Role of the RNA-Binding Protein Hur in Colon Carcinogenesis
Total Page：16
File Type：pdf, Size：1020Kb
Oncogene (2003) 22, 7146–7154 & 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00 www.nature.com/onc Role of the RNA-binding protein HuR in colon carcinogenesis Isabel Lo´ pez de Silanes1, Jinshui Fan1, Xiaoling Yang1, Alan B. Zonderman2, Olga Potapova3, Ellen S. Pizer4, and Myriam Gorospe*,1 1Laboratory of Cellular and Molecular Biology, and 2Research Resources Branch, National Institute on Aging-Intramural Research Program, National Institutes of Health, Baltimore, MD 21224, USA; 3Preclinical Research and Translational Medicine, SUGEN, Inc., San Francisco, CA 94080, USA; 4Department of Pathology, Johns Hopkins Medical Institutions, Baltimore, MD 21224, USA Immunohistochemical analysis of paired tumor and such as cyclin A and cyclin B1, proliferation-associated normal tissue specimens revealed that the expression and genes such as c-fos and c-myc, as well as other factors cytoplasmic abundance of the RNA-binding protein HuR that influence tumor cell growth like the vascular increased with malignancy, particularly in colon carcino- endothelial growth factor, cyclooxygenase-2, tumor mas. Interventions to modulate HuR expression in human necrosis factor (TNF)-a, and several interleukin (Levine RKOcolon cancer cells altered gene expression profiles et al., 1993; Antic and Keene, 1997; Levy et al., 1998; and identified b-catenin mRNA as a novel HuR target. Peng et al., 1998; Wang et al., 2000a; Dixon et al., 2001). Subcutaneous injection of HuR-overexpressing RKOcells HuR enhanced the stability of the cyclin A and cyclin B1 into nude mice produced significantly larger tumors than mRNAs during the S phase of the cell division cycle, an those arising from control populations; conversely, RKO effect that was linked to cell cycle progression and cell cells expressing reduced HuR through small interference proliferation (Wang et al., 2000a). In models of in vitro RNA- or antisense HuR-based approaches developed senescence of human diploid fibroblasts, high HuR significantly more slowly. We propose that HuR-regulated expression levels in young fibroblasts contributed to the target mRNA expression contributes to colon cancer stabilization of mRNAs encoding cyclin A, cyclin B1, growth. Our results suggest a pivotal function for HuR in and c-fos and to the heightened expression of the colon carcinogenesis. corresponding protein products (Wang et al., 2001). Oncogene (2003) 22, 7146–7154. doi:10.1038/sj.onc.1206862 The precise mechanisms whereby HuR mediates the stabilization of target mRNAs are still poorly under- Keywords: HuR; ELAV; colon cancer; mRNA turn- stood. However, HuR’s presence in the cytoplasm over; carcinogenesis appears to be intimately linked to its mRNA-stabilizing function. HuR is predominantly (490%) localized in the nucleus of most unstimulated cells, but upon cell stimulation, it can translocate to the cytoplasm where it Introduction binds target mRNAs and prevents their decay (Atasoy et al., 1998; Fan and Steitz, 1998a, b; Peng et al., 1998; The RNA-binding protein HuR, a member of the Keene, 1999; Wang et al., 2000a, b; Chen et al., 2002). embryonic lethal abnormal vision (ELAV)/Hu protein The association of HuR with PP32, APRIL, and SETa/ family, is emerging as an important regulator of cellular b proteins (Brennan et al., 2000) is believed to influence proliferation. ELAV/Hu proteins were initially identi- HuR export from the nucleus and possibly also fied as specific tumor antigens in cancers of individuals modulate HuR’s affinity for its target mRNAs. with paraneoplastic neurological disorder, providing the Although PP32 and SETa/b are inhibitors of PP2A, first indication that they could exert a growth-regulatory the only kinase thus far implicated in regulating HuR function (Dalmau et al., 1990; Szabo et al., 1991). translocation, and consequently the stabilization of ELAV/Hu proteins, comprising HuB, HuC, HuD HuR target mRNAs, is the AMP-activated kinase (primarily expressed in neuronal tissues), and the (AMPK). Interventions to modulate AMPK profoundly ubiquitous HuR, were subsequently found to regulate affect the subcellular localization of HuR and conse- the expression of labile mRNAs bearing AU- and U-rich quently influence HuR’s ability to increase target sequences by enhancing their stability, translation, or mRNA expression and cellular proliferation (Wang both (Brennan and Steitz, 2001); many such target et al., 2002). mRNAs encode proteins important for cell growth and Recent studies examining HuR expression in lung proliferation. Examples include cell cycle regulators tumors revealed that the abundance of HuR protein was significantly greater in malignant tumors than in benign tumors (Blaxall et al., 2000). Despite HuR’s long- *Correspondence: