DOCSLIB.ORG

Expression and Localization of Gene Encoding Biomineralization In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression and Localization of Gene Encoding Biomineralization In Int. J. Life. Sci. Scienti. Res. January 2018 RESEARCH ARTICLE Expression and Localization of Gene encoding Biomineralization in Magnetotactic Bacteria Renu Singh1*, Tanzeel Ahmad2 1PhD Scholar, School of Biotechnology, IFTM University, Moradabad, India 2 Head, School of Biotechnology, IFTM University, Moradabad, India *Address for Correspondence: Ms. Renu Singh, PhD Scholar, School of Biotechnology, IFTM University, Moradabad, India Received: 27 Oct 2017/Revised: 28 Nov 2017/Accepted: 30 Dec 2017 ABSTRACT- The magnetosome is organelles of prokaryotic bacteria having a magnetic property, they are Magnetotactic Bacteria. MTB consisting of phospholipids bilayer bounded a magnetite crystal that contains the different set of proteins and functionally different. The magnetosome particles are potentially useful in the number of applications as a magnetic nanoparticle. In this work, we studied the localization and expression of proteins play an essential role in magnetosome biomineralization process by fluorescence microscopy and biochemical analysis in microaerophilic Magnetospirillum gryphiswaldense R3/S1. Although optimum conditions were mutually exclusive for high fluorescence and magnetite synthesis through this study, oxygen-limited growth conditions were established, which enhance magnetite biomineralization, growth, and formation of GFP fluorophore at reasonable rates. Through fluorescence microscopy and immunoblotting technique, we were studied that the subcellular localization and expression of magnetosome proteins i.e. GFP-tagged. Among MamC, MamF, and MamG magnetosome proteins fused to GFP, the strongest expression, and fluorescence displayed by MamC-GFP. The magnetosome tagged to MamC-GFP purified from cells shows strong fluorescence, shows stability towards wide temperature range and salt concentration however sensitive towards detergent. Our research exhibited the utilization of MamC as an anchor for magnetosome- specific display for fusions of the heterologous gene. Key-words- Magnetotactic Bacteria, Gene cloning, Fluorescent Microscopy, Immunoblotting, Biomineralization INTRODUCTION The MTB’s magnetosomes are specific organelles for Furthermore, the uniform sizes of magnetosome, their magnetic orientation of magnetosomes that comprise of crystal habits and magnetic property made them magnetic iron mineral crystal enveloped within interesting for utilizing them as magnetic nanoparticles membrane [1-2]. Magnetosomes are synthesized by with extremely extraordinary properties [9-10], and various magnetite (Fe3O4) precipitation inside particular vesicles potential applications i.e. magnetic separation, analyses framed by the magnetosome membrane (MM) in strains detection use in MRI as contrast agent, & use as magnetic of Magnetospirillum, which inhaled from the cytoplasm nanoparticles in magnetic hyperthermia treatment [11-14]. membrane and contains various particular proteins that Most of these applications require functional are involved in functional magnetosome particles magnetosome particles, e.g. by the magnetosome-specific synthesis [3-6]. Huge increment in interdisciplinary display of the functional moieties, for example, antibody research is aimed to understand the mechanism binding protein, enzyme, oligonucleotides as protein tags magnetotactic bacteria through which they achieve their [14]. Mostly, this has been achieved by coupling specific exceptional control over the properties of the crystals of ligands chemically to lipids or proteins of MM [15-18]. On magnetic minerals and association of highly ordered the other hand, the integral magnetosome membrane chain-like structure [7-8]. Magnetotactic bacteria have proteins (MMPs) utilized as an anchor for magnetosome emerged as effective models for the investigation and specific display of fused heterologous proteins [10,19-20]. study of cell biology and formation of organelle in For instance, luciferase was utilized as a reporter for prokaryotes, as magnetosomes show numerous features expression of genetic fusion of Mms 13 protein of M. that are also shown in organelles of eukaryotes [8]. magneticum that is magnetosome directed [21]. Green fluorescent protein (GFP) is another protein that is useful Access this article online as a reporter for expression and intracellular localization of magnetosome proteins. To subcellular organization and Quick Response Code Website: membrane targeting in bacteria, for example, Escherichia www.ijlssr.com coli, Bacillus subtilis and Caulobacter crescentus, has [22-23] been revolutionized by using GFP . Various studies have already been conducting however still the subcellular localization of several magnetosome proteins DOI: 10.21276/ijlssr.2018.4.1.10 is under research. The GFP-assisted fluorescent microscopy was already used to study the magnetosome Copyright © 2015-2018| IJLSSR by Society for Scientific Research is under a CC BY-NC 4.0 International License Page 1567 Int. J. Life. Sci. Scienti. Res. January 2018 protein’s subcellular localization in M. magneticum. The in 1 liter flask under aerobic and microaerobic condition. protein which was investigated includes MamA Protein, The cell was incubated in free gas exchange with air for which is probably required in magnetosome activation aerobic cultivation and for microaerobic cultivation, where as the intracellular assembly of magnetosome flasks was sealed with butyl rubber stopper before chain controlled by acidic MamJ protein and the autoclaving under microaerobic gas mixture containing [24] actin-like MamK protein. In spite of the fact that these 1% O2 in 99% N2 . The inoculation of microaerobic examples previously verified its principal utility in MTB, culture was done by injection through rubber stopper. the GFP expression can be problematic if used as an During cultivation, the temperature was mentioned at intracellular marker of magnetosome localization. The 28°C and pH 7. All culture grown in incubator shaker for formation of magnetite crystal with in microaerophilic 24-48h and agitated at 100 rpm. For isolation of the gene organisms required very low oxygen concentration that is of interest, standard DNA procedure was employed [29]. underneath 10 mbar (×100 pas) [24], subsequently The primers sequences of gene cloning and fusion maturation of proteins needs molecular oxygen during constructs were purchased from GENETIC. The primer last step of fluorophore maturation, thus the use of GFP at sequences are analyzed previously [28]. Primer sequences micro-or anaerobic is limited [25-26]. Likewise, it has been are listed in Table 1. seen that intensity of fluorescence and fluorescent cell [28] proportion were rather low and different under microoxic Table 1: Primers used in this research [26] growth condition . Primer Target Sequence* This research paper was intended to explore the Name gene expression of GFP fused protein in the microaerophilic M. gryphiswaldense R3/S1 at different oxygen levels by L1 egfp catatgggaggcggaggcggtggcggaggtggcg using fluorescence microscopy. Optimum cultivation gagtgagcaagggcgaggag condition was estimated regarding growth, magnetite crystal biomineralization and maximum expression of CL2 egfp gtggatccttacttgtacagctcgtc GFP fused proteins and fluorophore formation. We were additionally analyzed the subcellular localization of CL3 mamF ctcgagagggcaaagcaatggccgagac magnetosome proteins i.e GFP-tagged are MamC, MamF, and MamG, by fluorescence microscopy and CL4 mamF catatggatcagggcgactacatggctg