CNN1 Regulates the DKK1/Wnt/Β‑Catenin/C‑Myc Signaling Pathway by Activating TIMP2 to Inhibit the Invasion, Migration and EMT of Lung Squamous Cell Carcinoma Cells

Total Page:16

File Type:pdf, Size:1020Kb

CNN1 Regulates the DKK1/Wnt/Β‑Catenin/C‑Myc Signaling Pathway by Activating TIMP2 to Inhibit the Invasion, Migration and EMT of Lung Squamous Cell Carcinoma Cells EXPERIMENTAL AND THERAPEUTIC MEDICINE 22: 855, 2021 CNN1 regulates the DKK1/Wnt/β‑catenin/c‑myc signaling pathway by activating TIMP2 to inhibit the invasion, migration and EMT of lung squamous cell carcinoma cells WUSHENG LIU1, XIAOGANG FU2 and RUMEI LI3 1Department of Respiratory Medicine, The Affiliated Xinyu Hospital of Nanchang University; Departments of 2Respiratory Medicine and 3Endocrinology, Xinyu People's Hospital, Xinyu, Jiangxi 338000, P.R. China Received October 23, 2020; Accepted February 12, 2021 DOI: 10.3892/etm.2021.10287 Abstract. The present study aimed to investigate the effect tumors has increased over the last decades and this type of of calponin 1 (CNN1) on the invasion and migration of lung cancer is responsible for >1.3 million deaths worldwide annu‑ squamous cell carcinoma (LUSC) cells and the associations ally (1). Lung tumors are one of the most frequent malignant between CNN1, tissue inhibitor of metalloproteinases 2 tumors types in China (2,3). Lung cancer is mainly divided (TIMP2), Dickkopf‑1 (DKK1) and the Wnt/β‑catenin/c‑myc into non‑small cell lung cancer (NSCLC) and small cell lung signaling pathway. The expression levels of CNN1 and cancer, with NSCLC accounting for ~80% of all cases (4). TIMP2 in LUSC cells and the association between CNN1 The two main subtypes of NSCLC are lung adenocarcinoma and TIMP2 were predicted using the GEPIA database. The and lung squamous cell carcinoma (LUSC), and LUSC is cells were transiently transfected to overexpress CNN1, which insidious and develops rapidly (5). A subset of patients with resulted in inhibition of DKK1 and TIMP2 expression levels. LUSC do not have the opportunity to receive radical surgery Wound healing and Transwell assays were used to detect and, consequently, the survival rate of patients is low (6). It the invasive and migratory abilities of LUSC cells. Reverse has been shown that <5% of patients survive 5 years following transcription‑quantitative PCR and western blotting were chemotherapy treatment (7). Therefore, the identification of used to investigate the expression levels of CNN1, MMP2, new and effective treatments for this disease is crucial. MMP9, E‑cadherin, N‑cadherin (N‑cad), SLUG, DKK1, Basic calponin (CNN) or CNN1 (also referred to as calmod‑ β‑catenin and c‑myc. The expression levels of N‑cad were ulin 1) is a marker for the differentiation of cardiac and smooth detected using immunofluorescence staining. The results muscle (8). It is one of three subtypes of CNN and is encoded indicated that overexpression of CNN1 inhibited the inva‑ by a gene on human chromosome 19 (19p13.2‑p13.1) (8). sion and migration of NCI‑H2170 cells. Inhibition of DKK1 The expression levels of CNN1 are abnormal under various reversed this change and the expression levels of β‑catenin pathological conditions, such as abnormal gastrointestinal and c‑myc were upregulated, whereas the expression levels of motility (9) and hypoxia (10). In addition, a number of studies DKK1 were downregulated with a concomitant inhibition of have shown that CNN1 is expressed at low levels in a variety TIMP2. In summary, these results demonstrated that CNN1 of tumor tissue types, such as malignant melanoma (11), regulated the DKK1/Wnt/β‑catenin/c‑myc signaling pathway hepatocellular carcinoma (12), ovarian cancer (13) and breast by activating TIMP2 to inhibit the invasion, migration and cancer (14). However, to the best of our knowledge, the epithelial‑to‑mesenchymal transition of LUSC cells. association between CNN1 and LUSC has