DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2001/0034023 A1 Stanton, JR

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2001/0034023 A1 Stanton, JR US 2001.0034O23A1. (19) United States (12) Patent Application Publication (10) Pub. No.: US 2001/0034023 A1 Stanton, JR. et al. (43) Pub. Date: Oct. 25, 2001 (54) GENE SEQUENCE VARIATIONS WITH Related U.S. Application Data UTILITY IN DETERMINING THE (63) Continuation-in-part of application No. 09/710,467, TREATMENT OF DISEASE, INGENES filed on Nov. 8, 2000, which is a continuation-in-part RELATING TO DRUG PROCESSING of application No. 09/696,482, filed on Oct. 24, 2000. Non-provisional of provisional application No. 60/131,334, filed on Apr. 26, 1999. Non-provisional (76) Inventors: Vincent P. Stanton JR., Belmont, MA of provisional application No. 60/139,440, filed on (US); Martin Zillmann, Shrewsbury, Jun. 15, 1999. MA (US) (30) Foreign Application Priority Data Correspondence Address: Jan. 20, 2000 (WO)........................... PCT/USOO/O1392 EDWARD O. KRUESSER BROBECK PHLEGER & HARRISON Publication Classification 12390 EL CAMINO REAL (51) Int. Cl. ............................. C12O 1/68; G06F 19/00 SAN DIEGO, CA 92130 (US) (52) U.S. Cl. ................................................... 435/6; 702/20 (57) ABSTRACT (21) Appl. No.: 09/733,000 Methods for identifying and utilizing variances in genes relating to efficacy and Safety of medical therapy and other aspects of medical therapy are described, including methods (22) Filed: Dec. 7, 2000 for Selecting an effective treatment. US 2001/0034023 A1 Oct. 25, 2001 GENE SEQUENCE WARIATIONS WITH UTILITY 0005 For some drugs, over 90% of the measurable IN DETERMINING THE TREATMENT OF interSubject variation in Selected pharmacokinetic param DISEASE, INGENES RELATING TO DRUG eters has been shown to be heritable. For a limited number PROCESSING of drugs, DNA sequence variances have been identified in Specific genes that are involved in drug action or metabo RELATED APPLICATIONS lism, and these variances have been shown to account for the 0001. This application is a continuation-in-part of Stan variable efficacy or safety of the drugs in different individu ton et al., U.S. application Ser. No. 09/710,467, filed Nov. 8, als. AS the Sequence of the human genome is completed, and 2000 entitled GENE SEQUENCE VARIATIONS WITH as additional human gene Sequence variances are identified, UTILITY IN DETERMINING THE TREATMENT OF the power of genetic methods for predicting drug response DISEASE, IN GENES RELATING TO DRUG PROCESS will further increase. This application concerns methods for ING, which is a continuation-in-part of Stanton et al., U.S. identifying and exploiting gene Sequence variances that application Ser. No. 09/696,482, filed Oct. 24, 2000 entitled account for interpatient variation in drug response, particu GENE SEQUENCE VARIATIONS WITH UTILITY IN larly interpatient variation attributable to pharmacokinetic DETERMINING THE TREATMENT OF DISEASE, IN factors and interpatient variation in drug tolerability or GENES RELATING TO DRUG PROCESSING, which is a toxicity. continuation-in-part of U.S. application Ser. No. not yet 0006 The efficacy of a drug is a function of both phar assigned, Attorney Docket No. 030586.0009CIP4, filed Oct. macodynamic effects and pharmacokinetic effects, or bio 6, 2000 entitled GENE SEQUENCE VARIATIONS WITH availability. In the present invention, interpatient variability UTILITY IN DETERMINING THE TREATMENT OF in drug Safety, tolerability and efficacy are discussed in terms DISEASE, IN GENES RELATING TO DRUG PROCESS of the genetic determinants of interpatient variation in ING, which is a continuation-in-part of Stanton et al., U.S. absorption, distribution, metabolism, and excretion, i.e. application Ser. No. 09/639,474, filed Aug. 15, 2000 GENE pharmacokinetic parameters. SEQUENCE VARIATIONS WITH UTILITY IN DETER MINING THE TREATMENT OF DISEASE, IN GENES 0007 Adverse drug reactions are a principal cause of the RELATING TO DRUG PROCESSING, which is a continu low Success rate of drug development programs (less than ation in part of Stanton et al., U.S. application Ser. No. one in four compounds that enters human clinical testing is 09/590,783, filed Jun. 8, 2000 GENE SEQUENCE VARIA ultimately approved for use by the U.S. Food and Drug TIONS WITH UTILITY IN DETERMINING THE TREAT Administration (FDA)). Adverse drug reactions can be cat MENT OF DISEASE, IN GENES RELATING TO DRUG egorized as 1) mechanism based reactions and 2) idiosyn PROCESSING, which is a continuation-in-part of Stanton, cratic, “unpredictable' effects apparently unrelated to the U.S. application Ser. No. 09/501.955, filed Feb. 10, 2000, primary pharmacologic action of the compound. Although which is a continuation-in-part of Stanton, International Some side effects appear Shortly after administration, in Application Ser. No. PCT/US00/01392, filed Jan. 20, 2000, Some instances Side effects appear only after a latent period. Stanton, U.S. application Ser. No. 09/427,835, filed Oct. 26, Adverse drug reactions can also be categorized into revers 1999, and Stanton et al., U.S. application Ser. No. 09/300, ible and irreversible