immunoblotting. These proteins were also involved in controlling the size of growing magnetite crystal [27]. The CL5 mamC ctcgagaggacaacagcgatgagctttc GFP modified fluorescent magnetic nanoparticles were isolated and purified from bacterial cells and studied in CL6 mamC catatgggccaattcttccctcag vitro condition for identifying the stability of expression and fluorescence of MamC-GFP labeled magnetosomes. CL7 mamG ctcgagggagatcagatgatcaagggcatc MATERIALS AND METHODS A prospective experimental study was designed and CL8 mamG catatgagcaggctcggcggaggc performed in department of Biotechnology, IFTM University, Moradabad, Uttar Pradesh, India in the year *Restriction sites are indicated into the primers indicated in bold, 2013 to 2017. For cloning E. coli strain DH5α and Top 10 Glycine-linker encoding sequence is in italic front strain, DH5 were used as a host (Top 10 Chemically Competent Cells) and for conjugation Experiments E. coli The GFP-fusion proteins were constructed by using strain S17-1 was used [28]. These strains were grown on variant of GFPmut1 or termed EGFP (enhancer GFP) was medium Luria-Bertani (LB) which was supplemented used [30]. By using CL1 forward primar, egfp gene was with 50ul/ml of kanamycin and ampicilline, and incubate PCR amplified from plasmid pEGFPN-1 (BD Biotech) at 37°C for 24 hrs. “M. gryphiswaldense R3/S1” the .CL1 forward primer adds to 10 glycine linker and NdeI mutant of “M. gryphiswaldense MSR-1” were used in this restriction site to 5’end of CL2 reverse primer and egfp study. The “M. gryphiswaldense R3/S1”was resistant to gene. To yield pCL1, the PCR product was cloned into rifampicin and streptomycin. The strain was grown in pGEMT-Easy. The amplification of mamC, mamF and modified FSM medium microaerobically at 28°C under mamG genes was carried out with pairs of corresponding moderate shaking at 100rpm by using carbon source “27 primers and thus M. gryphiswaldense R3/S1 genomic mM pyruvate” [28]. R3/S1 was cultured in FSM (Flask cDNA taken as template. The pCL2-4 was generated by [24] standard medium) . It contains
Load more

Recommended publications
  • Magnetotactic Bacteria and Their Application in Medicine
    Chem cal ist si ry y & h P B f i o o Dasdag and Bektas. J Phys Chem Biophys 2014, 4:2 p l h a Journal of Physical Chemistry & y n s r DOI: 10.4172/2161-0398.1000141 i u c o s J ISSN: 2161-0398 Biophysics ResearchReview Article Article OpenOpen Access Access Magnetotactic Bacteria and their Application in Medicine Suleyman Dasdag1* and Hava Bektas2 1Department of Biophysics, Medical School of Dicle University, Diyarbakir, Turkey 2Department of Biophysics, Medical School of Yuzuncu Yil University, Van / Turkey Abstract It is a known fact how the magnetic field of the Earth is very important for life. Relation between living systems and the earth magnetic field has been investigated for many years. Birds and their migration routes are the first one of the things that comes to mind when we state living things. The Earth’s magnetic field is still accepted to be the main factor for birds and other flying living beings to complete their travels correctly. The changes in migration routes, which are observed from time to time, are sometimes said to be due to the changes in the magnetic field. However, no light has been shed to this matter yet. The Earth’s magnetic field has not been sufficiently studied, and its role on small living models such as bacteria has not been adequately discussed. One of the best examples in this field is relation between the Earth’s magnetic field and “magnetotactic bacteria (MTB)”, which were discovered by Salvatore Bellini in 1963. Currently, it is claimed that magnetotactic bacteria have a widespread use in microbiology, mineralogy, limnology, physics, biophysics, chemistry, biochemistry, geology, crystallography, and astrobiology.
