Regulation of Vitamin E and the Tocopherol Transfer

REGULATION OF VITAMIN E

AND THE

TOCOPHEROL TRANSFER PROTEIN

LYNN M. ULATOWSKI

Submitted in partial fulfillment of the requirements

For the degree of Doctor of Philosophy

Dissertation Advisor: Dr. Danny Manor

Department of Nutrition

CASE WESTERN RESERVE UNIVERSITY

May 2012

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

______Lynn M. Ulatowski______candidate for the ______Doctor of Philosophy____degree *.

(signed) _____Colleen Croniger______

(chair of the committee)

_____Danny Manor______

_____Thomas Kelley______

_____Ruth Siegel______

_____Laura Nagy______

______

(date ) March 12, 2012

*We also certify that written approval has been obtained for any proprietary material contained therein.

Dedication

I dedicate this thesis to my wonderful daughter Lindsey and my mother Joyce. I know my mom’s example shaped my ability to raise such an extraordinary daughter. Lindsey, you are my inspiration and I love you to infinity. I share the success of earning a PhD with my family and Jeff, for I am convinced without their support and love it would not have been possible.

Table of Contents Table of Contents ...... iii List of Tables ...... vi List of Figures ...... vii Acknowledgements ...... 1 The Regulation of Tocopherol Transfer Protein ...... 4 Abstract ...... 4 Chapter 1 ...... 6 Literature Review...... 6 1.1 Vitamin E ...... 6 1.1.1 Vitamin E Family...... 6 1.1.2. Biosynthesis of vitamin E in plants ...... 8 1.1.3. Vitamin E absorption and intracellular transport ...... 11 1.1.4. Vitamin E Selectivity ...... 18 1.1.5. Vitamin E turnover ...... 20 1.1.6. Antioxidant activity ...... 21 1.1.7. Vitamin E and Fertility ...... 24 1.1.8. Non-antioxidant activity of vitamin E ...... 25 1.2 Vitamin E binding proteins ...... 26 1.2.1. Tocopherol Transfer Protein (TTP) identification and structure ...... 26 1.2.2. TTP Function and mutations (AVED) ...... 29 1.2.3. Regulation of TtpA/ttpA transcript and protein ...... 32 1.2.4. Other Vitamin E binding proteins: heart TBP, SPF, Sec14 ...... 33 1.2.5. TTP and vitamin E in the central nervous system ...... 34 Statement of purpose ...... 36 Chapter 2 ...... 37 Altered vitamin E Status in Niemann-Pick type C Disease ...... 37 Abstract ...... 38 Introduction ...... 39 Materials and Methods ...... 41

iii

Results ...... 44 Discussion ...... 52 Chapter 2 Figures ...... 56 Chapter 3 ...... 63 Transcriptional Regulation of the Alpha Tocopherol Transfer Protein in Hepatocytes ...... 63 Abstract: ...... 63 Introduction ...... 64 Materials and Methods ...... 66 Results ...... 70 Discussion ...... 76 Chapter 3 Figures ...... 83 Chapter 4 ...... 92 Tocopherol transfer protein and vitamin E in the CNS ...... 92 Abstract: ...... 92 Introduction: ...... 93 Results ...... 95 Discussion ...... 103 Chapter 4 figures ...... 106 Materials and Methods ...... 113 Chapter 5 ...... 118 Vitamin E levels in mouse models of human disease ...... 118 Abstract: ...... 118 Introduction ...... 119 Description of human disease and mouse models ...... 121 _Toc318047841 Materials and Methods ...... 126 Results ...... 129 Discussion ...... 138 Chapter 6 ...... 145 Overall Summary and Future Directions ...... 145 6.1 Overall Summary ...... 145

6.2 Regulation of TTP/TtpA ...... 147 6.2.1 Single Nucleotide Polymorphisms effect on TtpA regulation ...... 149 6.3 Vitamin E status is altered in Niemann-Pick type C disease ...... 151 6.3.1 Regulation of NPC1 and NPC2 levels ...... 153 6.4 Localization of TTP and tocopherol in the CNS ...... 154 6.5 Levels of vitamin E in animal models of human disease ...... 157 6.6. Concluding Remarks (in a nutshell) ...... 159 Literature Cited ...... 161

List of Tables

Table 1.1 α-Tocopherol content in various plant regions...... 10

Table 1.2 Relationship between tocochromanol binding to TTP and biological activity. .19

Table 1.3 Summary of biochemical analysis of α-tocopherol and TTP mutations...... 31

Table 3.1 Ethnic Frequencies of SNPs in TTP promoter ...... 91

Table 5.1 Genetic diseases associated with low plasma vitamin E levels and compromised neurological function ...... 121

List of Figures

Figure 1.1 Vitamin E family ...... 6

Figure 1.2 Preferential retention of RRR-α-tocopherol ...... 8

Figure 1.3 Biosynthesis of vitamin E in A. thaliana plants ...... 9

Figure 1.4 Absorption of vitamin E ...... 12

Figure 1.5 Summary of the transport of vitamin E in hepatocytes ...... 17

Figure 1.6 Hypothesized location of tocopherol relative to a PUFA molecule in a lipid membrane...... 22

Figure 1.7 Tocopherol scavenging of lipid peroxidation...... 23

Figure 1.8 Relationship between affinity of tocopherol analogue and biological activity .24

Figure 1.9 TTP crystal structure with α-tocopherol in binding pocket ...... 27

Figure 1.10 ClustalW generated alignment of the most homologous regions of the

CRAL-TRIO family members...... 28

Figure 2.1 NBD-tocopherol accumulates in human NPC1 fibroblasts...... 56

Figure 2.2 Characterization of human hepatocytes stably expressing shRNAs to NPC1 or NPC2...... 57

Figure 2.3 Intracellular accumulation of NBD-tocopherol in shNPC1 and shNPC2 IHH cells...... 58

Figure 2.4 Binding of vitamin E to NPC1/2 in vitro...... 59

Figure 2.5 Tocopherol and unesterified cholesterol content in tissue extracts from Npc1 -

/-, Npc2 -/- and wild-type mice...... 60

Figure 2.6 Plasma tocopherol levels are normal in Npc1 -/- and Npc 2-/- mice and NPC- affected humans...... 61

Figure 2.7 Plasma vitamin E: cholesterol ratios are normal in human NPC1 patients ....62

Figure 3.1. TtpA/TTP expression is tissue specific...... 83

Figure 3.2. Chemical Modulators of TTPA expression ...... 84

vii

Figure 3.3. Transcriptional activity of cloned TTP promoter constructs in IHH cells...... 85

Figure 3.4. Transcriptional responses of the cloned 1904 TTP promoter in IHH cells. ...86

Figure 3.5. Transcriptional responses of the TTPA gene to oxidative stress ...... 87

Figure 3.6 . mRNA stability of H2O2-induced expression of TTPA...... 88

Figure 3.7. Involvement of NF-κB in oxidative-stress induced TTPA expression...... 89

Figure 3.8. Common SNPs affect transcriptional activity of the TTPA promoter...... 90

Figure 4.1 TTP mRNA and protein are expressed in various brain regions...... 106

Figure 4.2 TTP expression is increased in astrocyte-enriched cultures...... 107

Figure 4.3 TTP localizes to GFAP-positive cells and is excluded from β-tubulin III positive cells in primary cerebellar cultures ...... 108

Figure 4.4 TTP co-localizes with GFAP-positive cells and is excluded from β-tubulin III- positive cells in organotypic cerebellar slice cultures...... 108

Figure 4.5 Tocopherol secretion correlates with increased TTP and GFAP expression in glia...... 110

Figure 4.6 NBD-tocopherol is localized in GFAP-positive and TTP expressing cells. ... 111

Figure 4.7 TTP expression increases in primary cultures challenged with oxidative stress...... 112

Figure 4.8 Proposed model of TTP expression in normal and oxidative stress conditions in the brain ...... 113

Figure 5.1 Tocopherol (A) and unesterified cholesterol (B) levels in the cortex (CX) and liver of two years old WT and Ttpa-/- mice ...... 130

Figure 5.2 Tocopherol (A) and unesterified cholesterol (B) levels in the cerebellum (CB) and cortex (CX) of three months old WT and Atm-/- mice ...... 131

Figure 5.3 Tocopherol (A) and cholesterol (B) levels in the cerebellum (CB), cortex (CX) and liver of young WT and Cftr-/- mice ...... 132

viii

Figure 5.4 Tocopherol (A) and cholesterol (B) levels in the hippocampus (HP), cerebellum (CB), and cortex (CX) of 13 months old WT and 3XTg AD mice...... 134

Figure 5.5 Tocopherol (A, C, E) and cholesterol (B, D, E) levels in the cerebellum, cortex and liver of WT, Npc1-/- and Npc2-/- mice...... 136

Figure 5.6 Tocopherol and cholesterol levels in plasma ...... 138

Figure 6.1 Schematic summarizing tocopherol transport in hepatocytes...... 146

Figure 6.2 Compensatory increases in NPC1 and NPC2 expression levels...... 154

Figure 6.3 Proposed model of TTP expression in normal and oxidative stress conditions in the brain ...... 156

Acknowledgements

There are numerous people I need to extend my sincere gratitude to for their help in me earning my PhD. I would like to thank my past and present lab-mates with whom I worked with day in and day out. The lab environment held a sense of unity and support that made this experience enjoyable. I want to especially thank Samantha Morley and Varsha Thakur, who helped to immerse me in this whole new world of lipid biology. Their guidance and scientific expertise my first few years facilitated my progress and success in the lab.

My committee of Tom Kelley, Ruth Siegel, Colleen Croniger and Laura Nagy for helping me to think outside the box at my committee meetings and for ensuring I was adequately progressing in my research. I especially want to thank Tom for his collaborations in my first paper and for asking me to give pulmonology seminar. I not only gained an immense amount of confidence from that single seminar but formed a research collaboration as well. I also thank Ruth for welcoming me into her office numerous times to review the morphology of cells from my cerebellum cultures. I have to say how you deal with the ‘color- challenge’ is inspiring.

There were numerous people around campus that helped to make this PhD possible. I had the opportunity to interact with many experts in their techniques and fields. There were a few people I need to specifically identify.

Tory Barron Flemming, who taught me a vegetarian, can harvest primary cerebellar cells from mouse pups like nobody’s business.

Wataru Kudo, who helped me adapt hippocampal slice cultures to cerebellar cultures, as well as taught me the ‘non-invasive’ stereotactic technique of ICV injections. I will miss Wataru, as he goes back to do great science in Japan.

Darcie Seachrist, who was the ‘too-nice’ person that managed the brightfield microscope and really got me rolling with the IHC technique.

Susan Brady-Gullen who patiently, and at a moment’s notice, gave of her time to help me on the Maestro.

Paulina Getzy, in Chris Wilsons lab showed me the patience involved in patch- clamping experiments. She was a pleasure to work with, keeping a positive attitude during each long and frustrating day of patching.

Alma Wilson, who is the best animal technician. She was always there with the animal answers as well as a big smile and warm words.

Another person from the animal center who deserves a shout-out is Cheryl Urban. Her help with the ins and outs of the animal facility was priceless.

Debbie Corey was a key contributor to my first paper. Her help with getting the NPC experiments rolling was crucial to the success of the NPC project.

Dan Barry, who was my go-to guy for last minute reagents and computer help. He helped to ease my frustration of making my table of contents.

I want to extend sincere thanks to Ed Greenfield for taking the time to write so many letters of recommendations throughout the years, from the PhD program and grant funding to the job applications.

I also would like to acknowledge my former boss, Mitch Drumm. He allowed me the independence in his lab that made me believe a PhD was possible and also encouraged me to apply to a PhD program.

I left Mitch’s lab thinking I was leaving an ideal situation and I could get through the next 4-5 years in a less than ideal environment. As it turned out I was beyond fortunate to land in Danny Manor’s lab. Danny exceeded my expectations as a mentor, plus he had a good sense of humor. I appreciated the opportunities Danny gave me to collaborate with so many different people on campus, as well as travel to different meetings. It allowed me to grow socially and scientifically. I will be forever grateful for his patience with my writing, which progressed slower than mastering bench techniques. I believe I will leave the PhD program as a well-rounded scientist because of Danny’s commitment to my success. Danny was also very understanding and flexible with my parental responsibilities. That was very important to me and critical in my ability to balance school and life. I will strive to emulate the patience Danny dealing with personnel and lab issues. Danny always fostered encouragement.

I cannot express how fortunate I am to have such a remarkable family. Their unbelievable love and support played a critical role in me completing this journey. They were always there when I needed a kid-sitter, a ride, a hug, a laugh and motivation. To say I have the best family is an understatement. If I had nothing but my family, I would be truly blessed. I want to acknowledge my mom. Although she unfortunately left this earth way too early, I know she instilled in me many values and characteristics that have shaped the person I am today.

I ‘re-met’ Jeff about 6 months into my PhD. He’s been around ever since asking me on a frequent basis if ‘I solved vitamin E’. He shared my highs and lows and never wavered in his encouragement and love. I feel truly fortunate to have him in my life.

Finally, my daughter Lindsey. We both started school on August 27, 2007…her in 4th grade and me in the PhD program. Four and a half years later, Lindsey has grown into an extraordinary young lady. During this time, Lindsey’s patience was notable, her perseverance was always motivational and the maturity she exhibited was beyond my expectations. Lindsey, we definitely took this journey together and succeeded ♥2∞.

The Regulation of Tocopherol Transfer Protein Abstract by

LYNN M. ULATOWSKI

It has been appreciated for almost a century that vitamin E is an essential micronutrient. Vitamin E functions as the major lipid soluble antioxidant by protecting lipid bilayers from free radical induced damage. Tocopherol transfer protein (TTP) is the only known regulator of vitamin E status. Our research aims to identify mechanisms that control TTP levels. These results will in turn yield insight into the regulation of vitamin E status. In Immortalized Human

Hepatocytes (IHH), TTPA mRNA levels are significantly increased by pharmacological agonists of PPARα, RXR, and CREB, implying lipid metabolism and cAMP levels can regulate TTPA expression. Common single nucleotide polymorphisms present in the TTP promoter region result in variable promoter activity. These data support the notion that by regulating TTP levels, the SNP variants can affect an individual’s vitamin E status. In both IHH and primary cerebellar cells, chemical inducers of oxidative stress increase TTPA mRNA levels, likely as a protective mechanism to facilitate delivery of vitamin E to neighboring cells. Indeed, in radiolabelled secretion assays in mouse primary cerebellar cultures, TTP-expressing astrocytes secrete 50% more tocopherol than neurons. The accumulation of NBD-tocopherol in the lysosomes of cells with attenuated NPC1 and NPC2 protein expression yields insight into vitamin E trafficking in hepatocytes. Importantly, in the NPC1, NPC2 and AD mouse models of human diseases vitamin E plasma levels are within normal range,

4 although tissue levels are altered, suggesting plasma tocopherol levels are not accurate predictors of tissue vitamin E status. Moreover, mis-localization of vitamin E may also contribute to altered vitamin E status. The overall finding that TtpA is regulated in the liver and brain substantiates our hypothesis that

TTP functions to maintain specific microenvironments of vitamin E, likely to protect against free radical induced damage, especially in diseased conditions.

This notion complements our work in the mouse models of human disease where we report that vitamin E levels are variable throughout the brain.

Chapter 1 Literature Review 1.1 Vitamin E

1.1.1 Vitamin E Family Vitamin E is a collective term for a family of neutral plant lipids, which includes the tocopherols and tocotrienols. Tocopherols are distinguished by a saturated

13 carbon phytyl side chain, whereas tocotrienols possess an unsaturated farnesyl side chain containing double bonds on carbons 3’, 7’, and 11’. All vitamin E family members can be referred to as tocochromonals due to a common polar chromanol head group. However the methylation pattern on the chromanol ring distinguishes the family members, giving rise to the designation

-, -, -, and - tocopherol or tocotrienol (Figure 1.1).

Figure 1.1 Vitamin E family. The vitamin E family is composed of tocopherols and tocotrienols. Tocopherols have fully saturated side chain and tocotrienols possess three double bonds. The methylation pattern on the phenolic ring further distinguishes the tocochromanol. Adapted from [1]

Naturally occurring tocopherols possess the R configuration at each of the three chiral centers located at carbon atoms 2’, 4’ and 8’ of the phytyl side chain and are therefore designated RRR- or d- tocopherols. Synthetic tocopherols are racemic mixtures of both R and S configurations (all-rac-tocopherol or dl- tocopherol), resulting in eight stereoisomer permutations: RRR-, RRS-, RSS-,

SSS-, SRR-, SSR-, RSR-, SRS- [2]. Of all the naturally occurring and synthetic vitamin E family members, RRR-alpha-tocopherol is preferentially retained in our bodies and has the highest biological activity [3, 4]. The stereo- isomerization at the 2’ carbon, where the chromanol head joins the tail region, has a profound effect on vitamin E retention. Studies administrating deuterated

RRR- and SRR- tocols determined a half-life of 60-100 hours for RRR- versus a mere 15 hours for SRR- in human plasma. Additionally, administrating equal mixtures of SRR- and RRR- enriches both human and rodent plasma RRR- form by as much as two-fold [4-7]. These results indicate a mechanism(s) that distinguishes and preferentially retains specific vitamin E family members while eliminating other forms. Indeed, hepatic tocopherol transfer protein (TTP) and a

CYP450 ω-hydroxylase family member combine to preferentially retain RRR-α- tocopherol. This preferential retention of alpha-tocopherol explains why 70% of our dietary vitamin E intake is gamma-tocopherol but 90% of our plasma and tissue is enriched with the alpha-tocopherol form of vitamin E [8]. Moreover, normal plasma α-tocopherol levels range between 11 to 37 µM/L, whereas γ- tocopherol levels reach only 5 µM/L, even with γ-tocopherol supplementation [9].

Figure 1.2 Preferential retention of RRR-α-tocopherol due to the presence of tocopherol transfer protein and the CYP450 ω-hydroxylase CY4f2.

1.1.2. Biosynthesis of vitamin E in plants Dietary sources rich in vitamin E include almonds, sunflower seeds, and vegetable oils. Vitamin E is synthesized by the condensation of a hydrophilic chromanol head group and a hydrophobic phytyl side chain in the plastids of all photosynthetic plants [10, 11]. The pathway was initially investigated in the

1980’s using radiolabeled bio-tracer studies and further delineated using forward genetics approaches. The skeleton of vitamin E’s polar head group is formed from an aromatic tyrosine amino acid that is modified by a tyrosine amino transferase (TAT) to p-hydroxyphenylpyruvate (HPP) and subsequently catalyzed by HPP dioxygenase to the final product homogentisic acid (HGA).

The side chain of tocotrienols can be donated from a geranylgeranyl diphosphate (GGDP) intermediate of the 2-C-methyl-D-erthritol-4-phosphate

(MEP) pathway or isopetenylpyrophosate (IPP) pathway. It is this latter pathway, IPP, which produces the side chain for tocopherols. The committed

8 step for all vitamin E family members’ synthesis is the prenylation reaction of

HGA which occurs via the homogentisate phytyltransferase (VTE2) enzyme.

The disruption of the VTE2 enzyme results in complete vitamin E deficiency

[12]. Further modifications by methyl-5-phytyl- 1, 4-benzoquinone (MPBQ) result in generating the methylation pattern for the delta- and beta- forms.