not been reported previously. In the present study, the effects of CNN1 on the Introduction invasive and migratory abilities of LUSC cells were investi‑ gated. Lung cancer ranks first in incidence and mortality among The Wnt/β‑catenin signaling pathway is involved in various malignant tumors worldwide. The incidence of malignant lung crucial cellular functions, such as stem cell regeneration and organogenesis (15). Wnt activation has been observed in various types of malignant tumor, including in the breast, lung and hematopoietic system, and has been shown to contribute to tumor recurrence (16). In NSCLC, it has been reported that Correspondence to: Dr Wusheng Liu, Department of Respiratory Medicine, The Affiliated Xinyu Hospital of Nanchang University, targeting the negative regulators of Wnt signaling for degrada‑ 369 North Xinxin Road, Yushui, Xinyu, Jiangxi 338000, P.R. China tion to increase β‑catenin‑mediated Wnt activity may lead to E‑mail: [email protected] the maintenance of lung cancer ‘stemness’ (17). The activa‑ tion of the Wnt/β‑catenin signaling pathway promotes tumor Key words: lung squamous cell carcinoma, non‑small cell lung growth, metastasis and epithelial‑to‑mesenchymal transition cancer, calponin 1, invasion, migration (EMT) of NSCLC cells (18). Dickkopf‑1 (DKK1) is a member of the DKK protein family, which is a secretory protein that 2 liu et al: CNN1 ALLEVIATES LUNG SQUAMOUS CELL CARCINOMA BY ACTIVATING TIMP2 acts as an inhibitor of the extracellular Wnt signal transduction 5'‑TCGTCATCGTCGAAATGGGC‑3'; CNN1 forward, pathway (19). c‑myc is one of the target genes of Wnt/β‑catenin 5'‑TGAAGAAGATCAATGAGTCAACC‑3' and reverse, pathway and can be activated by the transcription factor, 5'‑CGTTCACCTTGTTTCCTTTCG‑3'; DKK1 forward, β‑catenin, which enters the nucleus to regulate target genes 5'‑GAAGAGTGTTAAAGGTTTTTTTTTATGTAT‑3' and expression upon being stabilized by Wnt binding (20). Notably, reverse, 5'‑CCAAAATCCTAACTACAAAAAACACA‑3'; c‑myc functions as a critical oncogene and has been shown TIMP2 forward, 5'‑CTCTGATTTGGTCGTATTGGG‑3' and to be implicated in enhancing the aggressiveness of various reverse, 5'‑TGGAAGATGGTGATGGGATT‑3'; and GAPDH cancer types, including lung cancer (21). The present study forward, 5'‑GCAACCGGGAAGGAAATGAATG‑3' and aimed to investigate whether the DKK1/Wnt/β‑catenin/c‑myc reverse, 5'‑CCCAATACGACCAAATCAGAGA‑3'. signaling pathway participated in the effect of CNN1 on LUSC. Western blotting. The cells were harvested and total protein Materials and methods was extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology). Protease inhibitors were added (Beyotime Cell culture and transfection. The LUSC cell lines NCI‑H520, Institute of Biotechnology) to the lysis buffer (1:100). The SK‑MES‑1 and NCI‑H2170 were obtained from the Cell lysates were centrifuged at 4˚C, 850 x g for 15 min. The Bank of Type Culture Collection of the Chinese Academy of supernatant was collected and mixed with a loading buffer Sciences. All cells were cultured in DMEM (Gibco; Thermo (Beyotime Institute of Biotechnology) containing 100 mM Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; dithiothreitol. Total protein was quantified using a Protein Thermo Fisher Scientific, Inc.) and maintained at 37˚C Concentration Determination BCA kit (Beyotime Institute and 5% CO2. Overexpression (OE) vectors for CNN1 and of Biotechnology) and the proteins (30 µg/lane) were sepa‑ knockdown vectors for DKK1 and tissue inhibitor of metal‑ rated via SDS‑PAGE (15%). The separated proteins were loproteinases 2 (TIMP2) [OE‑negative control (NC; empty subsequently transferred onto PVDF membranes (EMD pcDNA3.1), OE‑CNN1 (pcDNA3.1‑CNN1), short hairpin Millipore) and blocked using 5% BSA (Beyotime Institute of RNA (shRNA)‑NC, shRNA‑TIMP2 and shRNA‑DKK1] were Biotechnology) at room temperature for 2 h. The membranes purchased from Biomics Biotechnologies. Cell