    [Show full text]
  • Life with Compass: Diversity and Biogeography of Magnetotactic Bacteria
    bs_bs_banner Environmental Microbiology (2014) 16(9), 2646–2658 doi:10.1111/1462-2920.12313 Minireview Life with compass: diversity and biogeography of magnetotactic bacteria Wei Lin,1,2 Dennis A. Bazylinski,3 Tian Xiao,2,4 the present-day biogeography of MTB, and the ruling Long-Fei Wu2,5 and Yongxin Pan1,2* parameters of their spatial distribution, will eventu- 1Biogeomagnetism Group, Paleomagnetism and ally help us predict MTB community shifts with envi- Geochronology Laboratory, Key Laboratory of the ronmental changes and assess their roles in global Earth’s Deep Interior, Institute of Geology and iron cycling. Geophysics, Chinese Academy of Sciences, Beijing 100029, China. 2France-China Bio-Mineralization and Nano-Structures Introduction Laboratory, Chinese Academy of Sciences, Beijing Iron is the fourth most common element in the Earth’s 100029, China. crust and a crucial nutrient for almost all known organ- 3 School of Life Sciences, University of Nevada at Las isms. The cycling of iron is one of the key processes in the Vegas, Las Vegas, NV, USA. Earth’s biogeochemical cycles. A number of organisms 4 Key Laboratory of Marine Ecology & Environmental synthesize iron minerals and play essential roles in global Sciences, Institute of Oceanology, Chinese Academy of iron cycling (Westbroek and de Jong, 1983; Winklhofer, Sciences, Qingdao, China. 2010). One of the most interesting examples of these 5 Laboratoire de Chimie Bactérienne, Aix-Marseille types of organisms are the magnetotactic bacteria (MTB), Université, CNRS, Marseille Cedex, France. a polyphyletic group of prokaryotes that are ubiquitous in aquatic and sedimentary environments (Bazylinski Summary and Frankel, 2004; Bazylinski et al., 2013).
    [Show full text]
  • Cell Structure and Function in the Bacteria and Archaea
    4 Chapter Preview and Key Concepts 4.1 1.1 DiversityThe Beginnings among theof Microbiology Bacteria and Archaea 1.1. •The BacteriaThe are discovery classified of microorganismsinto several Cell Structure wasmajor dependent phyla. on observations made with 2. theThe microscope Archaea are currently classified into two 2. •major phyla.The emergence of experimental 4.2 Cellscience Shapes provided and Arrangements a means to test long held and Function beliefs and resolve controversies 3. Many bacterial cells have a rod, spherical, or 3. MicroInquiryspiral shape and1: Experimentation are organized into and a specific Scientificellular c arrangement. Inquiry in the Bacteria 4.31.2 AnMicroorganisms Overview to Bacterialand Disease and Transmission Archaeal 4.Cell • StructureEarly epidemiology studies suggested how diseases could be spread and 4. Bacterial and archaeal cells are organized at be controlled the cellular and molecular levels. 5. • Resistance to a disease can come and Archaea 4.4 External Cell Structures from exposure to and recovery from a mild 5.form Pili allowof (or cells a very to attach similar) to surfacesdisease or other cells. 1.3 The Classical Golden Age of Microbiology 6. Flagella provide motility. Our planet has always been in the “Age of Bacteria,” ever since the first 6. (1854-1914) 7. A glycocalyx protects against desiccation, fossils—bacteria of course—were entombed in rocks more than 3 billion 7. • The germ theory was based on the attaches cells to surfaces, and helps observations that different microorganisms years ago. On any possible, reasonable criterion, bacteria are—and always pathogens evade the immune system. have been—the dominant forms of life on Earth.
