed We identified the amplification of 41 common chromosomal carcinogenic risk factors. regions (harboring 149 candidate genes) and the deletion of 22 (28 candidate genes). Predominant chromosomal alterations Introduction that were observed included high-level amplification at 1q21 (harboring the S100A gene family) and 11q22 (including Head and neck squamous cell carcinoma (HNSCC), including several MMP family members).
  • Associated Antigen 9 Exerts in Vivo Tumor- Promoting Effects Via Its Coiled-Coil Region

    Associated Antigen 9 Exerts in Vivo Tumor- Promoting Effects Via Its Coiled-Coil Region

    INTERNATIONAL JOURNAL OF ONCOLOGY 39: 41-49, 2011 Intracellular estrogen receptor-binding fragment- associated antigen 9 exerts in vivo tumor- promoting effects via its coiled-coil region YOSHIHIRO MAEYAMA1,2, MAKOTO OTSU3, SHUJI KUBO4, TOMOKI YAMANO5, YASUAKI IIMURA1,2, MASAFUMI ONODERA6, SATOSHI KONDO2, YUKIO SAKIYAMA1 and TADASHI ARIGA1,7 1Group of Human Gene Therapy, 2Department of Surgical Oncology, Hokkaido University Graduate School of Medicine, N15W7 Sapporo, Hokkaido 060-8638; 3Division of Stem Cell Therapy, Center for Stem Cell Biology and Regenerative Medicine, The Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639; 4Department of Genetics and 5Division of Lower Gastrointestinal Surgery, Department of Surgery, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501; 6Department of Human Genetics, National Center for Child Health and Development, 2-10-1 Okura, Setagaya-ku, Tokyo 157-8535; 7Department of Pediatrics, Hokkaido University Graduate School of Medicine, N15W7 Sapporo, Hokkaido 060-8638, Japan Received February 22, 2011; Accepted April 6, 2011 DOI: 10.3892/ijo.2011.1026 Abstract. Estrogen receptor-binding fragment-associated showed a predominantly cytoplasmic localization in the antigen 9 (EBAG9) is a tumor-promoting factor of largely tumor cells. Collectively, these results suggest that EBAG9 unknown function. To assess a causative role of EBAG9 in overexpression can be causative in enhancing the malignant advanced malignancies, we generated the EG7-OVA and properties of tumor cells, and that tumor promotion likely MethA murine tumor cell lines that stably express full-length requires EBAG9 intracellular association with as yet unidentified or truncated EBAG9 protein, using retroviral-mediated gene binding partners via the coiled-coil region.
  • Estrogen Receptor–Binding Fragment–Associated Antigen 9 Is a Tumor-Promoting and Prognostic Factor for Renal Cell Carcinoma

    Estrogen Receptor–Binding Fragment–Associated Antigen 9 Is a Tumor-Promoting and Prognostic Factor for Renal Cell Carcinoma

    Research Article Estrogen Receptor–Binding Fragment–Associated Antigen 9 Is a Tumor-Promoting and Prognostic Factor for Renal Cell Carcinoma Tetsuo Ogushi,1 Satoru Takahashi,1 Takumi Takeuchi,1 Tomohiko Urano,2 Kuniko Horie-Inoue,3 Jinpei Kumagai,1 Tadaichi Kitamura,1 Yasuyoshi Ouchi,2 Masami Muramatsu,3 and Satoshi Inoue2,3 Departments of 1Urology and 2Geriatric Medicine, Faculty of Medicine, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo, Japan and 3Research Center for Genomic Medicine, Saitama Medical School, Yamane, Hidaka-shi, Saitama, Japan Abstract target organs as well as several other tissues such as brain, liver, The estrogen receptor–binding fragment–associated antigen and kidney (2). The protein expression of EBAG9 is estrogen inducible, as it has been shown in ovariectomized mice treated 9(EBAG9) has been identified as a primary estrogen- h responsive gene in human breast cancer MCF7 cells. A high with 17 -estradiol administration (2). The physiologic function of expression of EBAG9 has been observed in invasive breast EBAG9 has not been well defined, yet the molecule may be cancer and advanced prostate cancer, suggesting a tumor- implicated in cancer pathophysiology, with several lines of evidence promoting role of the protein in malignancies. Here we show of the protein expression in malignancies, including breast (3), that intratumoral (i.t.) administration of small interfering ovarian (4), prostate (5), and hepatocellular carcinomas (6). In RNA against EBAG9 exerted overt regression of tumors prostate cancer (5), EBAG9 expression significantly correlated with following s.c. implantation of murine renal cell carcinoma advanced pathologic stages and high Gleason score (P = 0.0305 and P < 0.0001, respectively), suggesting the abundance of EBAG9 may (RCC) Renca cells.
  • Anti-RCAS1 / Estrogen Receptor Binding Site Associated, Antigen 9 Monoclonal Antibody(Clone: CPTC-EBAG9-2)