Whereas, MPBQ transferase (VTE3) and 2, 3-dimethyl-5-phytyl- 1, 4- benzoquinone (DMPBQ) enzymes produce gamma- and alpha- tocopherol forms, delta- and gamma- head groups are precursors to the beta- and alpha- forms, respectively. The final production of beta- and alpha- vitamers requires

VTE4 and S-adenosyl methionine (SAM). Overexpression of the VTE3 and

VTE4 enzymes shunts the pathway toward alpha-tocopherol production [13].

Figure 1.3 Biosynthesis of vitamin E in A. thaliana plants. From [14]. Enzymes are in black boxes. Bold arrows show the biosynthetic route leading to the most abundant tocopherol in seed, γ-tocopherol. HPP, hydroxyphenylpyruvate; GGDP, geranylgeranyl- diphosphate; Phytyl-P, phytyl-monophosphate; PDP, phytyl-diphosphate; HGA, homogentisic acid; MPBQ, 2-methyl-6-phytyl-1,4-benzoquinol; DMPBQ, 2,3-dimethyl-6-phytyl-1,4-benzoquinol; HPPD, hydroxyphenylpyruvate dioxygenase; GGDR, geranylgeranyl-diphosphate reductase; VTE1, tocopherol cyclase; VTE2, homogentisic acid phytyltransferase; VTE3, 2-methyl-6-phytyl- 1,4-benzoquinol methyltransferase; VTE4, γ-tocopherol methyltransferase; VTE5, phytol kinase.

Vitamin E composition and distribution is heterogeneous across different plant species as well as within the plant. Alpha-tocopherol is the most abundant form of vitamin E in many plant leaves. The purpose of alpha-tocopherol in the plants’ leaves is to protect the chloroplast membranes from oxidative stress-induced damage during photosynthesis [15-17].

% α-tocopherol Plant and organ (of all tocochromonals)

Potato tuber 90

Lettuce leaf 55

Cabbage leaf 100

Arabidopsis leaf 90

Arabidopsis seed 1

Oil palm leaf 100

Palm seed oil 25

Sunflower seed oil 96

Corn seed oil 7

Table 1.1 α-Tocopherol content in various plant regions. Adapted from [18].

However, the majority of most seed types contain gamma-tocopherol. This is of particular interest when considering humans consuming the western diet ingest large quantities of soybean and corn oil, which have much higher levels of gamma-tocopherols than the more biologically active alpha tocopherol form.

Although all vitamin E family members are equally absorbed in our bodies

10 alpha-tocopherol is preferentially retained. The daily recommended amount of

15 mg alpha-tocopherol for an adult is rarely fulfilled. In separate studies, researchers determined intakes of vitamin E were 50% lower that the DRI [19] and plasma vitamin E levels were less than 20 μM/L in 41% of the population

[20]. The inadequate intake combined with the preferential discrimination of the different forms of vitamin E substantiates the rationale to develop genetic modifications in the plant biosynthetic pathway to enrich alpha tocopherol. An overexpression method of γγ-tocopherol methyltransferase (VTE4) in

Arabidopsis has been reported to increase alpha-tocopherol by nine-fold [13].

1.1.3. Vitamin E absorption and intracellular transport

All natural and synthetic dietary forms of vitamin E family members are equally absorbed into micelles of the intestinal epithelia [21]. Micelles facilitate the passive diffusion across the lumen into enterocytes where tocols are incorporated into chylomicrons for delivery to the liver. The majority of dietary vitamin E is delivered to the liver while a small percentage is directly supplied to non-hepatic tissues [21-23].

Figure 1.4 Absorption of vitamin E. All forms of vitamin E are equally absorbed in the intestines, incorporated into the chylomicron and delivered to the liver. TTP binds and retains α-tocopherol while CYP4f2 catabolizes non-α-tocopherol forms to water soluble compounds that are excreted in the urine and bile. TTP facilitates α-tocopherol incorporation into lipoproteins that are delivered to extra-hepatic tissues.

Considering that vitamin E is a fat-soluble vitamin any perturbation in lipid uptake will affect the vitamin’s absorption. Consequently, conditions including celiac disease, Cystic fibrosis, Cholestatic liver disease and Abetalipoproteinemia, often result in low vitamin E plasma levels. In fat mal-absorption conditions large quantities, up to 10 g per day, of vitamin E supplementation are required to reach adequate plasma vitamin E levels [24, 25]. This point is particularly important when normalizing vitamin E levels to cholesterol or other lipids. For instance, if overall lipid levels are low but tocopherol levels are normal, then the tocopherol: lipid ratio may overestimate vitamin E sufficiency and caretakers may conclude that vitamin E supplementation is not necessary. Furthermore, the plasma levels of vitamin E will likely not reflect tissue levels. Patients with fat mal-absorption diseases given 10g of α-tocopherol per day have normal adipose vitamin E levels

12 but low plasma levels. This disconnect between plasma and tissue vitamin E levels is indeed the case in cholestatic liver disease, CF and Niemann-Pick Type

C [26-29], and is a vital concern in assessing vitamin E status. Although, the specific mechanism of how vitamin E is absorbed and incorporated into chylomicrons is still undefined, it is hypothesized that vitamin E uses a similar mechanism to cholesterol, a molecule with a comparable hydrophobic profile.

Studies to determine vitamin E absorption in humans use fecal radioactivity measurements and deuterated vitamin E in plasma. These studies conclude a range of absorption from 68% [30] to 33% [31] respectively. Clearly, elucidating the mechanism of vitamin E absorption and developing a standardized absorption measurement is required.

The liver is the major regulatory organ of whole-body vitamin E levels and thus, the information regarding vitamin E transport has been delineated in this organ.

However, not all vitamin E travels through the liver. With the aid of phospholipid transfer protein, a very small proportion of vitamin E gets exchanged into lipoproteins and is delivered to extra-hepatic tissues [32]. Of all the vitamin E that reaches the liver, naturally occurring RRR-alpha-tocopherol (tocopherol) is specifically retained over all other synthetic and natural vitamin E forms.

Consequently, the terms tocopherol and vitamin E are often used interchangeably. In the last twenty years, research has begun to define the trafficking of vitamin E through the hepatocytes. Vitamin E uptake in the liver is facilitated by LDL and SR-B1 receptors [33-36]. In studies with mice there seems to be some preference for vitamin E uptake from HDLs. However, this

13 may be attributed to the fact that rodent lipoprotein profiles are HDL-enriched compared to humans. Ldlr-/- mice displayed normal vitamin E tissue or plasma levels whereas, mice lacking the SRB1 receptor for HDL, had both increased plasma tocopherol and decreased tissue concentrations [33, 37-39]. It should be noted that only ovaries, testes, lung and brain tissue levels are affected in the

SRB1 knock-out mice; thus, there may be some tissue-specific selectivity of vitamin E uptake.

Once vitamin E is internalized in the liver it travels the endocytic pathway to reach the lysosomal vesicles. Studies using fluorescently labeled vitamin E found co-localization of tocopherol in LAMP-positive vesicles; an indication tocopherol is in the lysosomes [33]. Although, functional resident lysosomal proteins NPC1 and NPC2 are required to maintain proper vitamin E status, radioactive competition binding studies suggest tocopherol is not a bona fide ligand for NPC1 and NPC2 [29, 40]. However, the exact mechanism of vitamin E egress out of the lysosomes is still under investigation. Multiple reports from the same group suggest alpha-tocopherol can “flip-flop” out of the membranes.

Synthetically made tocopherol-containing liposomes are used to monitor the ability of potassium ferroxide to oxidize alpha-tocopherol. The findings that after several hours half the tocopherol is oxidized led the group to the conclusion that tocopherol slowly flip-flops in membranes [41, 42]. Reproduction of these studies by our collaborators results indicate that oxidation is complete and immediate, suggesting either the tocopherol flips quickly in the membranes or the numerous membrane preparations were leaky (unpublished communications). Thus, the

14 notion that tocopherol flip-flops in membranes is still under debate. However, it should be noted that other lipids, including cholesterol, which also possesses a polar head-group and hydrophobic tail like vitamin E, have been shown to have substantially varying flipping times depending on the membrane lipid composition

[43].

Various lines of evidence substantiate the requirement for TTP. First, mutations in the TTP gene result in the heritable disease ataxia with vitamin E deficiency

(AVED, OMIM #277640), characterized by low vitamin E levels. Second, secretion studies in rat hepatoma cells (McA-RH7777) and human hepatoblastoma cells (HepG2) confirmed that the presence of TTP is necessary for tocopherol egress out of cells but not for tocopherol uptake [33, 44, 45].

Although it is accepted TTP functions to facilitate intracellular transport of vitamin

E between membrane vesicles, in vitro, there is a gap in our understanding of how TTP actually obtains vitamin E from the endocytic vesicles. It is hypothesized there is a transient association of TTP with the membrane vesicle, possibly utilizing an accessory protein (s) to anchor TTP to the membrane [45-

51]. In support of this notion TTP contains a putative lysosomal targeting motif.

Studies are underway in our lab to delineate the role of the dileucine motif on

TTP transport function.

Tocopherol movement in hepatocytes may also occur via tubulin microtubules.

This idea is supported by the fact that treatment with the tubulin polymerization inhibitors decrease tocopherol secretion [33, 52]; however the transport vesicles

15 involved with this pathway are undefined. Other insights into vitamin E transport are defined using a liver-specific conditional Mttp mouse model. Inactivation of microsomal triglyceride transfer protein leads to an inability of Mttp mice to package and secrete VLDL [53]. However after 28 days of deuterated tocopherol administration, plasma levels of vitamin E in the conditional Mttp KO mice were low but tissue levels were normal [54]. These results suggest that tocopherol is exchanged between the plasma lipoproteins but that VLDL is not the only route involved in secretion of vitamin E from hepatocytes. Several lines of evidence suggest ATP binding cassette transporter type C1 (ABCA1), a known transporter of cholesterol, is involved in tocopherol transport [33, 55]. First, people with

Tangiers disease (OMIM #205400), a condition attributed to mutations in ABCA1 have low plasma vitamin E levels. The decreased tocopherol secretion seen in

Tangier fibroblasts is attenuated with ABCA1 overexpression [56]. People with

Tangiers disease also develop demyelination of peripheral neurons that is likely associated with cholesterol accumulation but may be associated with the vitamin

E deficiency [57]. Mouse models with mutations in Abca1 also have low vitamin

E levels [58]. Finally, in cell culture models the ABCA1 transporter inhibitor, glyburide, decreases radiolabeled tocopherol secretion. Taken together it is reasonable to conclude that tocopherol egress from the liver requires functional

ABCA1. Although ABCA1 transports lipids to lipid-poor HDL particles, it is also known that ABCA1 is present on the surface of intracellular membranes, rapidly recycling from endosomes/lysosomes to the plasma membrane [59-61]. The studies discussed above do not address the compartmentalization of ABCA1.

One could hypothesize ABCA1 is working in several locations in the cell to aid in tocopherol egress.

Taken together, there is preferential uptake of vitamin E by the SRB1 receptors that delivers the lipid to the endocytic pathway. Release of the tocopherol from the endosomes/lysosome requires functional NPC1 and NPC2 as well as some transitory presence of TTP. TTP facilitates the transport of vitamin E between intracellular vesicles to be secreted via the ABCA1 transporter. Clearly despite the progress in delineating the transport of vitamin E there are voids in our understanding that deserve further attention. First, what is the mechanism of tocopherol transport of the lysosomes and how does TTP remove the tocopherol? Second, what are the possible intracellular transport vesicles that tocopherol uses for transport? Third, what are the TTP accessory proteins and how do the proteins interact? Finally, is this defined vitamin E transport pathway for hepatocytes similar in non-hepatic tissues?

Figure 1.5 Summary of the transport of vitamin E in hepatocytes.

1.1.4. Vitamin E Selectivity The preferential retention of RRR-alpha-tocopherol is a consequence of two biological mechanisms: retention by hepatic TTP and ω-hydroxylase selectivity.

The ω-hydroxylase is a member of the cytochrome CYP450-4F2 family (Cyp4f2).

ω-hydroxylase is the key enzyme in the pathway of ω- and β-oxidation of non- alpha-tocopherol family members to water soluble 3’ carboxychromanol, or 2, 7,

8-trimethyl-2-(β-carboxyethyl)-6-hydroxychroman (CEHC) compounds that can be excreted in bile or urine [62]. ω-hydroxylase is specifically influenced by the methylation pattern on the different vitamers’ chromanol ring, with significantly lower activity towards compounds with methyl groups on C5 [63]. ω-hydroxylase exhibits little activity towards catabolizing alpha-tocopherol, which has a methyl group at C5. The combination of TTP and ω-hydroxylase result in a 5- to 10- fold enrichment of plasma alpha-tocopherol levels compared to gamma-tocopherol and tocotrienol [9]. Nascent VLDL have been shown to contain RRR-alpha- tocopherol whereas other E vitamers are found in bile [64]. Additionally, rats fed diets with a 1:3 ratio of alpha- to gamma- tocopherol exhibit a 30-fold increase in alpha-tocopherol after 12 hours. TTP exhibits various affinities towards different vitamin E forms [3]. As shown in the table below the binding of vitamin E to TTP is linearly correlated with the biological activity of vitamin E.

Tocochromonal % binding to TTP Vitamin E activity

α- tocopherol 100 100

α- tocotrienol 12.5 21-50

β- tocopherol 38 25-50

γ- tocopherol 9 8-19

δ- tocopherol 1.5 <3

Table 1.2 Relationship between tocochromanol binding to TTP and biological activity. Adapted from [3].

Although TTP functions to retain RRR-α-tocopherol over the other natural and synthetic forms of vitamin E, the selectivity for the specific vitamer is assigned to

ω-hydroxylase activity. This is best substantiated by the fact that although mutations in TTP result in low vitamin E levels, there is still an enrichment of alpha- over gamma-tocopherol plasma levels [39]. Additionally, drosophila discriminate between vitamers but do not express TTP suggesting there are multiple mechanisms to vitamin E discrimination [65]. Further evolutionary conservation of the discriminatory mechanism to specifically retain and accumulate α-tocopherol is demonstrated in other species, including fish, turkey and cows [66-69].

The majority of vitamin E is harbored in the parenchymal cells of the liver, the skeletal muscle, the adrenals and the bulk lipid droplet of the adipose tissue [70-

74]. The fact that approximately 90% of all vitamin E is found in the adipose tissue is ascribed to its lipid soluble properties [71]. At the sub-cellular level the golgi apparatus, endoplasmic reticulum, mitochondria and lysosomes are major sites of vitamin E localization [72].

1.1.5. Vitamin E turnover Several studies, mainly with rats, demonstrate that tocopherol turnover varies among tissues [75-79]. These studies encompass vitamin E depletion periods of seven to 55 weeks. The results suggest a biphasic tocopherol depletion for most tissues, which is characterized by an initial rapid depletion of vitamin E followed by a slower progressive decline. Interestingly, regions of the brain, including the forebrain and cerebellum, do not follow this biphasic pattern [75]. Impressively the nervous system tissues still retain 5% of the normal tocopherol levels after 52 weeks of vitamin E depletion [78], whereas plasma, liver and heart tissues deplete half the starting tocopherol values in the first few weeks [76]. The initial loss of tocopherol is proposed to come from the labile pool whereas the second phase of tocopherol disappearance comes from the vitamin E in the sub cellular fractions [77]. Results from studies utilizing deuterated tocopherols to monitor tocopherol tissue turnover for up to 5 months confirm the vitamin E depletion studies [7, 79]— that the half-life of tocopherol ranges from 8 days (lung) to 72 days (spinal cord) [79]. Additionally, when rats are given both SRR- and RRR- deuterated tocopherols, the brain preferably uptakes the natural RRR-tocopherol vitamer five-fold greater than other tissues [79]. These results suggest that the brain exhibits a greater selectivity for the naturally-occurring RRR-tocopherol than other tissues. This may be a result of a tissue specific function of TTP in the central nervous system. Furthermore, the accumulation of dietary tocopherol in rats supplemented with vitamin E [77] and uptake of deuterated tocopherol [79] is slower in brain tissues than other tissues, suggesting the tocopherol in the nervous system is not in equilibrium with plasma. In summary, tocopherol

20 uptake and turnover is tissue specific. Furthermore the nervous system demonstrates slower uptake and depletion as well as a preference for natural tocopherol compared to other tissues and plasma, proposing a presence of a unique tocopherol processing mechanism in the nervous system. Elucidation of this mechanism is critical considering the major phenotype of low vitamin E status is cerebellar ataxia.

1.1.6. Antioxidant activity Oxidative stress is defined by the imbalance between the body’s levels of antioxidants and endogenous reactive oxygen species (ROS) [80]. Normal physiological metabolism produces ROS that are normally neutralized by the body’s ability to scavenge free radicals. The presence of vitamin E in cellular membranes is thought to prevent oxidative stress by scavenging free radicals and thus attenuating lipid peroxidation. Vitamin E attenuates hypoxia-induced oxidative stress in mice [81] as well as protect rats cerebellar neurons from hydrogen peroxide oxidative stress-induced cell death [82]. Important to its physiological role in the brain, vitamin E crosses the blood brain barrier [83].

Vitamin E is designated as the major lipid soluble antioxidant [84-87] and thus is a widely supplemented nutrient [88, 89]. The antioxidant activity of vitamin E is assigned to the lone hydroxyl group on the chromanol ring. Tocopherol is an efficient and fast antioxidant, with the ability to scavenge radical 200 times faster than a common commercially available antioxidant butylated hydroxytoluene, in vitro [85].

Based on multiple models generated from x-ray diffraction and steady-state polarization studies [90-92] it is hypothesized that the hydrophobic tail portion of

21 vitamin E inserts into the lipid membranes whereas the polar head is positioned near other phospholipid head groups (Figure 1.6).

Figure 1.6 Hypothesized location of tocopherol relative to a PUFA molecule in a lipid membrane. The polar hydroxyl (OH) head-group of α- tocopherol (right) is positioned near the lipid peroxyl radical of the PUFA. The red dashed line represents the lipid bilayer. Adapted from [92].

The location of tocopherol relative to the polyunsaturated fatty acids (PUFA) is critical considering the low concentrations of tocopherol in biological membranes; roughly one tocopherol to 100-1000 phospholipid molecules [85]. In the heterogeneous distribution of lipids in membranes tocopherol tends to localize to

PUFA-rich regions, a region that tends to be more curved and fluid [93]. The significance of tocopherol in the fluid regions of the membrane may relate to how tocopherol exits membranes. In addition, it is also speculated that vitamin E position in the membrane must permit access of ascorbate (vitamin C) to regenerate the oxygen radical [94, 95]. The neutralization of reactive oxygen species by tocopherol is a three step process. The process involves a slow, rate- limiting step of initiation, followed by propagation of the free radicals and eventual

22 termination of the chain reaction resulting in tocopherols donation of hydrogen.

This last step results in conversion of tocopherol to a tocopheroxyl radical [2, 96]

(Figure 1.7). Tocopheroxyl radicals that are not recycled back to tocopherol by ascorbic acid are oxidized to alpha-tocopherol quinone (TQ) and further reduced to tocopherolhydroquinone [87, 97-99].

Figure 1.7 Tocopherol scavenging of lipid peroxidation. L• (carbon-centered lipid radical), LOO• (lipid peroxyl radical), LOOH (lipid hydroperoxide), TOH (α- tocopherol), TO• (α-tocopheroxyloxyl radical). Adapted from [100].

