Role of the RNA-Binding Protein Hur in Colon Carcinogenesis

Role of the RNA-binding protein HuR in colon carcinogenesis

Isabel Lo´ pez de Silanes1, Jinshui Fan1, Xiaoling Yang1, Alan B. Zonderman2, Olga Potapova3, Ellen S. Pizer4, and Myriam Gorospe*,1

1Laboratory of Cellular and Molecular Biology, and 2Research Resources Branch, National Institute on Aging-Intramural Research Program, National Institutes of Health, Baltimore, MD 21224, USA; 3Preclinical Research and Translational Medicine, SUGEN, Inc., San Francisco, CA 94080, USA; 4Department of Pathology, Johns Hopkins Medical Institutions, Baltimore, MD 21224, USA

Immunohistochemical analysis of paired tumor and such as cyclin A and cyclin B1, proliferation-associated normal tissue specimens revealed that the expression and genes such as c-fos and c-myc, as well as other factors cytoplasmic abundance of the RNA-binding protein HuR that influence tumor cell growth like the vascular increased with malignancy, particularly in colon carcino- endothelial growth factor, cyclooxygenase-2, tumor mas. Interventions to modulate HuR expression in human necrosis factor (TNF)-a, and several interleukin (Levine RKOcolon cancer cells altered gene expression profiles et al., 1993; Antic and Keene, 1997; Levy et al., 1998; and identified b-catenin mRNA as a novel HuR target. Peng et al., 1998; Wang et al., 2000a; Dixon et al., 2001). Subcutaneous injection of HuR-overexpressing RKOcells HuR enhanced the stability of the cyclin A and cyclin B1 into nude mice produced significantly larger tumors than mRNAs during the S phase of the cell division cycle, an those arising from control populations; conversely, RKO effect that was linked to cell cycle progression and cell cells expressing reduced HuR through small interference proliferation (Wang et al., 2000a). In models of in vitro RNA- or antisense HuR-based approaches developed senescence of human diploid fibroblasts, high HuR significantly more slowly. We propose that HuR-regulated expression levels in young fibroblasts contributed to the target mRNA expression contributes to colon cancer stabilization of mRNAs encoding cyclin A, cyclin B1, growth. Our results suggest a pivotal function for HuR in and c-fos and to the heightened expression of the colon carcinogenesis. corresponding protein products (Wang et al., 2001). Oncogene (2003) 22, 7146–7154. doi:10.1038/sj.onc.1206862 The precise mechanisms whereby HuR mediates the stabilization of target mRNAs are still poorly under- Keywords: HuR; ELAV; colon cancer; mRNA turn- stood. However, HuR’s presence in the cytoplasm over; carcinogenesis appears to be intimately linked to its mRNA-stabilizing function. HuR is predominantly (490%) localized in the nucleus of most unstimulated cells, but upon cell stimulation, it can translocate to the cytoplasm where it Introduction binds target mRNAs and prevents their decay (Atasoy et al., 1998; Fan and Steitz, 1998a, b; Peng et al., 1998; The RNA-binding protein HuR, a member of the Keene, 1999; Wang et al., 2000a, b; Chen et al., 2002). embryonic lethal abnormal vision (ELAV)/Hu protein The association of HuR with PP32, APRIL, and SETa/ family, is emerging as an important regulator of cellular b proteins (Brennan et al., 2000) is believed to influence proliferation. ELAV/Hu proteins were initially identi- HuR export from the nucleus and possibly also fied as specific tumor antigens in cancers of individuals modulate HuR’s affinity for its target mRNAs. with paraneoplastic neurological disorder, providing the Although PP32 and SETa/b are inhibitors of PP2A, first indication that they could exert a growth-regulatory the only kinase thus far implicated in regulating HuR function (Dalmau et al., 1990; Szabo et al., 1991). translocation, and consequently the stabilization of ELAV/Hu proteins, comprising HuB, HuC, HuD HuR target mRNAs, is the AMP-activated kinase (primarily expressed in neuronal tissues), and the (AMPK). Interventions to modulate AMPK profoundly ubiquitous HuR, were subsequently found to regulate affect the subcellular localization of HuR and conse- the expression of labile mRNAs bearing AU- and U-rich quently influence HuR’s ability to increase target sequences by enhancing their stability, translation, or mRNA expression and cellular proliferation (Wang both (Brennan and Steitz, 2001); many such target et al., 2002). mRNAs encode proteins important for cell growth and Recent studies examining HuR expression in lung proliferation. Examples include cell cycle regulators tumors revealed that the abundance of HuR protein was significantly greater in malignant tumors than in benign tumors (Blaxall et al., 2000). Despite HuR’s long- *Correspondence: M Gorospe, Box 12, LCMB, NIA-IRP, NIH, 5600 Nathan Shock Drive, Baltimore, MD 21224, USA; recognized role as a regulator of the expression of E-mail: [email protected] proliferative genes, its potential involvement in cancer Received 25 February 2003; revised 11 May 2003; accepted 4 June 2003 has not been directly investigated. In the present study, HuR in colon carcinogenesis ILo´pez de Silanes et al 7147 we carry out a systematic comparison between HuR (Wang et al., 2000b). For REMSA supershift analysis, expression in a variety of cancers and their normal tissue 0.2 mg of HuR antibody (Santa Cruz Biotech., Santa Cruz, counterparts. Examination of HuR abundance and CA, USA) was incubated with lysates for 30 min on ice before addition of radiolabeled RNA; all subsequent steps were as subcellular localization in tissue arrays containing MAPK paired cancer and normal specimens revealed higher described for REMSA. Anti-p38 antibody used in REMSA supershift assays was obtained from Pharmingen HuR expression and cytoplasmic presence in all (San Diego, CA, USA). malignancies