DOCSLIB.ORG

Argonaute Proteins at a Glance Christine Ender and Gunter Meister

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Argonaute Proteins at a Glance Christine Ender and Gunter Meister Cell Science at a Glance 1819 Argonaute proteins at a RNAs) – ncRNAs that are characteristically Biogenesis of miRNAs and siRNAs ~20-35 nucleotides long – are required for miRNAs glance the regulation of gene expression in many Generally, miRNAs are transcribed by RNA different organisms. Most small RNA species polymerase II or III to form stem-loop-structured Christine Ender1 and Gunter fall into one of the following three classes: primary miRNA transcripts (pri-miRNAs). pri- Meister1,2,* microRNAs (miRNAs), short-interfering RNAs miRNAs are processed in the nucleus by the 1 Center for Integrated Protein Science Munich (siRNAs) and Piwi-interacting RNAs (piRNAs) microprocessor complex, which contains (CIPSM), Laboratory of RNA Biology, Max-Planck- Institute of Biochemistry, Am Klopferspitz 18, 82152 (Carthew and Sontheimer, 2009). Although the RNAse III enzyme Drosha and its DiGeorge Martinsried, Germany different small RNA classes have different syndrome critical region gene 8 (DGCR8) 2University of Regensburg, Universitätsstraße 31, 93053 Regensburg, Germany bio genesis pathways and exert different cofactor. The transcripts are cleaved at the stem *Author for correspondence functions, all of them must associate with a of the hairpin to produce a stem-loop- ([email protected]) member of the Argonaute protein family for structured miRNA precursor (pre-miRNA) of Journal of Cell Science 123, 1819-1823 activity. This article and its accompanying ~70 nucleotides. After this first processing step, © 2010. Published by The Company of Biologists Ltd poster provide an overview of the different pre-miRNAs are exported into the cytoplasm by doi:10.1242/jcs.055210 classes of small RNAs and the manner in which exportin-5, where they are further processed they interact with Argonaute protein family by the RNAse III enzyme Dicer and its TRBP Although a large portion of the human genome members during small-RNA-guided gene (HIV transactivating response RNA-binding is actively transcribed into RNA, less than 2% silencing. In addition, we highlight recently protein) partner. Dicer produces a small double- encodes proteins. Most transcripts are non- uncovered structural features of Argonaute stranded RNA (dsRNA) intermediate of coding RNAs (ncRNAs), which have various proteins that shed light on their mechanism of ~22 nucleotides with 5 phosphates and cellular functions. Small ncRNAs (or small action. 2-nucleotide 3 overhangs. In subsequent Argonaute Proteins at a Glance Christine Ender and Gunter Meister Structure of Argonaute proteins Small-RNA biogenesis and mechanisms of action Highest Cytoplasm heterogeneity RNA binding Active site Nucleus dsRNA from exogenous sources siRNA from exogenous sources mRNA cleavage N terminus PAZ MID PIWI AGO L1 L2 siRNAs Cofactor Cofactor 3Ј OH-binding site 5Ј P-binding site Repetitive elements, Dicer 7 pseudogenes, other AGO m G AAA Crystal structure of ThermThermusus thermophilthermophilusus ArgonaArgonaute endo-siRNA loci AGO RISC Journal of Cell Science Endo-siRNAs PAZ MID BBackbone phosphorus aatoms are in yellow miRNAs (Reproduced( with Primary permissionp from Drosha miRNA DGCR8 WWang et al., 2008a) transcripts Processing Translational AGO repression and/or N Microprocessor deadenylation TRBP Dicer Pol miRNA L1 II/III precursor AGO m7G AAA AGO PIWI Exportin-5 miRNAs miRNP L2 Ribosome Splicing Guide-DNA–target-RNA duplex used in crystal structure 110 21 Guide DNA 5Ј p-TGAGGTAGTAGGTTGTATAGT 3Ј Mirtron Spliceosome Primary piRNA generation oo piRNAs Target RNA3Ј UGCUCCAUCACUCAACAUAU 5Ј 1Ј 10Ј 19Ј Repetitive elements, piRNA precursors transposons, piRNA clusters Arginine methylation of Piwi proteins Sequence