The biological activity of vitamin E has been established by rat fetal gestation- resorption and hemolysis of red blood cells. By these methods it was determined d-alpha tocopherol acetate has the highest biological activity [101]. A linear relationship is established by combining the affinity of a specific tocopherol for

TTP versus its biological activity [3] (Figure 1.8).

Figure 1.8 Relationship between affinity of tocopherol analogue and biological activity. Adapted from [3].

1.1.7. Vitamin E and Fertility The term tocopherol originates from “tokos” meaning childbirth and “pherin”, meaning to bear or bring. The –ol indicates the alcohol nature of the compound.

Early studies in rats given rancid fats resulted in the discovery that a vital nutrient absent from these diets are required for fertility [102]. Subsequent studies branded this unknown factor X, which is necessary for embryonic survival, as vitamin E or tocopherol. More recent research in rodents concludes that vitamin

E is required during days 6.5 to 13.5 dpc and is specifically necessary for implantation but not development [103]. The expression of TTP in the uterus and placenta underscore the importance of vitamin E presence and delivery to the fetus during pregnancy, presumably to defend against the high oxidative environment.

1.1.8. Non-antioxidant activity of vitamin E In addition to vitamin E being designated as the major lipid soluble antioxidant there are also claims that vitamin E harbors non-antioxidant functions. Several of these functions are associated with cardiovascular function. Specifically, α- tocopherol is proposed to decrease smooth muscle proliferation by inhibiting the activity of protein kinase C (PKC) in human platelets, diabetic rat kidney and human monocytes [104-107]. The mechanism of action is believed to be associated with the interaction of α-tocopherol and PKC in the membrane, possibly affecting the production of diayclglycerol, a known activator of PKC

[108-110]. However, it should be noted and stressed that PKC is known to be regulated and affected by the oxidative environment and therefore the PKC and tocopherol connection indeed may be due to the antioxidant properties of vitamin

E [111-113]. Additional proposed non-antioxidant functions of vitamin E include increasing phosphoprotein phosphatase 2A and cyclooxygenase activities, two key regulating enzymes in arachidonic acid metabolism [114, 115]. Vitamin E functioning in cardiovascular health may be linked to its ability to down-regulate both intercellular adhesion molecule (ICAM) and vascular adhesion molecule

(VCAM) and thereby prevent oxidized LDL-monocyte adhesion to endothelial cells [116]. The regulation of all these genes is ascribed to a non-antioxidant activity of α-tocopherol because β-tocopherol, which has a similar antioxidant capability in vitro, does not produce the same responses. However, the major caveat of this statement, and the above studies, is the fact there is preferential retention and bioavailability of α-tocopherol over all non-α-tocopherols.

Transcriptional regulation of SRB1 [117] and other cholesterol pathway genes, including HMGCoA reductase [118], the rate-limiting enzyme of cholesterol synthesis, are regulated by a non-antioxidant α-tocopherol associated mechanism. These studies were substantiated by comparing tocopherol to N- acetyl-cysteine, a global antioxidant.

1.2 Vitamin E binding proteins

1.2.1. Tocopherol Transfer Protein (TTP) identification and structure TTP is a ~32 kDa soluble protein that was first described as a tocopherol binding protein in rat liver homogenates [46]. Early characterization of TTP using competition assays revealed the preference of the binding protein for α- tocopherol [46]. Studies following radiolabeled α-tocopherol transfer from liposomes to lung, liver, heart and brain microsomes provided insight into TTP functioning to transfer tocopherol between membranes [119]. The greatest transfer activity was in the liver microsomes, suggesting that TTP activity was the most robust in the liver. A decade later, purification of the tocopherol transfer protein to homogeneity from rat liver homogenates [120] was followed by identifying a TtpA cDNA clone generated from a rat liver cDNA library [121].

Sato et al determined that TTP was a 278 amino acid protein with a predicted molecular weight of 31845 daltons. Therefore, these results verified that the previously identified tocopherol binding protein and TTP were indeed the same protein. Binding reactions with a fluorescent analogue of α-tocopherol established a Kd of ~10 nM binding affinity for TTP [122, 123]. This information extended the previous radiolabeled tocopherol and TTP binding experiments.

The cloning of the human TTPA transcript from a human liver cDNA library predicted a 278 amino acid protein with a molecular weight of 31749 daltons.

The TTPA gene includes five exons that compose an 834 base pair coding sequence. The sequence homology between the rat, mouse and human TTP was determined to be greater than 90% [124]. The TTP gene was localized to the 8q13.1-13.3 chromosomal region, an area associated with the familial disorder ataxia with vitamin E deficiency (AVED, OMIM #277640) [124-127]. In

2003, two independent labs solved the tocopherol ligand bound TTP crystal structure [128, 129] (Figure 1.9). The TTP structure was proposed to include 5

β-sheets and 14 α-helices along with a hinged “lid” region that opened and closed dependent on whether tocopherol was bound in the hydrophobic pocket.

The tocopherol ligand binding domain encompasses the residues 129-194 [128].

Additional characteristics of TTP include two CRAL-TRIO domains, pfam03765

(residues 11–83) and pfam00650 (residues 89–275), which were initially recognized in cellular retinal-binding protein (CRALBP) and the Trio protein [130,

131].

Figure 1.9 TTP crystal structure with α-tocopherol in binding pocket [129]. Lid region (green), β-sheets (red), α-helices (blue), α-tocopherol (yellow).

The family of cytosolic proteins also includes the yeast phosphatidyl inositol/ phosphatidyl choline transfer protein Sec14 (Sec14p) and supernatant protein factor (SPF), a key protein in cholesterol biosynthesis, critical in the conversion of squalene to lanosterol [132, 133]. There were attempts to re-name SPF to tocopherol associated protein (TAP) because it had some ability to bind tocopherol [134]. Although these proteins were known to function as lipid binding and transport proteins, they have a high promiscuity towards non-specifically binding lipids. TTP is the only CRAL-TRIO family member that binds α- tocopherol with high affinity and therefore is considered the primary regulator of whole body vitamin E status [4]. The relationship between the sequence identity of TTP and other CRAL-TRIO family members ranges between 28% (Sec14p) to

32% (CRALBP) identical (Figure 1.10).

Figure 1.10 ClustalW generated alignment of the most homologous regions of the CRAL-TRIO family members. The α-tocopherol binding domain of TTP spans amino acids 129-194 [4] and is underlined in red.

1.2.2. TTP Function and mutations (AVED) By virtue of its lipophilic nature tocopherol likely requires a protein to facilitate its transport in the aqueous milieu of the cytosol. Indeed, it has been established that TTP specifically binds tocopherol with high affinity and facilitates its transport between membrane vesicles [33, 120, 124, 135, 136]. Consequently, TTP is thought to be the key regulator of whole body tocopherol status. As stated earlier, TTP is not necessary for absorption or uptake of vitamin E into the liver.

TTP is highly expressed in the liver and to a lesser but significant amount in the brain, as well as in the kidney and in the lung [137, 138]. Several studies have demonstrated TTP expression in mouse uteri and human placenta trophoblasts

[139-142] suggesting that TTP expression is critical in gestation and fetal development. Thus, expression of TTP is both temporal and tissue-specific.

The critical role of TTP is demonstrated in the fact that mutations in the TTPA gene result in an autosomal recessive neurodegenerative disorder termed ataxia with vitamin E deficiency (AVED OMIM #277460). To date there are 24 mutations identified in the TTPA gene. The most common mutation (744delA) in

TTPA results in a frameshift of the coding region that is accompanied by a severe phenotype [143-145]. Notably, some individuals harboring severe TTPA mutations (400C→T; 513insTT; 530AG→GTAAGT; 744delA) do not discriminate between the natural and synthetic α-tocopherol stereoisomers [146]. However, the consequences of the nondiscrimination of have not been studied. Patients with AVED display very low circulating levels of tocopherol (< 3 µmol/L) , loss of proprioception, areflexia, progressive spinocerebellar ataxia [126, 147, 148] and are reported to have degeneration of Purkinje neurons and spinal sensory

29 demyelination accompanied by neuronal atrophy and axonal spheroids [80, 138,

148, 149]. Some patients with AVED also develop retinitis pigmentosa, which high dose vitamin E supplementation—800 to 1500 mg per day, can reverse [80,

126, 148, 150-152]. AVED symptoms begin to manifest from age 2 until around age 50 depending on the specific mutation in the TTPA gene [153]. Due to lack of controlled population-based studies no prevalence ratio of AVED is known.

Binding experiments, transfer assays and secretion assays are used for the biochemical analysis of TTP mutations [44, 45, 154, 155]. Not surprisingly, in comparison to the WT TTP purified protein preparations, some mutant TTP proteins possess a much lower affinity for α-tocopherol (Kd about 30 nM for WT versus 40-123 nM for mutant TTP). Furthermore, there is a correlation between severity of TTP mutation and vitamin E’s binding affinity for TTP. Additionally, early-onset AVED-causing TTP mutations display a slower transfer activity in vitro [154, 155] as well as a decreased secretion of tocopherol in comparison to the more mild AVED mutations [44, 156]. The table below (table 1.3) demonstrates the correlation between the spectrum of AVED-causing mutations in TTP and the function of TTP. More severe mutations in TTP tend to bind tocopherol with less affinity, exhibit less transfer activity and secrete less tocopherol, thus reinforcing the correlation between the severities of the AVED mutations and TTP function.

Transfer T %-tocopherol TTP Binding K (nM) 1/2 d (min) secretion

WT 36 +/- 5 5.9 +/- 1.1 100%

A120T 70 +/- 3.8 6.0 +/- 0.9 86%

H101Q 63.4 +/- 3.5 6.2 +/- 1.2 ND

R192H 40.9 +/- 3.7 6.2 +/- 0.5 ND

R221W 86.1 +/- 11 17.3 +/- 1.6 71%

R59W 123.2 +/- 11 11.8 +/- 0.6 75%

E141K 76.4 +/- 8 15.7 +/- 3.8 ND

Table 1.3 Summary of biochemical analysis of α-tocopherol and TTP mutations. Mutations in the shaded boxes indicate severe AVED mutations. ND; not determined. Adapted from [154, 156].

TtpA-/- knock-out mice display reduced tocopherol levels in the serum and non- hepatic tissues. In addition, TtpA-/- mice exhibit a neurodegenerative phenotype resembling the human ataxia pathology [23]. Specifically, the mice are infertile and present with low vitamin E levels, ataxia, progressive neurodegeneration and increased markers of oxidative stress [138]. Therefore, the TtpA-/- mouse is a resource for studying progressive oxidative stress and complete depletion of vitamin E. It is notable that due to the slow turnover of vitamin E in some tissues it is difficult to completely deplete vitamin E strictly by dietary means. Therefore, the depletion of vitamin E requires nonfunctional TTP in combination with a vitamin E depleted diet.

1.2.3. Regulation of TtpA/ttpA transcript and protein The tissue-specific and temporal expression profile of TtpA suggests the gene is highly regulated. Furthermore, the Gene atlas results for TtpA expression showing variable mRNA levels across many anatomical regions

(http://biogps.gnf.org/#goto=genereport&id=7274) supports the notion of tissue specific transcriptional regulation. The fact that TTP regulates the major non- enzymatic lipophilic antioxidant, vitamin E, suggests that regulation of TTP levels has profound physiological significance. However, studies to examine TTP regulation are inconclusive and incomplete. In rats fed an enriched vitamin E diet containing 50 mg all rac-α-tocopherol/ kg diet for 12 weeks had decreases in TTP protein expression but no change in TtpA mRNA levels compared to rats fed a normal diet. The gene levels of TtpA did not change and therefore the authors hypothesize that low vitamin E levels do not affect TtpA gene levels but instead tocopherol protects the TTP protein from degradation [157]. This idea is consistent with results from our lab that demonstrate the half-life of TTP degradation is slowed by 2-fold with tocopherol treatment, possibly due to TTP relocating from the soluble to insoluble fraction of the cell during tocopherol treatment [158]. However, other studies in depleted rats and mice report no effect of vitamin E status on expression levels of TTP protein [159, 160].

Conversely, significantly altered TtpA mRNA levels in vitamin E depleted [28] and replete [31] rats imply a transcriptional regulatory mechanism of TtpA expression.

Since TTP regulates the whole body levels of the major lipid soluble antioxidant other studies investigated the effect of the oxidative environment on TTP expression. Again these studies generated mixed and inconclusive results.

Hyperoxia resulted in decreased TtpA [161] in rat livers, while oxidative stress generated from three days of exposure to environmental smoke did not change mouse hepatic TTP protein [160]. Using Fullerene C60 to induce oxidative stress in zebrafish embryos resulted in a 3-fold increased TtpA gene expression [162].

Taken together, there is evidence that tocopherol levels and oxidative stress can regulate TTP expression, however the data are incomplete. Furthermore, there are no studies that examine the regulatory mechanisms of TTP expression in non-hepatic tissues. This is of significance considering the primary outcome of vitamin E deficiency is that of neurodegeneration.

1.2.4. Other Vitamin E binding proteins: heart TBP, SPF, Sec14 Considering TTP is only expressed in selected tissues and it is not required for vitamin E absorption, uptake or plasma transport, there have been efforts to identify additional tocopherol binding proteins. TTP is not expressed in the heart, but lack of vitamin E has been shown to be associated with cardiovascular disease [163-166]. These observations suggested the possibility of an alternative vitamin E transport protein in the heart. In the early eighties several studies from Dutta-Roy et al identified a tocopherol binding protein in bovine, rabbit and rat heart liver homogenates [167-169]. The purified protein was determined to be between 14 to 16 kilodaltons and impressively bind tocopherol with a high affinity (Kd 2.56 nm). However beyond purifying the protein to homogeneity and determining the binding affinity this tocopherol binding protein has never been further characterized [170].

As discussed earlier, SPF has been described as a key member in the cholesterol synthesis pathway by stimulating squalene epoxidase activity [133].

SPF is highly expressed in the liver and intestine and has been suggested to associate with tocopherol and TTP, leading to an alternative name tocopherol associated protein, or TAP [124, 171, 172]. However, binding assays with tocopherol and SPF demonstrated a 25-fold weaker affinity of α-tocopherol for

SPF compared to TTP [4]. Furthermore, γ-tocopherol (269 nM) had a much higher affinity for SPF than α-tocopherol. Taken together these results suggest there is little physiological relevance to SPF serving as a modulator of α- tocopherol status.

Like SPF, Sec14p is a yeast member of the CRAL-TRIO binding family. Sec14p is established as a phosphatidyl inositol/ phosphatidyl choline transfer protein

[173, 174]. In binding studies, α-tocopherol bound with greater affinity to Sec14p

(373 nM) compared to SPF [4]. Moreover the affinity of Sec14p for α-tocopherol was comparable to the affinity for phosphatidylinositol— Sec14p’s established ligand. However, there is an order of magnitude difference for tocopherol binding to TTP compared to Sec14p.

1.2.5. TTP and vitamin E in the central nervous system The brain’s relative size (2% of the whole body weight) and disproportionate demand for oxygen (20%) makes it particularly vulnerable to oxidative stress and development of sporadic neurodegenerative diseases, like Alzheimer’s disease,

Parkinson disease, Amyotrophic Lateral Sclerosis and Downs Syndrome.

Autopsies of human patients suffering from neurodegeneration show an increase

34 in the levels of markers of oxidative stress [175, 176]. Furthermore, studies in humans and transgenic mouse models established that supplementation with vitamin E leads to a significant decrease in the levels of oxidative stress markers in the brain, and delays the progression of Alzheimer’s disease and Amyotrophic lateral sclerosis [177, 178]. Additionally, research has shown a positive correlation between decreased risk for Parkinson’s disease and dietary intake of vitamin E [179-182], and there is compelling evidence that vitamin E supplementation slows the progression of some of these oxidative stress-related diseases [183]. Thus, vitamin E supplementation is commonly prescribed for these diseases [178, 184, 185].

The primary pathology of vitamin E deficiency is neurological degeneration resulting in ataxia. Multiple lines of evidence suggest that TTP and tocopherol play important roles in the CNS. First, heritable mutations in the TTPA gene result in AVED, a neurodegenerative disorder characterized by low tocopherol levels, ataxia, and degeneration of Purkinje neurons [183]. Second, TTP is expressed in the Bergmann glial cells of the rat brain, as well as in the cerebral cortex and cerebellum of humans and mice [137, 138]. Third, the TtpA-/- mice present increased levels of lipid peroxides, morphological and functional defects in cortical and retinal neurons, and significantly decreased plasma and tissue vitamin E levels [138]. Finally, TTP protein expression in the brain increased in the Purkinje and hippocampal neurons of patients with Alzheimer’s disease,

Down’s syndrome and AVED [153]. A number of studies showed that vitamin E levels were significantly lower in the plasma [186-188] and cerebrospinal fluid

[189, 190] of AD patients as compared to healthy individuals. Furthermore, in mouse models of AD, vitamin E supplementation followed by injection of the Aβ peptide [191, 192] attenuated Aβ-induced lipid peroxidation, plaque formation, and subsequent neurotoxicity. The effect of tocopherol appears to be a protective mechanism because tocopherol administration after plaque formation did not reverse the senile plaques [193]. Taken together, this suggests that vitamin E is efficacious in prevention of disease. These data strongly supports the hypothesis that TTP, by regulating tocopherol status, is a critical mediator of neuronal integrity, function and protection from oxidative stress.

Statement of purpose It has been appreciated for almost a century that vitamin E is an essential micronutrient. The ability of vitamin E to prevent oxidative stress by scavenging free radicals and thus attenuate lipid peroxidation designates vitamin E as the major lipid soluble antioxidant in humans. Consequently, vitamin E supplementation has been efficacious in oxidative stress-related diseases, including neurodegenerative diseases, diabetes, and cardiovascular disease.

However, our understanding of how the localization of vitamin E and its carrier protein— tocopherol transfer protein (TTP), affects function are not completely elucidated. My thesis aims to 1) extend knowledge of vitamin E trafficking events in hepatocytes, 2) provide insight into the regulation of TTPA transcription, 3) determine vitamin E levels in disease models associated with oxidative stress and fat mal-absorption and 4) localize vitamin E and TTP in the central nervous system.

Chapter 2 Altered vitamin E Status in Niemann-Pick type C Disease L. Ulatowski1, R. Parker2, C. Davidson3, N. Yanjanin4, T. J. Kelley5, D. Corey5, J. Atkinson6, F. Porter4, H. Arai7, S. U. Walkley3 & D. Manor1,8

Departments of Nutrition1, Pediatrics5, and Pharmacology8, School of Medicine, Case Western Reserve University, Cleveland, OH 44106; Division of Nutritional Sciences2, Cornell University, Ithaca, NY 14853; Department of Neuroscience3, Rose F. Kennedy Center for Research in Mental Retardation and Human Development, Albert Einstein College of Medicine, Bronx, NY 10461; Program in Developmental Endocrinology and Genetics4, Eunice Kennedy Shriver National Institute of Child Health and Human Development, NIH, DHHS, Bethesda, MD 20892; Department of Chemistry6, Brock University, St. Catharines, Ontario, L2S 3A1, Canada; Department of Health Chemistry7, The University of Tokyo, Tokyo 113-0033, Japan.

Published: Ulatowski, L., et al., Altered vitamin E status in Niemann-Pick type C disease. J Lipid Res, 2011. 52(7): p. 1400-10.

Abstract Alpha-tocopherol is the major lipid-soluble antioxidant in many species.

Niemann-Pick type C (NPC) disease is a lysosomal storage disorder caused by mutations in the NPC1 or NPC2 genes, which regulate lipid transport through the endocytic pathway. NPC disease is characterized by massive intracellular accumulation of unesterified cholesterol and other lipids in lysosomal vesicles.