examined, particularly colon cancer. Moreover, HuR-overexpressing colon cancer cells injected into nude mice caused accelerated tumor growth Northern blot, Western blot, and cDNA array analyses compared with the growth of control cells. Decreased Northern blot analysis was previously described (Gorospe expression of HuR through antisense RNA and small et al., 1998). For detection of mRNAs encoding b-catenin and interference RNA (siRNA) approaches inhibited tumor GAPDH, PCR fragments encompassing the respective CRs 32 growth. These findings underscore HuR’s function in were random primer labeled with [a- P]dATP. Northern blot regulating the proliferation of malignant cells, a func- signals were quantitated with a PhosphorImager (Molecular Dynamics) and normalized to GAPDH mRNA signals. For tion that likely relies on its ability to modulate the Western blotting, whole-cell (10 mg), nuclear (10 mg), and expression of cancer-associated genes. cytoplasmic (40 mg) extracts, as well as extracts (50 mg) from frozen tumor material that was homogenized in a buffer Materials and methods containing 50 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1% NP-40, 0.25% Na-deoxycholate, 1 mm EDTA, and protease Cell culture, treatment, and transfection of plasmids and siRNA inhibitor cocktail (Roche), were size fractionated by SDS–PAGE and transferred onto membranes. HuR, b- Human colorectal carcinoma RKOcells were cultured in catenin, histone deacetylase 1 (HDAC1) were detected using minimum essential medium (Gibco-BRL, Gaithersburg, MD, monoclonal antibodies from Santa Cruz Biotech., BD USA) supplemented with 10% fetal bovine serum and Biosciences (San Jose, CA, USA), and b-actin was detected antibiotics. Cell lines expressing sense or antisense HuR using a monoclonal antibody from Abcor Abcam Limited mRNA constitutively were established through transfection (Cambridge, UK). Following secondary antibody incubations, with pZeoSV2(-)HuR(S), pZeoSV2(-)ASHuR (AS), or empty signals were visualized by enhanced chemiluminescence pZeoSV2(-) (zeo) (Levy et al., 1998). Stably transfected clonal (Amersham, Arlington, Heights, IL, USA). populations were stored frozen and used within 3–5 weeks of The total RNA from S2 and AS7 cells was reverse thawing. HuR2 siRNA sequence, targeting the coding region transcribed in the presence of [a-33P]dCTP and the radiolabeled (CR) of HuR (nucleotides 980–1000, Genbank# BC003376), product used to hybridize cDNA arrays (Human Focused was AACACCAACAAGTGGAAAGGG; C siRNA (a con- Array, 4608 genes, http://www.grc.nia.nih.gov/branches/rrb/ trol sequence not matching any known human gene) was dna/dna.htm), as previously described (Fan et al., 2002). All AAGTGTAGTAGATCACCAGGC. siRNAs (200 nm, Dhar- the data were first analysed using the Array Pro software macon Research, Lafayette, CO, USA) were transfected using (Media Cybernetics, Inc., Carlsbad, CA, USA), then normal- oligofectamine (Invitrogen, Carslbad, CA, USA). ized by Z-score transformation (Cheadle et al., 2003). In brief, the log base-10 of each original spot intensity was adjusted to Synthesis of radiolabeled transcripts the mean and divided by the standard deviation of all the spot For in vitro synthesis of c-fos and b-catenin transcripts, intensities. Changes in gene expression between different RNA reverse-transcribed total RNA was used as a template for groups were then calculated by subtracting the average of PCR reactions. All 50 oligonucleotides contained the T7 RNA replicate measurements. This value, referred to as the Z polymerase promoter sequence CCAAGCTTCTAATAC- difference (Z diff, Z average in S2ÀZ average in AS7 cells) was 0 tested for significance using a two-tailed Z-test [ZX2.4] and GACTCACTATAGGGAGA (T7). To prepare the c-fos 3 untranslated region (UTR) template, oligonucleotides Pp0.01. The data reflect three independent experiments. The complete cDNA array data are available (http://www.grc.nia.- (T7)GCAATGAGCCTTCCTCTGAC and CATTCAACT- TAAATGCTTTTATTG (region 1246–2101) were used. To nih.gov/branches/rrb/dna/dnapubs.htm). prepare the b-catenin CR template, oligonucleotides (T7) ATGGCTACTCAAGCTGATTTGATGG and TTACAGGT Tumor development in nude mice CAGTATCAAACCAGGCCAGC (region 215–2560) were RKOcells were trypsinized, resuspended in PBS (10 6 cells/ used; to prepare the b-catenin 30UTR template, oligonucleo- 0.2 ml), and injected into the lumbar regions of male athymic tides (T ) ATCATCCTTTAGCTGTATTGTCTGAACTTG 7 BALB/c nude mice (BALB/cnu/nu, 8 weeks of age (Taconic, and AATGAATTAAAAGTTTAATTCTGAACC (region Germantown, NY, USA)): control (either C siRNA-trans- 2561–3362) were used. Plasmid pT7T3-TNF30UTR (human fected or zeo) cells in left flanks; HuR2 siRNA-transfected, cDNA clone IMAGE: 446927 30, accession no. AA699697) sense HuR (S)- or antisense HuR (AS)-transfected cells, in served as a template for in vitro transcription of the TNF-a right flanks. Tumor size ((a b)1/2; a: largest diameter and b: its 30UTR, which encompassed nucleotides 1004–1565. PCR Â perpendicular diameter) was calculated by measuring tumor fragments served as templates for transcript synthesis using dimensions with a caliper every 2–3 days. T7 RNA polymerase in the presence of [a-32P]UTP (Wang et al., 2002). Statistical analyses Data were analysed by mixed-effects regression with back- Subcellular fractionation, RNA-electrophoretic mobility shift ward elimination of higher-order interactions using SAS assay (REMSA), and REMSA supershift version 8.2 (Laird and Ware, 1982; Morrell et al., 1997; SAS Preparation of cytoplasmic and nuclear fractions, as well as Institute Inc., 1999). For experiments involving HuR-over- REMSA analysis were carried out as previously described expressing cells, analyses were performed on tumor size with