effects. The methods of this invention 747, filed Apr. 26, 1999, and claims the benefit of U.S. are useful for identifying the genetic basis of both mecha Provisional Patent Application, Stanton & Adams, Ser. No. nism based and idiosyncratic toxic effects, whether revers 60/131,334, filed Apr. 26, 1999, and U.S. Provisional Patent ible or not. Methods for identifying the genetic sources of Application, Stanton, Ser. No. 60/139,440, filed Jun. 15, interpatient variation in efficacy and mechanism based tox 1999, which are hereby incorporated by reference in their icity may be initially directed to analysis of genes affecting entireties, including drawings and tables. pharmacokinetic parameters, while the genetic causes of idiosyncratic adverse drug reactions are more likely to be BACKGROUND OF THE INVENTION attributable to genes affecting variation in pharmacody namic responses or immunological responsiveness. 0002 This application concerns the field of mammalian therapeutics and the Selection of therapeutic regimens uti 0008 Absorption is the first pharmacokinetic parameter lizing host genetic information, including gene Sequence to consider when determining the causes of interSubject variances within the human genome in human populations. variation in drug response. The relevant genes depend on the route of administration of the compound being evaluated. 0003. The information provided below is not admitted to For orally administered drugs the major Steps in absorption be prior art to the present invention, but is provided Solely may occur during exposure to Salivary enzymes in the to assist the understanding of the reader. mouth, exposure to the acidic environment of the Stomach, 0004. Many drugs or other treatments are known to have exposure to pancreatic digestive enzymes and bile in the highly variable safety and efficacy in different individuals. A Small intestine, exposure to enteric bacteria and exposure to consequence of Such variability is that a given drug or other cell Surface proteins throughout the gastrointestinal tract. treatment may be effective in one individual, and ineffective For example, uptake of a drug that is absorbed acroSS the or not well-tolerated in another individual. Thus, adminis gastrointestinal tract by facilitated transport may vary on tration of Such a drug to an individual in whom the drug account of allelic variation in the gene encoding the trans would be ineffective would result in wasted cost and time porter protein. Many drugs are lipophilic (a property which during which the patient's condition may significantly promotes passive movement across biological membranes). worsen. Also, administration of a drug to an individual in Variation in levels of Such drugs may depend, for example, whom the drug would not be tolerated could result in a direct on the enterohepatic circulation of the drug, which may be worsening of the patient's condition and could even result in affected by genetic variation in liver canalicular transporters, the patient's death. or intestinal transporters, alternatively renal reabsorbtion US 2001/0034023 A1 Oct. 25, 2001 mechanisms may vary among patients as a consequence of the compound. Experimental means of assessing relevant gene Sequence variances. If a compound is delivered biotransformation Systems are also described. parenterally then absorption is not an issue, however tran 0012 Drug-induced disease or toxicity presents a unique Scutaneous administration of a compound may be Subject to Series of challenges to drug developers, as these reactions genetically determined variation in skin absorptive proper are often not predictable from preclinical Studies and may ties. not be detected in early clinical trials involving Small 0009. Once a drug or candidate therapeutic intervention numbers of subjects. When such effects are detected in later is absorbed, injected or otherwise enters the bloodstream it Stages of clinical development they often result in termina is distributed to various biological compartments via the tion of a drug development program because, until now, blood. The drug may exist free in the blood, or, more there have been no effective tools to seek the determinants commonly, may be bound with varying degrees of affinity to of Such reactions. When a drug is approved despite Some plasma proteins. One classic Source of interpatient variation toxicity, its clinical use is frequently Severely constrained by in drug response is attributable to amino acid polymor the possible occurrence of adverse reactions in even a Small phisms in serum albumin, which affect the binding affinity of group of patients. The likelihood of Such a compound drugs. Such as warfarin. Consequent interpatient variation in becoming first line therapy is Small (unless there are no levels of free warfarin have a significant effect on the degree competing products). Thus, clinical trials that lead to detec of anticoagulation. From the blood a compound diffuses into tion of genetic causes of adverse events and Subsequently to and is retained in interstitial and cellular fluids of different the creation of genetic tests to identify and Screen out organs to different degrees.