    Anti-RCAS1 / Estrogen Receptor Binding Site Associated, Antigen 9 Monoclonal Antibody(Clone: CPTC-EBAG9-2)

    9853 Pacific Heights Blvd. Suite D. San Diego, CA 92121, USA Tel: 858-263-4982 Email: [email protected] 36-3485: Anti-RCAS1 / Estrogen Receptor Binding Site Associated, Antigen 9 Monoclonal Antibody(Clone: CPTC-EBAG9-2) Clonality : Monoclonal Clone Name : CPTC-EBAG9-2 Application : IHC Reactivity : Human Gene : EBAG9 Gene ID : 9166 Uniprot ID : O00559 BAG9; cancer associated surface antigen; cancer associated surface antigen RCAS1; EB9; Alternative Name : estrogen receptor binding fragment associated gene 9; PDAF; receptor binding cancer antigen expressed on SiSo cells Isotype : Mouse IgG2a, kappa Immunogen Information : Recombinant full-length human EBAG9 protein Description EBAG9, also known as RCAS1, is an estrogen-transcribed protein. Soluble and membranous RCAS1 proteins may play a role in the immune escape of tumor cells by promoting T lymphocyte inhibition of growth and apoptosis. RCAS1 is expressed in a wide variety of cancers, including uterine, ovarian, and lung cancer cells, and acts as a ligand for a putative receptor present on peripheral lymphocytes. RCAS1 is highly expressed not only in cancer cells but also in non-tumor bile duct cells subject to immune attack. RCAS1 inhibits the in vitro growth of receptor-expressing cells and induces apoptosis, contributing to the ability of tumor cells to evade host immune surveillance. High expression of RCAS1 significantly correlates with tumor progression and with poor outcome for many cancer patients. Product Info Amount : 20 µg / 100 µg 200 µg/ml of Ab Purified from Bioreactor Concentrate by Protein A/G. Prepared in 10mM PBS with Content : 0.05% BSA & 0.05% azide. Also available WITHOUT BSA & azide at 1.0mg/ml.
  • EBAG9 / RCAS1 (28-213, His-Tag) Human Protein Product Data

    EBAG9 / RCAS1 (28-213, His-Tag) Human Protein Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AR09111PU-L EBAG9 / RCAS1 (28-213, His-tag) Human Protein Product data: Product Type: Recombinant Proteins Description: EBAG9 / RCAS1 (28-213, His-tag) human recombinant protein, 0.5 mg Species: Human Expression Host: E. coli Tag: His-tag Predicted MW: 23.4 kDa Concentration: lot specific Purity: >90% by SDS PAGE Buffer: Presentation State: Purified State: Liquid purified protein Buffer System: 20 mM Tris pH 8.0, 1 mM DTT, 2 mM EDTA, 10% glycerol Preparation: Liquid purified protein Protein Description: Recombinant human EBAG9 protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. Note: (Real molecular weight on SDS-PAGE will be shift up). Storage: Store (in aliquots) at -20°C. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. RefSeq: NP_001265867 Locus ID: 9166 UniProt ID: O00559, A0A024R9E0 Cytogenetics: 8q23.2 Synonyms: EB9; PDAF This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 EBAG9 / RCAS1 (28-213, His-tag) Human Protein – AR09111PU-L Summary: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene.
  • EBAG9 (NM 001278938) Human Untagged Clone Product Data