    [Show full text]
  • Geobiology of Marine Magnetotactic Bacteria Sheri Lynn Simmons
    Geobiology of Marine Magnetotactic Bacteria by Sheri Lynn Simmons A.B., Princeton University, 1999 Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Oceanography at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY and the WOODS HOLE OCEANOGRAPHIC INSTITUTION June 2006 c Woods Hole Oceanographic Institution, 2006. Author.............................................................. Joint Program in Oceanography Massachusetts Institute of Technology and Woods Hole Oceanographic Institution May 19, 2006 Certified by. Katrina J. Edwards Associate Scientist, Department of Marine Chemistry and Geochemistry, Woods Hole Oceanographic Institution Thesis Supervisor Accepted by......................................................... Ed DeLong Chair, Joint Committee for Biological Oceanography Massachusetts Institute of Technology-Woods Hole Oceanographic Institution Geobiology of Marine Magnetotactic Bacteria by Sheri Lynn Simmons Submitted to the MASSACHUSETTS INSTITUTE OF TECHNOLOGY and the WOODS HOLE OCEANOGRAPHIC INSTITUTION on May 19, 2006, in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Oceanography Abstract Magnetotactic bacteria (MTB) biomineralize intracellular membrane-bound crystals of magnetite (Fe3O4) or greigite (Fe3S4), and are abundant in the suboxic to anoxic zones of stratified marine environments worldwide. Their population densities (up to 105 cells ml−1) and high intracellular iron content suggest a potentially significant role in iron
    [Show full text]
  • Magnetotactic Bacteria
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by MPG.PuRe Eur. Phys. J. Special Topics 225, 2173–2188 (2016) © The Author(s) 2016 THE EUROPEAN DOI: 10.1140/epjst/e2016-60055-y PHYSICAL JOURNAL SPECIAL TOPICS Review Magnetotactic bacteria Magnetic navigation on the microscale Stefan Klumpp1,2,a and Damien Faivre3 1 Institute for Nonlinear Dynamics, Georg August University G¨ottingen, Friedrich-Hund-Platz 1, 37077 G¨ottingen,Germany 2 Department Theory & Bio-Systems, Max Planck Institute of Colloids and Interfaces, 14424 Potsdam, Germany 3 Department Biomaterials, Max Planck Institute of Colloids and Interfaces, 14424 Potsdam, Germany Received 17 February 2016 / Received in final form 19 April 2016 Published online 10 November 2016 Abstract. Magnetotactic bacteria are aquatic microorganisms with the ability to swim along the field lines of a magnetic field, which in their natural environment is provided by the magnetic field of the Earth. They do so with the help of specialized magnetic organelles called mag- netosomes, vesicles containing magnetic crystals. Magnetosomes are aligned along cytoskeletal filaments to give linear structures that can function as intracellular compass needles. The predominant viewpoint is that the cells passively align with an external magnetic field, just like a macroscopic compass needle, but swim actively along the field lines, propelled by their flagella. In this minireview, we give an introduction to this intriguing bacterial behavior and discuss recent advances in understanding it, with a focus on the swimming directionality, which is not only affected by magnetic fields, but also by gradients of the oxygen concentration.
    [Show full text]
  • Magnetically Controlled Vector Based on E Coli Nissle 1917 S.V. Gorobets1, O.Yu
    Magnetically controlled vector based on E coli Nissle 1917 S.V. Gorobets1, O.Yu. Gorobets1,2*, I.V. Sharau2, Yu.V. Milenko1 1National Technical University of Ukraine «Igor Sikorsky Kyiv Polytechnic Institute», 37 Peremohy Ave., 03056 Kyiv, Ukraine 2Institute of Magnetism of NAS and MES of Ukraine, 36b Acad. Vernadskoho Blvd., 03142 Kyiv, Ukraine *Correspondent author e-mail: [email protected], National Technical University of Ukraine «Igor Sikorsky Kyiv Polytechnic Institute», 37 Peremohy Ave., 03056 Kyiv, Ukraine Introduction For decades gene or protein replacement therapy has been proposed as means of preventing and treating various human diseases, in particular cancer [1] and monogenic diseases such as hemophilia and cystic disease, fibrosis [2–5]. The delivery of proteins or nucleic acids to the target cells is carried out through various mechanisms; these include viral vectors, electroporation, microinjection, lipofection, and others [6,7]. In the past, most researchers have focused on the use of viral vectors that have high delivery efficiency for gene therapy [6]. However, some drawbacks have been noted for viral transduction methods, including: primarily safety of use [8,9], high cost, short-lived bioactivity, size limitation for DNA payload, and problems with immunogenicity and cytotoxicity [6,10,11]. As a result, alternative methods of creating vectors for targeted drug and DNA delivery are being explored. In the mid-1990s, the benefits of using bacterial carriers as vectors for delivery of eukaryotic plasmids were introduced with different bacteria being investigated such as Shigella, S. typhimurium, Salmonellatyphi, S. flexneri, L. Monocytogenes, E. coli and others [12–17]. E. coli is an integral part of the human gastrointestinal flora and is therefore considered as an alternative for delivery through the gut when using gene therapy.