Load more

Recommended publications
  • Enzymatic Encoding Methods for Efficient Synthesis Of
    (19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN,
    [Show full text]
  • Structural Forms of the Human Amylase Locus and Their Relationships to Snps, Haplotypes, and Obesity
    Structural Forms of the Human Amylase Locus and Their Relationships to SNPs, Haplotypes, and Obesity The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Usher, Christina Leigh. 2015. Structural Forms of the Human Amylase Locus and Their Relationships to SNPs, Haplotypes, and Obesity. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:17467224 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Structural forms of the human amylase locus and their relationships to SNPs, haplotypes, and obesity A dissertation presented by Christina Leigh Usher to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Genetics and Genomics Harvard University Cambridge, Massachusetts March 2015 © 2015 Christina Leigh Usher All rights reserved. Dissertation Advisor: Professor Steven McCarroll Christina Leigh Usher Structural forms of the human amylase locus and their relationships to SNPs, haplotypes, and obesity Abstract Hundreds of human genes reside in structurally complex loci that elude molecular analysis and assessment in genome-wide association studies (GWAS). One such locus contains the three different amylase genes (AMY2B, AMY2A, and AMY1) responsible for digesting starch into sugar. The copy number of AMY1 is reported to be the genome’s largest influence on obesity, yet has gone undetected in GWAS.
    [Show full text]
  • Hyperbilirubinemia
    Porphyrins Porphyrins (Porphins) are cyclic tetrapyrol compounds formed by the linkage )). of four pyrrole rings through methenyl bridges (( HC In the reduced porphyrins (Porphyrinogens) the linkage of four pyrrole rings (tetrapyrol) through methylene bridges (( CH2 )) The characteristic property of porphyrins is the formation of complexes with the metal ion bound to nitrogen atoms of the pyrrole rings. e.g. Heme (iron porphyrin). Proteins which contain heme ((hemoproteins)) are widely distributed e.g. Hemoglobin, Myoglobin, Cytochromes, Catalase & Tryptophan pyrrolase. Natural porphyrins have substituent side chains on the eight hydrogen atoms numbered on the pyrrole rings. These side chains are: CH 1-Methyl-group (M)… (( 3 )) 2-Acetate-group (A)… (( CH2COOH )) 3-Propionate-group (P)… (( CH2CH2COOH )) 4-Vinyl-group (V)… (( CH CH2 )) Porphyrins with asymmetric arrangement of the side chains are classified as type III porphyrins while those with symmetric arrangement of the side chains are classified as type I porphyrins. Only types I & III are present in nature & type III series is more important because it includes heme. 1 Heme Biosynthesis Heme biosynthesis occurs through the following steps: 1-The starting reaction is the condensation between succinyl-CoA ((derived from citric acid cycle in the mitochondria)) & glycine, this reaction is a rate limiting reaction in the hepatic heme synthesis, it occurs in the mitochondria & is catalyzed by ALA synthase (Aminolevulinate synthase) enzyme in the presence of pyridoxal phosphate as a cofactor. The product of this reaction is α-amino-β-ketoadipate which is rapidly decarboxylated to form δ-aminolevulinate (ALA). 2-In the cytoplasm condensation reaction between two molecules of ALA is catalyzed by ALA dehydratase enzyme to form two molecules of water & one 2 molecule of porphobilinogen (PBG) which is a precursor of pyrrole.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Porphyrins & Bile Pigments
    Bio. 2. ASPU. Lectu.6. Prof. Dr. F. ALQuobaili Porphyrins & Bile Pigments • Biomedical Importance These topics are closely related, because heme is synthesized from porphyrins and iron, and the products of degradation of heme are the bile pigments and iron. Knowledge of the biochemistry of the porphyrins and of heme is basic to understanding the varied functions of hemoproteins in the body. The porphyrias are a group of diseases caused by abnormalities in the pathway of biosynthesis of the various porphyrins. A much more prevalent clinical condition is jaundice, due to elevation of bilirubin in the plasma, due to overproduction of bilirubin or to failure of its excretion and is seen in numerous diseases ranging from hemolytic anemias to viral hepatitis and to cancer of the pancreas. • Metalloporphyrins & Hemoproteins Are Important in Nature Porphyrins are cyclic compounds formed by the linkage of four pyrrole rings through methyne (==HC—) bridges. A characteristic property of the porphyrins is the formation of complexes with metal ions bound to the nitrogen atom of the pyrrole rings. Examples are the iron porphyrins such as heme of hemoglobin and the magnesium‐containing porphyrin chlorophyll, the photosynthetic pigment of plants. • Natural Porphyrins Have Substituent Side Chains on the Porphin Nucleus The porphyrins found in nature are compounds in which various side chains are substituted for the eight hydrogen atoms numbered in the porphyrin nucleus. As a simple means of showing these substitutions, Fischer proposed a shorthand formula in which the methyne bridges are omitted and a porphyrin with this type of asymmetric substitution is classified as a type III porphyrin.