M Gorospe, Box 12, LCMB, NIA-IRP, NIH, 5600 Nathan Shock Drive, Baltimore, MD 21224, USA; recognized role as a regulator of the expression of E-mail: [email protected] proliferative genes, its potential involvement in cancer Received 25 February 2003; revised 11 May 2003; accepted 4 June 2003 has not been directly investigated. In the present study, HuR in colon carcinogenesis ILo´pez de Silanes et al 7147 we carry out a systematic comparison between HuR (Wang et al., 2000b). For REMSA supershift analysis, expression in a variety of cancers and their normal tissue 0.2 mg of HuR antibody (Santa Cruz Biotech., Santa Cruz, counterparts. Examination of HuR abundance and CA, USA) was incubated with lysates for 30 min on ice before addition of radiolabeled RNA; all subsequent steps were as subcellular localization in tissue arrays containing MAPK paired cancer and normal specimens revealed higher described for REMSA. Anti-p38 antibody used in REMSA supershift assays was obtained from Pharmingen HuR expression and cytoplasmic presence in all (San Diego, CA, USA). malignancies examined, particularly colon cancer. Moreover, HuR-overexpressing colon cancer cells in- jected into nude mice caused accelerated tumor growth Northern blot, Western blot, and cDNA array analyses compared with the growth of control cells. Decreased Northern blot analysis was previously described (Gorospe expression of HuR through antisense RNA and small et al., 1998). For detection of mRNAs encoding b-catenin and interference RNA (siRNA) approaches inhibited tumor GAPDH, PCR fragments encompassing the respective CRs 32 growth. These findings underscore HuR’s function in were random primer labeled with [a- P]dATP. Northern blot regulating the proliferation of malignant cells, a func- signals were quantitated with a PhosphorImager (Molecular Dynamics) and normalized to GAPDH mRNA signals. For tion that likely relies on its ability to modulate the Western blotting, whole-cell (10 mg), nuclear (10 mg), and expression of cancer-associated genes. cytoplasmic (40 mg) extracts, as well as extracts (50 mg) from frozen tumor material that was homogenized in a buffer Materials and methods containing 50 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1% NP-40, 0.25% Na-deoxycholate, 1 mm EDTA, and protease Cell culture, treatment, and transfection of plasmids and siRNA inhibitor cocktail (Roche), were size fractionated by SDS–PAGE and transferred onto membranes. HuR, b- Human colorectal carcinoma RKOcells were cultured in catenin, histone deacetylase 1 (HDAC1) were detected using minimum essential medium (Gibco-BRL, Gaithersburg, MD, monoclonal antibodies from Santa Cruz Biotech., BD USA) supplemented with 10% fetal bovine serum and Biosciences (San Jose, CA, USA), and b-actin was detected antibiotics. Cell lines expressing sense or antisense HuR using a monoclonal antibody from Abcor Abcam Limited mRNA constitutively were established through transfection (Cambridge, UK). Following secondary antibody incubations, with pZeoSV2(-)HuR(S), pZeoSV2(-)ASHuR (AS), or empty signals were visualized by enhanced chemiluminescence pZeoSV2(-) (zeo) (Levy et al., 1998). Stably transfected clonal (Amersham, Arlington, Heights, IL, USA). populations were stored frozen and used within 3–5 weeks of The total RNA from S2 and AS7 cells was reverse thawing. HuR2 siRNA sequence, targeting the coding region transcribed in the presence of [a-33P]dCTP and the radiolabeled (CR) of HuR (nucleotides 980–1000, Genbank# BC003376), product used to hybridize cDNA arrays (Human Focused was AACACCAACAAGTGGAAAGGG; C siRNA (a con- Array, 4608 genes, http://www.grc.nia.nih.gov/branches/rrb/ trol sequence not matching any known human gene) was dna/dna.htm), as previously described (Fan et al., 2002). All AAGTGTAGTAGATCACCAGGC. siRNAs (200 nm, Dhar- the data were first analysed using the Array Pro software macon Research, Lafayette, CO, USA) were transfected using (Media Cybernetics, Inc., Carlsbad, CA, USA), then normal- oligofectamine (Invitrogen, Carslbad, CA, USA). ized by Z-score transformation (Cheadle et al., 2003). In brief, the log base-10 of each original spot intensity was adjusted to Synthesis of radiolabeled transcripts the mean and divided by the standard deviation of all the spot For in vitro synthesis of c-fos and b-catenin transcripts, intensities. Changes in gene expression between different RNA reverse-transcribed total RNA was used as a template for groups were then calculated by subtracting the average of PCR reactions. All 50 oligonucleotides contained the T7 RNA replicate measurements. This value, referred to as the Z polymerase promoter sequence CCAAGCTTCTAATAC- difference (Z diff, Z average in S2ÀZ average in AS7 cells) was 0 tested for significance using a two-tailed Z-test [ZX2.4] and GACTCACTATAGGGAGA (T7). To prepare