We examined the roles that NPC1/2 proteins play in the intracellular trafficking of tocopherol. Reduction of NPC1 or NPC2 expression or function in cultured cells caused a marked lysosomal accumulation of vitamin E in cultured cells. In vivo, tocopherol significantly accumulated in murine Npc1-null and Npc2-null livers,

Npc2-null cerebella, and Npc1-null cerebral cortices. Plasma tocopherol levels were within the normal range in Npc1-null and Npc2-null mice, and in plasma samples from human NPC patients. The binding affinity of tocopherol to the purified sterol-binding domain of NPC1 and to purified NPC2 was significantly weaker than that of cholesterol (measurements kindly performed by R. Infante,

University of Texas Southwestern, Dallas, TX). Taken together, our observations indicate that functionality of NPC1/2 proteins is necessary for proper bioavailability of vitamin E, and that the NPC pathology might involve tissue- specific perturbations of vitamin E status.

Introduction Niemann-Pick type C (NPC) disease is a heritable lysosomal storage disorder, in which the intracellular transport of lipids is perturbed ({Brady, 1997 #11640}). The cellular phenotype of NPC disease is massive accumulation of cholesterol and other lipids in membranous organelles derived from late endosomes and lysosomes [26, 194-196]. Since the ‘trapped’ cholesterol is not metabolically available, various regulatory pathways sense an apparent shortage, and, paradoxically, de-novo synthesis is increased, further exacerbating the situation

[197, 198]. Although dysregulated lipid processing occurs in most organ systems of NPC patients, the primary pathology they present is localized to the central nervous system, in the form of progressive neurodegeneration. Specifically, NPC patients suffer from motor and coordination dysfunctions, seizures, and cognitive impairments that typically present during the first decade of life. NPC disease is fatal, and most patients succumb to it before reaching teen age (e.g.[199]).

Intensive investigations in the recent two decades lead to the development of diverse therapeutic intervention strategies, most of which aim to repair the imbalance in specific lipids or metabolites (cf. [200]). To date, however, only limited clinical benefit was achieved, at best leading to stabilization of clinical symptoms (e.g. [201]). The molecular culprits underlying NPC disease have been shown to be loss-of-function mutations in either NPC1 or NPC2 proteins, which reside in the lysosomal limiting membrane or lumen, respectively [202-

205]. Although the precise mechanisms of action of these proteins are not fully understood, it is generally accepted that NPC1 and NPC2 function in sequence in removing free cholesterol from the lysosomal lumen to the cytosol [206-211].

While NPC-affected lysosomes accumulate large amounts of free cholesterol, intracellular transport of glycosphingolipids, sphingomyelin and sphingosine is also severely perturbed (cf. [212]). Which of these trapped molecules (or their metabolites) is the metabolic root for the NPC pathology is presently unknown

[212].

It is interesting to note that common pathological and biochemical hallmarks are shared by NPC disease and deficiency in the dietary antioxidant vitamin E. First, in both cases, the major site of dysfunction is the CNS, and the major clinical presentation is cerebellar ataxia [127, 213, 214], accompanied by specific injury to cerebellar Purkinje neurons [215, 216]. Secondly, axonal spheroids (focal swellings) are frequently observed in both NPC disease [217] and in vitamin E deficiency [149, 218, 219]. Similarly, pronounced hypomyelination is characteristic of advanced-stage disease in both cases [220, 221].

Finally, modest supplementation with vitamin E was reported to result in a mild improvement in motor performance in a mouse model of NPC disease [222]. On the cellular level, it has been established that uptake of vitamin E occurs via endocytosis [33, 45], and that a significant portion of the vitamin is found in lysosomes [223]. In light of these observations, we hypothesized that proper intracellular trafficking of vitamin E (and in turn, adequate antioxidant protection) depends on timely egress from the lysosome, and therefore on the functionality of NPC1/2. We describe here our findings regarding α-tocopherol status in cells that express defective alleles or reduced expression of NPC1/2, in various

40 tissues from mice in which expression of NPC1/2 is disrupted, and in plasma from human NPC patients.

Materials and Methods Cell culture. Human fibroblasts harboring the p.P237S and p.I1061T missense mutations in the NPC1 gene were obtained from Coriell Cell Repository

(GM03123; Camden, NJ) and grown in Eagle’s minimum essential medium with

Earle’s salts, 2 mM L-glutamine and 15% fetal bovine serum at 37°C and 5%

CO2 [224]. Control human fibroblasts (CRL-2076) were obtained from American

Type Culture Collection (Manassas, VA). Immortalized human hepatocytes (IHH,

[225, 226]) were a generous gift from R. Ray, Saint Louis University, St. Louis,

MO) and were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% calf serum. Lentiviral shRNA constructs targeted against human NPC1, human NPC2 and a control shRNA in the pLKO vector (Open

Biosystems, Huntsville, AL) were transfected into HEK293T cells using

Lipofectamine-Plus (Invitrogen, Carlsbad, CA). Culture media were harvested 24 and 48 hours post-transfection, pooled, and pelleted by centrifugation at 100,000 x g for 1.5 hours. The pellet was re-suspended in PBS and used for polybrene- mediated (4 μg/ml) transduction of IHH cells using standard protocols. Stable knock-down clones were selected in media supplemented with puromycin (10

μg/ml, Sigma Chemical Co., St. Louis, MO) 48 hours after transduction. Knock- down efficiency was evaluated by immunoblotting using antibodies raised against

NPC1 (Abcam, Cambridge, MA) or NPC2 (generous gift of Peter Lobel, Rutgers

University, Rutgers, NJ). For evaluating the endogenous expression levels of the

41 alpha-tocopherol transfer protein (TTP), samples were immunoblotted using the

AE85 anti-TTP antibody (H. Arai).

Disease models. The Npc1-/- mice (BABLc/NPCnih) were originally described in

[202] and the Npc2-/- mice were described in [227]. Human serum samples were collected from NPC1 patients and healthy age-appropriate unaffected subjects under a clinical protocol (06-CH-0186) approved by the NICHD Institutional

Review Board. Both consent and assent, if appropriate, were obtained. Serum samples were de-identified and maintained at -80 degrees.

Fluorescence microscopy. Cells were plated on poly-L-lysine coated glass cover slips in 24-well tissue culture plates. NBD-cholesterol (Invitrogen) and

NBD-tocopherol [122, 123] were complexed to serum lipoprotein as described earlier [228], [33] and added to the culture media to a final concentration of 20

μM and incubated for 17 hours at 37°C. The fluorescent lipid was ‘chased’ by incubation in normal media for 3 more hours. Cells were fixed for 20 min. in

3.7% paraformaldehyde and mounted in SlowFade Gold antifade reagent

(Invitrogen) prior to imaging on a confocal or inverted fluorescence microscope

(Zeiss LSM 510 and Leica DMI 4000B, respectively). For quantitation of accumulated fluorophores, ten microscopic images were captured under identical conditions, each containing 30-60 cells. Fluorescence intensities were quantitated using Image J software (http://rsbweb.nih.gov/ij/index.html). The

RGB image was converted to an 8-bit image and a common threshold set for all images. For co-localization studies, LysoTracker Red DND-99 (75 nM,

Invitrogen) was added 30 minutes prior to fixing. For visualization of free

42 cholesterol, fixed and permeablized cells were incubated with filipin

(Streptomyces filipinensis, Sigma Chemical Co. St. Louis MO; 25 μg/ml) for 1 hour at room temperature in the dark, prior to washing in PBS and visualization.

Analytical determinations. Total cholesterol: Cells were harvested, resuspended in PBS and lysed by repeated passing through a 22-gauge needle.

Total cholesterol was measured using the Amplex Red Cholesterol Assay kit

(Invitrogen) according to manufacturer’s protocol. Fluorescence was excited at

530 nm and emission was collected at 590 nm on a Tecan GENios Pro plate reader (Tecan, Durham, NC). Total cholesterol was normalized to total protein, as determined by the Bio-Rad protein assay kit. Tocopherols and free cholesterol: Serum and appropriate tissues from Npc1-/- and Npc2-/- mice and their wild-type littermates were freshly-excised and flash-frozen as described previously [200]. Lipids were extracted, silylated, and analyzed by gas chromatography mass spectrometry (GC-MS) on a Hewlett-Packard 6890 gas chromatograph coupled to a Hewlett-Packard 5872 mass selective detector operated in selected ion mode as previously described [63]. Deuterated alpha- tocopherol added prior to extraction served as an internal standard. Monitored masses of trimethylsilyl ethers (TMS) were 511.6 (d9-alpha-tocopherol-TMS),

502.6 (d0-alpha-tocopherol-TMS), 488.6 (d0-gamma-tocopherol-TMS) and 458.7

(cholesterol-TMS). A previously determined detector response correction factor was applied in quantitation of cholesterol. Tocopherol and unesterified cholesterol concentrations were normalized to tissue wet weight.

Binding of tocopherol to purified NPC1 and NPC2. The affinity of α-tocopherol to the purified NPC1/2 proteins was measured by Rodney Infante and Joseph

Goldstein at the University of Texas, SouthWestern, using a published assay based on competition with radio-labeled cholesterol [207]. Briefly, 4 pmol purified sterol binding domain (NTD) of NPC1, or 8 pmol purified full-length NPC2 were incubated overnight with 130 nmol [3H]-cholesterol at 4°C. The proteins were then incubated with 6 μM unlabeled competitor (cholesterol, epicholesterol, 25- hydroxycholesterol or dl- tocopherol), and protein-bound radioactivity was measured after affinity chromatography with nickel-agarose and scintillation counting.

Statistical analyses. Statistical significance of data was determined using unpaired Student’s t-test. P values < 0.05 were taken as the threshold of significance. Data were analyzed and graphed using the IgorPro software package (Wavemetrics, Inc. Portland, OR).

Results Alpha-tocopherol accumulates in NPC-affected fibroblasts. The NPC1 and

NPC2 proteins are residents of the lysosome that are required for proper transit of cholesterol through the endocytic pathway [205, 229]. Given that sphingomyelin, glycosphingolipids, and phospholipids also accumulate in NPC- affected lysosomes [194, 230-233], we hypothesized that NPC1/2 proteins participate in the endocytic processing of the lipid-soluble antioxidant α- tocopherol (vitamin E). To visualize the intracellular trafficking of α-tocopherol, we utilized NBD-tocopherol, a fluorescent analog that we previously characterized in

44 vitro [122, 123, 136, 234] and in vivo [33, 156]. Using fluorescence microscopy, we visualized the accumulation of NBD-tocopherol in cultured fibroblasts isolated from an NPC-affected patient (harboring the c.709C>T and c.3182T>C substitutions in the NPC1 gene), and control fibroblasts. As shown in Figure 2.1, control fibroblasts retain very little NBD-tocopherol. However, NPC-fibroblasts accumulate much higher (ca. 3-fold) levels of the fluorescent vitamin, appearing in a punctate, perinuclear distribution pattern. These observations indicate that egress of α-tocopherol from the endocytic compartment require a functional

NPC1 protein.

Generation and characterization of NPC1 and NPC2 ‘knock-down’ hepatocyte cell lines. Although genetic defects in NPC1 and NPC2 lead to severe accumulation of cholesterol in the liver [235], no hepatocyte cell culture model is presently available to study the disease. We therefore generated lentiviruses that encode shRNAs against the human NPC1 and NPC2 transcripts, and used these reagents to generate HPV-immortalized human hepatocytes

(IHH; [225]) in which the expression of NPC1 or NPC2 is stably disrupted. As shown in Figure 2.2A, expression of NPC1 and NPC2 in the stable ‘knock-down’ cell lines is reduced by ~50% and 90%, respectively, as compared to IHH cells which express a control shRNA. Since egress of α-tocopherol from the liver depends on the hepatic tocopherol transfer protein (TTP) [33, 44], we examined whether expression levels of TTP are altered in NPC1/2 knock-down cells.

Immunoblotting with anti-TTP antibodies revealed that expression levels of TTP in these cells is comparable to the levels observed in control IHH cells (data not

45 shown). As altered intracellular distribution of cholesterol is the cellular hallmark of NPC disease [235], we examined the levels and intracellular distribution of cholesterol in the NPC1/2 ‘knock-down’ cells. Figure 2.2B shows the amount of total cholesterol retained in these cells, as determined by the Amplex Red colorimetric assay kit. In both shNPC1 and shNPC2 cells, total cellular cholesterol was increased by approximately 2-fold as compared to control cells.

To examine the effects of NPC1/2 on the intracellular distribution pattern of cholesterol, we employed the fluorescent fungal macrolide filipin, which selectively binds to free (unesterified) cholesterol in membranes [236], and is a primary tool for diagnosing NPC disease [194, 237]. In control IHH cells, filipin fluorescence outlined free cholesterol exclusively in the cells’ plasma membranes

(Figure 2.2C, left panel). In shNPC1 and shNPC2 cells, however, filipin-staining pattern was markedly different: First, intensity of the fluorescence signal was much higher as compared to control cells, indicating significant accumulation of free cholesterol. Second, filipin staining was seen primarily within the hepatocytes, in a punctate, peri-nuclear pattern (arrows in center and right panels of Figure 2.2C). This pattern is essentially identical to the lysosomal accumulation of free cholesterol in other NPC1/2 cell types [224, 227]. Finally, we examined the intracellular fate of cholesterol that was taken up through endocytosis. Toward this end, we monitored the uptake of the fluorescent analog

NBD-cholesterol [238-241] that was pre-complexed to serum lipoproteins. shNPC1 and shNPC2 cells accumulated significantly higher levels (ca. 3-fold) of

NBD-cholesterol compared to control hepatocytes (Figure 2.2D).Taken together,

46 these results indicate that hepatocytes with disrupted expression of NPC1 or

NPC2 display the established lipid-trafficking defects that characterize NPC disease. Therefore, we conclude that the stable shRNA IHH cell lines are an appropriate model system for investigating the roles of NPC proteins in the intra- hepatocyte trafficking of lipids, including vitamin E.

Disrupted expression of NPC1/2 causes lysosomal accumulation of vitamin

E in IHH cells. To examine the involvement of NPC proteins in trafficking of α- tocopherol, we ‘loaded’ the different IHH cell-lines with serum-complexed NBD- tocopherol and examined accumulation of the vitamin using fluorescence microscopy. As shown in Figure 2.3A, NBD-tocopherol was efficiently taken up by the cells, and concentrated in a vesicular, peri-nuclear compartment, reminiscent of our previous observations in human HepG2 and rat McARH-7777 hepatocytes [33, 156]. We quantitated fluorescence intensity in images from three independent experiments, and found that cells with reduced expression of either NPC1 or NPC2 accumulated ca. 2-fold more NBD-tocopherol as compared to control cells. Next, we utilized confocal fluorescence microscopy to determine the intracellular compartment in which NBD-tocopherol accumulates. As shown in Figure 2.3C, the intracellular distribution pattern of NBD-tocopherol co- localized with that of LysoTracker, an established marker of the late endocytic / lysosomal compartment [242, 243]. We conclude that functionality of NPC1 and

NPC2 is required for the egress of endocytosed vitamin E from the endocytic compartment. Furthermore, under conditions of NPC1/2 impairment, the majority

47 of tocopherol accumulates in lysosomes, in a pattern similar to that of NBD- cholesterol.

Tocopherol is a poor ligand for NPC1 and NPC2. To gain insights into the molecular mechanisms by which NPC1/2 affect tocopherol trafficking, we directly measured the binding affinity of these proteins for α-tocopherol. Toward this end, we examined the efficacy of vitamin E in competing with [3H]-cholesterol for binding to purified NPC2, or to purified recombinant sterol binding domain of

NPC1 (residues 1-240) [207, 209]. Under saturating conditions (tocopherol: binding site molar ratio = 1000) α-tocopherol was able to displace only 30% and

50% of the [3H]-cholesterol bound to NPC2 and NPC1, respectively (Figure 2.4), whereas unlabeled cholesterol displaced >85% of the bound ligand. These results indicate that the affinity of α-tocopherol to NPC proteins is 2-3 orders of magnitude weaker than that of cholesterol. These in vitro findings are put into physiological perspective when appreciating that in vivo, concentrations of cholesterol are 100- to 1000-fold higher than those of α-tocopherol [244], and this ratio is likely higher in lysosomes [245]. These considerations suggest that α- tocopherol is not likely to occupy a significant fraction of the NPC1 / NPC2 binding pockets in lysosomes of intact cells. Thus, we conclude that the accumulation of α-tocopherol observed in the NPC-defective cells is likely an indirect effect, secondary to the significant build-up of lipids and the extensive structural reconfiguration of the late endocytic compartment. This conclusion is consistent with reports regarding other lipids that do not directly bind to NPC1 or

NPC2, but accumulate under NPC1 or NPC2 loss-of-function [211, 246],[247].

Vitamin E status in NPC-affected mice. To examine the involvement of NPC proteins in the status of vitamin E in vivo, we employed GC-MS to determine the tocopherol content in extracts from plasma, livers and brains of Npc1-/- and

Npc2-/- mice [227]. To frame our findings in the context of overall lipid status, we also determined the free cholesterol content of these extracts. In the liver, both cholesterol and tocopherol accumulated in NPC-affected mice to higher levels than in wild-type animals. Specifically, hepatic concentrations of cholesterol increased by 10- and 6-fold in the livers of 12-week old Npc1-/- and

Npc2-/- mice, respectively (Figure 2.5A). These values are similar to the hepatic values reported earlier for these model [227, 235],[233, 248]. Analyses of vitamin E content revealed that hepatic levels of tocopherol also increased in

12-weeks old NPC-affected mice, albeit to a lesser degree (Figure 2.5A). Since vitamin E shares with cholesterol many common uptake and transport steps, it is instructive to present the concentration values also as tocopherol: cholesterol mole ratios (see [249, 250] for detailed discussion). As seen in Figure 5E, the tocopherol:cholesterol ratio is significantly decreased in NPC-affected livers.

Thus, while NPC-affected livers accumulated both lipids, hepatic accumulation of cholesterol exceeds that of tocopherol by >5-fold. As a result, the effective disruption in hepatic vitamin E status caused by NPC is actually more severe than appears at first sight. Mechanistically, such disproportionate accumulations of the two lipids are likely to reflect additional, vitamin E- specific routes of egress from the endocytic pathway that are not shared by cholesterol.

The existence of such secretion pathways is supported by the rapid turn-over of

49 hepatic tocopherol in plasma (approximately 1 hepatic pool per day) [25], and by our observations that in cultured hepatocytes, some NBD-tocopherol co- localizes with the rapidly recycling, transferrin-positive compartment (J. Qian and D. Manor, unpublished results).

We also found that expression levels of TTP did not differ among the wild-type,

Npc1-/-, and Npc2-/- mice (Figure 2.5D). We conclude that accumulation of tocopherol in NPC-affected mice does not stem from altered TTP expression, but rather, is a consequence of impairment in the function of NPC1/2 proteins.

In the cortex, we observed a significant (40-50%) decrease in the content of tocopherol as well as cholesterol in 12-week old Npc1-/- mice (Figure 2.5B). We attribute this decrease to the severe hypomyelination of the cortex that accompanies NPC disease [217, 227, 251], and note that both cholesterol and tocopherol are important constituents of myelin [252-254], and that vitamin E deficiency causes hypo-myelination [255-257]. In the cerebellum, the only statistically significant difference was observed in 12-week old Npc2-/- mice, which exhibited a ~30% increase in the content of tocopherol as well as cholesterol, as compared to wild-type animals (Figure 2.5C). No significant differences in tocopherol or cholesterol content were observed in Npc1-/- mice, although the fractional lipid content (mole ratio) of tocopherol was slightly increased (Figure 2.5G). This could be explained by the fact that lipid accumulation is balanced by lipid loss that accompanies neurodegeneration in this tissue [200, 252, 258, 259].