motifs MIWI2 MILI MIWI Generation of piRNA for symmetrical GRG 5Ј ends by MILI dimethylarginine GRA MILI PRMT5 MIWI (sDMA) modification, ARG MILI MILI MILI often in repeats MIWI ? TDRD MIWI2 sDMA CH CH 3 3 MIWI2 MIWI modification MILI Transposon silencing HN + NH Secondary processing: C ping-pong model TDRD NH MILI Trimming/cleavage MIWI2 CH of piRNA 3Ј ends 2 TDRD TDRD CH2 MIWI2 CH 2 TDRD MILI MIWI C + – H N H MILI Transposon silencing 3 COO Methylation of Piwi MIWI2 proteins enables their interaction with Generation of piRNA MIWI2 functionally important piRNA precursors 5Ј ends by MIWI2 TDRD = sDMA modification TDRD proteins Abbreviations: DGCR8, DiGeorge syndrome critical region gene 8; dsRNA, double-stranded RNA; endo-siRNA, as PIWIL1 (Piwi-like homolog 1); MIWI2, also known as PIWIL4 (Piwi-like homolog 4); piRNA, Piwi-interacting RNA; Pol siRNA derived from endogenous source; L1, linker 1; L2, linker 2; miRNA, microRNA; miRNP, miRNA-containing II/III, RNA polymerase II or III; PRMT5, protein arginine methyltransferase 5; RISC, RNA-induced silencing complex; siRNA, ribonucleoprotein particle; Mirtron, miRNA-intron; MILI, also known as PIWIL2 (Piwi-like homolog 2); MIWI, also known small-interfering RNA; TDRD, Tudor-domain-containing protein; TRBP, HIV transactivating response RNA-binding protein. © Journal of Cell Science 2010 (123, pp. 1819-1823) (See poster insert) 1820 Journal of Cell Science 123 (11) processing and unwinding steps, one strand of The Argonaute protein family Argonaute proteins typically have a the dsRNA intermediate is incorporated into an To perform their effector functions, small RNAs molecular weight of ~100 kDa and are Argonaute-protein-containing complex that is must be incorporated into Argonaute-protein- characterized by a Piwi-Argonaute-Zwille referred to as an miRNA-containing containing complexes. Argonaute proteins are (PAZ) domain and a PIWI domain. ribonucleoprotein particle (miRNP). The highly specialized small-RNA-binding Crystallographic studies of archaeal and opposite strand, the so-called miRNA* (miRNA modules and are considered to be the key bacterial Argonaute proteins revealed that the ‘star’) sequence, is thought to be degraded. In components of RNA-silencing pathways. PAZ domain, which is also common to Dicer some cases, however, miRNA* sequences can Argonaute proteins were named after an AGO- enzymes, forms a specific binding pocket for the also be functional (Packer et al., 2008). Mature knockout phenotype in Arabidopsis thaliana 3-protruding end of the small RNA with which miRNAs guide Argonaute-containing complexes that resembles the tentacles of the octopus it associates (Jinek and Doudna, 2009). The to target sites in mRNAs that are partially Argonauta argo (Bohmert et al., 1998). On the structure of the PIWI domain resembles that of complementary to the miRNA sequence, and basis of sequence homology, Argonaute bacterial RNAse H, which has been shown to induce repression of gene expression at the level proteins can be divided into two subclasses. cleave the RNA strand of an RNA-DNA hybrid of mRNA stability or translation (see poster). One resembles Arabidopsis AGO1 and is (Jinek and Doudna, 2009). More recently, it was In addition to this canonical miRNA referred to as the Ago subfamily; the other discovered that the catalytic activity of miRNA biogenesis pathway, some alternative is related to the Drosophila PIWI protein and is effector complexes, also referred to as Slicer miRNA biogenesis pathways have recently been referred to as the Piwi subfamily. activity, resides in the Argonaute protein itself. discovered. So-called mirtrons (miRNA- Members of the human Ago subfamily, which Interestingly, not all Argonaute proteins show introns) are miRNAs found in introns. They are consists of AGO1, AGO2, AGO3 and AGO4, endonucleolytic activity. In humans, only identical