EXPERIMENTAL AND THERAPEUTIC MEDICINE 22: 855, 2021 CNN1 regulates the DKK1/Wnt/β‑catenin/c‑myc signaling pathway by activating TIMP2 to inhibit the invasion, migration and EMT of lung squamous cell carcinoma cells WUSHENG LIU1, XIAOGANG FU2 and RUMEI LI3 1Department of Respiratory Medicine, The Affiliated Xinyu Hospital of Nanchang University; Departments of 2Respiratory Medicine and 3Endocrinology, Xinyu People's Hospital, Xinyu, Jiangxi 338000, P.R. China Received October 23, 2020; Accepted February 12, 2021 DOI: 10.3892/etm.2021.10287 Abstract. The present study aimed to investigate the effect tumors has increased over the last decades and this type of of calponin 1 (CNN1) on the invasion and migration of lung cancer is responsible for >1.3 million deaths worldwide annu‑ squamous cell carcinoma (LUSC) cells and the associations ally (1). Lung tumors are one of the most frequent malignant between CNN1, tissue inhibitor of metalloproteinases 2 tumors types in China (2,3). Lung cancer is mainly divided (TIMP2), Dickkopf‑1 (DKK1) and the Wnt/β‑catenin/c‑myc into non‑small cell lung cancer (NSCLC) and small cell lung signaling pathway. The expression levels of CNN1 and cancer, with NSCLC accounting for ~80% of all cases (4). TIMP2 in LUSC cells and the association between CNN1 The two main subtypes of NSCLC are lung adenocarcinoma and TIMP2 were predicted using the GEPIA database. The and lung squamous cell carcinoma (LUSC), and LUSC is cells were transiently transfected to overexpress CNN1, which insidious and develops rapidly (5). A subset of patients with resulted in inhibition of DKK1 and TIMP2 expression levels. LUSC do not have the opportunity to receive radical surgery Wound healing and Transwell assays were used to detect and, consequently, the survival rate of patients is low (6). It the invasive and migratory abilities of LUSC cells. Reverse has been shown that <5% of patients survive 5 years following transcription‑quantitative PCR and western blotting were chemotherapy treatment (7). Therefore, the identification of used to investigate the expression levels of CNN1, MMP2, new and effective treatments for this disease is crucial. MMP9, E‑cadherin, N‑cadherin (N‑cad), SLUG, DKK1, Basic calponin (CNN) or CNN1 (also referred to as calmod‑ β‑catenin and c‑myc. The expression levels of N‑cad were ulin 1) is a marker for the differentiation of cardiac and smooth detected using immunofluorescence staining. The results muscle (8). It is one of three subtypes of CNN and is encoded indicated that overexpression of CNN1 inhibited the inva‑ by a gene on human chromosome 19 (19p13.2‑p13.1) (8). sion and migration of NCI‑H2170 cells. Inhibition of DKK1 The expression levels of CNN1 are abnormal under various reversed this change and the expression levels of β‑catenin pathological conditions, such as abnormal gastrointestinal and c‑myc were upregulated, whereas the expression levels of motility (9) and hypoxia (10). In addition, a number of studies DKK1 were downregulated with a concomitant inhibition of have shown that CNN1 is expressed at low levels in a variety TIMP2. In summary, these results demonstrated that CNN1 of tumor tissue types, such as malignant melanoma (11), regulated the DKK1/Wnt/β‑catenin/c‑myc signaling pathway hepatocellular carcinoma (12), ovarian cancer (13) and breast by activating TIMP2 to inhibit the invasion, migration and cancer (14). However, to the best of our knowledge, the epithelial‑to‑mesenchymal transition of LUSC cells. association between CNN1 and LUSC has not been reported previously. In the present study, the effects of CNN1 on the Introduction invasive and migratory abilities of LUSC cells were investi‑ gated. Lung cancer ranks first in incidence and mortality among The Wnt/β‑catenin signaling pathway is involved in various malignant tumors worldwide. The incidence of malignant lung crucial cellular functions, such as stem cell regeneration and organogenesis (15). Wnt activation has been observed in various types of malignant tumor, including in the breast, lung and hematopoietic system, and has been shown to contribute to tumor recurrence (16). In NSCLC, it has been reported that Correspondence to: Dr Wusheng Liu, Department of Respiratory Medicine, The Affiliated Xinyu Hospital of Nanchang University, targeting the negative regulators of Wnt signaling for degrada‑ 369 North Xinxin Road, Yushui, Xinyu, Jiangxi 338000, P.R. China tion to increase β‑catenin‑mediated Wnt activity may lead to E‑mail: [email protected] the maintenance of lung cancer ‘stemness’ (17). The activa‑ tion of the Wnt/β‑catenin signaling pathway promotes tumor Key words: lung squamous cell carcinoma, non‑small cell lung growth, metastasis and epithelial‑to‑mesenchymal transition cancer, calponin 