Plasma tocopherol and cholesterol levels in NPC-affected mice and humans. Figure 2.6 shows the concentrations of tocopherol and cholesterol in plasma samples from Npc1-/-, Npc2-/-, and wild-type mice. In agreement with published reports [197], plasma cholesterol values of Npc1-/- mice were not significantly different from wild-type animals (Figure 2.6A). Similarly, plasma vitamin E levels were unchanged in Npc1-/- mice (Figure 2.6B). In 12-week old

Npc2-/- mice, however, plasma levels of both cholesterol and tocopherol were elevated by approximately 30%. Unlike in other tissues, however, the increase in the two lipids was essentially identical, such that the tocopherol:cholesterol ratio did not differ among the different mouse models (Figure 2.6C).

Lastly, we analyzed the plasma levels of tocopherol in a cohort of 45 NPC1 patients and 20 age-appropriate control subjects. Total cholesterol levels in plasma samples from NPC patients were <200 mg/dL, i.e. within the normal range for adults as defined by the American Heart Association (1988 ). These values are similar to those reported previously for NPC1 patients [260].

Importantly, plasma levels of α-tocopherol and the most prevalent vitamin E form in the US diet, α-tocopherol, were within the clinically normal range (12-

50 μM; [249]). Figures 7A and 7B show the concentrations of α- and γ- tocopherol, respectively, after normalization to plasma cholesterol levels. Taken together, our data indicate that although NPC-affected cells and tissues show significant alterations in the status of vitamin E and cholesterol, plasma levels were not affected in NPC-affected mice and humans.

Discussion Niemann-Pick type C disease is a debilitating, fatal disorder in which intracellular lipid transport is impaired due to loss-of-function mutations in the NPC1 or NPC2 proteins. The main biochemical phenotype associated with NPC disease is accumulation of unesterified cholesterol and other lipids in a vesicular compartment of an endosomal / lysosomal origin. A number of metabolic scenarios can be envisioned to be at the root of the NPC pathology. First, the extensive localized accumulation of lipids may be toxic, thereby compromising cell function and viability. Second, since the affected lipids are ‘sequestered’ away from their proper sites of action, the affected cell may experience a catastrophic deficiency of these metabolites. Lastly, physical disruption of the endocytic compartment may deprive the cell of other molecules that rely on this pathway for cellular transport. Despite intense research efforts in the past 50 years, many questions regarding the etiology of NPC disease remain unanswered. Thus, it is still not known which of scenarios described above is of highest significance during disease progression. Similarly, it has not been conclusively determined which of the lipids sequestered in NPC lysosomes is the primary ‘culprit’ responsible for the NPC pathology (see ([212]) for discussion).

Moreover, the detailed biochemical mechanisms of action of the NPC1 protein are still enigmatic.

The neurological hallmarks of NPC disease share striking similarity to those presented during vitamin E deficiency. On the clinical level, the primary presentation of both diseases is ataxia, reflecting selective injury of cerebellar

Purkinje neurons. On the microscopic level, the two pathologies share the

52 presence of axonal swellings (spheroids) and hypomyelination. These associations raise the possibility that oxidative stress is a significant factor contributing to the etiology of NPC disease. Indeed, NPC-affected cells exhibit mitochondrial dysfunctions [261], increased expression of ROS-producing and oxidative stress-responsive genes [262] and elevated plasma levels of oxidized cholesterol [263]. Recent studies demonstrated that plasma samples from human

NPC patients exhibit compromised ex-vivo antioxidant capacity [264]. Our findings confirm and extend these observations with regards to the lipophilic antioxidant vitamin E. We show here that tocopherol is sequestered in vesicles of lysosomal origin in NPC-affected fibroblasts and hepatocytes. Furthermore, we show that vitamin E status is perturbed in brains and livers of Npc1-/- and Npc2-/- mice. Thus, it is possible that imbalance in vitamin E status is contributing to the progression of NPC disease, and, conversely, that supplementation with μ- tocopherol may benefit those afflicted with this disorder. Although vitamin E supplementation was reported in Npc1-/- mice [222], the measured end-points were limited, and no study of such supplementation has been reported in human patients.

It is important to note that concentrations of vitamin E in plasma samples from NPC-affected mice and humans were not significantly different from those of healthy controls. The immediate implication of these findings is that plasma tocopherol concentrations do not reflect vitamin E status in tissues and cells, and are thus of limited clinical use. This is not the first time such a concern is raised.

Sokol et al. studied a small pediatric cholestasis cohort and found that in some

53 cases vitamin E deficiency occurs in the presence of ‘normal’ plasma tocopherol levels [28]. On the mechanistic level, these findings may be explained by the presence of homeostatic mechanisms that maintain constant circulating levels of tocopherol, despite severe localized perturbations in specific tissues and cells, similar to the regulation of plasma cholesterol. On the practical level, these observations raise the urgent need for an adequate biomarker that reflects tissue vitamin E status. Since analysis of the NPC-affected affected tissue is impractical, a sensitive circulating indicator of oxidative stress may be the appropriate biomarker in this case. Circulating unsaturated lipid peroxidation products such as HETEs and isoprostanes [265, 266], and hydroxylated cholesterol metabolites [263] may serve as the proper biomarker for these purposes. Clearly, there is a dire need to better define and optimize the most suitable plasma marker for oxidation status, and to streamline its applicability for routine clinical use.

Our data indicate that CNS tocopherol status is adversely affected in NPC disease. In light of the relative ease, low cost, and lack of ill effects associated with moderate vitamin E supplementation, our observations support the design of a clinical trial in which the clinical benefit of vitamin E supplementation will be assessed in NPC patients.

Footnotes

 This work was supported by NIH awards DK067494 to DM and HD045561

to SJW, a Bench-to-Bedside award from the Office of Rare Diseases of

the NIH to FP, and the Intramural Research Program of NICHD at NIH

(FP). NY has been supported by the Ara Parseghian Medical Research

Foundation and Dana Angel's Research Trust.

 We thank TY Chang, Laura Liscum, Peter Lobel, and members of their

labs for invaluable advice and reagents. We thank the Hadley Hope Fund

and Ed Cutler (Phlebotomy Services International) for their assistance in

obtaining samples from control subjects. We would also like to

acknowledge the contribution of the caretakers and patients who have

participated in this study.

Chapter 2 Figures

Figure 2.1 NBD-tocopherol accumulates in human NPC1 fibroblasts. Indicated fibroblasts were incubated with serum-complexed NBD-tocopherol overnight and ‘chased’ in normal growth media for 3 hours. Fixed cells were imaged by fluorescence microscopy. A. Representative fluorescence micrographs. Magnification: 60X. B. Quantitation of fluorescence intensity of 10 images, each including at least 30 cells. Asterisks denote significant difference (p> 0.05) from control shRNA cells, as determined by student’s t-test.

Figure 2.2 Characterization of human hepatocytes stably expressing shRNAs to NPC1 or NPC2. IHH cells expressing the indicated shRNA were generated by lentiviral transduction and antibiotic selection as detailed in Materials and Methods. A. Expression of NPC1 and NPC2 was examined by Western blotting in lysates from the indicated sub- lines. B. Cellular content of total (esterified plus free) cholesterol in the different sub-lines was measured using the Amplex Red kit. Shown are averages and standard deviations of 3 independent experiments. C. Content and distribution of unesterified cholesterol were determined by filipin staining. Note that in control cells, free cholesterol is localized exclusively to the plasma membrane, whereas shNPC sub-lines exhibit pronounced intracellular accumulation, appearing as perinuclear vesicles (white arrows). Scale bar = 10 μm. D. Accumulation of NBD-cholesterol was examined after overnight loading with serum-complexed NBD-cholesterol as described in Materials and Methods. Ten fluorescent images, each containing 40-60 cells, were digitized and fluorescence intensity determined using Image J software. Asterisks in 2B and 2D denote significant difference (p> 0.05) from control shRNA cells, as determined by student’s t-test.

Figure 2.3 Intracellular accumulation of NBD-tocopherol in shNPC1 and shNPC2 IHH cells. Cells were ‘loaded’ with NBD-tocopherol as described in Materials and Methods, and intracellular distribution of the vitamin was examined using fluorescence microscopy. A. Representative NBD-fluorescence images. B. Accumulation of NBD- tocopherol. Cells were loaded with NBD-tocopherol, and fluorescence intensity was measured as described in Materials and Methods. Asterisks denote significant difference (p> 0.05) from control shRNA cells, as determined by student’s t-test. C. Confocal fluorescence micrographs showing co-localization of NBD-tocopherol (green) with the lysosomal marker LysoTracker (red).

Figure 2.4 Binding of vitamin E to NPC1/2 in vitro. Binding of radiolabeled cholesterol to the purified proteins was measured in the presence of the indicated competitors as described in Materials and Methods. CHOL-cholesterol; EPI-epicholesterol; 25HC-25- hydroxycholesterol; TOH- dl-α-tocopherol. Shown are averages and standard deviations of three experiments. See ([207]) for details.

Figure 2.5 Tocopherol and unesterified cholesterol content in tissue extracts from Npc1 -/-, Npc2 -/- and wild-type mice. Analytes were measured using GC-MS as described in Materials and Methods. A: liver, B: cerebral cortex, and C: cerebellum. Shown are averages and standard deviations (n=3). Asterisks denote significant difference (p<0.05) compared to age-matched controls, determined by Student’s t-test. D: Expression levels of the alpha tocopherol transfer protein in livers of the different mouse models. Expression levels were evaluated by anti-TTP Western blotting of soluble extracts prepared from three animals of the indicated genotypes.

Figure 2.6 Plasma tocopherol levels are normal in Npc1 -/- and Npc 2-/- mice and NPC-affected humans. Tocopherol and cholesterol levels were measured in plasma samples of the indicated mouse models using GC-MS as described in Materials and Methods. Shown are averages and standard deviations (n=3). Asterisks denote significant difference (p<0.05) compared to age-matched controls, determined by Student’s t-test.

Figure 2.7 Plasma vitamin E: cholesterol ratios are normal in human NPC1 patients. Plasma was collected from 45 NPC1 patients and 20 healthy age-appropriate controls, and concentrations of α-tocopherol (A) and γ-tocopherol (B) as well as unesterified cholesterol were determined using GC-MS as described in Materials and Methods. Data are represented in a box plot, in which the horizontal line designates the median value, separating the upper and lower quartiles. The “whiskers” show the maximum and minimum spread of the data.

Chapter 3 To be submitted April 2012

Transcriptional Regulation of the Alpha Tocopherol Transfer Protein in Hepatocytes Lynn Ulatowski1, Cara Dreussi1, Jill Barnholtz-Sloan3 and Danny Manor1,2. Departments of Nutrition1, Pharmacology2 and Epidemiology and Biostatistics3, School of Medicine, Case Western Reserve University, Cleveland, OH, USA.

Keywords: tocopherol, oxidative stress, single nucleotide polymorphism

Abstract: Vitamin E (tocopherol) is the major lipid soluble antioxidant in most animal species. Despite the well-documented role of tocopherol transfer protein in maintaining normal tocopherol status, the mechanism(s) that regulate TTPA gene expression are unknown. We report that chemical agonists of the PPARα,

RXR and CREB transcription factors, as well as hydrogen peroxide and a hypoxic mimetic, increase expression of the TTPA gene by 2-5-fold in immortalized human hepatocytes. Our data indicate that a ‘rapid-acting’ transcription factor regulates the transcription of the TTPA gene in response to oxidative stress. We cloned a 2 Kb proximal segment of the human TTPA promoter, and demonstrate that distinct regions elicit transcriptional repression and activation. Finally, we report that single nucleotide polymorphisms (SNPs) that are commonly found in the TTP promoter region in humans dramatically affect the transcriptional activity of this region. These results may explain the variable responses to vitamin E supplementation in human clinical trials. Our findings imply that the oxidative stress-induced and SNP-associated transcriptional regulation of TTP likely contributes to vitamin E status in humans.

Introduction Vitamin E is a collective name for a family of neutral plant lipids (tocols), of which

RRR--tocopherol (tocopherol) is selectively retained in the body and hence is considered the most biologically active form. Tocopherol’s characteristic hydrophobicity, localization in cell membranes and ability to scavenge free radicals, generated from polyunsaturated fatty acid oxidation, define tocopherol as the major lipid-soluble antioxidant. Thus, low vitamin E levels are associated with many oxidative stress-related diseases, including Alzheimer’s Disease (AD),

Downs syndrome (DS), cardiovascular disease, diabetes, and ataxia.

By virtue of its lipophilic nature, tocopherol requires a transporter to facilitate its movement in the aqueous milieu of the cytosol. Indeed, it is established that the hepatic alpha tocopherol transfer protein (TTP) specifically binds tocopherol with high affinity. Additionally, TTP facilitates vitamin E transport between intracellular membrane vesicles aiding in tocopherol’s incorporation into circulating lipoproteins [33, 120, 124, 135, 136]. As a result, TTP regulates whole-body tocopherol status. The critical function of TTP is underscored by the observation that that heritable mutations in the TTPA gene result in the syndrome ataxia with vitamin E deficiency (AVED; OMIM #600415), characterized by progressive spinocerebellar ataxia and very low serum tocopherol levels. Despite the well- documented role of TTP as an indispensable protein in maintaining normal tocopherol levels, the mechanism(s) that control TTPA transcriptional activity are unknown.

The expression profile of TTP is extremely tissue-specific. TTP mRNA and protein are highly expressed in the liver, and to a lesser but significant extent in the cerebellum and prefrontal cortex of the brain, as well as in the kidney and lung [137, 138]. Several studies demonstrate TTP expression in mouse and human placental trophoblasts as well as the mouse uterus [139-142], suggesting TTP functions to regulate delivery of tocopherol to the developing embryo. Further support of tissue specificity is demonstrated in the BioGPS database results for TTPA/TtpA expression showing variable mRNA levels across many anatomical regions

(http://biogps.gnf.org/#goto=genereport&id=7274). However, information regarding regulation of TTP gene expression is inconclusive and incomplete.

The majority of studies that address whether TTP is regulated focus on TTP’s relationship with tocopherol. Recent work from our lab demonstrates that tocopherol treatment can increase TTP levels in hepatocytes by protecting the protein from degradation [158]. Additionally, tocopherols ability to prevent proliferation of prostate cancer cells is associated with the TTP protein levels

[267 ]. In rats fed a vitamin E deficient diet there was a decrease in TTP protein expression reported. Consistent with our results, these authors suggest tocopherol protects TTP from degradation [157]. Conversely, other studies report no effect of vitamin E status on expression levels of TTP protein [159,

160]. However, the altered TtpA mRNA levels in vitamin E deplete [268] and replete [159] rats imply a transcriptional regulatory mechanism of TTP. Studies

65 investigating the effect of the oxidative environment on TTP expression also report inconclusive results. Hyperoxia results in a decrease of TtpA mRNA expression [161] in rat livers, while oxidative stress from environmental smoke does not change mouse hepatic TTP protein [160]. Using Fullerene C60 to induce oxidative stress in zebrafish results in a 3-fold increase in TTP gene expression [162]. Taken together, there is evidence that tocopherol and oxidative stress may regulate TTP expression; however, the data are inconsistent. The purpose of this study is to investigate the molecular-level transcriptional control of TTPA. We present our results that suggest TTP gene expression is regulated at various levels, including chemical modulation, common SNP variations, and oxidative stress. Understanding the molecular- level regulation of TTP provides insight into how environmental and genetic factors affect TTP expression and, in turn, the status of the major lipid-soluble antioxidant vitamin E.

Materials and Methods Cell lines. Immortalized human hepatocytes (IHH), a generous gift from R. Ray,

St. Louis University, St. Louis, MO were described in [226]. IHH cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% calf serum (Hyclone Laboratories, Logan, UT).

Treatments and RNA harvest. To identify chemical modulators of TTPA mRNA, IHH cells were treated with the following conditions and chemicals: 4 hours with 1 μM GW072 (a PPARδ agonist) , 1 μM WY14643 (a PPARα agonist),

1 μM TNFα, 1 μM Troglitazone (a PPARγ agonist) , 1 μM 9-cis retinoic acid, 1 μM

66 all trans retinoic acid or 0.5mM 3-isobutyl-l-methylxanthine (IBMX); 24 hours with

200 μM desferrioxaminemesylate (DFX; a hypoxic mimetic [269]); 3 hours with

200 μM hydrogen peroxide; 16 hours with 1 μM dexamethasone or 100 μM d-α- tocopherol (Acros Organics, NJ), 30 minutes with 2.5 μM and 10 μM Bay 11-

7085 (a NF-κB inhibitor) . RNA was harvested with Trizol reagent (Invitrogen,

Grand Island, NY) and reverse transcribed using High Capacity cDNA Reverse

Transcription Kit (Applied Biosystems, Foster City, CA). Taqman expression assays for Fam- labeled TTPA (Hs00609398_m1), MT1A (Hs00831826_s1) and

18s (Hs99999901_s1) were used in combination with Fast Universal PCR

Master Mix (Applied Biosystems) in a 96 well format on a StepOnePlus real time

PCR machine (Applied Biosystems). The data were analyzed according to the

Livak method for comparative real-time PCR to determine TTPA and MT1A mRNA levels [270].

Generation of Reactive Oxygen Species. IHH cells were pre-treated with 10

μM or 100 μM d-α-tocopherol (supplied in ethanol), or 1 mM N-acetyl cysteine

(NAC) for 16 hours. The following day, to induce oxidative stress, the media was changed and the cells were challenged with indicated concentrations of H2O2 for

3 hours. 10 μg/ml dichloro-fluorescein diacetate (DCF-DA) in HBSS without phenol red (Invitrogen) was added during the final hour of H2O2 treatment and the cell were read on a Perkin Elmer Victor 3 multilabel plate reader (San Jose,

CA) using the 485 nm excitation and 535 nm emission filters. Raw DCF was normalized to DNA content as determined from a Bisbenzamide assay (BBZ;

Sigma). The cells were incubated with 2.5 μg/ml BBZ (Sigma) in 2 M NaCl, 50

67 mM Na2HPO4, pH 7.4 in the dark at 37C for 60 minutes. BBZ fluorescence was read on a Perkin Elmer Victor 3 plate reader using the 365 nm excitation and 460 nm emission filters.

Western blot. Endogenous TTP expression was determined in lysates prepared from flash frozen liver, heart, cerebellum, prefrontal cortex, kidney, and intestine of 8 days old C57Bl/6 mice using a rabbit polyclonal CW201P antibody. A secondary HRP-conjugated rabbit antibody in combination with SuperSignal

West Dura substrate (Thermo Fisher Scientific, Inc., Rockford, Il) was used for visualization.