to pre-miRNAs with respect to their are ubiquitously expressed and associate with AGO2 has been shown to cleave the size and features, but are generated miRNAs and siRNAs. Ago proteins are phosphodiester bond of a target RNA, at a site independently of Drosha (Kim et al., 2009; conserved throughout species and many opposite nucleotides 10 and 11 of the siRNA, Siomi and Siomi, 2009). Moreover, some organisms express multiple family members, although the conserved aspartic acid-aspartic classes of small nucleolar RNAs (snoRNAs) can ranging from one in Schizosaccharomyces acid-histidine (DDH) motif (which is important be processed into small RNAs that act like pombe, five in Drosophila, eight in humans, ten for divalent metal ion binding and catalytic miRNAs (Ender et al., 2008; Scott et al., 2009; in Arabidopsis to twenty-seven in C. elegans activity) is also present in human AGO3 (Liu Taft et al., 2009). (Tolia and Joshua-Tor, 2007). Argonaute et al., 2004; Meister et al., 2004). proteins are also present in some species of More recently, structural studies have been siRNAs budding yeast, including Saccharomyces extended to Thermus thermophilus Argonaute in There are many similarities between the castellii. It was recently found that S. castellii complex with a guide strand only or a guide pathways by which miRNAs and siRNAs are expresses siRNAs that are produced by a Dicer DNA strand and a target RNA duplex. This processed. In contrast to miRNAs, however, protein that differs from the canonical analysis revealed that the structure of the siRNAs are processed independently of Drosha Dicer proteins found in animals, plants and other complex is divided into two lobes. One lobe from long dsRNAs that are derived from fungi (Drinnenberg et al., 2009). However, the contains the PAZ domain connected to the Journal of Cell Science either exogenous sources (to form exo- model organism Saccharomyces cerevisiae N-terminal domain through a linker region, L1. siRNAs) or endogenous
Load more

Recommended publications
  • Not Dicer but Argonaute Is Required for a Microrna Production
    Cell Research (2010) 20:735-737. npg © 2010 IBCB, SIBS, CAS All rights reserved 1001-0602/10 $ 32.00 RESEARCH HIGHLIGHT www.nature.com/cr A new twist in the microRNA pathway: Not Dicer but Argonaute is required for a microRNA production Gabriel D Bossé1, Martin J Simard1 1Laval University Cancer Research Centre, Hôtel-Dieu de Québec (CHUQ), Quebec City, Québec G1R 2J6, Canada Cell Research (2010) 20:735-737. doi:10.1038/cr.2010.83; published online 15 June 2010 Found in all metazoans, microRNAs A Canonical pathway B Ago2-dependent pathway or miRNAs are small non-coding RNA Nucleus Cytoplasm Nucleus Cytoplasm of ~22 nucleotides in length that com- Exp.5 Exp.5 pletely reshaped our understanding of gene regulation. This new class of gene pre-miR-451 regulator is mostly transcribed by the pre-miRNA RNA polymerase II producing a long stem-loop structure, called primary- or Ago2 pri-miRNA, that will first be processed Ago2 Dicer in the cell nucleus by a multiprotein TRBP complex called microprocessor to gen- erate a shorter RNA structure called Ago2 RISC precursor- or pre-miRNA. The precisely Ago2 RISC processed pre-miRNA will next be ex- ported into the cytoplasm by Exportin 5 and loaded onto another processing machine containing the ribonuclease III enzyme Dicer, an Argonaute protein Ago2 Ago2 and other accessory cellular factors mRNA mRNA (Figure 1A; [1]). Dicer will mediate the Translation inhibition Translation inhibition cleavage of the pre-miRNA to form the mature miRNA that will then be bound Figure 1 (A) Canonical microRNA biogenesis. In mammals, the pre-miRNA is by the Argonaute protein to form, most loaded onto a multiprotein complex consisting minimally of Dicer, Tar RNA Bind- likely with other cellular factors, the ef- ing Protein (TRBP) and Ago2.