transfection in were incubated with the following primary antibodies at 4˚C NCI‑H2170 cells was performed using Lipofectamine® 2000 overnight: Anti‑CNN1 (cat. no. ab46794; 1:1,000 dilution), (Invitrogen; Thermo Fisher Scientific, Inc.) according to the anti‑MMP2 (cat. no. ab92536; 1:1,000 dilution), anti‑MMP9 manufacturer's instructions. Briefly, Lipofectamine 2000 (cat. no. ab76003; 1:1,000 dilution), anti‑E‑cadherin (E‑cad; was mixed with 20 µg plasmids, which was then added to cat. no. ab40772; 1:1,000 dilution), anti‑N‑cadherin (N‑cad; the cells at 70‑80% confluence and incubated for 6 h at 37˚C. cat. no. ab245117; 1:1,000 dilution), anti‑SLUG (cat. no. The transfection efficiency in cells was measured using ab51772; 1:1,000 dilution), anti‑DKK1 (cat. no. ab109416; reverse transcription‑quantitative PCR (RT‑qPCR). At 48 h 1:1,000 dilution), anti‑β‑catenin (cat. no. ab32572; 1:1,000 post‑transfection, the transfection efficacy was validated using dilution), anti‑c‑myc (cat. no. ab32072; 1:1,000 dilution) and RT‑qPCR and successfully transfected cells were selected for anti‑GAPDH (cat. no. ab8245; 1:10,000 dilution). All anti‑ subsequent experiments. bodies were purchased from Abcam. Following the primary incubation, the membranes were washed with TBS containing Dynamic analysis of GEPIA gene expression profile data. Tween‑20 (0.1%) and incubated at room temperature for 1.5 h GEPIA (http://gepia.cancer‑pku.Cn/index.html) is a website with a horseradish peroxidase‑conjugated donkey anti‑rabbit for cancer data mining. Using RNA sequencing data for CNN1 IgG secondary antibody (cat. no. SA00001‑9; 1:5,000 dilu‑ and TIMP2 from tumor and normal samples, the database was tion; ProteinTech Group, Inc.) or a donkey anti‑mouse IgG used to analyze the expression levels and association between secondary antibody (SA00001‑8; 1:5,000 dilution; ProteinTech CNN1 and TIMP2 in tumor samples. Group, Inc.). The protein bands were visualized using the Odyssey Western Blot Analysis system (LI‑COR Biosciences) RT‑qPCR. Total RNA was extracted using TRIzol® and quantified using Image J version
Recommended publications
  • Harnessing Low-Density Lipoprotein Receptor Protein 6 (LRP6) Genetic Variation and Wnt Signaling for Innovative Diagnostics in Complex Diseases
    OPEN The Pharmacogenomics Journal (2018) 18, 351–358 www.nature.com/tpj REVIEW Harnessing low-density lipoprotein receptor protein 6 (LRP6) genetic variation and Wnt signaling for innovative diagnostics in complex diseases Z-M Wang1,2, J-Q Luo1,2, L-Y Xu3, H-H Zhou1,2 and W Zhang1,2 Wnt signaling regulates a broad variety of processes in both embryonic development and various diseases. Recent studies indicated that some genetic variants in Wnt signaling pathway may serve as predictors of diseases. Low-density lipoprotein receptor protein 6 (LRP6) is a Wnt co-receptor with essential functions in the Wnt/β-catenin pathway, and mutations in LRP6 gene are linked to many complex human diseases, including metabolic syndrome, cancer, Alzheimer’s disease and osteoporosis. Therefore, we focus on the role of LRP6 genetic polymorphisms and Wnt signaling in complex diseases, and the mechanisms from mouse models and cell lines. It is also highly anticipated that LRP6 variants will be applied clinically in the future. The brief review provided here could be a useful resource for future research and may contribute to a more accurate diagnosis in complex diseases. The Pharmacogenomics Journal (2018) 18, 351–358; doi:10.1038/tpj.2017.28; published online 11 July 2017 INTRODUCTION signaling pathways and expressed in various target organs.1 LDLR- The Wnt1 gene was identified in 1982. Ensuing studies in related proteins 5/6 (LRP5/6) belong to this large family and Drosophila and Xenopus unveiled a highly conserved Wnt/ function as co-receptors of the Wnt/β-catenin pathway. These β-catenin pathway, namely, canonical Wnt signaling.