Cloning Luciferase Reporter Plasmids and Site-directed mutagenesis. A

1904 bp fragment of human genomic DNA corresponding to the region immediately 5’ of the ATG translational start site of TTPA (NC_000008.10 chromosome 8, 8q12.3; range 63998612-64000612) was PCR amplified, shuttled through the pDRIVE vector (Qiagen, Valencia, CA) and ligated into the pGL3-

Basic vector (Promega) where it regulates expression of the luciferase gene. We generated the schematic (Figure 3.3A) of the potential regulatory cis- elements in this region based on our inclusion criteria—conserved throughout species and liver specific factors with known regulatory roles. Conserved elements were identified using multiple species alignment (human, mouse, zebrafish, chicken, and chimpanzee) of the promoter (MultAlin [271] data not shown). Site directed mutagenesis (QuikChange kit, Agilent) was used to construct single-base pair substitutions in the TTPA promoter, reflecting reported SNPs in the human population determined from dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/) .

In addition, the 1904 bp promoter was restriction digested to generate deletion constructs which start at the -1654, -1213, -852, -436 and -208 bp of the TTPA promoter in the pGL3B vector (Figure 3A). All constructs were verified by sequencing.

Transient transfections. IHH cells plated in triplicate into 24 well tissue culture plates and co-transfected with a pTTPGL3B construct together with the pCH110

β-galactosidase expressing plasmid (Pharmacia) using Lipofectamine Plus reagents (Invitrogen). Forty-eight hours after transfection cells were washed once with PBS, harvested in 100μl 1X passive lysis buffer (provided in the firefly luciferase kit, Promega) and freeze-thawed to completely lyse the cells before measuring luminescence on an Lmax luminometer (Molecular Diagnostics) using firefly luciferase reagents (Promega). To normalize transfection efficiency 30 μl of lysate was used in a β-galactosidase assay to measure hydrolysis of OPNG at

420nm on a Perkin Elmer Victor 3 multilabel plate reader. Luciferase luminescence was normalized to β-galactosidase activity to account for variations in transfection efficiency.

Measurements of RNA stability. IHH cells were treated with 10 μg/ml

Actinomycin D (Sigma) and with or without 200 μM H2O2 for indicated time, followed by the RNA isolation, as described above. Pretreatment with 100 μg/ml cyclohexamide (or DMSO control) for 15 minutes was followed by the addition of

200μM H2O2 for 3 hours and RNA isolation using the Trizol method.

Statistics. Statistical significance was established at a threshold p value <0.05 using a Student’s t-test.

Results Expression of the TTPA gene is spatially regulated. Previously, independent groups have shown that TtpA mRNA and protein expression are extremely high in the liver compared to the cerebellum, cortex and kidney [124, 138]. We found that TtpA mRNA levels mimic the TTP protein levels (Figure 3.1) in the liver, cerebellum, cortex, intestine, kidney and heart tissues taken from the same 8 days old C57Bl/6J mouse. These results suggest that TtpA is variably regulated at the transcriptional level in different tissues.

Chemical modulators of endogenous TTPA. Earlier studies have examined the change in TTP transcription or translation in relation to the levels of vitamin E.

To gain further insight into the mechanisms of TTPA regulation, we employed a computational sequence analysis (MatInspector [272]) to identify putative transcription factor binding sites in the proximal promoter region of human TTP, immediately upstream of the translational start site We thereby identified a number of potential transcription factors that may participate in regulating the expression of the TTPA gene. Figure 3.2A lists these factors, their putative binding location within the TTPA promoter region, and their physiological relevance. We then treated IHH cells with pharmacological reagents that are known to affect these transcription factors, and measured the TTPA mRNA level using comparative RT-PCR. As shown in (Figure 3.2B), treatment with 9-cis RA,

WY14643 and IBMX treatments caused a 2-3-fold increase in the TTPA mRNA

70 levels, implicating RXR, cAMP and /or Ca2+ responsive CREB, and PPARα as likely regulators of TTPA expression [273]. These findings raise the possibilities that changes in lipid metabolism [274, 275] affect expression levels of TTP. It is true that lipids can regulate fatty acid transport proteins [276].

Tocopherol, the only known ligand for TTP elicited a robust 3-fold transcriptional activation (Figure 3.2B). This observation is in line with earlier research demonstrating that tocopherol levels affected TTPA mRNA expression [16, 18].

The chemicals H2O2 and DFX, which are both inducers of oxidative stress, also increased the TTPA transcript by 3- and 4-fold, respectively (Figure 3.2B).

Taken together these data show that TTPA is indeed transcriptionally regulated by physiologically-relevant changes in cell metabolism.

Distinct regulatory regions in the TTPA promoter. To address the molecular mechanisms that govern expression of the TTPA promoter, we ligated a 1.9 Kb proximal region, upstream of the TTP translational start site, into a reporter vector which can be used for transcriptional activation assays (Figure 3.3A). To delineate regions of the promoter that might confer basal transcriptional activity we generated six deletion constructs beginning at positions: -1654, -1213, -852,

-525, -436 and -208 bp of the TTP promoter (Figure 3.3A). Transfection of these promoter constructs into IHH cells demonstrated variable transcriptional luciferase activity, as shown in Figure 3.3B. The -1213 bp construct displayed the highest luciferase activity, 50% greater than the next longest fragment

(-1654) yet almost 6-fold higher than the next smallest fragment (-852) (Figure

3.3B). These data suggested positive regulatory factors between the -852 and

-1213 regions and between the -436 and -526 constructs. Conversely, binding sites for transcriptional repressors may exist between positions -208 and -436,

-526 and -852, and -1654 and -1904 (Figure 3.3B). Taken together the TTPA promoter deletion constructs elicited variable transactivation, suggesting that cis- acting activators and repressors bind within these regions and regulate the basal activity of the TTPA promoter.

Transcriptional modulators of the cloned TTPA promoter. To further characterize the proximal 2 Kb region of the TTPA promoter, we examined its responses to the chemical regulators that affected transcription of the endogenous TTPA gene. We transfected the 1.9 Kb TTPA reporter constructs into IHH cells and treated the transfected cells with the various pharmacological modulators (shown earlier (Figure 3.2A). Consistent with the increase in endogenous TTPA with H2O2 and DFX treatments, we also observed a 2-fold increase in promoter activity with the addition of these two chemicals. These results support our evidence that TTPA was regulated by oxidative stress.

Notably, the luciferase activity was also significantly increased (75%) upon treatment of TNFα, a mediator of inflammation. However, tocopherol and IBMX treatments, which activated transcription of endogenous TTP mRNA, had no significant effect on transactivation of the cloned TTP promoter. This observation suggests that elements required for responsiveness to these chemicals reside outside the 1.9 Kb promoter region we cloned (i.e. enhancers or intronic sequence [277-280]). Additionally, considering the blunted basal expression of the -1904TTP construct compared to other constructs (Figure 3.3B), it is possible

72 that there may be a strong transcriptional repressor operating on the -1904 construct preventing responses to these chemicals.

Transcriptional response of endogenous TTPA to oxidative stress.

Transcriptional activation of the TTPA promoter by H2O2 (Figure 3.2B) may represent an important physiological feedback mechanism, in which TTP levels increase in response to cellular oxidative stress. To better characterize this response, we verified that H2O2 treatment induces intracellular oxidative stress using two independent experiments. DCF-DA is a cell-permeable oxidation- sensitive fluorescent dye that is widely used as an indicator of intracellular reactive oxygen species [99]. Treatment of IHH cells with increasing concentrations of peroxide yielded a clear, dose-responsive increase in dye fluorescence (Figure 3.5A). Pretreatment of the cells with vitamin E (10-100 μM

α-tocopherol) or with the water-soluble antioxidant N-acetyl cysteine (1 mM;

[281]) attenuated the H2O2-induced increase in DCF fluorescence (Figure 3.5A).

Using real-time RT-PCR we also measured the effect of H2O2 treatment on the expression of a known oxidative stress-responsive gene, namely Metallothionein-

1A (MT1A) [282]. Indeed, H2O2 induced a robust increase in the mRNA levels of both TTPA (6-fold) and MT1A (12-fold) treatment (Figure 3.5B). Taken together, these observations demonstrate that intracellular oxidative stress induces the expression of the TTPA in cultured hepatocytes.

Mechanisms underlying the transcriptional responses of TTPA to oxidative stress. The lack of a robust TTPA luciferase response to H2O2 treatment (Figure

3.4) suggested there may be additional regulatory mechanisms that lie outside

73 the 1.9 Kb proximal promoter region. The H2O2-induced increase in TTPA mRNA could result from enhanced transcription of the gene or from reduction in degradation of the TTPA mRNA. To investigate the effect of oxidative stress on mRNA stability, we measured the level of TTPA mRNA over time using real-time

RT-PCR, while inhibiting mRNA synthesis with Actinomycin D treatment (Figure

3.6A). We found that the half-life of TTPA was 3 hours, and this value was not affected by treatment with hydrogen peroxide. Thus, the oxidative stress- induced increase in TTPA transcript does not result from mRNA stabilization. To further investigate the mechanism of H2O2 action on TTPA, we examined whether the increase in TTPA mRNA is mediated by already-present transcription factor (s), or requires the synthesis of a new transcriptional regulator. To this end, we tested the effect of the translational inhibitor [283]

(Figure 3.6B). We found that pretreatment of IHH cells with cyclohexamide did not affect the transcriptional response of TTPA to hydrogen peroxide. These results implicate already present ‘first-responder’ transcription factor (s) as regulatory mediators of the TTPA gene to oxidative stress.

NF-κB influence on oxidative stress induced TtpA expression.

Computational analysis identified two putative NF-κB binding sites within the

TTPA promoter region (positions -838 and -1786; Figure 3.3A). Since, NF-κB is well-recognized as an oxidative stress-responsive transcription factor (reviewed in [284]), we wondered whether this factor mediates the transcriptional response of the TTPA promoter to H2O2 . Treatment of IHH cells with Bay 11-7085, an established inhibitor of NF-κB activation [285, 286] in conjunction with H2O2 did

74 not abrogate oxidative stress-induced TtpA expression beyond the 70% reduction the inhibitor elicited on the basal activity (Figure 3.7). These results indicate that the oxidative stress-induced TtpA expression in not mediated by

NF-κB.

Effect of common single nucleotide polymorphisms in TTPA on transcription. Like many other genes, the sequence of the TTPA gene includes common polymorphic variant alleles that distinguish individuals within a given human population. We searched the publically available NCBI database

(dbSNP) for SNPs within the promoter region of the TTPA gene. Out of the 37 reported SNPs in the TTPA promoter region we focused on 12 variants in our 2

Kb region. These 12 SNPs have been validated by multiple independent observations and occur in meaningful frequencies (penetrance between 1 and

50%). The nature and locations of these variations are outlined in Figure 3.8A.

We then used site-directed mutagenesis to generate variant alleles of the TTPA promoter in our reporter construct, and measured their effect on promoter activity after transfection into IHH cells. We found that the various SNPs had profound effects on the TTP promoter activity (Figure 3.8B). The -1752C/T, -1408G/T, and -345C/T substitutions resulted in a 3-fold increase in activity compared to the

‘parental’ promoter construct. Conversely, the -1408A/T, -943A/G, -674C/T,

-439A/G and -344 C/T SNPs resulted in significant repression of promoter activity. The mechanism of the SNPs ability to regulate the TTPA promoter activity may be associated with the alterations in transcription factor consensus sequence binding sites caused by the minor allele (Figure 3.8C). Notably, it has

75 been previously reported that the 980A/T SNP is associated with a modest but significant decrease in vitamin E plasma levels [287]. We showed that mutagenizing to the “T” allele in the 980A/T construct decreased the TTPA promoter activity. Thus it is plausible that the -980 SNP, along with the other

SNP alleles that resulted in repression of the TTPA promoter activity, may participate in regulating vitamin E plasma levels. Hepatic TTP is the only known regulator of whole body vitamin E levels [44]. We reason that if the SNP variant alleles decrease the expression of TTP then this decrease will be accompanied by a reduction in incorporation of vitamin E into lipoproteins and ultimately led to extra-hepatic vitamin E deficiency. Therefore these SNPs may be responsible for TTP’s homeostatic control of tocopherol levels that has been observed in mice and humans [138, 288]. Table 3.1 includes the known frequency data of the SNPs in the TTP promoter region that are derived from the various ethnic populations in the HapMap, SNP500Cancer and 1000Genomes databases. If a

SNP can regulate TTP levels and in turn alter plasma vitamin E levels then the penetrance of these SNPs in a particular population is meaningful in the context of recruiting and analyzing clinical trials, as well as in individualized medicine.

Discussion Vitamin E is the major lipid soluble antioxidant in most animal species. TTP is recognized as an indispensable protein and the only direct regulator of whole body status of vitamin E. This is exemplified in human patients that harbor naturally occurring mutations in the TTPA gene, resulting in Ataxia with vitamin E deficiency (AVED). AVED is characterized by progressive spinocerebellar ataxia accompanied by very low vitamin E levels [126, 127]. Similarly, the Ttpa-/- mice

76 present with low vitamin E levels, an ataxic phenotype and increased markers of oxidative stress in the plasma, brain, heart, liver and uterus [7, 39, 138, 139,

289]. The undeniable association between TTP and tocopherol levels is further exemplified by the linear correlation between TTP expression level and plasma concentration of tocopherol in the Ttpa+/+, Ttpa+/- and Ttpa-/- mouse models [138,

290].

Early studies of dietary vitamin E repletion and depletion in rats and mice offer mixed results regarding the effect of tocopherol on TTP mRNA and protein levels

[157, 268, 291]. More recent studies investigating the expression of TTP under oxidative stress conditions, such as environmental smoke [160], hyperoxia [161] and chemical oxidizers [162], report conflicting results. Studies from our lab reveal that tocopherol increases the steady-state levels of TTP by protecting the protein from ubiquitination and proteosomal degradation [158]. These results, in combination with findings on the spatial and temporal expression of TTP [137,

139, 140, 291] suggest that TTPA is transcriptionally regulated. Identifying the molecular determinants of TTPA transcriptional regulation will impact the ability to modify human vitamin E levels when necessary. The purpose of our research is to determine if TTPA transcription is regulated, using the promoter as our guide.

We report that expression of the TTPA gene is modulated by chemical agonists of PPARα, RXR and CREB. By inhibiting phosphodiesterases IBMX prevents degradation of cAMP levels and in turn positively modulates the transcriptional actions of CREB [273]. In a rat model of fluid percussion injury, which generates

77 oxidative stress, vitamin E supplementation was shown to increase CREB levels

[292]. Additionally, tocopherol supplementation (200 mg/kg) was shown to prevent neuron degeneration in the dentate gyrus region of the rat brain via the increase in CREB [293]. Therefore, it is possible that CREB can mediate the positive actions of IBMX on TTPA expression. This is especially meaningful under conditions of oxidative stress, when such effects will serve to increase and/or maintain vitamin E levels. The neuropathology of AVED, Alzheimer’s disease (AD), and Abetalipoproteinemia patients is accompanied by an increases in TTP levels in the central nervous system [153]. Furthermore, CREB is a key factor in bridging the neuronal activity involved in learning and memory to gene expression [294]. Vitamin E treatment has been shown to be efficacious in combating neuro-inflammatory diseases like AD, Parkinson’s disease (PD), and

Down’s syndrome (DS) by decreasing oxidative stress [295-297] [298]. In rodents, vitamin E treatment delayed the loss of cognitive and motor performance that was attributed to oxidative-stress related damage [299].

Further investigation into the connection of CREB and TTPA regulation, especially in the brain is necessary.

Given the presence of putative PPAR/RXR response elements in the TTPA promoter (Figure 3.3A), we speculate that WY14643 and 9-cis RA are acting on the endogenous TTPA transcript at these sites. PPARs and RXR hetero- dimerize to function in various cellular processes, including differentiation and lipid metabolism and transport [300]. These results raise the possibility that lipid metabolism can affect TTP expression. However, there is no increase in

78 promoter activity after the addition of these agonists to the transfections of the cloned TTP promoter reporter constructs (Figure 3.4). These results may reflect the limitations of the cloned promoter reporter experiments. First, the cloned promoter is possibly lacking an accessory element (i.e. enhancer) that is required to elicit a response to various stimuli. Second, the regulatory factor (i.e. intronic sequence or beyond the cloned region) may lie outside the region of the promoter we interrogated. However, in our promoter “bashing” experiments we did yield insight into regions of the promoter that harbor variable activity; further delineation of the specific transcription factors controlling these regions using site-directed mutagenesis and ChIP assays are the basis of future studies. Thus, we conclude that the source of the increase in endogenous TTPA expression is not exclusive to the 2 Kb region we interrogated and/or there are auxiliary elements required for TTPA regulation [301].

We found that hydrogen peroxide and DFX—a hypoxic mimetic, significantly enhances TTPA expression in the IHH cells (Figures 3.2 and 3.5B), as well as increases the cloned TTP promoter activity (Figure 3.4). These observations indicate that oxidative stress induces the expression of the TTPA gene. Since oxidative stress did not influence TTPA mRNA stability (Figure 3.6A) we conclude this is not the mechanism of H2O2-induced TTPA mRNA expression. Our results further show that transcriptional activation of TTPA by oxidative stress does not require new protein synthesis (Figure 3.6B), thus implicating the already-present

‘first-responder’ transcription factors. A possible candidate transcription factor responsible for the H2O2-induced increase in TTPA is NF-κB for several reasons.

First, there are two putative NF-κB sites that exist within the TtpA promoter region. Second, NF-κB is well-recognized as a transcription factor activated by oxidative stress (reviewed in [284]). Finally, the mechanism of NF-κB activation is consistent with our observations that new protein synthesis is not required for activation of NF-κB. STAT and CREB are other putative ‘first-responder’ factors, meaning, like NF-κB, they are also present in an inactive form in the cytosolic milieu and, therefore, can be immediately activated in response to oxidative stress.

Several clinical trials to assess the efficacy of vitamin E supplementation in the prevention of cancer and disease report mixed results unlike observations made in pre-clinical models [302-305]. However, a recent paper analyzing validated

SNP’s in and around the TTPA gene demonstrates a correlation between plasma

α-tocopherol levels and these genetic variants [287]. Interestingly, the report describes a variant (rs6994076; -980A/T) in the promoter region of TTPA that results in a decrease of plasma vitamin E levels [287]. Considering TTP, by virtue of facilitating tocopherol into circulating lipoproteins, is the only known regulator of vitamin E status, we reasoned SNPs in the promoter region may regulate TTP expression and in turn control vitamin E levels. This led us to examine the functional consequences of other validated SNPs in our cloned 2 Kb human promoter reporter construct. We find there are striking differences in promoter activity when the variants are changed to the minor SNP allele (Figure

3.8B). The -1752C/T, -1408G/T, and -345C/T substitutions resulted in a 3-fold increase in activity compared to the ‘parental’ promoter construct. Conversely,

80 the -1408A/T, -980A/T, -943A/G, -674C/T, -439A/G and -344 C/T SNPs resulted in significant repression of promoter activity. These changes are possibly due to modifications in transcription factor consensus sequence binding sites (Figure

3.8C) and future studies using ChIP analysis will address this possibility.

The results of these SNP experiments may shed light on ‘responders’ to vitamin

E supplementation in clinical trials. Indeed it is plausible that the variants in the

TTP promoter region could be dictating a person’s ability to ‘handle’ vitamin E supplementation by regulating TTPA expression. This notion is supported by several lines of evidence. First, recent work from our lab demonstrates that in cell models of prostate cancer the anti-proliferative effect of tocopherol is correlated with TTP levels [267]. Second, analysis of plasma α-tocopherol levels in healthy individuals under basal and vitamin E supplemented conditions showed that there is an extremely controlled intra-individual plasma vitamin E level. However there is high variability in vitamin E plasma levels between the study participate [288]. These results strongly suggest there is a genetic basis for vitamin E homeostasis. We hypothesize that an individual with a variant that decreases TTPA transactivation (i.e. -1408A/T, -943A/G, -674C/T, -439A/G and -

344 C/T) may not respond to vitamin E supplementation the same way as those individuals with the ‘activating’ alleles (-1752C/T, -1408G/T, and -345C/T). Thus,

SNP variant alleles may hold a key to delineating how a person ‘handles’ vitamin

E and, furthermore, who would be a ‘responder’ to vitamin E supplementation.