    [Show full text]
  • Expression Pattern of Small Nucleolar RNA Host Genes and Long Non-Coding RNA in X-Rays-Treated Lymphoblastoid Cells
    Int. J. Mol. Sci. 2013, 14, 9099-9110; doi:10.3390/ijms14059099 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Expression Pattern of Small Nucleolar RNA Host Genes and Long Non-Coding RNA in X-rays-Treated Lymphoblastoid Cells M. Ahmad Chaudhry Department of Medical Laboratory and Radiation Sciences, University of Vermont, Burlington, VT 05405, USA; E-Mail: [email protected]; Tel.: +1-802-656-0569; Fax: +1-802-656-2191 Received: 5 March 2013; in revised version: 19 April 2013 / Accepted: 22 April 2013 / Published: 25 April 2013 Abstract: A wide variety of biological effects are induced in cells that are exposed to ionizing radiation. The expression changes of coding mRNA and non-coding micro-RNA have been implicated in irradiated cells. The involvement of other classes of non-coding RNAs (ncRNA), such as small nucleolar RNAs (snoRNAs), long ncRNAs (lncRNAs), and PIWI-interacting RNAs (piRNAs) in cells recovering from radiation-induced damage has not been examined. Thus, we investigated whether these ncRNA were undergoing changes in cells exposed to ionizing radiation. The modulation of ncRNAs expression was determined in human TK6 (p53 positive) and WTK1 (p53 negative) cells. The snoRNA host genes SNHG1, SNHG6, and SNHG11 were induced in TK6 cells. In WTK1 cells, SNHG1 was induced but SNHG6, and SNHG11 were repressed. SNHG7 was repressed in TK6 cells and was upregulated in WTK1 cells. The lncRNA MALAT1 and SOX2OT were induced in both TK6 and WTK1 cells and SRA1 was induced in TK6 cells only. Interestingly, the MIAT and PIWIL1 were not expressed in TK6 cells before or after the ionizing radiation treatment.
    [Show full text]
  • Epigenetic Roles of PIWI‑Interacting Rnas (Pirnas) in Cancer Metastasis (Review)
    ONCOLOGY REPORTS 40: 2423-2434, 2018 Epigenetic roles of PIWI‑interacting RNAs (piRNAs) in cancer metastasis (Review) JIA LIU1, SHUJUN ZHANG2 and BINGLIN CHENG1 1Department of Integrated Traditional Chinese and Western Medicine Oncology, The First Affiliated Hospital of Harbin Medical University; 2Department of Pathology, The Fourth Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150000, P.R. China Received March 19, 2018; Accepted September 3, 2018 DOI: 10.3892/or.2018.6684 Abstract. P-element-induced wimpy testis (PIWI)-interacting 7. Epigenetics of ncRNAs in cancer RNAs (piRNAs) are epigenetic-related short ncRNAs that 8. Discussion participate in chromatin regulation, transposon silencing, and modification of specific gene sites. These epigenetic factors or alterations are also involved in the growth of a variety 1. Introduction of human cancers, including lung, breast, and colon cancer. Accumulating evidence has revealed that tumor metastasis P-element-induced wimpy testis (PIWI)-interacting RNAs and invasion involve genetic and epigenetic factors. Cancer (piRNAs) belong to a new class of ncRNAs that have been asso- metastasis is characterized by epigenetic alterations including ciated with many cancers (1). piRNAs are involved in the gene DNA methylation and histone modification. Changes in DNA regulation process in which certain nucleotides bind coding methylation, H3K9me3 heterochromatin and transposable regions in gene promoters (2). piRNAs function in the epigen- elements have been detected in several cancers. piRNAs may etic regulation of DNA methylation (3), transposable silencing function in gene silencing and gene modification upstream and chromatin modification (4). PIWI is a type of Argonaute or downstream of oncogenes in cancer cell lines or cancer protein that binds to piRNAs and carries out unique functions tissues.