    [Show full text]
  • Renal Cell Neoplasms Contain Shared Tumor Type–Specific Copy Number Variations
    The American Journal of Pathology, Vol. 180, No. 6, June 2012 Copyright © 2012 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ajpath.2012.01.044 Tumorigenesis and Neoplastic Progression Renal Cell Neoplasms Contain Shared Tumor Type–Specific Copy Number Variations John M. Krill-Burger,* Maureen A. Lyons,*† The annual incidence of renal cell carcinoma (RCC) has Lori A. Kelly,*† Christin M. Sciulli,*† increased steadily in the United States for the past three Patricia Petrosko,*† Uma R. Chandran,†‡ decades, with approximately 58,000 new cases diag- 1,2 Michael D. Kubal,§ Sheldon I. Bastacky,*† nosed in 2010, representing 3% of all malignancies. Anil V. Parwani,*†‡ Rajiv Dhir,*†‡ and Treatment of RCC is complicated by the fact that it is not a single disease but composes multiple tumor types with William A. LaFramboise*†‡ different morphological characteristics, clinical courses, From the Departments of Pathology* and Biomedical and outcomes (ie, clear-cell carcinoma, 82% of RCC ‡ Informatics, University of Pittsburgh, Pittsburgh, Pennsylvania; cases; type 1 or 2 papillary tumors, 11% of RCC cases; † the University of Pittsburgh Cancer Institute, Pittsburgh, chromophobe tumors, 5% of RCC cases; and collecting § Pennsylvania; and Life Technologies, Carlsbad, California duct carcinoma, approximately 1% of RCC cases).2,3 Benign renal neoplasms are subdivided into papillary adenoma, renal oncocytoma, and metanephric ade- Copy number variant (CNV) analysis was performed on noma.2,3 Treatment of RCC often involves surgical resec- renal cell carcinoma (RCC) specimens (chromophobe, tion of a large renal tissue component or removal of the clear cell, oncocytoma, papillary type 1, and papillary entire affected kidney because of the relatively large size of type 2) using high-resolution arrays (1.85 million renal tumors on discovery and the availability of a life-sus- probes).
    [Show full text]
  • Salivary Alpha Amylase (AMY1C) (NM 001008219) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG215827 Salivary alpha amylase (AMY1C) (NM_001008219) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Salivary alpha amylase (AMY1C) (NM_001008219) Human Tagged ORF Clone Tag: TurboGFP Symbol: AMY1C Synonyms: AMY1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Salivary alpha amylase (AMY1C) (NM_001008219) Human Tagged ORF Clone – RG215827 ORF Nucleotide >RG215827 representing NM_001008219 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGCTCTTTTGGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAATACACAACAAG GACGAACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATTT AGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCCATTCACAACCCTTTC AGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAGATCTGGAAATGAAGATGAAT TTAGAAACATGGTGACTAGATGCAACAATGTTGGGGTTCGTATTTATGTGGATGCTGTAATTAATCATAT GTGTGGTAATGCTGTGAGTGCAGGAACAAGCAGTACCTGTGGAAGTTACTTCAACCCTGGAAGTAGGGAC TTTCCAGCAGTCCCATATTCTGGATGGGATTTTAATGATGGTAAATGTAAAACTGGAAGTGGAGATATCG AGAACTATAATGATGCTACTCAGGTCAGAGATTGTCGTCTGTCTGGTCTTCTCGATCTTGCACTGGGGAA
    [Show full text]
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • Investigation of Plasma Metabolomics and Neurotransmitter Dysfunction In
    RSC Advances View Article Online PAPER View Journal | View Issue Investigation of plasma metabolomics and neurotransmitter dysfunction in the process of Cite this: RSC Adv.,2019,9,18308 Alzheimer's disease rat induced by amyloid beta 25- 35 Mengying Wei,ab Yuanyuan Liu,a Zifeng Pi, b Kexin Yue,a Shizhe Li,c Mingxin Hu,a Zhiqiang Liu,b Fengrui Song b and Zhongying Liu*a Alzheimer's disease (AD) has become one of the major diseases endangering the health of the elderly. Clarifying the features of each AD animal model is valuable for understanding the onset and progression of diseases and developing potential treatments in the pharmaceutical industry. In this study, we aimed to clarify plasma metabolomics and neurotransmitter dysfunction in the process of AD model rat induced by amyloid beta 25-35 (Ab 25-35). Firstly, Morris Water Maze (MWM) test was used to investigate cognitive impairment in AD rat after 2, 4 and 8 weeks of modelling. Based on this, the effects on levels Creative Commons Attribution-NonCommercial 3.0 Unported Licence. of