    [Show full text]
  • Iron-Biomineralizing Organelle in Magnetotactic Bacteria: Function
    Iron-biomineralizing organelle in magnetotactic bacteria: function, synthesis and preservation in ancient rock samples Matthieu Amor, François Mathon, Caroline Monteil, Vincent Busigny, Christopher Lefèvre To cite this version: Matthieu Amor, François Mathon, Caroline Monteil, Vincent Busigny, Christopher Lefèvre. Iron- biomineralizing organelle in magnetotactic bacteria: function, synthesis and preservation in ancient rock samples. Environmental Microbiology, Society for Applied Microbiology and Wiley-Blackwell, 2020, 10.1111/1462-2920.15098. hal-02919104 HAL Id: hal-02919104 https://hal.archives-ouvertes.fr/hal-02919104 Submitted on 7 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Iron-biomineralizing organelle in magnetotactic bacteria: function, synthesis 2 and preservation in ancient rock samples 3 4 Matthieu Amor1, François P. Mathon1,2, Caroline L. Monteil1 , Vincent Busigny2,3, Christopher 5 T. Lefevre1 6 7 1Aix-Marseille University, CNRS, CEA, UMR7265 Institute of Biosciences and Biotechnologies 8 of Aix-Marseille, CEA Cadarache, F-13108 Saint-Paul-lez-Durance, France 9 2Université de Paris, Institut de Physique du Globe de Paris, CNRS, F-75005, Paris, France. 10 3Institut Universitaire de France, 75005 Paris, France 11 1 12 Abstract 13 Magnetotactic bacteria (MTB) are ubiquitous aquatic microorganisms that incorporate iron 14 from their environment to synthesize intracellular nanoparticles of magnetite (Fe3O4) or 15 greigite (Fe3S4) in a genetically controlled manner.
    [Show full text]
  • Characterizing of Novel Magnetotactic Bacteria Using a Combination of Magnetic
    bioRxiv preprint doi: https://doi.org/10.1101/682252; this version posted June 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Characterizing of novel magnetotactic bacteria using a combination of magnetic 2 column separation (MTB-CoSe) and mamK-specific primers 3 Veronika V. Koziaeva1, Lolita M. Alekseeva1,2, Maria M. Uzun1,2, Pedro Leão3, 4 Marina V. Sukhacheva1, Ekaterina O. Patutina1, Tatyana V. Kolganova1, Denis S. 5 Grouzdev1* 6 7 1 Institute of Bioengineering, Research Center of Biotechnology of the Russian 8 Academy of Sciences, Moscow, 119071, Russia 9 2 Lomonosov Moscow State University, Moscow, 199991, Russia, 10 3 Instituto de Microbiologia Professor Paulo de Góes, Universidade Federal do Rio de 11 Janeiro, Rio de Janeiro, RJ, 21941-902, Brazil 12 13 *Corresponding author 14 Denis S. Grouzdev. Moscow, Prospect 60 Letiya Oktyabrya 7 bld 1, 117312, Russia. 15 +74991351240, [email protected] 16 17 Running title 18 Novel approaches for MTB investigation 19 20 ABSTRACT 21 Magnetotactic bacteria (MTB) belong to different taxonomic groups according to 16S 22 rRNA or whole-genome phylogeny. Magnetotactic representatives of the class 23 Alphaproteobacteria and the order Magnetococcales are the most frequently isolated 24 MTB in environmental samples. This bias is due in part to limitations of currently 1 bioRxiv preprint doi: https://doi.org/10.1101/682252; this version posted June 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved.