    [Show full text]
  • Xenopus Piwi Proteins Interact with a Broad Proportion of the Oocyte Transcriptome
    Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Xenopus Piwi proteins interact with a broad proportion of the oocyte transcriptome JAMES A. TOOMBS,1,2,4 YULIYA A. SYTNIKOVA,3,5 GUNG-WEI CHIRN,3,6 IGNATIUS ANG,3,7 NELSON C. LAU,3 and MICHAEL D. BLOWER1,2 1Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 02114, USA 2Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115, USA 3Department of Biology and Rosenstiel Basic Medical Science Research Center, Brandeis University, Waltham, Massachusetts 02454, USA ABSTRACT Piwi proteins utilize small RNAs (piRNAs) to recognize target transcripts such as transposable elements (TE). However, extensive piRNA sequence diversity also suggests that Piwi/piRNA complexes interact with many transcripts beyond TEs. To determine Piwi target RNAs, we used ribonucleoprotein-immunoprecipitation (RIP) and cross-linking and immunoprecipitation (CLIP) to identify thousands of transcripts associated with the Piwi proteins XIWI and XILI (Piwi-protein-associated transcripts, PATs) from early stage oocytes of X. laevis and X. tropicalis. Most PATs associate with both XIWI and XILI and include transcripts of developmentally important proteins in oogenesis and embryogenesis. Only a minor fraction of PATs in both frog species displayed near perfect matches to piRNAs. Since predicting imperfect pairing between all piRNAs and target RNAs remains intractable, we instead determined that PAT read counts correlate well with the lengths and expression levels of transcripts, features that have also been observed for oocyte mRNAs associated with Drosophila Piwi proteins. We used an in vitro assay with exogenous RNA to confirm that XIWI associates with RNAs in a length- and concentration-dependent manner.
    [Show full text]
  • Piwi-Interacting Rnas and PIWI Genes As Novel Prognostic Markers for Breast Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 25 Research Paper Piwi-interacting RNAs and PIWI genes as novel prognostic markers for breast cancer Preethi Krishnan1, Sunita Ghosh2,3, Kathryn Graham2,3, John R. Mackey2,3, Olga Kovalchuk4, Sambasivarao Damaraju1,3 1Department of Laboratory Medicine and Pathology, University of Alberta, Edmonton, Alberta, Canada 2Department of Oncology, University of Alberta, Edmonton, Alberta, Canada 3Cross Cancer Institute, Alberta Health Services, Edmonton, Alberta, Canada 4Department of Biological Sciences, University of Lethbridge, Lethbridge, Alberta, Canada Correspondence to: Sambasivarao Damaraju, email: [email protected] Keywords: piRNA, PIWI, breast cancer, prognostic marker, TCGA Received: January 13, 2016 Accepted: April 28, 2016 Published: May 10, 2016 ABSTRACT Piwi-interacting RNAs (piRNAs), whose role in germline maintenance has been established, are now also being classified as post-transcriptional regulators of gene expression in somatic cells. PIWI proteins, central to piRNA biogenesis, have been identified as genetic and epigenetic regulators of gene expression. piRNAs/PIWIs have emerged as potential biomarkers for cancer but their relevance to breast cancer has not been comprehensively studied. piRNAs and mRNAs were profiled from normal and breast tumor tissues using next generation sequencing and Agilent platforms, respectively. Gene targets for differentially expressed piRNAs were identified from mRNA expression dataset. piRNAs and PIWI genes were independently assessed for their prognostic significance (outcomes: Overall Survival, OS and Recurrence Free Survival, RFS). We discovered eight piRNAs as novel independent prognostic markers and their association with OS was confirmed in an external dataset (The Cancer Genome Atlas). Further, PIWIL3 and PIWIL4 genes showed prognostic relevance. 306 gene targets exhibited reciprocal relationship with piRNA expression.