AD-related enzymes and eight neurotransmitters were analyzed. And plasma metabolomics analysis based on ultra high-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UHPLC-Q-TOF-MS) was used to research the metabolic disturbances in the process of AD rat. The results shown the injury on the spatial learning ability of AD rats was gradually aggravated within 4 weeks, reached the maximum at 4 weeks and then was stable until 8 weeks. During 8 weeks of modeling, the levels of enzymes including b-secretase, g-secretase, glycogen synthase kinase-3b (GSK- 3b), acetyl cholinesterase (AchE) and nitric oxide synthase (NOS) were significant increased in the plasma of AD rats.
    [Show full text]
  • Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed.
    [Show full text]
  • Bilirubin Metabolism (Lecture 8)
    Bilirubin Metabolism (Lecture 8) Excretory function of bile Bile is a medium for excretion of many substances as bile pigments, cholesterol, many drugs, toxins and various organic substances as copper and zinc. These substances are then eliminated in the feces. One of these substances excreted in bile is the greenish yellow pigment bilirubin. This is a major end product of hemoglobin degradation. It’s highly soluble in all cell membranes & is also very toxic. Therefore, its excretion in the bile is one of the very important functions of the liver. FATE OF RED BLOOD CELLS Life span of RBCs in blood stream is 60-120 days. Senescent RBCs become too fragile to exist longer in the circulatory system, their cell membranes rupture and they are phagocytosed and/or lysed. Normally, lysis occurs extravascularly in the reticuloendothelial system subsequent to RBC phagocytosis. Lysis can also occur intravascularly (in blood stream). The hemoglobin is first split into globin & heme. The AA formed from breakdown of globin are stored in the body. Metabolism of bilirubin The heme ring is opened to give: 1. Free iron that is transported in the blood by transferrin and stored in the body as a reservoir for erythropoiesis. 2. Bile pigments: The 1st pigment is biliverdin but it is rapidly reduced by biliverdin reductase to free bilirubin which is gradually released into the plasma. The free bilirubin is hydrophobic, immediately combines with plasma proteins (mainly albumin and globulin) forming a water soluble compound called hemobilirubin (unconjugated bilirubin) which is rapidly transported to hepatocytes for further metabolism. Even when bound to albumin it’s called free bilirubin.
    [Show full text]
  • Biochemistry I Enzymes
    BIOCHEMISTRY I 3rd. Stage Lec. ENZYMES Biomedical Importance: Enzymes, which catalyze the biochemical reactions, are essential for life. They participate in the breakdown of nutrients to supply energy and chemical building blocks; the assembly of those building blocks into proteins, DNA, membranes, cells, and tissues; and the harnessing of energy to power cell motility, neural function, and muscle contraction. The vast majority of enzymes are proteins. Notable exceptions include ribosomal RNAs and a handful of RNA molecules imbued with endonuclease or nucleotide ligase activity known collectively as ribozymes. The ability to detect and to quantify the activity of specific enzymes in blood, other tissue fluids, or cell extracts provides information that complements the physician’s ability to diagnose and predict the prognosis of many diseases. Further medical applications include changes in the quantity or in the catalytic activity of key enzymes that can result from genetic defects, nutritional deficits, tissue damage, toxins, or infection by viral or bacterial pathogens (eg, Vibrio cholerae). Medical scientists address imbalances in enzyme activity by using pharmacologic agents to inhibit specific enzymes and are investigating gene therapy as a means to remedy deficits in enzyme level or function. In addition to serving as the catalysts for all metabolic processes, their impressive catalytic activity, substrate specificity, and stereospecificity enable enzymes to fulfill key roles in additional processes related to human health and well-being. Proteases and amylases augment the capacity of detergents to remove dirt and stains, and enzymes play important roles in producing or enhancing the nutrient value of food products for both humans and animals.
    [Show full text]