    [Show full text]
  • Lgr5 Homologues Associate with Wnt Receptors and Mediate R-Spondin Signalling
    ARTICLE doi:10.1038/nature10337 Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling Wim de Lau1*, Nick Barker1{*, Teck Y. Low2, Bon-Kyoung Koo1, Vivian S. W. Li1, Hans Teunissen1, Pekka Kujala3, Andrea Haegebarth1{, Peter J. Peters3, Marc van de Wetering1, Daniel E. Stange1, Johan E. van Es1, Daniele Guardavaccaro1, Richard B. M. Schasfoort4, Yasuaki Mohri5, Katsuhiko Nishimori5, Shabaz Mohammed2, Albert J. R. Heck2 & Hans Clevers1 The adult stem cell marker Lgr5 and its relative Lgr4 are often co-expressed in Wnt-driven proliferative compartments. We find that conditional deletion of both genes in the mouse gut impairs Wnt target gene expression and results in the rapid demise of intestinal crypts, thus phenocopying Wnt pathway inhibition. Mass spectrometry demonstrates that Lgr4 and Lgr5 associate with the Frizzled/Lrp Wnt receptor complex. Each of the four R-spondins, secreted Wnt pathway agonists, can bind to Lgr4, -5 and -6. In HEK293 cells, RSPO1 enhances canonical WNT signals initiated by WNT3A. Removal of LGR4 does not affect WNT3A signalling, but abrogates the RSPO1-mediated signal enhancement, a phenomenon rescued by re-expression of LGR4, -5 or -6. Genetic deletion of Lgr4/5 in mouse intestinal crypt cultures phenocopies withdrawal of Rspo1 and can be rescued by Wnt pathway activation. Lgr5 homologues are facultative Wnt receptor components that mediate Wnt signal enhancement by soluble R-spondin proteins. These results will guide future studies towards the application of R-spondins for regenerative purposes of tissues expressing Lgr5 homologues. The genes Lgr4, Lgr5 and Lgr6 encode orphan 7-transmembrane 4–5 post-induction onwards.
    [Show full text]
  • Recombinant Human Dkk-1 Catalog Number: 5439-DK
    Recombinant Human Dkk-1 Catalog Number: 5439-DK DESCRIPTION Source Spodoptera frugiperda, Sf 21 (baculovirus)­derived human Dkk­1 protein Thr32­His266 Accession # O94907 N­terminal Sequence Thr32 Analysis Predicted Molecular 25.8 kDa Mass SPECIFICATIONS SDS­PAGE 33­38 kDa, reducing conditions Activity Measured by its ability to inhibit Wnt induced TCF reporter activity in HEK293 human embryonic kidney cells. Recombinant Human Dkk­1 (Catalog # 5439­DK) inhibits a constant dose of 500 ng/mL of Recombinant Human Wnt­3a (Catalog # 5036­WN). The ED50 for this effect is 10­60 ng/mL. Endotoxin Level <1.0 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS­PAGE with silver staining. Formulation Lyophilized from a 0.2 μm filtered solution in PBS with BSA as a carrier protein. See Certificate of Analysis for details. PREPARATION AND STORAGE Reconstitution Reconstitute at 100 μg/mL in PBS containing at least 0.1% human or bovine serum albumin. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. Stability & Storage Use a manual defrost freezer and avoid repeated freeze­thaw cycles. l 12 months from date of receipt, ­20 to ­70 °C as supplied. l 1 month, 2 to 8 °C under sterile conditions after reconstitution. l 3 months, ­20 to ­70 °C under sterile conditions after reconstitution. DATA Bioactivity SDS­PAGE Recombinant Human Wnt­3a 1 μg/lane of Recombinant Human Dkk­1 was (Catalog # 5036­WN) induces a resolved with SDS­PAGE under reducing (R) dose responsive increase in Wnt conditions and visualized by silver staining, reporter activity in HEK293 cells showing major bands at 33­38 kDa.