    EBAG9 (NM 001278938) Human Untagged Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC334501 EBAG9 (NM_001278938) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: EBAG9 (NM_001278938) Human Untagged Clone Tag: Tag Free Symbol: EBAG9 Synonyms: EB9; PDAF Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_001278938, the custom clone sequence may differ by one or more nucleotides ATGGCCATCACCCAGTTTCGGTTATTTAAATTTTGTACCTGCCTAGCAACAGTATTCTCATTCCTAAAGA GATTAATATGCAGATCTGGCAGAGGACGGAAATTAAGTGGAGACCAAATAACTTTGCCAACTACAGTTGA TTATTCATCAGTTCCTAAGCAGACAGATGTTGAAGAGTGGACTTCCTGGGATGAAGATGCACCCACCAGT GTAAAGATCGAAGGAGGGAATGGGAATGTGGCAACACAACAAAATTCTTTGGAACAACTGGAACCTGACT ATTTTAAGGACATGACACCAACTATTAGGAAAACTCAGAAAATTGTTATTAAGAAGAGAGAACCATTGAA TTTTGGCATCCCAGATGGGAGCACAGGTTTCTCTAGTAGATTAGCAGCTACACAAGATCTGCCTTTTATT CATCAGTCTTCTGAATTAGGTGACTTAGATACCTGGCAGGAAAATACCAATGCATGGGAAGAAGAAGAAG ATGCAGCCTGGCAAGCAGAAGAAGTTCTGAGACAGCAGAAACTAGCAGACAGAGAAAAGAGAGCAGCCGA ACAACAAAGGAAGAAAATGGAAAAGGAAGCACAACGGCTAATGAAGAAGGAACAAAACAAAATTGGTGTG AAACTTTCATAA Restriction Sites: SgfI-MluI ACCN: NM_001278938 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name Receptor-binding cancer antigen expressed on SiSo cells Gene Symbol Ebag9 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.64132 Ensembl Gene ID ENSRNOG00000004220 Entrez Gene ID 299864 Assay Information Unique Assay ID qRnoCIP0027433 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000005705 Amplicon Context Sequence AGCAGCGCAGCAGAACTCTTTGGAACAACTGGAGCCTGACTATTTCAAGGACAT GACACCAACTATACGGAAAACGCAGAAAATTGTCATTAAGAAGAGAGAACCATTG AGTTTTGGTG Amplicon Length (bp) 89 Chromosome Location 7:83588185-83589886 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9997 cDNA Cq 22.4295 cDNA Tm (Celsius) 78.5 gDNA Cq 32.635 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ebag9, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
  • EBAG9 (BC017729) Human Untagged Clone – SC122499 | Origene

    EBAG9 (BC017729) Human Untagged Clone – SC122499 | Origene

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC122499 EBAG9 (BC017729) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: EBAG9 (BC017729) Human Untagged Clone Tag: Tag Free Symbol: EBAG9 Synonyms: cancer associated surface antigen; EB9; estrogen receptor binding site associated, antigen, 9; estrogen receptor binding site associated antigen 9; PDAF; RCAS1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene sequence for BC017729 edited CAGGCTGCTACGGAGCGCGCGCCCGGCTTTGAATGAGCGGGGCTGGGAGTGAGCGGGCGG AGCGCGAGCTCGAGGAAGAGACAGGCAGCGCGCGTGAGCGCGCCTTGTGTGCGCGCGCGG CCCGCGGCAGCTCGGAGCCTCCGCCGGGCGGGCGGGGAGGGGGAGGGGCAGGTTTTGATT CCCACCATGGCCATCACCCAGTTTCGGTTATTTAAATTTTGTACCTGCCTAGCAACAGTA TTCTCATTCCTAAAGAGATTAATATGCAGATCTGGCAGAGGACGGAAATTAAGTGGAGAC CAAATAACTTTGCCAACTACAGTTGATTATTCATCAGTTCCTAAGCAGACAGATGTTGAA GAGTGGACTTCCTGGGATGAAGATGCACCCACCAGTGTAAAGATCGAAGGAGGGAATGGG AATGTGGCAACACAACAAAATTCTTTGGAACAACTGGAACCTGACTATTTTAAGGACATG ACACCAACTATTAGGAAAACTCAGAAAATTGTTATTAAGAAGAGAGAACCATTGAATTTT GGCATCCCAGATGGGAGCACAGGTTTCTCTAGTAGATTAGCAGCTACACAAGATCTGCCT TTTATTCATCAGTCTTCTGAATTAGGTGACTTAGATACCTGGCAGGAAAATACCAATGCA TGGGAAGAAGAAGAAGATGCAGCCTGGCAAGCAGAAGAAGTTCTGAGACAGCAGAAACTA GCAGACAGAGAAAAGAGAGCAGCCGAACAACAAAGGAAGAAAATGGAAAAGGAAGCACAA CGGCTAATGAAGAAGGAACAAAACAAAATTGGTGTGAAACTTTCATAACACATGTTCAAA TTTTATCATGCCAGTAGGAGAAATCTCAGCTCCACAACCCAAGCAACATTTGTATGGATT
  • Role of EBAG9 in COPI-Dependent Glycoprotein Maturation and Secretion Processes in Tumor Cells

    Role of EBAG9 in COPI-Dependent Glycoprotein Maturation and Secretion Processes in Tumor Cells