    [Show full text]
  • Desulfovibrio Magneticus RS-1 Contains an Iron- and Phosphorus-Rich Organelle Distinct from Its Bullet- Shaped Magnetosomes
    Desulfovibrio magneticus RS-1 contains an iron- and phosphorus-rich organelle distinct from its bullet- shaped magnetosomes Meghan E. Byrnea, David A. Ballb,1, Jean-Luc Guerquin-Kernc,d,1, Isabelle Rouillere,f, Ting-Di Wuc,d, Kenneth H. Downingb, Hojatollah Valie,f,g, and Arash Komeilia,2 aDepartment of Plant and Microbial Biology, University of California, Berkeley, CA 94720; bLawrence Berkeley National Laboratory, Berkeley, CA 94720; cInstitut National de la Santé et de la Recherche Médicale, U759, 91405 Orsay, France; dInstitut Curie, Laboratoire de Microscopie Ionique, 91405 Orsay, France; and eFacility for Electron Microscopy Research, fDepartment of Anatomy and Cell Biology, and gDepartment of Earth and Planetary Sciences, McGill University, Montreal, QC, Canada H3A 2B2 Edited by Caroline S. Harwood, University of Washington, Seattle, WA, and approved May 17, 2010 (received for review February 2, 2010) Intracellular magnetite crystal formation by magnetotactic bacteria crystals, and genes found in the MAI have been shown to play has emerged as a powerful model for investigating the cellular and a role in the formation of the magnetite crystals and the magne- molecular mechanisms of biomineralization, a process common to tosome chain (7). all branches of life. Although magnetotactic bacteria are phylo- Although knowledge of magnetite biomineralization is growing, genetically diverse and their crystals morphologically diverse, our current understanding is based on studies of a relatively nar- studies to date have focused on a few, closely related species row subset of magnetotactic bacterial strains. All studies cited with similar crystal habits. Here, we investigate the process of above have focused on MB that belong to the α-Proteobacteria magnetite biomineralization in Desulfovibrio magneticus sp.
    [Show full text]
  • Flagella and Swimming Behavior of Marine Magnetotactic Bacteria
    biomolecules Review Flagella and Swimming Behavior of Marine Magnetotactic Bacteria Wei-Jia Zhang 1,2 and Long-Fei Wu 2,3,* 1 Laboratory of Deep-Sea Microbial Cell Biology, Institute of Deep-sea Science and Engineering, Chinese Academy of Sciences, Sanya 572000, China; [email protected] 2 International Associated Laboratory of Evolution and Development of Magnetotactic Multicellular Organisms, F-13402 CNRS-Marseille, France/CAS-Sanya 572000, China 3 Aix Marseille Univ, CNRS, LCB, IMM, IM2B, CENTURI, F-13402 Marseille, France * Correspondence: [email protected]; Tel.: +33-4-9116-4157 Received: 25 February 2020; Accepted: 15 March 2020; Published: 16 March 2020 Abstract: Marine environments are generally characterized by low bulk concentrations of nutrients that are susceptible to steady or intermittent motion driven by currents and local turbulence. Marine bacteria have therefore developed strategies, such as very fast-swimming and the exploitation of multiple directional sensing–response systems in order to efficiently migrate towards favorable places in nutrient gradients. The magnetotactic bacteria (MTB) even utilize Earth’s magnetic field to facilitate downward swimming into the oxic–anoxic interface, which is the most favorable place for their persistence and proliferation, in chemically stratified sediments or water columns. To ensure the desired flagella-propelled motility, marine MTBs have evolved an exquisite flagellar apparatus, and an extremely high number (tens of thousands) of flagella can be found on a single entity, displaying a complex polar, axial, bounce, and photosensitive magnetotactic behavior. In this review, we describe gene clusters, the flagellar apparatus architecture, and the swimming behavior of marine unicellular and multicellular magnetotactic bacteria.