    [Show full text]
  • Dickkopf-1 (DKK1) Reveals That Fibronectin Is a Major Target of Wnt Signaling in Branching Morphogenesis of the Mouse Embryonic Lung
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Developmental Biology 277 (2005) 316–331 www.elsevier.com/locate/ydbio Dickkopf-1 (DKK1) reveals that fibronectin is a major target of Wnt signaling in branching morphogenesis of the mouse embryonic lung Stijn P. De Langhea, Fre´de´ric G. Salaa, Pierre-Marie Del Morala, Timothy J. Fairbanksa, Kenneth M. Yamadab, David Warburtona, Robert C. Burnsa, Saverio Belluscia,* aDevelopmental Biology Program, Department of Surgery, USC Keck School of Medicine and the Saban Research Institute of Children’s Hospital Los Angeles, Los Angeles, CA 90027, USA bCraniofacial Developmental Biology and Regeneration Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 20892, USA Received for publication 6 April 2004, revised 16 September 2004, accepted 20 September 2004 Available online 22 October 2004 Abstract Members of the Dickkopf (Dkk) family of secreted proteins are potent inhibitors of Wnt/h-catenin signaling. In this study we show that Dkk1, -2, and -3 are expressed distally in the epithelium, while Kremen1, the needed co-receptor, is expressed throughout the epithelium of the developing lung. Using TOPGAL mice [DasGupta, R., Fuchs, E., 1999. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126, 4557–4568] to monitor the Wnt pathway, we show that canonical Wnt signaling is dynamic in the developing lung and is active throughout the epithelium and in the proximal smooth muscle cells (SMC) until E12.5. However, from E13.5 onwards, TOPGAL activity is absent in the SMC and is markedly reduced in the distal epithelium coinciding with the onset of Dkk-1 expression in the distal epithelium.
    [Show full text]
  • Structural Characterization and Association of Ovine Dickkopf-1 Gene with Wool Production and Quality Traits in Chinese Merino
    G C A T T A C G G C A T genes Article Structural Characterization and Association of Ovine Dickkopf-1 Gene with Wool Production and Quality Traits in Chinese Merino Fang Mu 1,†, Enguang Rong 1,†, Yang Jing 1, Hua Yang 2, Guangwei Ma 1, Xiaohong Yan 1, Zhipeng Wang 1, Yumao Li 1, Hui Li 1 and Ning Wang 1,* 1 Key Laboratory of Chicken Genetics and Breeding at Ministry of Agriculture, Key Laboratory of Animal Genetics, Breeding and Reproduction at Education Department of Heilongjiang Province, Key Laboratory of Animal Cellular and Genetic Engineering of Heilongjiang Province, Harbin 150030, China; [email protected] (F.M.); [email protected] (E.R.); [email protected] (Y.J.); [email protected] (G.M.); [email protected] (X.Y.); [email protected] (Z.W.); [email protected] (Y.L.); [email protected] (H.L.) 2 Institute of Animal Husbandry and Veterinary, Xinjiang Academy of Agriculture and Reclamation Science, Shihezi 832000, China; [email protected] * Correspondence: [email protected]; Tel.: +86-0451-5519-1770 † These authors contributed equally to this work. Received: 20 October 2017; Accepted: 15 December 2017; Published: 20 December 2017 Abstract: Dickkopf-1 (DKK1) is an inhibitor of canonical Wnt signaling pathway and regulates hair follicle morphogenesis and cycling. To investigate the potential involvement of DKK1 in wool production and quality traits, we characterized the genomic structure of ovine DKK1, performed polymorphism detection and association analysis of ovine DKK1 with wool production and quality traits in Chinese Merino. Our results showed that ovine DKK1 consists of four exons and three introns, which encodes a protein of 262 amino acids.