    Role of EBAG9 in COPI-Dependent Glycoprotein Maturation and Secretion Processes in Tumor Cells Dissertation zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat.) im Fach Biologie eingereicht an der Mathematisch-Naturwissenschaftlichen Fakultät I der Humboldt-Universität zu Berlin von Diplom-Biologin Jana Wolf, geb. Göttert Präsident der Humboldt-Universität zu Berlin Prof. Dr. Dr. h.c. Christoph Markschies Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I Prof. Dr. Andreas Herrmann Gutachter/innen: 1. Prof. Dr. Thomas Börner 2. Prof. Dr. med. Bernd Dörken 3. PD Dr. Uta Höpken Tag der mündlichen Prüfung: 21.10.2010 Index of contents Index of contents ABSTRACT......................................................................................................................................................... VI ZUSAMMENFASSUNG....................................................................................................................................VII 1 INTRODUCTION......................................................................................................................................... 1 1.1 THE TUMOR ASSOCIATED ANTIGEN EBAG9 ............................................................................................. 1 1.1.1 Features of EBAG9 protein............................................................................................................. 1 1.1.2 EBAG9 and cancer.........................................................................................................................
  • Immunological and Translational Consequences of an Altered CD8+ T Cell Cytolytic Activity

    Immunological and Translational Consequences of an Altered CD8+ T Cell Cytolytic Activity

    Immunological and translational consequences of an + altered CD8 T cell cytolytic activity Inaugural-Dissertation to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by Anthea Wirges 2018 Die vorliegende Arbeit wurde in der Zeit vom Juli 2014 bis Dezember 2018 in der Arbeitsgruppe „Translationale Tumorimmunologie“ unter der Leitung von Dr. Armin Rehm am „Max-Delbrück-Centrum für Molekulare Medizin“ in der Helmholtz- Gemeinschaft in Berlin angefertigt. 1. Gutachter: Dr. Armin Rehm 2. Gutachter: Prof. Dr. Oliver Daumke Disputation: 06.05.2019 4 Index I ABBREVATIONS ..................................................................................................... V II TABLES .................................................................................................................. XI III FIGURES .............................................................................................................. XIII IV ZUSAMMENFASSUNG ............................................................................................ 1 V ABSTRACT ............................................................................................................... 3 1. INTRODUCTION ....................................................................................................... 5 1.1 The immune system .......................................................................................... 5 1.2 T cell-mediated immunity ..................................................................................
  • Rabbit Anti-RCAS1/EBAG9/FITC Conjugated Antibody

    Rabbit Anti-RCAS1/EBAG9/FITC Conjugated Antibody

    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-RCAS1/EBAG9/FITC Conjugated antibody SL10982R-FITC Product Name: Anti-RCAS1/EBAG9/FITC Chinese Name: FITC标记的Tumour相关表面抗原EBAG9抗体 BAG9; Cancer associated surface antigen; Cancer associated surface antigen RCAS1; EB9; EBAG 9; Estrogen receptor binding fragment associated gene 9 protein; Estrogen Alias: receptor binding site associated antigen 9; PDAF; RCAS 1; RCAS1; Receptor binding cancer antigen expressed on SiSo cells. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Chicken,Pig,Cow,Rabbit, ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 24kDa Form: Lyophilized or Liquid Concentration: 2mg/1ml immunogen: KLHwww.sunlongbiotech.com conjugated synthetic peptide derived from human RCAS1 Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: This gene was identified as an estrogen-responsive gene. Regulation of transcription by Product Detail: estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene.
  • Identification of Novel Prognosis-Related Genes Associated

    Identification of Novel Prognosis-Related Genes Associated

    www.nature.com/scientificreports OPEN Identifcation of novel prognosis- related genes associated with cancer using integrative network Received: 9 October 2017 Accepted: 8 February 2018 analysis Published: xx xx xxxx YongKiat Wee1, Yining Liu2, Jiachun Lu2,3, Xiaoyan Li4 & Min Zhao1 Prognosis identifes the seriousness and the chances of survival of a cancer patient. However, it remains a challenge to identify the key cancer genes in prognostic studies. In this study, we collected 2064 genes that were related to prognostic studies by using gene expression measurements curated from published literatures. Among them, 1820 genes were associated with copy number variations (CNVs). The further functional enrichment on 889 genes with frequent copy number gains (CNGs) revealed that these genes were signifcantly associated with cancer pathways including regulation of cell cycle, cell diferentiation and mitogen-activated protein kinase (MAPK) cascade. We further conducted integrative analyses of CNV and their target genes expression using the data from matched tumour samples of The Cancer Genome Atlas (TCGA). Ultimately, 95 key prognosis-related genes were extracted, with concordant CNG events and increased up-regulation in at least 300 tumour samples. These genes, and the number of samples in which they were found, included: ACTL6A (399), ATP6V1C1 (425), EBAG9 (412), FADD (308), MTDH (377), and SENP5 (304). This study provides the frst observation of CNV in prognosis- related genes across pan-cancer. The systematic concordance between CNG and up-regulation of gene expression in these novel prognosis-related genes may indicate their prognostic signifcance. Prognosis, diagnosis and treatment are key components in medicine. Cancer prognosis involves an assessment of how the disease will afect the individual and an estimation of life expectancy.