This information is important to consider when designing as well as analyzing clinical trials. Moreover, due to ethnic frequency differences (Table 3.1) there

81 may be reason to segregate analysis of studies based on an individual and ethnic SNP profile in efforts to avoid skewing the results. In support of this idea, the “T” allele in -980A/T (rs6994076) SNP, which has previously been shown to alter plasma vitamin E levels, occurs in the Caucasian population (HapMap) at

47.8%, whereas in the descendants of African (HapMap) and Chinese ancestry

(HapMap) the “T” allele is present in 63% and 76% of the populations, respectively (Table 3.1). Finally, if these SNP variants indeed can affect vitamin

E homeostasis by regulating TTP then SNPs in the TTP promoter region are also important in personalized medicine.

Taken together, we conclude that TTPA is indeed transcriptionally regulated by physiologically-relevant signals, and this regulation may have a profound effect on human vitamin E status, especially in oxidative stress-related diseases.

Chapter 3 Figures

Figure 3.1. TtpA/TTP expression is tissue specific. RNA was harvested from the indicated tissues of an 8 days old mouse, and used to determine TtpA and actin expression levels using RT-PCR (top two panels) or for measuring TTP protein expression levels using immunoblotting (bottom panel). Note: 10 μg of liver protein and 200 μg of CB (cerebellum), CX (cortex), heart, INT (intestine) and KID (kidney) were loaded.

Figure 3.2. Chemical Modulators of TTPA expression. A. Candidate transcription factors in the TTPA promoter likely to mediate responses to the chemical agonists shown in B. B. Real-time PCR results of fold increase in TtpA expression. IHH cells were exposed to the indicated treatments as detailed in Methods. Dex (Dexamethasone), ATRA (all trans retinoic acid), 9-cis RA (9-cis retinoic acid), H2O2 (hydrogen peroxide), IBMX (3-isobutyl-1-methylxanthine), TOH (d-α-tocopherol), DFX (desferrioxaminemesylate). *indicates statistical significance of p<0.05 versus the untreated -1904 construct, as determined from a Student’s T-test.

Figure 3.3. Transcriptional activity of cloned TTP promoter constructs in IHH cells. A. Schematic of the cloned 1.9kB human TTPA promoter used in transcriptional reporter experiments and the deletion constructs generated from it. Putative transcription factors are notated by the black boxes and the hatched box indicates a highly GC–rich region. B. Promoter activity of the indicated TTP reporter constructs in IHH cells. *indicates statistical significance of p<0.05 compared to the -208 construct, as determined from a Student’s T-test.

Figure 3.4. Transcriptional responses of the cloned 1904 TTP promoter in IHH cells. Luciferase activity of the 1904bp TTP reporter construct was determined IHH cells as described in Methods. Cells were treated with indicated chemicals as described in Methods. Dex (Dexamethasone), ATRA (all trans retinoic acid), H2O2 (hydrogen peroxide), IBMX (3-isobutyl-1-methylxanthine), TOH (d-α-tocopherol), DFX (desferrioxaminemesylate). Shown are values after normalization to the untreated condition.

Figure 3.5. Transcriptional responses of the TTPA gene to oxidative stress. A. Oxidative stress in the presence of indicated treatment was measured in IHH cells as described in Methods. *indicates statistical significance of p<0.05, as determined from a Student’s T-test. B. Real-time PCR of MT1A and TtpA expression normalized to 18s in established conditions of oxidative-stress.

Figure 3.6 . mRNA stability of H2O2-induced expression of TTPA. A. Real- time RT-PCR analysis of mRNA stability in IHH cells during conditions of oxidative stress. B. Real-time RT-PCR results determining the inhibition of new protein synthesis on oxidative-stress induced TTPA expression. *indicates statistical significance of p<0.05 in as determined from a Student’s T-test.

Figure 3.7. Involvement of NF-κB in oxidative-stress induced TTPA expression. Real-time RT-PCR results of IHH cells treated with indicated concentrations of the NF-κB inhibitor BAY 11-7085 followed by treatment with H2O2. *indicates statistical significance of p<0.05 compared to the untreated conditions, as determined from a Student’s T-test

Figure 3.8. Common SNPs affect transcriptional activity of the TTPA promoter. A. Schematic of the 2 Kb proximal promoter with validated single polymorphisms identified by the black boxes. The RS number as determined by dbSNP is above and the base changes are below the line. B. Promoter activity of the ‘parental’ 1904 bp TTP reporter construct compared to the minor SNP allele changes in transfected IHH cells. *indicates statistical significance of p<0.05 versus the ‘parental’ construct, as determined from a Student’s T-test. C. Table of transcription factor consensus sequences that are affected by the SNPs. Shaded boxes (repressors) and bold font (activators).

Table 3.1 Ethnic Frequencies of SNPs in TTP promoter % % rs# Sample major minor SNP Population Study Count allele allele 1000Genomes rs73684515 pilot low- 439 A/G Yoruba in Ibadan, Nigeria coverage panel 59 A=10.2 G=89.8 1000Genomes rs80169698 pilot low- 674 C/T Yoruba in Ibadan, Nigeria coverage panel 59 C=94.9 T=5.1 Caucasian SNP500Cancer 30 rs34358293 African/African American SNP500Cancer 24 944 A/G Hispanic SNP500Cancer 23 Pacific Rim SNP500Cancer 24 A=2.1 G=97.9 Utah residents with Northern rs6994076 and Western European ancestry HapMap 113 A=52.2 T=47.8 980 A/T Han Chinese in Beijing, China HapMap 45 A=24.4 T=75.6 Japanese in Tokyo, Japan HapMap 86 A=29.7 T=70.3 Yoruba in Ibadan, Nigeria, Sub- Saharan HapMap 113 A=27.0 T=73.0 African ancestry in Southwest USA HapMap 49 A=36.7 T=63.3 Caucasian SNP500Cancer 30 A=50.0 T=50.0 African/African American SNP500Cancer 24 A=29.2 T=70.8 Hispanic SNP500Cancer 23 A=34.8 T=65.2 Pacific Rim SNP500Cancer 24 A=26.1 T=73.9 1000Genomes rs73270590 pilot low- 1356 C/T Yoruba in Ibadan, Nigeria coverage panel 59 A=12.7 T=87.3 1000Genomes rs6472071 Utah residents with Northern pilot low- 1409 A/G/T and Western European ancestry coverage panel 60 A=44.2 T=55.8 1000Genomes Han Chinese in Beijing, China + pilot low- Japanese in Tokyo, Japan coverage panel 60 A=40.0 T=60.0 Yoruba in Ibadan, Nigeria HapMap 60 A=47.5 T=52.5 1000Genomes rs35028635 pilot low- 1083 C/G Yoruba in Ibadan, Nigeria coverage panel 59 C=11.9 G=88.1 Caucasian SNP500Cancer 30 C=0 G=100 African/African American SNP500Cancer 24 C=2.1 G=97.9 Hispanic SNP500Cancer 23 C=0 G=100 Pacific Rim SNP500Cancer 24 C=0 G=100 1000Genomes rs12056582 Utah residents with Northern pilot low- 1752 C/T and Western European ancestry coverage panel 60 C=95.8 T=4.2 1000Genomes Han Chinese in Beijing, China + pilot low- Japanese in Tokyo, Japan coverage panel 60 C=64.2 T=35.8

Chapter 4 Tocopherol transfer protein and vitamin E in the CNS

Abstract: Vitamin E (tocopherol) is the major lipid soluble antioxidant. Consequently, maintaining adequate vitamin E levels is critical for the prevention of oxidative stress-related diseases. The tocopherol transfer protein (TTP), which is highly expressed in the liver and to a lesser extent in the brain, functions as the major regulator of vitamin E status. Mutations in TTP result in a heritable disease that is characterized by very low vitamin E levels and neurological consequences that manifest as spinocerebellar ataxia. Despite the importance of vitamin E in maintaining neurological function, the majority of our knowledge regarding vitamin E transport is limited to in the liver. Using primary dissociated cells and organotypic slice cultures, we established that TTP is preferentially expressed in astrocytes. In accordance with the function of liver TTP, we find an increase in efflux of tocopherol from TTP-expressing astrocyte cells. Finally, we report that

TtpA expression increases in conditions of oxidative stress in the astrocyte cells.

Taken together, our data suggests that TTP-expressing astrocytes distribute tocopherol to protect neurons from oxidative-stress induced damage. This astrocyte-neuron transport interaction is similar for other lipids, including cholesterol.

Introduction: Vitamin E is a family of neutral lipids produced in photosynthetic plants. By virtue of two discriminatory mechanisms in the liver, mammals preferentially retain the alpha-tocopherol (tocopherol) form of vitamin E. The high affinity of alpha- tocopherol for hepatic alpha tocopherol transfer protein (TTP) combined with the robust activity of Cyp4f2 towards non-alpha-tocopherols results in an enrichment of alpha-tocopherol levels in plasma and tissues. Consequently, alpha- tocopherol is considered the most biologically active form of vitamin E. The presence of alpha-tocopherol in the lipid bilayer prevents cellular membrane damage evoked from free radical-induced lipid peroxidation of polyunsaturated fatty acids (PUFAS). It is due to this activity that vitamin E is considered the major lipid-soluble antioxidant. Therefore, maintaining optimal vitamin E status is critical in defense against oxidative stress-related diseases, like Alzheimer’s disease, Parkinson’s disease, Down’s syndrome and Diabetes.

The brain’s relative size (2% of the whole body weight) and disproportionate demand for oxygen (20%) makes it particularly vulnerable to oxidative stress and development of sporadic neurodegenerative diseases. Autopsies of human patients suffering from neurodegeneration show an increase in the levels of markers of oxidative stress [306, 307]. Furthermore, studies in humans and transgenic mouse models established that supplementation with vitamin E attenuates the levels of oxidative stress markers, as well as delays the progression of Alzheimer’s disease and Amylotrophic lateral sclerosis [177, 178].

Additionally, research has shown a positive correlation between decreased risk for Parkinson’s disease and dietary intake of vitamin E [179-182]. There is

93 compelling evidence suggesting that vitamin E supplementation slows the progression of some of these oxidative-stress-related diseases [183]. Thus, supplementation with vitamin E is commonly prescribed for these diseases [178,

184, 185].

The primary pathology of vitamin E deficiency is neurological degeneration manifesting as ataxia. Multiple lines of evidence suggest that TTP and tocopherol play important roles in the CNS. First, heritable mutations in the TTPA gene result in AVED, a neurodegenerative disorder characterized by low tocopherol levels, spinocerebellar ataxia, and degeneration of Purkinje neurons

[183]. Second, TTP is expressed in the Bergmann glia cells surrounding the

Purkinje neurons of the rat brain, as well as in the cerebral cortex and cerebellum of humans and mice [137, 138]. Third, the TtpA-/- mice present increased levels of lipid peroxides, morphological and functional defects in cortical and retinal neurons, and significantly decreased plasma and tissue vitamin E levels [138].

Finally, TTP protein expression in the brain increases in the Purkinje and hippocampal neurons of patients with Alzheimer’s disease, Down’s syndrome and AVED [153]. A number of studies report that vitamin E levels are significantly lower in the plasma [186-188] and cerebrospinal fluid [189, 190] of

AD patients as compared to healthy individuals. Furthermore, in mouse models of AD, vitamin E supplementation [191, 192] attenuates Aβ-induced lipid peroxidation, plaque formation, and subsequent neurotoxicity. The effect of tocopherol appears to be a preventive one, because tocopherol administration after plaque formation does not reverse the senile plaques [193]. Taken

94 together, this suggests that vitamin E is efficacious in prevention of disease.

These data strongly support the hypothesis that TTP, by regulating tocopherol status, is a critical mediator of neuronal integrity, function and protection from oxidative stress.

Although TTP is highly expressed in the liver, it is also detected in the hippocampus, cortex and cerebellar regions of the brain [138, 153]. In vitro, TTP binds tocopherol with high affinity and facilitates its transport between membrane vesicles. In vivo, TTP facilitates secretion of tocopherol from hepatocytes to circulating lipoproteins, thereby regulating whole-body vitamin E status [23, 33].

Despite the wealth of information regarding the physiological roles of hepatic

TTP, nothing is known about the function of TTP in non-hepatic tissues. The goal of our research is to investigate the factors that determine and regulate expression of TTP in the cerebellum with an aim to gain insight into the function of TTP in the brain. We report that TTP expression in astroglial cells of the cerebellum increases in conditions of oxidative stress. Furthermore, tocopherol co-localizes to astrocytes and TTP-expressing cells. We propose that the TTP- expressing astrocytes deliver tocopherol to neurons when the cells require vitamin E.

Results TTP is expressed in various regions of the mouse brain. TtpA mRNA and protein levels are extremely high in the liver but the gene is also expressed to a lesser extent in the cerebellum and cortex of the brain, the kidney, lung and placenta [124, 138, 140, 153, 308]. We extend the expression profile of TtpA

95 mRNA and TTP protein to include the hippocampus, brainstem and midbrain regions in C57Bl6 mice (Figure 4.1). Importantly, expression levels of the TtpA transcript (Figure 4.1, panel A) are mirrored by the protein levels (Figure 4.1, panel B). Taken together, these data suggest that expression of TtpA is regulated, possibly to maintain ‘microenvironments’ of tocopherol in the various brain regions. In fact, this theory has been previously suggested but it has never been tested [138].

TTP expression is increased in astrocyte-enriched cultures. The cell populations in the central nervous system are divided into three main types, neurons, microglia and macroglia cells. Macroglia, in turn, can be further distinguished into astrocytes and oligodendrocytes, based on their precursor cells [309]. Primary dissociated cerebellar cultures are dynamic in their cellular population. The neuronal population is essentially non-mitotic, whereas the glia cells are proliferative. We employed culture conditions to enrich for astrocyte and neuron cell populations. To characterize our cell populations, we harvested the primary dissociated cerebellar cultures after maintaining them in culture for 2 days and 6 days and co-stained the cells with astrocyte-specific (GFAP) and neuronal-specific (β-tubulin III) cell markers. Indeed we determined the cell populations to be remarkably different. Immunofluorescent staining of the cells that were maintained in culture for 2 days revealed the majority of the population were neurons while only a small percentage were GFAP-positive astrocytes

(Figure 4.2A). These results were not surprising considering the conditions to harvest primary cerebella cultures are established to enrich granule neurons.

Conversely, after the cells were maintained in culture for 6 days there was a shift towards enrichment of GFAP-positive cells (Figure 4.2B). To investigate the various cell populations in our primary dissociated cerebellar cultures, we measured TtpA, Gfap and Tubb3 (neuron marker) from the different cell populations and determined that TtpA is restricted to the astrocytes. Real-time

PCR in the two days culture demonstrated about equal Gfap and Tubb3.

Although, at this time-point, protein levels of β-tubulin III are much higher than

GFAP, suggesting post-transcriptional regulatory control of GFAP. However, after 6 days in culture we observed a 5-fold increase in Gfap and a dramatic 24- fold rise in TtpA mRNA levels, while we saw a significant 90% decline in Tubb3 transcript. A transcriptome database generated from mouse brain GeneChip arrays also reported that TtpA was enriched only in astrocyte cultures, but not in neuronal or oligodendrocyte cell populations [310]. Thus, we established a neuron-enriched cell population (denoted as ‘neuron-enriched’ culture in Figures

4.2, 4.5, and 4.7) and a culture enriched in both TtpA and Gfap expression

(denoted as ‘astrocyte-enriched’ culture in Figures 4.2, 4.5, and 4.7).

TTP is expressed in GFAP-positive cells and not in β-tubulin III positive cells in primary cerebellar cultures. To confirm the cellular location of TTP in the cerebellum we performed immunofluorescence microscopy on primary dissociated cultures that were maintained in culture on poly-l-lysine-coated glass coverslips for 6 days. We co-stained the cultures with an anti-TTP antibody and glial fibrillary acidic protein (GFAP) antibody, an established marker of astrocytes

[311, 312]. We found that TTP expression in this preparation is restricted to

GFAP-positive cells (Figure 4.3). The TTP expression was distributed in both the cytosol and dendrites of the astrocytes. This observation is consistent with previous reports in hepatocytes that TTP is localized to the cytoplasmic region of cells [51]. These results support our observations from the real-time PCR experiments (Figure 4.2C) showing that TtpA transcript is enriched in GFAP- positive astrocytes. Conversely to the GFAP-positive cells, we did not detect any

TTP expression in cells that stained positively with the neuron-specific cell marker Class III β-tubulin [313-315]. Taken together, we conclude that TTP is expressed in the astrocyte cell subtype in the primary cerebellar dissociated cultures.

TTP co-localizes with GFAP-positive cells and is excluded from β-tubulin

III-positive cells in organotypic cerebellar slice cultures. In addition, we developed and employed a cerebellar organotypic slice culture technique. The organotypic slice preparation is especially attractive because the cellular environment, tissue architecture and electrochemical characteristics of individual cells are preserved for many days [316, 317]. We maintained the cerebellar slices in culture for 7 days prior to fixing and performing immunofluorescence staining to localize TTP, GFAP and β-tubulin III. As can be seen in Figure 4.4A,

4.4C and 4.4D TTP expression was localized to the GFAP positive cells. At low magnification (20X) it was evident TTP and GFAP cells were preferentially located in the Purkinje and molecular cell layers (Figure 4.4A), whereas at higher magnification (40X and 100X) there was a complete co-localization of TTP and

GFAP-positive cells in the Purkinje cells layer (Figure 4.4C and 4.4D). These results are in agreement with previous reports that demonstrated TTP was expressed in the Bergman glia cells surrounding the Purkinje neurons in the rat cerebellum [137]. Confirming our previous results, we found no co-localization of the TTP and β-tubulin III-positive cells, supporting the notion TTP is excluded from neuronal cells in both culture preparations. Analysis of the images using the LSM Image Browser software results in a strong Pearson’s correlation coefficient (r=0.55) confirming that TTP co-localizes with GFAP-staining. On the other hand, merged images of TTP- and β-tubulin III–stained cells yields a

Pearson Coefficient of r=0.03, indicating that TTP is not expressed in neurons.

Taken together, our results show that TTP is co-localized to GFAP-positive astrocytes, but not neurons.

Tocopherol secretion correlates with increased TTP and GFAP expression.

Next, we used the selective primary culture preparations (‘neuron-enriched’ and

‘astrocyte-enriched’) to investigate the functional outcomes of TTP expression.

The ascribed function of TTP in hepatocytes has been to facilitate intracellular transport of tocopherol, thereby regulating vitamin E’s secretion. We therefore used an established tocopherol secretion assay [33] to examine whether the two cell populations differ in this activity. Indeed, the radiolabeled tocopherol secretion in the ‘astrocyte-enriched’ cells was about 2-fold greater than the secretion observed in ‘neuron-enriched’ cultures (Figure 4.5). This two-fold increase was comparable to the TTP-induced secretion of vitamin E observed in control doxycycline-inducible TTP expressing HepG2 cells. Taken together,

99 these observations raise the possibility that the TTP-expressing astrocytes control the distribution of vitamin E in the central nervous system. This model is consistent with the role astrocytes play in regulating the trafficking of cholesterol to neurons [318, 319].