Oncogene HuR in colon carcinogenesis ILo´pez de Silanes et al 7148 one between-group factor with three levels (HuR overexpression: S2, S4, and S11) and two within-group factors condition (experiment versus control), and nine levels of time (0, 7, 9, 12, 14, 16, 19, 21, 23 days). For experiments involving cells that expressed reduced HuR levels, analyses were performed on tumor size with one between-group factor with two levels (experiment versus control) and with two within-group factors method (reduction of HuR levels: AS7 and siRNA), and nine levels of time (0, 7, 9, 12, 14, 16, 19, 21, 23 days).

Immunohistochemistry Colorectal carcinoma specimens were obtained from the Pathology Department, Johns Hopkins Bayview Hospital. Tissue arrays were obtained from Imgenex (San Diego, CA, USA) and InnoGenex (San Ramon, CA, USA). Slides were subjected to heat-induced epitope retrieval, incubation with primary antibody, and detection with the LSAB2 system (Dako, Carpinteria, CA, USA). Monoclonal anti-HuR antibody (Molecular Probes Inc., Eugene, OR, USA) was used at 0.25 mg/ml, and anti-Ki-67 antibody (Dako, Carpinteria, CA, USA) was used at 1 : 200 dilution. IHC grading was performed using a system that grades both intensity and subcellular distribution. Each intensity score (negative ¼ 0, weak ¼ 1, moderate ¼ 2, strong ¼ 3) was multiplied by the fraction of the tissue that stained at that level. The total was multiplied by a constant to bring the scores into a higher numerical range for convenience of display. For example, (25% Â 0) þ (25% Â 1) þ (50% Â 2) þ (0% Â 3) ¼ 1.25; 1.25 Â 4 ¼ 5, out of a maximum of 12.