    [Show full text]
  • Targeting Wnt-Driven Cancer Through the Inhibition of Porcupine by LGK974
    Targeting Wnt-driven cancer through the inhibition of Porcupine by LGK974 Jun Liua,1, Shifeng Pana, Mindy H. Hsieha, Nicholas Nga, Fangxian Suna, Tao Wangb, Shailaja Kasibhatlaa, Alwin G. Schullerc, Allen G. Lia, Dai Chenga, Jie Lia, Celin Tompkinsa, AnneMarie Pferdekampera, Auzon Steffya, Jane Chengc, Colleen Kowalc, Van Phunga, Guirong Guoa, Yan Wanga, Martin P. Grahamd, Shannon Flynnd, J. Chad Brennerd, Chun Lia, M. Cristina Villarroele, Peter G. Schultza,2,XuWua,3, Peter McNamaraa, William R. Sellersc, Lilli Petruzzellie, Anthony L. Borale, H. Martin Seidela, Margaret E. McLaughline, Jianwei Chea, Thomas E. Careyd, Gary Vanassee, and Jennifer L. Harrisa,1 aGenomics Institute of Novartis Research Foundation, San Diego, CA 92121; bPreclinical Safety, Novartis Institutes for Biomedical Research, Emeryville, CA 94608; cOncology Research and eOncology Translational Medicine, Novartis Institutes for Biomedical Research, Cambridge, MA 02139; and dDepartment of Otolaryngology – Head and Neck Surgery, University of Michigan, Ann Arbor, MI 48109 Edited by Marc de la Roche, MRC Laboratory of Molecular Biology, Cambridge, United Kingdom, and accepted by the Editorial Board October 31, 2013 (received for review July 31, 2013) Wnt signaling is one of the key oncogenic pathways in multiple Cytoplasmic and nuclear β-catenin have also been correlated with cancers, and targeting this pathway is an attractive therapeutic triple-negative and basal-like breast cancer subtypes (9, 10), and approach. However, therapeutic success has been limited because Wnt signaling has also been implicated in cancer-initiating cells in of the lack of therapeutic agents for targets in the Wnt pathway multiple cancer types (11–14). Wnt pathway signaling activity is and the lack of a defined patient population that would be dependent on Wnt ligand.
    [Show full text]
  • R-Spondin1 Regulates Wnt Signaling by Inhibiting Internalization of LRP6
    R-Spondin1 regulates Wnt signaling by inhibiting internalization of LRP6 Minke E. Binnerts, Kyung-Ah Kim, Jessica M. Bright, Sejal M. Patel, Karolyn Tran, Mei Zhou, John M. Leung, Yi Liu, Woodrow E. Lomas III, Melissa Dixon, Sophie A. Hazell, Marie Wagle, Wen-Sheng Nie, Nenad Tomasevic, Jason Williams, Xiaoming Zhan, Michael D. Levy, Walter D. Funk, and Arie Abo* Nuvelo, Inc., 201 Industrial Road, Suite 310, San Carlos, CA 94070-6211 Communicated by Lewis T. Williams, Five Prime Therapeutics, Inc., Emeryville, CA, March 13, 2007 (received for review December 1, 2006) The R-Spondin (RSpo) family of secreted proteins act as potent Wnt signaling by modulating levels of LRP6 on the cell surface, activators of the Wnt/␤-catenin signaling pathway. We have previ- through inhibition of DKK1-dependent internalization of LRP6. ously shown that RSpo proteins can induce proliferative effects on the gastrointestinal epithelium in mice. Here we provide a mechanism Results and Discussion whereby RSpo1 regulates cellular responsiveness to Wnt ligands by To further investigate the role of RSpo1 in the activation of the Wnt modulating the cell-surface levels of the coreceptor LRP6. We show pathway, we generated a HEK-293 stable cell line expressing a TCF that RSpo1 activity critically depends on the presence of canonical luciferase reporter plasmid. In agreement with reported results Wnt ligands and LRP6. Although RSpo1 does not directly activate (16), both RSpo1 and Wnt3A proteins induced a comparable LRP6, it interferes with DKK1/Kremen-mediated internalization of TCF-mediated reporter activity [supporting information (SI) Fig. LRP6 through an interaction with Kremen, resulting in increased LRP6 7].