    [Show full text]
  • Polyubiquitin Gene Ubb Is Required for Upregulation of Piwi Protein Level During Mouse Testis Development
    www.nature.com/cddiscovery ARTICLE OPEN Polyubiquitin gene Ubb is required for upregulation of Piwi protein level during mouse testis development 1,4 2,4 2 1 1 2 ✉ Bitnara Han , Byung-Kwon✉ Jung , So-Hyun Park , Kyu Jin Song , Muhammad Ayaz Anwar , Kwon-Yul Ryu and Kwang Pyo Kim 1,3 © The Author(s) 2021 Testis development, including early embryonic gonad formation and late postnatal spermatogenesis, is essential for the reproduction of higher metazoans to generate fertile gametes, called sperm. We have previously reported that the polyubiquitin gene Ubb is required for fertility in both male and female mice. In particular, the Ubb-null male mice showed an azoospermia phenotype due to arrest of spermatogenesis at the pachytene stage. Here, we analyzed the whole testis proteome at postnatal day 20 to define the molecular mediators of the male-infertility phenotype caused by Ubb knockout. From the identified proteome, 564 proteins were significantly and differentially expressed in Ubb-knockout testes and, among these, 36 downregulated proteins were involved at different stages of spermatogenesis. We also found that levels of piRNA metabolic process-related proteins, including Piwil2 and Tdrd1, were downregulated in Ubb-null testes through functional gene ontology analysis. Further, protein–protein interaction mapping revealed that 24 testis development-related proteins, including Hsp90aa1, Eef1a1, and Pabpc1, were directly influenced by the depletion of ubiquitin. In addition, the reduced mRNA levels of these proteins were observed in Ubb-knockout testes, which closely resembled the global downregulation of piRNA-metabolic gene expression at the transcriptional and post- transcriptional levels. Together with proteomic and transcriptional analyses, our data suggest that Ubb expression is essential for the maintenance of testicular RNA-binding regulators and piRNA-metabolic proteins to complete spermatogenesis in mice.
    [Show full text]
  • The Other Face of Piwi Plant Gene Editing Improved
    RESEARCH HIGHLIGHTS NON-CODING RNA The other face of PIWI Spermiogenesis involves gradual with 3ʹUTRs of the target mRNAs; Credit: S. Bradbrook/Springer Nature Limited chromatin compaction and trans- reporter protein levels but not cription shut-down. mRNAs that mRNA levels increased, implicating activation. Translation of hundreds are transcribed in spermatocytes translation in reporter activation. of mRNAs co-targeted by piRNA and early-round spermatids are Activation of the target-mRNA and HuR was dependent on MIWI, stored as translationally inactive reporters required piRNA–3ʹUTR indicating that they are direct targets ribonucleoproteins until later during base-pairing and 3ʹUTR binding by of this selective mechanism of spermiogenesis, when their trans- functional MIWI. Screening for translation activation. lation is activated, but how this MIWI-interacting proteins revealed The proteins encoded by activation occurs is largely unknown. that eukaryotic translation initiation two of the five original target PIWI proteins and PIWI-interacting factor 3f (eIF3f) directly interacted mRNAs are essential for sperm RNAs (piRNAs) are essential for with MIWI and was also required MIWI– acrosome formation. Indeed, gametogenesis as they suppress for reporter activation. The activated piRNAs severe acrosome defects were found the expression of transposons and 3ʹUTRs included AU-rich elements … in MIWI-depleted spermatids mRNAs. Dai et al. now show that (AREs) that are bound by HuR, interact with owing to considerable decrease in mouse PIWI (MIWI)–piRNAs which is an RNA-binding protein eIF3f–HuR and the levels of the two proteins. are the core of a complex required known to interact with another other proteins Thus, although MIWI–piRNAs for selective mRNA translation translation factor, eIF4G3, for trans- are mostly known for gene silencing, in spermatids.