Results and discussion

Immunohistochemical analysis of HuR expression and subcellular localization in human tissues Given HuR’s ability to bind to mRNAs encoding proliferation-associated proteins and enhance their stability and expression, we set out to examine HuR levels in Figure 1 Immunohistochemical detection of HuR in paired cancer tissues. The expression of HuR was examined in normal and cancer tissues. Representative HuR staining photomicrographs of the indicated normal and cancer sections from human tissue arrays containing a total of 182 tumor human tissue arrays; 10 specimens from each tissue type were specimens and 135 corresponding normal tissue sam- assessed. Images are shown at 20 Â magniﬁcation ples. Figure 1 shows examples of pairs of normal and malignant specimens of the stomach, lung, colon, thyroid, and kidney. HuR staining was weak to We carried out immunohistochemical analysis of moderate in all normal tissues examined and was almost HuR expression in a collection of 15 colon specimens exclusively nuclear (with the exception of ‘normal’ liver presenting normal and neoplastic tissue, the latter specimens, which were obtained from patients with liver exhibiting different stages of progression to malignancy cirrhosis and displayed abundant cytoplasmic HuR) (Figure 2). Compared with the colon mucosa, the HuR (Table 1). By contrast, pairwise comparisons between signal was more intense in colon adenomas and stronger normal and cancer tissues revealed markedly heightened yet in colon carcinomas (Figure 2a). Moreover, the HuR expression in the tumor samples and a prominent subcellular localization of HuR within the tumor cells increase in its cytoplasmic presence (Figure 1 and differed from that seen in the normal colon cells. The Table 1). Ascertaining the relative abundance of relative cytoplasmic abundance of HuR is lowest in the cytoplasmic HuR was of great potential relevance to normal mucosa, moderately higher in adenomas, and this analysis, since HuR’s mRNA-stabilizing function is highest in carcinomas (Figure 2a zoom, 2b). In normal believed to be intimately linked to its cytoplasmic colon mucosa, HuR staining was strongest at the base of presence. The increase in cytoplasmic staining with the crypts, progressively decreasing towards the top of malignancy was most pronounced in colon specimens; the crypt (Figure 3, panel 2). HuR expression correlated therefore, in order to investigate if elevated HuR closely with cellular proliferation, as evidenced by the expression was directly involved in the carcinogenic gradient of staining for the proliferation-associated process, we focused on colon cancer. antigen Ki-67: it was highest at the base of the crypt,

Oncogene HuR in colon carcinogenesis ILo´pez de Silanes et al 7149 Table 1 Semiquantitative scoring of nuclear and cytoplasmic HuR staining HuR in normal tissues HuR in tumor tissues Tumor relative to normal (relative intensity)

Tumor site Tumor type n Nuc. Cytop. Nuc. Cytop. Nuc. Cytop.

Stomach Adenocarcinoma 9 12 4 9 10 0.75 2.5 Lung Squamous cell carcinoma 8 10 4 4 9 0.4 2.25 Colon Adenocarcinoma 10 5 2 10 10 2 5 Thyroid Papillarycarcinoma 9 10 2 2 10 0.2 5 Kidney Renal cell carcinoma 9 5 5 4 8 0.8 1.6 Breast Inﬁltrating duct carcinoma 7 3 4 2 5 0.66 1.25 Liver Hepatocellular carcinoma 9 1* 12* 4 9 4 0.75 Ovary Papillary carcinoma 9 4 2 2 8 0.5 4 Pancreas Ductal adenocarcinoma 10 3 4 4 4 1.3 1 Prostate Adenocarcinoma 9 4 4 5 8 1.2 2 Larynx Squamous cell carcinoma 9 2 6 4 8 2 1.3 Skin Malignant melanoma 9 1 5 3 10 3 2 Esophagus Squamous cell carcinoma 10 4 2 8 6 2 3 Gallbladder Adenocarcinoma 10 4 4 8 6 2 1.5 Endometrium Adenocarcinoma 10 4 4 4 9 1 2.25 Urinary bladder Transitional cell carcinoma 9 5 4 5 8 1 2

*‘Normal’ liver specimens on tissue array were prepared from patients with liver cirrhosis.