    [Show full text]
  • Wnt Inhibitor Dickkopf-1 As a Target for Passive Cancer Immunotherapy
    Published OnlineFirst June 15, 2010; DOI: 10.1158/0008-5472.CAN-09-3879 Published OnlineFirst on June 15, 2010 as 10.1158/0008-5472.CAN-09-3879 Molecular and Cellular Pathobiology Cancer Research Wnt Inhibitor Dickkopf-1 as a Target for Passive Cancer Immunotherapy Nagato Sato1,2, Takumi Yamabuki1, Atsushi Takano1,6, Junkichi Koinuma1, Masato Aragaki1, Ken Masuda1, Nobuhisa Ishikawa1, Nobuoki Kohno3, Hiroyuki Ito4, Masaki Miyamoto2, Haruhiko Nakayama4, Yohei Miyagi5, Eiju Tsuchiya5, Satoshi Kondo2, Yusuke Nakamura1, and Yataro Daigo1,6 Abstract Dickkopf-1 (DKK1) is an inhibitor of Wnt/β-catenin signaling that is overexpressed in most lung and esoph- ageal cancers. Here, we show its utility as a serum biomarker for a wide range of human cancers, and we offer evidence favoring the potential application of anti-DKK1 antibodies for cancer treatment. Using an original ELISA system, high levels of DKK1 protein were found in serologic samples from 906 patients with cancers of the pancreas, stomach, liver, bile duct, breast, and cervix, which also showed elevated expression levels of DKK1. Additionally, anti-DKK1 antibody inhibited the invasive activity and the growth of cancer cells in vitro and suppressed the growth of engrafted tumors in vivo. Tumor tissues treated with anti-DKK1 displayed sig- nificant fibrotic changes and a decrease in viable cancer cells without apparent toxicity in mice. Our findings suggest DKK1 as a serum biomarker for screening against a variety of cancers, and anti-DKK1 antibodies as potential theranostic tools for diagnosis and treatment of cancer. Cancer Res; 70(13); OF1–11. ©2010 AACR. Introduction growth factor (VEGF) used for the treatment of metastatic colorectal and lung cancers in combination with chemother- The concept of specific molecular targeting therapy has been apy (4).
    [Show full text]
  • Catenin Pathway (DKK1) in a STAT 3-Dependent Manner This Information Is Current As of September 24, 2021
    IFN-γ Mediates Enhancement of HIV Replication in Astrocytes by Inducing an Antagonist of the β-Catenin Pathway (DKK1) in a STAT 3-Dependent Manner This information is current as of September 24, 2021. Wei Li, Lisa J. Henderson, Eugene O. Major and Lena Al-Harthi J Immunol 2011; 186:6771-6778; Prepublished online 11 May 2011; doi: 10.4049/jimmunol.1100099 Downloaded from http://www.jimmunol.org/content/186/12/6771 References This article cites 41 articles, 10 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/186/12/6771.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 24, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology IFN-g Mediates Enhancement of HIV Replication in Astrocytes by Inducing an Antagonist of the b-Catenin Pathway (DKK1) in a STAT 3-Dependent Manner Wei Li,*,1 Lisa J. Henderson,* Eugene O.
    [Show full text]
  • Expression of Cancer Stem Cell-Associated DKK1 Mrna
    ANTICANCER RESEARCH 37 : 4881-4888 (2017) doi:10.21873/anticanres.11897 Expression of Cancer Stem Cell-associated DKK1 mRNA Serves as Prognostic Marker for Hepatocellular Carcinoma TOMOHIKO SAKABE 1,2 , JUNYA AZUMI 1, YOSHIHISA UMEKITA 2, KAN TORIGUCHI 3, ETSURO HATANO 3, YASUAKI HIROOKA 4 and GOSHI SHIOTA 1 1Division of Molecular and Genetic Medicine, Department of Genetic Medicine and Regenerative Therapeutics, Graduate School of Medicine, Tottori University, Yonago, Japan; 2Division of Organ Pathology, Department of Pathology, Faculty of Medicine, Tottori University, Yonago, Japan; 3Department of Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan; 4Department of Pathobiological Science and Technology, School of Health Science, Faculty of Medicine, Tottori University, Yonago, Japan Abstract. Background/Aim: Cancer stem cells (CSCs) are Hepatocellular carcinoma (HCC) is the sixth most common associated with prognosis of hepatocellular carcinoma (HCC). cancer, and the third most frequent cause of death worldwide In our previous study, we created cDNA microarray databases (1). Since biomarkers are useful for early diagnosis and on the CSC population of human HuH7 cells. In the present prediction of prognosis (2), they may provide effective study, we identified genes that might serve as prognostic treatment options. Although several biomarkers, including markers of HCC by employing existing databases. Materials alpha-fetoprotein (AFP), protein induced by vitamin K and Methods: Expressions of glutathione S-transferase pi 1 deficiency or antagonist-II (PIVKAII), and glypican-3, were (GSTP1), lysozyme (LYZ), C-X-C motif chemokine ligand 5 reported as being useful (2, 3), identification of novel (CXCL5), interleukin-8 (IL8) and dickkopf WNT signaling biomarkers for HCC is expected to improve prognosis of pathway inhibitor 1 (DKK1), the five most highly expressed patients with HCC.