    [Show full text]
  • Genomic Expansion of Magnetotactic Bacteria Reveals an Early Common Origin of Magnetotaxis with Lineage-Specific Evolution
    The ISME Journal (2018) 12:1508–1519 https://doi.org/10.1038/s41396-018-0098-9 ARTICLE Genomic expansion of magnetotactic bacteria reveals an early common origin of magnetotaxis with lineage-specific evolution 1,2,3 1,2,3,4 5 5 1,2,6 Wei Lin ● Wensi Zhang ● Xiang Zhao ● Andrew P. Roberts ● Greig A. Paterson ● 7 1,2,3,4 Dennis A. Bazylinski ● Yongxin Pan Received: 4 October 2017 / Revised: 23 February 2018 / Accepted: 26 February 2018 / Published online: 26 March 2018 © The Author(s) 2018. This article is published with open access Abstract The origin and evolution of magnetoreception, which in diverse prokaryotes and protozoa is known as magnetotaxis and enables these microorganisms to detect Earth’smagneticfield for orientation and navigation, is not well understood in evolutionary biology. The only known prokaryotes capable of sensing the geomagnetic field are magnetotactic bacteria (MTB), motile microorganisms that biomineralize intracellular, membrane-bounded magnetic single-domain crystals of either magnetite (Fe3O4)orgreigite(Fe3S4) called magnetosomes. Magnetosomes are responsible for magnetotaxis in MTB. Here we report the first large-scale metagenomic survey of MTB from both northern and southern hemispheres combined with 28 1234567890();,: genomes from uncultivated MTB. These genomes expand greatly the coverage of MTB in the Proteobacteria, Nitrospirae,and Omnitrophica phyla, and provide the first genomic evidence of MTB belonging to the Zetaproteobacteria and “Candidatus Lambdaproteobacteria” classes. The gene content and organization of magnetosome gene clusters, which are physically grouped genes that encode proteins for magnetosome biosynthesis and organization, are more conserved within phylogenetically similar groups than between different taxonomic lineages.
    [Show full text]
  • Novel Magnetite-Producing Magnetotactic Bacteria Belonging to the Gammaproteobacteria
    The ISME Journal (2012) 6, 440–450 & 2012 International Society for Microbial Ecology All rights reserved 1751-7362/12 www.nature.com/ismej ORIGINAL ARTICLE Novel magnetite-producing magnetotactic bacteria belonging to the Gammaproteobacteria Christopher T Lefe`vre1,4, Nathan Viloria1, Marian L Schmidt1,5, Miha´ly Po´sfai2, Richard B Frankel3 and Dennis A Bazylinski1 1School of Life Sciences, University of Nevada at Las Vegas, 4505 Maryland Parkway, Las Vegas, NV, USA; 2Department of Earth and Environmental Sciences, University of Pannonia, Veszpre´m, Hungary and 3Department of Physics, California Polytechnic State University, San Luis Obispo, CA, USA Two novel magnetotactic bacteria (MTB) were isolated from sediment and water collected from the Badwater Basin, Death Valley National Park and southeastern shore of the Salton Sea, respectively, and were designated as strains BW-2 and SS-5, respectively. Both organisms are rod-shaped, biomineralize magnetite, and are motile by means of flagella. The strains grow chemolithoauto- trophically oxidizing thiosulfate and sulfide microaerobically as electron donors, with thiosulfate oxidized stoichiometrically to sulfate. They appear to utilize the Calvin–Benson–Bassham cycle for autotrophy based on ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) activity and the presence of partial sequences of RubisCO genes. Strains BW-2 and SS-5 biomineralize chains of octahedral magnetite crystals, although the crystals of SS-5 are elongated. Based on 16S rRNA gene sequences, both strains are phylogenetically affiliated with the Gammaproteobacteria class. Strain SS-5 belongs to the order Chromatiales; the cultured bacterium with the highest 16S rRNA gene sequence identity to SS-5 is Thiohalocapsa marina (93.0%).
    [Show full text]