reduced towards the top. These observations are in RKOpopulations displaying different HuR levels keeping with our earlier findings that higher HuR were used to ascertain the influence of HuR on global expression was linked to increased cell proliferation gene expression profiles. cDNA array analysis using (Wang et al., 2000a, 2001). However, the presence of RNA prepared from S2 and AS7 served to identify a HuR-positive cells in Ki-67-negative areas of the collection of genes whose expression was influenced by malignant tissues indicates that HuR expression does HuR abundance. From the 1177 genes whose expression not strictly correlate with cellular proliferation (Figure 3, was found to be significantly higher in S2 cells relative to panel 3). This finding further suggests a possible AS7 cells, 26 genes of potential relevance to cancer, involvement of HuR in malignancy that is independent cellular proliferation, or both processes, are listed in of HuR’s ability to upregulate the expression of Figure 4b (see http://www.grc.nia.nih.gov/branches/rrb/ proliferative genes. dna/dnapubs.htm for the complete list of genes). Among them are several genes encoding mRNAs that were Altered levels of HuR in colon carcinoma RKO cells previously shown to be direct targets of HuR binding modifies the expression of numerous genes, including a and HuR-mediated upregulation, such as VEGF, p21, novel HuR target mRNA encoding b-catenin cyclin A1, and cyclin B1 (Levy et al., 1998; Joseph et al., 1998; Wang et al., 2000a). The b-catenin mRNA was In order to assess the significance of HuR expression in also found to be more abundant in HuR-overexpressing colon cancer, we generated different cell lines that cells (Figure 4b,c). This finding was of particular expressed different amounts of HuR. The human colon interest, given the close link between colorectal carcino- cancer cell line RKOwas transfected with pZeo(SV2)- genesis and b-catenin accumulation or mutation (for a derived constructs expressing either the sense or the review, see reference Wong and Pignatelli, 2002). antisense HuR transcript. HuR levels in selected sense Northern blot analysis was performed to monitor b- clonal isolates (S2, S4, S11) were about 3–5-fold higher catenin mRNA levels in all cell populations (Figure 4c). than in empty vector-transfected cells (zeo), and they Relative to zeo control cells, the abundance of b-catenin were 50% lower in the antisense clonal population mRNAs decreased in AS7 cells and increased in S2, S4, selected (AS7) (Figure 4a). We were unable to develop and S11 cells, as anticipated. clones displaying greater differences in HuR expression, Further characterization of the stably transfected suggesting that clonal cell growth required that HuR RKOpopulations exhibiting different HuR levels, as levels be maintained within strict limits. As previously well as assessment of HuR’s ability to directly bind some reported (Wang et al., 2000a, b), the reduced HuR known target transcripts were carried out next. HuR phenotype was lost after extended culture of cells, and binding to two mRNAs previously reported to be HuR therefore sense and antisense populations were used direct targets (those encoding TNF-a and c-fos (Figure within 3–5 weeks of thawing and were cultured in the 5a,b)), was assessed by REMSA in the presence of anti- continuous presence of zeocin. Assessment of the HuR antibodies to supershift radiolabeled complexes cytoplasmic levels of HuR in the clonal populations specifically containing HuR. The b-catenin mRNA revealed differences in expression comparable to those contains a long 30UTR with multiple AU-rich regions seen in whole-cell lysates (Figure 4a). (Figure 5c, schematic) and was therefore included in the

Oncogene HuR in colon carcinogenesis ILo´pez de Silanes et al 7150

Figure 3 Photomicrographs revealing HuR and Ki-67 signals in representative colon specimens. Areas of normal mucosa, adenoma, and carcinoma are depicted (1), with magniﬁcation of ﬁelds of (2) normal mucosa, and (3) adenoma and carcinoma

Figure 2 Immunohistochemical detection of HuR in human using nuclear lysates, which, as previously reported for normal colon mucosa and colon carcinoma tissues. (a) Top, (Wang et al., 2000a, b, 2001), revealed no HuR-related Representative photomicrographs of HuR expression in sections differences in complex formation. Western blot analysis from normal colon mucosa, colon adenoma, and colon carcinoma, shown at 40 Â magnification; zoom, local enlarged fields. (b) revealed that b-Catenin expression changed accordingly Semiquantitative assessment of HuR staining (arbitrary units (a.u.) (Figure 5d). In the cytoplasmic fractions, b-Catenin and percentage) in the nucleus and cytoplasm of normal mucosa, expression was elevated in the three cell lines over- adenoma and carcinoma as explained in the legend of Table 1 and expressing HuR, an effect that was particularly apparent in the Materials and methods section in S2 cells. In nuclear preparations, only S4 and S11 showed higher levels than control cells, possibly revealing deficiencies in b-catenin nuclear import in S2 cells. subsequent analysis of HuR function in these cells. Indeed, radiolabeled transcripts encompassing the The tumorigenicity of RKO cells in nude mice is 30UTRs of TNF-a,c-fos, and b-catenin formed abun- influenced by differences in HuR levels dant complexes detected by REMSA (Figure 5a–c). That HuR was present in the shifted complexes was Despite HuR’s ability to bind to and enhance the demonstrated by the formation of supershift bands expression of mRNAs that play pivotal roles in cell (arrowhead) in samples that were incubated with an proliferation (cyclin A, cyclin B1, and c-fos) and anti-HuR antibody. Accordingly, the intensity of super- carcinogenesis (b-catenin, as shown here, and c-myc, shifted complexes increased when using lysates from S2, TNF-a, and VEGF), its potential contribution to in vivo S4, S11 cells, and decreased when using lysates from tumorigenesis has not been directly investigated. To AS7 cells (Figure 5a–c). In control incubations, an explore the possibility that HuR does contribute to antibody recognizing the p38MAPK was unable to super- tumor development, RKOcells expressing different shift radiolabeled complexes (Figure 5c). Other controls HuR levels were assayed for their ability to form tumors included REMSA using transcripts spanning the CR in nude mice. One million cells derived from either and 50UTRs of TNF-a,c-fos, and b-catenin mRNAs parental populations (zeo), populations overexpressing (Figure 5c and data not shown), which did not form HuR (S2, S4, S11), or populations with reduced complexes with cytoplasmic proteins, and REMSA HuR expression (AS7) were injected into nude mice