    [Show full text]
  • The Activation of the WNT Signaling Pathway Is a Hallmark in Neurofibromatosis Type 1 Tumorigenesis
    Published OnlineFirst November 11, 2013; DOI: 10.1158/1078-0432.CCR-13-0780 Clinical Cancer Human Cancer Biology Research The Activation of the WNT Signaling Pathway Is a Hallmark in Neurofibromatosis Type 1 Tumorigenesis Armelle Luscan1,4, Ghjuvan'Ghjacumu Shackleford5, Julien Masliah-Planchon1, Ingrid Laurendeau1, Nicolas Ortonne10, Jennifer Varin1, Francois¸ Lallemand14, Karen Leroy11, Valerie Dumaine6, Mikael Hivelin2,12, Didier Borderie7, Thomas De Raedt15, Laurence Valeyrie-Allanore13,Fred erique Larousserie8, Beno^t Terris3,9, Laurent Lantieri2, Michel Vidaud1,4, Dominique Vidaud1,4, Pierre Wolkenstein13,Beatrice Parfait1,4, Ivan Bieche 1,14, Charbel Massaad5, and Eric Pasmant1,4 Abstract Purpose: The hallmark of neurofibromatosis type 1 (NF1) is the onset of dermal or plexiform neurofibromas, mainly composed of Schwann cells. Plexiform neurofibromas can transform into malignant peripheral nerve sheath tumors (MPNST) that are resistant to therapies. Experimental Design: The aim of this study was to identify an additional pathway in the NF1 tumorigenesis. We focused our work on Wnt signaling that is highly implicated in cancer, mainly in regulating the proliferation of cancer stem cells. We quantified mRNAs of 89 Wnt pathway genes in 57 NF1- associated tumors including dermal and plexiform neurofibromas and MPNSTs. Expression of two major stem cell marker genes and five major epithelial–mesenchymal transition marker genes was also assessed. The expression of significantly deregulated Wnt genes was then studied in normal human Schwann cells, fibroblasts, endothelial cells, and mast cells and in seven MPNST cell lines. Results: The expression of nine Wnt genes was significantly deregulated in plexiform neurofibromas in comparison with dermal neurofibromas. Twenty Wnt genes showed altered expression in MPNST biopsies and cell lines.
    [Show full text]
  • Gene Associations in Human Cancers by Vitamin D and Sulforaphane
    J Cancer Sci Clin Ther 2020; 4 (3): 237-244 DOI: 10.26502/jcsct.5079068 Research Article DICKKOPF-1 (DKK-1) Gene Associations in Human Cancers by Vitamin D and Sulforaphane Sharmin Hossain1*, Zhenhua Liu2, Richard J. Wood2 1National Institute on Aging (NIA/NIH), Baltimore, Maryland, USA 2Department of Nutrition, University of Massachusetts, Amherst, Massachusetts, USA *Corresponding Author: Dr. Sharmin Hossain, National Institute on Aging (NIA/NIH), Baltimore, Maryland, USA, Tel: 410-558-8545; E-mail: [email protected] Received: 06 July 2020; Accepted: 28 July 2020; Published: 03 August 2020 Citation: Sharmin Hossain, Zhenhua Liu, Richard J. DICKKOPF-1 (DKK-1) Gene Associations in Human Cancers by Vitamin D and Sulforaphane. Journal of Cancer Science and Clinical Therapeutics 4 (2020): 237-244. Abstract while in MCF-7 cells saw no effect of the treatments. Co- Dickkopf Wnt Signaling Pathway Inhibitor-1 gene (DKK- treating the cells with both compounds seemed to attenuate 1) encodes a member of the Dickkopf family of proteins the D effect, implying competing needs along the signaling and is involved primarily in the embryonic development pathway and require further investigation. and bone formation in adults. Based on its known relationship to Wnt signaling pathway, we set out to Keywords: Sulforaphane; Trichostatin A; Vitamin-D determine how this gene is affected by dietary agents- receptor; DICKKOPF-1 (DKK-1) gene; Colon cancer; vitamin D and sulforaphane (SFN). Cells were exposed for Breast cancer 24 hours to vitamin D3 [1,25(OH)2D3] (100nM) either alone or in combination with L-sulforaphane and TSA Abbreviations: 1,25(OH)2D3- 1,25 di-hydroxyvitamin (20μM and 1μM respectively) at 70% confluency.
    [Show full text]