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Genome-Wide DNA Methylation Dynamics During Epigenetic
    Gómez‑Redondo et al. Clin Epigenet (2021) 13:27 https://doi.org/10.1186/s13148‑021‑01003‑x RESEARCH Open Access Genome‑wide DNA methylation dynamics during epigenetic reprogramming in the porcine germline Isabel Gómez‑Redondo1*† , Benjamín Planells1†, Sebastián Cánovas2,3, Elena Ivanova4, Gavin Kelsey4,5 and Alfonso Gutiérrez‑Adán1 Abstract Background: Prior work in mice has shown that some retrotransposed elements remain substantially methylated during DNA methylation reprogramming of germ cells. In the pig, however, information about this process is scarce. The present study was designed to examine the methylation profles of porcine germ cells during the time course of epigenetic reprogramming. Results: Sows were artifcially inseminated, and their fetuses were collected 28, 32, 36, 39, and 42 days later. At each time point, genital ridges were dissected from the mesonephros and germ cells were isolated through magnetic‑ activated cell sorting using an anti‑SSEA‑1 antibody, and recovered germ cells were subjected to whole‑genome bisulphite sequencing. Methylation levels were quantifed using SeqMonk software by performing an unbiased analysis, and persistently methylated regions (PMRs) in each sex were determined to extract those regions showing 50% or more methylation. Most genomic elements underwent a dramatic loss of methylation from day 28 to day 36, when the lowest levels were shown. By day 42, there was evidence for the initiation of genomic re‑methylation. We identifed a total of 1456 and 1122 PMRs in male and female germ cells, respectively, and large numbers of transpos‑ able elements (SINEs, LINEs, and LTRs) were found to be located within these PMRs. Twenty‑one percent of the introns located in these PMRs were found to be the frst introns of a gene, suggesting their regulatory role in the expression of these genes.
    [Show full text]
  • The Argonaute Family: Tentacles That Reach Into Rnai, Developmental Control, Stem Cell Maintenance, and Tumorigenesis
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis Michelle A. Carmell,1,2,3 Zhenyu Xuan,1,3 Michael Q. Zhang,1 and Gregory J. Hannon1,4 1Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA; 2Program in Genetics, State University of New York at Stony Brook, Stony Brook, New York 11794, USA RNA interference (RNAi) is an evolutionarily conserved The Argonaute family process through which double-stranded RNA (dsRNA) Argonaute proteins make up a highly conserved family induces the silencing of cognate genes (for review, see whose members have been implicated in RNAi and re- Bernstein et al. 2001b; Carthew 2001). Sources of dsRNA lated phenomena in several organisms. In addition to silencing triggers include experimentally introduced roles in RNAi-like mechanisms, Argonaute proteins in- dsRNAs, RNA viruses, transposons, and RNAs tran- fluence development, and at least a subset are involved scribed from complex transgene arrays (for review, see in stem cell fate determination. Argonaute proteins are Hammond et al. 2001b). Short hairpin sequences en- ∼100-kD highly basic proteins that contain two common coded in the genome also appear to enter the RNAi path- domains, namely PAZ and PIWI domains (Cerutti et al. way and function to regulate the expression of endog- 2000). The PAZ domain, consisting of 130 amino acids, enous, protein-coding genes (Grishok et al. 2001; has been identified in Argonaute proteins and in Dicer Hutvagner et al. 2001; Ketting et al.