Oncogene HuR in colon carcinogenesis ILo´pez de Silanes et al 7151

Figure 5 Endogenous HuR forms complexes with transcripts encompassing the TNF-a,c-fos, and b-catenin 30UTRs. (a) REMSA analysis of complexes formed with proteins present in cytoplasmic lysates from stably transfected RKOclones and a Figure 4 Influence of HuR levels on gene expression patterns. (a) radiolabeled transcript encompassing the TNF-a 30UTR; binding Western blot analysis of HuR levels in whole-cell (10 mg) and was performed in the absence or presence of an antibody cytoplasmic (40 mg) lysates prepared from RKOcolon cancer cells recognizing HuR ( þ aHuR), as explained in ‘Materials and stably transfected with plasmids expressing antisense HuR (clone methods’. (b) REMSA analysis of complexes formed as described AS7), sense HuR (clones S2, S4 and S11), or lacking an insert (zeo); in the legend of panel A except using a radiolabeled transcript that b-Actin levels illustrate loading and transfer differences on Western encompasses the c-fos 30UTR. (c) Left, REMSA analysis of blots. (b) List of genes displaying significantly higher expression in complexes forming as described in the legend of panel A, except S2 relative to AS7 cells, as identified through cDNA array analysis using a radiolabeled transcript that encompasses either the b- (http://www.grc.nia.nih.gov/branches/rrb/dna/array.htm, ‘Focused catenin CR or the b-catenin 30UTR (schematic, depicting U- and array’, containing 4608 genes). Differences in Z averages (Z diff) AU-rich region in shaded box); binding was performed in the served to assess the relative abundance of a given transcript in S2 absence or presence of antibodies recognizing either HuR and AS7 and were calculated as explained in the Materials and ( þ aHuR) or p38MAPK ( þ ap38). (d) Western blot analysis of b- methods section. cDNA array analysis was performed three Catenin expression in cytoplasmic and nuclear fractions; b-Actin independent times and Z diff values are significant using two tests and HDAC1 levels reveal even loading and transfer of cytoplasmic (ZX2.4 and Pp0.01). (c) Representative Northern blotting and and nuclear samples on Western blots, respectively. Arrowheads, quantification of b-Catenin mRNA signals relative to GAPDH HuR-containing supershifted complexes; ‘-’, free probe mRNA in cells expressing different HuR levels. Graphs represent the mean of two independent experiments

there was a significant interaction between HuR over- BALB/cnu/nu. Tumor growth was monitored using expression and experimental condition (F½2; 347¼5:87, standard measurement tools. Compared with tumors Po0.01). Other higher-order terms in the analysis were arising from control cells, tumours arising from HuR- removed by backward elimination. Representative overexpressing RKOcells were larger and exhibited Western blots depicting HuR expression levels in tumors accelerated growth (Figure 6a). There was a significant excised at the end of the tumor growth period (around 1 difference associated with tumor growth over time month after inoculation) are shown in Figure 6b. HuR (F½1; 21¼177:96, Po0.001), indicating that the slope expression was higher in the tumors derived from cells of growth over time is greater than zero. There was no overexpressing HuR compared to that seen in control significant difference among the three populations tumors (zeo) from the same mouse. Interestingly, the overexpressing HuR (F½2; 347¼0:69, NS), but there animal tissue environment appeared to influence HuR was a significant difference between the experimental expression levels significantly, since HuR levels per and control groups (F½1; 347¼33:18, Po0.001), and tumor in the two mice shown were markedly different,

Oncogene HuR in colon carcinogenesis ILo´pez de Silanes et al 7152

Figure 6 Effect of HuR overexpression on tumor development in nude mice. Tumorigenicity of stably transfected clones expressing either basal (zeo) or elevated (S2, S4, S11) HuR was assessed by subcutaneous inoculation of 106 cells into the ﬂanks of athymic mice. (a) Tumor sizes were measured at various times after inoculation. Graphed data (mean and standard deviation) were obtained from eight mice from two independent experiments. (*) There is a signiﬁcant interaction between HuR overexpression and experimental condition (F[2, 347] ¼ 5.87, Po0.01). (b) Western blot analysis of HuR levels in tumors derived from either S2 or zeo cells and excised upon completion of the tumor growth period; b-Actin levels served to assess loading differences on Western blots