1, invasion, migration (EMT) of NSCLC cells (18). Dickkopf‑1 (DKK1) is a member of the DKK protein family, which is a secretory protein that 2 liu et al: CNN1 ALLEVIATES LUNG SQUAMOUS CELL CARCINOMA BY ACTIVATING TIMP2 acts as an inhibitor of the extracellular Wnt signal transduction 5'‑TCGTCATCGTCGAAATGGGC‑3'; CNN1 forward, pathway (19). c‑myc is one of the target genes of Wnt/β‑catenin 5'‑TGAAGAAGATCAATGAGTCAACC‑3' and reverse, pathway and can be activated by the transcription factor, 5'‑CGTTCACCTTGTTTCCTTTCG‑3'; DKK1 forward, β‑catenin, which enters the nucleus to regulate target genes 5'‑GAAGAGTGTTAAAGGTTTTTTTTTATGTAT‑3' and expression upon being stabilized by Wnt binding (20). Notably, reverse, 5'‑CCAAAATCCTAACTACAAAAAACACA‑3'; c‑myc functions as a critical oncogene and has been shown TIMP2 forward, 5'‑CTCTGATTTGGTCGTATTGGG‑3' and to be implicated in enhancing the aggressiveness of various reverse, 5'‑TGGAAGATGGTGATGGGATT‑3'; and GAPDH cancer types, including lung cancer (21). The present study forward, 5'‑GCAACCGGGAAGGAAATGAATG‑3' and aimed to investigate whether the DKK1/Wnt/β‑catenin/c‑myc reverse, 5'‑CCCAATACGACCAAATCAGAGA‑3'. signaling pathway participated in the effect of CNN1 on LUSC. Western blotting. The cells were harvested and total protein Materials and methods was extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology). Protease inhibitors were added (Beyotime Cell culture and transfection. The LUSC cell lines NCI‑H520, Institute of Biotechnology) to the lysis buffer (1:100). The SK‑MES‑1 and NCI‑H2170 were obtained from the Cell lysates were centrifuged at 4˚C, 850 x g for 15 min. The Bank of Type Culture Collection of the Chinese Academy of supernatant was collected and mixed with a loading buffer Sciences. All cells were cultured in DMEM (Gibco; Thermo (Beyotime Institute of Biotechnology) containing 100 mM Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; dithiothreitol. Total protein was quantified using a Protein Thermo Fisher Scientific, Inc.) and maintained at 37˚C Concentration Determination BCA kit (Beyotime Institute and 5% CO2. Overexpression (OE) vectors for CNN1 and of Biotechnology) and the proteins (30 µg/lane) were sepa‑ knockdown vectors for DKK1 and tissue inhibitor of metal‑ rated via SDS‑PAGE (15%). The separated proteins were loproteinases 2 (TIMP2) [OE‑negative control (NC; empty subsequently transferred onto PVDF membranes (EMD pcDNA3.1), OE‑CNN1 (pcDNA3.1‑CNN1), short hairpin Millipore) and blocked using 5% BSA (Beyotime Institute of RNA (shRNA)‑NC, shRNA‑TIMP2 and shRNA‑DKK1] were Biotechnology) at room temperature for 2 h. The membranes purchased from Biomics Biotechnologies. Cell transfection in were incubated with the following primary antibodies at 4˚C NCI‑H2170 cells was performed using Lipofectamine® 2000 overnight: Anti‑CNN1 (cat. no. ab46794; 1:1,000 dilution), (Invitrogen; Thermo Fisher Scientific, Inc.) according to the anti‑MMP2 (cat. no. ab92536; 1:1,000 dilution), anti‑MMP9 manufacturer's instructions. Briefly, Lipofectamine 2000 (cat. no. ab76003; 1:1,000 dilution), anti‑E‑cadherin (E‑cad; was mixed with 20 µg plasmids, which was then added to cat. no. ab40772; 1:1,000 dilution), anti‑N‑cadherin (N‑cad; the cells at 70‑80% confluence and incubated for 6 h at 37˚C. cat. no. ab245117; 1:1,000 dilution), anti‑SLUG (cat. no. The transfection efficiency in cells was measured using ab51772; 1:1,000 dilution), anti‑DKK1 (cat. no. ab109416; reverse transcription‑quantitative PCR (RT‑qPCR). At 48 h 1:1,000 dilution), anti‑β‑catenin (cat. no. ab32572; 1:1,000 post‑transfection, the transfection efficacy was validated using dilution), anti‑c‑myc (cat. no. ab32072; 1:1,000 dilution) and RT‑qPCR and successfully transfected cells were selected for anti‑GAPDH (cat. no. ab8245; 1:10,000 dilution). All anti‑ subsequent experiments. bodies were purchased from Abcam. Following the primary incubation, the membranes were washed with TBS containing Dynamic analysis of GEPIA gene expression profile data. Tween‑20 (0.1%) and incubated at room temperature for 1.5 h GEPIA (http://gepia.cancer‑pku.Cn/index.html) is a website with a horseradish peroxidase‑conjugated donkey anti‑rabbit for cancer data mining. Using RNA sequencing data for CNN1 IgG secondary antibody (cat. no. SA00001‑9; 1:5,000 dilu‑ and TIMP2 from tumor and normal samples, the database was tion; ProteinTech Group, Inc.) or a donkey anti‑mouse IgG used to analyze the expression levels and association between secondary antibody (SA00001‑8; 1:5,000 dilution; ProteinTech CNN1 and TIMP2 in tumor samples. Group, Inc.). The protein bands were visualized using the Odyssey Western Blot Analysis system (LI‑COR Biosciences) RT‑qPCR. Total RNA was extracted using TRIzol® and quantified using Image J version