    [Show full text]
  • Testis Gene PIWIL1 Promotes Cell Proliferation, Migration, And
    Cancer Medicine Open Access ORIGINAL RESEARCH Cancer-­testis gene PIWIL1 promotes cell proliferation, migration, and invasion in lung adenocarcinoma Kaipeng Xie1,2,3,a, Kai Zhang1,2,3,a, Jing Kong1,2,3,a, Cheng Wang1,2,3, Yayun Gu1,2,3, Cheng Liang1,2,3, Tingting Jiang1,2,3, Na Qin1,2,3, Jibin Liu4, Xuejiang Guo1, Ran Huo1, Mingxi Liu1, Hongxia Ma1,2,3 , Juncheng Dai1,2,3 & Zhibin Hu1,2,3 1State Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 211166, China 2Department of Epidemiology and Biostatistics, School of Public Health, Nanjing Medical University, Nanjing 211166, China 3Jiangsu Key Lab of Cancer Biomarkers, Prevention and Treatment, Collaborative Innovation Center For Cancer Personalized Medicine, Nanjing Medical University, Nanjing 211166, China 4Tumor Biobank, Nantong Tumor Hospital, Nantong 226000, China Keywords Abstract Cancer-testis genes, DNA methylation, Epi-driver genes, Lung adenocarcinoma, Piwi-­like RNA-­mediated gene silencing 1 (PIWIL1) has been identified as a PIWIL1 novel extremely highly expressed cancer-­testis (CT) gene in lung adenocarci- noma. However, the exact function and mechanism of PIWIL1 in lung adeno- Correspondence carcinoma remains unclear. Herein, we sought to investigate the role of PIWIL1 Zhibin Hu, State Key Laboratory of in the occurrence and development of lung adenocarcinoma. We examined Reproductive Medicine, Nanjing Medical the expression pattern of PIWIL1 in The Cancer Genome Atlas (TCGA) lung University, Nanjing, China. Tel: 86-25-8686-8440; adenocarcinoma samples, and validated it by Real-­Time PCR (RT-­PCR) in Fax: 86-25-8686-8437; additional 21 paired lung adenocarcinoma tissues and 16 normal tissues.
    [Show full text]
  • The PIWI Protein Aubergine Recruits Eif3 to Activate Translation in the Germ Plasm
    www.nature.com/cr www.cell-research.com ARTICLE OPEN The PIWI protein Aubergine recruits eIF3 to activate translation in the germ plasm Anne Ramat1, Maria-Rosa Garcia-Silva1, Camille Jahan1, Rima Naït-Saïdi1, Jérémy Dufourt 1,5, Céline Garret1, Aymeric Chartier1, Julie Cremaschi1, Vipul Patel1, Mathilde Decourcelle 2, Amandine Bastide3, François Juge 4 and Martine Simonelig 1 Piwi-interacting RNAs (piRNAs) and PIWI proteins are essential in germ cells to repress transposons and regulate mRNAs. In Drosophila, piRNAs bound to the PIWI protein Aubergine (Aub) are transferred maternally to the embryo and regulate maternal mRNA stability through two opposite roles. They target mRNAs by incomplete base pairing, leading to their destabilization in the soma and stabilization in the germ plasm. Here, we report a function of Aub in translation. Aub is required for translational activation of nanos mRNA, a key determinant of the germ plasm. Aub physically interacts with the poly(A)-binding protein (PABP) and the translation initiation factor eIF3. Polysome gradient profiling reveals the role of Aub at the initiation step of translation. In the germ plasm, PABP and eIF3d assemble in foci that surround Aub-containing germ granules, and Aub acts with eIF3d to promote nanos translation. These results identify translational activation as a new mode of mRNA regulation by Aub, highlighting the versatility of PIWI proteins in mRNA regulation. Cell Research (2020) 30:421–435; https://doi.org/10.1038/s41422-020-0294-9 1234567890();,: INTRODUCTION directly interacts with the Oskar (Osk) protein that is specifically Translational control is a widespread mechanism to regulate synthesized at the posterior pole of oocytes and embryos and gene expression in many biological contexts.
    [Show full text]