despite having inoculated the same zeo and S2 populations. Conversely, AS7 cells, expressing reduced HuR, produced smaller tumors (Figure 7a). A small reduction of HuR levels was seen in tumors derived from AS7 cells compared with tumors derived from control cells Figure 7 Effect of reduced HuR expression on tumor development in nude mice. (a) Tumor sizes were measured after (Figure 7b). These moderate differences are likely inoculation of either AS7 or zeo cells. (b) Western blot analysis attributed to an increasing loss of the reduced HuR of HuR levels in tumors derived from either AS7 or zeo cells, phenotype with the prolonged growth of cells in the excised upon completion of the tumor growth period; b-Actin absence of zeocin (Wang et al., 2000a, b). In addition, it signals served as loading and transfer control on Western blots. was noted that control tumors obtained from mice (c) Tumor sizes were measured after inoculation of either HuR2 siRNA- or C siRNA-transfected cells. Graphed data (mean and where antisense HuR-expressing cells were injected, were standard deviation) were obtained from eight mice from two bigger than those obtained when HuR-overexpressing independent experiments. (*) There is a significant interaction cells were inoculated. The reasons for these effects between experimental condition and tumor growth over time (F[1, remain unclear at the present time. 238] ¼ 10.85, Po0.01). Inset, Western blot analysis of HuR expression in siRNA-transfected cells. Numbers reflect percentage Given the moderate decrease in tumor growth in anti- of remaining HuR in HuR2 siRNA-transfected cells compared sense HuR-expressing populations, we sought to reduce with HuR signals in C siRNA-transfected populations at the HuR expression by alternative means. Use of siRNA led corresponding time intervals following transfection to a 35–50% reduction in HuR expression in transfected cells (Figure 7c, inset), with no effect on cell viability. However, even moderate reductions (comparable to experimental and control groups (F½1; 14¼0:35, NS). those achieved in AS7 cells), were capable of substan- However, there was a significant interaction between the tially reducing tumor growth (Figure 7c). There was a experimental condition and tumor growth over time significant difference associated with tumor growth over (F½1; 238¼10:85, Po0.01). There was no difference time (F½1; 14¼84:69, Po0.001), indicating that the between the AS7- and siRNA-transfected cell groups, slope of growth over time was lesser than zero. For both but there was a significant interaction between group methods, there was no significant difference between and time (F½1; 238¼19:25, Po0.001). There was no

Oncogene HuR in colon carcinogenesis ILo´pez de Silanes et al 7153 interaction between experimental condition and group; Vogelstein (1990), correlates stages of carcinogenesis however, there was a significant three-way interaction with key mutations in oncogenes and tumor-suppressor (F½1; 238¼11:92, Po0.001). Losing the siRNA effect genes that drive cancer development. However, it is by 43 weeks was expected (data not shown), given the becoming growingly apparent that in cancers of the well-documented decline in siRNA effects within this colon and other organs, many more genes are expressed time frame (Bosher and Labouesse, 2000). However, at abnormal levels than are mutated (Sager, 1997). these findings lend support to the notion that altered Based on the findings of the present investigation, we HuR levels at the time of inoculation can have propose that HuR serves to coordinately regulate the significant effects on tumor growth, even if such expression of genes involved in colon carcinogenesis. It differences in HuR levels decline thereafter. In conclu- is plausible that the HuR-upregulated expression of sion, in this model system, HuR is able to modulate the VEGF, TNF-a,c-fos,andb-catenin contributes to RKO tumorigenesis of colon cancer cells and appears to exert colon carcinogenesis, given their previously reported its effects early in the process. links to cancer (Folkman, 1995; Jooss and Muller, 1995; Post-transcriptional gene regulatory events, and Balkwill, 2002; Wong and Pignatelli, 2002). Finally, mRNA turnover in particular (Fan et al., 2002), are since HuR shows greater abundance and displays a emerging as fundamental and effective means of altering greater cytoplasmic presence in virtually all tumors the expression of functionally related genes in an examined, we further postulate that HuR is likely to orchestrated fashion. The investigation of such post- contribute to the malignant phenotype of other cancer transcriptional regulatory mechanisms has been termed types as well. Our findings illustrate the existence of ribonomics, and focuses on the association of a given additional levels of complexity in the mechanisms RNA-binding protein with its target mRNA collection regulating cancer-related gene expression and under- (Keene and Tenenbaum, 2002). In the case of HuR, score the usefulness of HuR as a potential target of many target mRNAs (such as those encoding c-fos, intervention in cancer therapy. c-myc, TNF-a, p21, cyclin A, cyclin B1, cyclooxygenase- 2, VEGF, etc.) lack a recognizable consensus sequence, but generally have U- or AU-rich stretches in their Abbreviations UTRs that serve as recognition sites for HuR. Given CR, coding region; ELAV, embryonic lethal abnormal vision; HuR’s potential role in carcinogenesis, it will be of REMSA, RNA electrophoretic mobility-shift assay; UTR, utmost interest to carry out a systematic identification of untranslated region. the mRNAs that HuR binds to, as previously performed for the HuR-related protein HuB (Tenenbaum et al., 2000). Acknowledgements We thank MB Kastan for the RKOcells, S Galba ´ n, M Jr The present study revealing HuR’s involvement in Ware, J Robinson, C Galba´ n, and J Alsruhe for assistance colon carcinogenesis is in keeping with its increasingly with experimental procedures, and KG Becker and C Cheadle recognized role as a regulator of cell proliferation (Wang for providing cDNA arrays and guidance in their analysis. We et al., 2000a, 2001). A widely established model of are grateful to our colleagues PJ Morin and DL Longo for colorectal carcinogenesis, proposed by Fearon and critical reading of the manuscript.

References

Antic D and Keene JD. (1997). Am. J. Hum. Genet., 61, Dixon DA, Tolley ND, King PH, Nabors LB, McIntyre TM, 273–278. Zimmerman GA and Prescott SM. (2001). J. Clin. Invest., Atasoy U, Watson J, Patel D and Keene JD. (1998). J. Cell 108, 1657–1665. Sci., 111, 3145–3156. Fan XC and Steitz JA. (1998a). Proc. Natl. Acad. Sci. USA, Balkwill F. (2002). Cytokine Growth Factor Rev., 13, 135–141. 95, 15293–15298. Blaxall BC, Dwyer-Nield LD, Bauer AK, Bohlmeyer TJ, Fan XC and Steitz JA. (1998b). EMBO J., 17, 3448–3460. Malkinson AM and Port JD. (2000). Mol. Carcinogen., 28, Fan J, Yang X, Wang W, Wood III WH, Becker KG and 76–83. Gorospe M. (2002). Proc. Natl. Acad. Sci. USA, 99, Bosher JM and Labouesse M. (2000). Nat. Cell Biol., 2, 10611–10616. E31–E36. Fearon ER and Vogelstein B. (1990). Cell, 61, 759–767. Brennan CM, Gallouzi IE and Steitz JA. (2000). J. Cell. Biol., Folkman J. (1995). Nat. Med., 1, 27–31. 151, 1–14. Gorospe M, Wang X and Holbrook NJ. (1998). Mol. Cell. Brennan CM and Steitz JA. (2001). Cell. Mol. Life Sci., 58, Biol., 18, 1400–1407. 266–277. Jooss KU and Muller R. (1995). Oncogene, 10, 603–608. Cheadle C, Vawter MP, Freed WJ and Becker KG. (2003). J. Joseph B, Orlian M and Furneaux H. (1998). J. Biol. Chem., Mol. Diagn., 5, 73–81. 273, 20511–20516. Chen CY, Xu N and Shyu A-B. (2002). Mol. Cell. Biol., 22, Keene JD. (1999). Proc. Natl. Acad. Sci. USA, 96, 5–7. 7268–7278. Keene JD and Tenenbaum SA. (2002). Mol. Cell, 9, Dalmau J, Furneaux HM, Gralla RJ, Kris MG and Posner JB. 1161–1167. (1990). Ann. Neurol., 27, 544–552. Laird NM and Ware JH. (1982). Biometrics, 38, 963–974.

Oncogene HuR in colon carcinogenesis ILo´pez de Silanes et al 7154 Levine TD, Gao F, King PH, Andrews LG and Keene JD. Vawter MP, Barrett T, Cheadle C, Sokolov BP, Wood WH, (1993). Mol. Cell. Biol., 13, 3494–3504. Donovan D, Webster M, Freed WJ and Becker KG. (2001). Levy NS, Chung S, Furneaux H and Levy AP. (1998). J. Biol. Brain Res. Bull., 55, 641–650. Chem., 273, 6417–6423. Wang W, Caldwell MC, Lin S, Furneaux H and Gorospe M. Morrell CH, Pearson JD and Brant LJ. (1997). Am. (2000a). EMBO J., 19, 2340–2350. Statistician, 51, 338–343. Wang W, Fan J, Yang X, Fu¨ rer S, Lo´ pez de Silanes I, von Nabors LB, Gillespie GY, Harkins L and King PH. (2001). Kobbe C, Guo J, Georas SN, Foufelle F, Hardie DG, Cancer Res., 61, 2154–2161. Carling D and Gorospe M. (2002). Mol. Cell. Biol., 22, Sager R. (1997). Proc. Natl. Acad. Sci. USA, 94, 952–955. 3425–3436. SAS Institute Inc.. 1999. SAS/STATs User’s Guide, Version Wang W, Furneaux H, Cheng H, Caldwell MC, Hutter D, Liu 8, SAS Institute Inc.: Cary, NC. Y, Holbrook NJ and Gorospe M. (2000b). Mol. Cell. Biol., Szabo A, Dalmau J, Manley G, Rosenfeld M, Wong E, 20, 760–769. Henson J, Posner JB and Furneaux HM. (1991). Cell, 67, Wang W, Yang X, Cristofalo VJ, Holbrook NJ and Gorospe 325–333. M. (2001). Mol. Cell. Biol., 21, 5889–5898. Tenenbaum SA, Carson CC, Lager PJ and Keene JD. (2000). Wong NA and Pignatelli M. (2002). Am. J. Pathol., 160, Proc. Natl. Acad. Sci. USA, 97, 14085–14090. 389–401.

Oncogene