NBD-tocopherol accumulates in GFAP-positive, TTP expressing glial cells.

We next sought to determine in which cerebellar cells vitamin E is localized by utilizing a fluorescent analogue of vitamin E—NBD-tocopherol [4, 29, 33, 51, 122,

136]. To mimic the physiological condition, we delivered NBD-tocopherol as a lipoprotein-complex instead of via organic solvent or liposome preparations [44,

228, 320]. After on overnight ‘loading’ period, the cells were washed, and localization of NBD-tocopherol determined by fluorescence microscopy. As shown in Figure 4.6 NBD-tocopherol selectively accumulates in GFAP-positive

(Figure 4.6A) and TTP-expressing (Figure 4.6C) cells. Only negligible NBD- tocopherol signal was observed in β-tubulin III-positive neurons (Figure 4.6B).

These results show that the TTP-expressing astrocyte cells harbor, possibly store, the majority of vitamin E. Together with the secretion data (Figure 4.5), these observations support a model in which TTP regulates the secretion of vitamin E from astrocytes to neighboring neuronal cells.

Oxidative stress induces TtpA in primary cerebellar cultures. In hepatocytes, TTP functions to regulate the distribution of vitamin E— the major lipid soluble antioxidant. Previous research has demonstrated that vitamin E deficiency causes a pronounced increase in oxidative stress markers [138, 175,

266, 321, 322]. Therefore, we investigated whether oxidative stress modulates

100 the expression levels of TTP in the primary cerebellar cultures. Toward this end, we first adapted an assay of oxidative stress to our ‘neuron-enriched’ and

‘astrocyte-enriched’ cultures, utilizing the redox sensor dichloro-fluorescein diacetate (DCF-DA). After cell uptake, DCF-DA is cleaved to DCF by intracellular esterases. DFC, in turn, produces strong fluorescence upon oxidation by reactive oxygen species (ROS). The intensity of DCF fluorescence is a quantitative measure of intracellular ROS production [99]. Primary dissociated cerebellar cells that were maintained in culture for 1 or 5 days were cultured with varying concentrations of α-tocopherol or the water-soluble antioxidant N-acetyl cysteine for 16 hours. The cells were then challenged with

H2O2 for three hours prior to quantification of fluorescence. As seen in Figure

4.7, DCF fluorescence increased in a dose-responsive manner as H2O2 concentrations were raised. Furthermore, DCF fluorescence was quenched when the cells were incubated with antioxidants (Figure 4.7A). These results indicate that hydrogen peroxide treatment indeed produces oxidative stress in the two cultured cell preparations, and that DCF is an appropriate reporter for these intracellular effects in neuron-enriched (Figure 4.7A) and ‘astrocyte-enriched’

(Figure 4.7B) cultures. To determine the effect of oxidative stress on the mRNA expression of TtpA we performed Real-time PCR. In ‘astrocyte-enriched’ cultures there was a robust dose-responsive increase in TtpA mRNA that was completely abolished by pretreatment with α-tocopherol (Figure 4.7D). These results show that in astrocytes, expression of the TtpA gene is responsive to oxidative stress. However, in neuron-enriched cultures, at low H2O2 levels there

101 was a significant decrease in TTP expression, which was normalized back to basal levels of TTP at increasing doses of H2O2 (Figure 4.7C) Taken together, these results suggest that the regulation of TTP in the astrocytes, and not the neurons, affects the distribution of vitamin E in the CNS. Furthermore, it is reasonable to postulate that that under conditions of oxidative stress, increased

TTP levels would cause enhanced tocopherol secretion from the astrocytes, presumably to neighboring neurons, thereby protecting the neurons from damage. Our results are consistent with a recently reported finding that described a 3-fold increase in zebrafish embryos TTP gene expression when using Fullerene C60 to induce oxidative stress [162].

Proposed model of vitamin E distribution in the brain in normal and oxidative stress conditions (Figure 4.8). In both primary dissociated cerebellar cells and cerebellar organotypic slice cultures, we found that TTP expression was selectively localized in the astrocytes. Moreover, using real-time

PCR we confirmed that TtpA expression was significantly higher in astrocytes than neuronal cells in normal culture conditions. These results are consistent with our findings in the radioactive tocopherol secretion assay that showed tocopherol secretion is enhanced in the astrocytes. These results are consistent with a model in which TTP regulation in the astrocytes controls the distribution of vitamin E to neighboring cells. This notion was supported by the observation that in conditions of oxidative stress TTP expression increased in the astrocytes, presumably to deliver vitamin E to neurons to protect them from ROS-generated damage. We speculate that ApoE particles, that are assembled in and secreted

102 from the astrocytes [323-327], shuttle the vitamin E from the astrocytes to the neighboring neurons.

Discussion Vitamin E is the major lipid soluble antioxidant and it is therefore critical for prevention of oxidative stress-related diseases. TTP, a protein highly expressed in the liver, but also to a lesser extent in the brain, functions to regulate vitamin E status. Mutations in TTP result in a heritable disease characterized by very low vitamin E levels and neurological consequences that manifest as spinocerebellar ataxia. Despite the importance vitamin E plays in maintaining neurological function, the majority of our understanding regarding vitamin E transport and regulation is limited to the liver [37, 44, 56, 58, 83, 328-332]. Previous research revealed that the half-life of vitamin E turnover in the rat brain was rather slow

(72 days) compared with other tissues (i.e. lung; 8 days) [79], suggesting that a unique mechanism of vitamin E retention exists in the brain. Similarly, even after prolonged dietary deprivation, the murine brain retains vitamin E long after other tissues are depleted [76]. Finally, in TtpA-/- mice, heart and plasma vitamin E levels were restored to wild-type levels after dietary supplementation, whereas in the cerebellum, cortex and spinal cord vitamin E levels remained very low [138].

Taken together, these results raise the intriguing model in which TTP functions to maintain localized microenvironments of vitamin E in the CNS.

We established two cerebellar culture model systems—primary dissociated cerebellar cells and cerebellar organotypic slice cultures. Although many primary cell ‘brain’ cultures were optimally obtained from tissue excised from late

103 embryonic or early postnatal days (i.e. cortical or hippocampal neurons [333,

334]), the ideal time for harvesting cells for cerebella cultures has been established as postnatal days 7 to 9 [335]. We characterized our primary dissociated cerebellar cultures using marker-specific immunofluorescence microscopy and found conditions whereby the culture was primarily composed of neurons (Figure 4.2A), or astrocytes (Figure 4.2B).

Our results showed that TTP is selectively expressed in astrocytes (Figures 4.2,

4.4A, 4.4C, and 4.4D). The fact that astrocytes are the major source of lipoprotein E (ApoE) in the CNS [324, 336-338], together with the known relationship between vitamin E levels and ApoE status [39, 339, 340], leads us to hypothesis that ApoE is involved in tocopherol transport in the brain. Although no CNS-specific transport mechanism has been established for vitamin E, it may share the transport paths of cholesterol. The astrocytes orchestrate the structural and metabolic support of the CNS, and as such the astrocyte- synthesized ApoE lipoproteins are lipidated with cholesterol for delivery to the neurons [318]. Results from primary astrocyte cultures derived from ApoE-/- mice demonstrated a decrease in cholesterol and phospholipid secretion from these astrocytes [319, 341, 342]. Moreover, the decrease in ApoE and cholesterol levels in the cortex and CSF of Abca1-/- mice further support the idea that cholesterol and tocopherol share the transport pathway in the brain [343]. ABCA1 is cellular membrane transporter that has been established to lipidate HDL with tocopherol, cholesterol and phospholipids [55, 56, 344]. In support of this hypothesis, we find that in astrocyte-enriched cultures, tocopherol efflux into the

104 media was much higher than in neuron-enriched cultures. This finding is compatible with the accepted model for how TTP functions to facilitate tocopherol egress from the liver [44, 51]. In support of the idea that TTP maintained microenvironments of vitamin E in the central nervous system, we demonstrated that NBD-tocopherol, a fluorescent analogue of vitamin E that we have characterized extensively [29, 33, 122, 123, 136, 156, 234, 345], preferentially localized to TTP-expressing astrocytes (Figure 4.6). Further studies are required to assess how TTP ‘handles’ tocopherol trafficking in conditions of oxidative stress. However, our real-time PCR experiments showed that levels of the TtpA transcript significantly increased in astrocyte cultures in conditions of oxidative stress (Figure 4.7). These results raise the possibility that TTP levels increase in the astrocytes in order to deliver vitamin E to neurons during oxidative-stressed conditions. Such a model is consistent with previous research that demonstrated

TTP expression increased in patients afflicted with oxidative stress-related diseases such as Alzheimer’s disease and Downs syndrome [153].

An area of further investigation will be to determine if ApoE lipoproteins deliver the vitamin E from the astrocytes to neurons. This is in line with the function of astrocyte-derived ApoE particles in facilitating lipid transport (reviewed in [346,

347]). There are several lines of evidence to support of the role of ApoE controlling tocopherol levels in the central nervous system. The levels of vitamin

E are significantly lower in all brain regions of ApoE-/- mice compared to the wild- type controls [39, 340]. Moreover, radiolabelled tocopherol injected into the

105 ventricles of ApoE-/- mice demonstrated altered vitamin E uptake in the brain regions suggesting that ApoE-/- is involved in tocopherol trafficking [339].

In conclusion, we have established a working model that attempts to address how TTP localization in astrocyte cells controls vitamin E distribution (Figure 4.8).

We propose the TTP expressing astrocyte cells harbor the majority of vitamin E in basal conditions. However, in oxidative stress conditions, TTP expression increases in the astrocytes to facilitate tocopherol delivery to the neurons to protect them from damage. Therefore, the regulation of TTP in astrocytes may be the key to controlling the vitamin E levels in Purkinje neurons, the cells compromised in some neurodegenerative diseases. Future experiments will address the alterations in the signaling mechanisms between astrocytes and neurons in vitamin E deficient conditions.

Chapter 4 figures Figure 4.1 TTP mRNA and protein are expressed in various brain regions. A. Indicated regions of the brain from a ten weeks old C57Bl6 mouse were harvested for TtpA and actin mRNA expression using RT-PCR. B. Immunoblotting of TTP protein expression from indicated tissues of 10 weeks old C57Bl6 mouse, or the cerebellum (CB) of an 8 days old C57Bl6 mouse. BS- brainstem; CB- cerebellum; CX-prefrontal cortex; HP- hippocampus; MB- midbrain; 8d CB (cerebellum from 8 days old mouse).

A B

106

Figure 4.2 TTP expression is increased in astrocyte-enriched cultures. Primary cerebellar cells prepared as described in ‘Methods’ were grown in culture for 2 days (neuron-enriched culture) and 6 days (astrocyte-enriched culture). Cells in culture for 2 days (A) and 6 days (B) were stained with the astrocyte marker GFAP (red) and the neuronal marker β-tubulin III (green). Scale bars: 20μm; Magnification B: 20X, C: 40X. (C) RNA was harvested to measure TtpA, Tubb3 (neuronal marker) and Gfap (astrocyte marker) mRNA expression using Real-time PCR.

107

Figure 4.3 TTP localizes to GFAP-positive cells and is excluded from β- tubulin III positive cells in primary cerebellar cultures. Primary cerebellar cells prepared as described in ‘Methods’ harvested after 6 days in culture were stained with rabbit anti-human TTP (green), in combination with the astrocyte marker GFAP (red; top) or the neuronal marker β-tubulin III (red; bottom). The yellow in the merged image indicates co-localization of TTP in GFAP positive cells; whereas, note the lack of co- localization between TTP and β-tubulin III. Magnification: 100X; scale bar: 20μm.

Figure 4.4 TTP co-localizes with GFAP-positive cells and is excluded from β-tubulin III-positive cells in organotypic cerebellar slice cultures. Cerebellar organotypic cultures were grown for 7 days prior to staining with anti-TTP (A- E), the astrocyte marker GFAP (A, C, D) or the neuronal marker β-tubulin III (B, E) and visualized by fluorescence microscopy. Yellow staining in the merged images indicates co-localization of TTP and GFAP (A, C, D). Blue staining in the merged images is the nuclear stain Dapi. Magnification: 20X (A), 40X (B, C, E) or 100X (D). Scale bars: 20μm. GCL: granular cell layer; PCL: Purkinje cell layer. (Figure next page).

108

109

Figure 4.5 Tocopherol secretion correlates with increased TTP and GFAP expression in glia. Primary cerebellar cells grown in culture for 2 days (neuron- enriched) or 6 days (astrocyte-enriched) were loaded with [14C]-α-tocopherol, and secretion activity measured as described in ‘Methods’. HepG2-TetOn-TTP cells served as the positive control [33]. Shown are averages and standard deviation of quadruplicate wells. * indicate p <0.05 in neuron-enriched versus astrocyte-enriched culture and HepG2 + doxycycline versus no doxycycline, as determined by Student’s T- test.

110

Figure 4.6 NBD-tocopherol is localized in GFAP-positive and TTP expressing cells. Primary cerebellar cells maintained in culture for 5 days were loaded with NBD-tocopherol (green) for 16 hours followed by a 3 hour chase period. Cells were then stained for antibodies against TTP, GFAP or β-tubulin III to reveal localization of the NBD-tocopherol in GFAP- and TTP-positive cells. Magnification: 40X; Scale bar: 20μm.

111

Figure 4.7 TTP expression increases in primary cultures challenged with oxidative stress. DCF-DA assays using neuron-enriched (A) or astrocyte-enriched (B) cultures were used to measure peroxide-induced oxidative stress as described in methods. The primary cerebellar cells were pretreated with 10 μM (◊) or 100 μM (□ ) d-α- tocopherol, 1 mM N-acetyl cysteine (NAC;▲ ), or without (○) antioxidants for 16 hours followed by a 3 hour challenge with indicated concentrations of H2O2 . *indicates statistical significance of p<0.05 among indicated samples, as determined by a Student’s T-test. B. Real-time PCR of TtpA expression normalized to 18s in neuron-enriched (C) or astrocyte-enriched (D) cultures *indicates statistical significance of p<0.05 in indicated samples draw a bar between relevant points, as determined from a Student’s T-test.

112

Figure 4.8 Proposed model of TTP expression in normal and oxidative stress conditions in the brain TTP is selectively expressed in in astrocytes, where vitamin E is localized. Upon induction of oxidative stress microenvironments, TTP expression in astrocytes is increased, leading to enhanced secretion of vitamin E from the astrocyte, in an ApoE-mediated pathway. The lipoprotein-complexed vitamin is taken up into the neighboring Purkinje (and possibly other) neurons, where it is used to quench lipid radicals and protect neurons from oxidative stress-induced damage.

Materials and Methods RNA harvest and PCR

RNA was harvested using Trizol reagent (Invitrogen, Grand Island, NY) followed by reverse transcription using a High Capacity cDNA Reverse Transcription Kit

(Applied Biosystems, Foster City, CA). Primers for PCR amplification of TTP from different brain regions of 10 weeks old C57BL/6J mice were: (forward) 5’

113

CTCACAGACGCTTTCCTGCT and (reverse) 5’ACAGCACATCCC AGCTACTG -

3’. TTP expression was normalized to β-actin expression using the following primers: (forward) 5’TGTGATGGTGGGAATGGGTCAGAA and (reverse)

5’TCTCCTTCTGCATCCTGTCAGCAA. Taqman expression assays for Fam- labeled TtpA (Mm00803829_m1) and VIC-labeled 18s (Hs99999901_s1) were used in combination with Fast Universal PCR Master Mix (Applied Biosystems) in a 96 well format on a StepOnePlus real time PCR machine (Applied Biosystems).

TTP expression in primary cerebella cultures was determined using comparative real-time PCR applying the Livak method [270]. To assess TTP expression in conditions of oxidative stress, primary cerebella cultures were treated with indicated concentrations of H2O2 (Sigma, St. Louis, MO) for 3 hours prior to RNA extraction.

Immunoblot

Endogenous TTP expression was determined in lysates from flash frozen liver, heart, cerebellum, prefrontal cortex, whole brain, hippocampus, and midbrain of 8 days old or 10 weeks old C57Bl/6 mice using a rabbit polyclonal CW201P antibody. The CW201P antibody was generated against the entire coding region of human TTPA and protein G Sepharose purified (Covance, Denver, PA).

A secondary HRP-conjugated rabbit antibody in combination with SuperSignal

West Dura substrate (Thermo Fisher Scientific, Inc., Rockford, IL) was used for visualization.

114

Primary cerebella dissociated cell culture

Cerebella were removed from eight days old C57Bl/J6 mice as described in a previous report [348]. Cerebella were dissected into HBSS w/o magnesium, calcium and phenol red (Invitrogen), mechanically dissociated with a razor blade, followed by chemical dissociation in 0.25% trypsin/EDTA at 37C for 10 minutes.

Cells were triturated and strained through a 70uM nylon strainer (BD

Biosciences, Bedford, MA) followed by underlying with FBS and centrifugation at

800 RPM for 5 minutes. The cells were resuspended in 10% FBS/DMEM

(Invitrogen) and plated on poly-L-lysine (Sigma) coated coverslips (Bellco Glass,

Inc., Vineland, NJ). Twenty-four hours after plating cell media was changed to a

1:1 mix of 10% FBS/DMEM and Neurobasal media containing B27 supplement, 2 mM L-glutamine, 5 mM KCl and 0.6% glucose. Media was changed every third day. Cells gown in culture for 2 days were designated ‘neuron-enriched cultures’ whereas cells kept in culture for 8 days were labeled as ‘astrocyte-enriched cultures’.

Cerebellum organotypic slice culture

Slice cultures were obtained from the cerebellum of 8 days old C57Bl/J6 mice modified from the protocol described for hippocampal slice cultures [349].

Cerebella were removed and sagittally sliced into 300 μm sections on a McIlwain tissue chopper. Slices were incubated in HBSS + 0.5% glucose for 30 minutes at

4°C and transferred onto 0.4 μm PTFE (polytetrafluoroethylene) membrane

(Millipore, Billerica, MA) inserts placed into 6 well dishes containing cell culture media (25% HBSS, 50% MEM, 25% horse serum, 0.5% glucose) below the

115 membrane. Care was taken to ensure no liquids were sitting on top of the membrane, so the slice culture to maintain optimal oxygen exchange. Media was changed every third day and slices were kept in culture at least 7 days.

Immunofluorescence microscopy

Serum-complexed NBD-tocopherol [33, 350] was loaded into primary cerebella dissociated cultures for a 16 hour incubation. Primary dissociated cells grown in culture for 2 or 6 days were fixed in 4% PFA, permeablized in 5% goat serum/0.3% triton X-100 followed by incubations in 1:1000 anti-TTP antibody

(CW210P), 1:1000 mouse anti-β-tubulin III (Sigma), or 1:400 mouse anti-GFAP

(Becton Dickenson, Franklin Lakes, NJ ). Goat anti-rabbit Alexa 568 (Invitrogen) was coupled to TTP, whereas goat anti-mouse Alexa 488 (Invitrogen) was used as the secondary antibody for β-tubulin III and GFAP. Dapi staining was used to visualize the cell nuclei, followed by mounting in SlowFade Gold antifade reagent

(Invitrogen) before imaging on an inverted (Leica DM4100B) or confocal (Zeiss

LSM 510) microscope. Cerebellar slice cultures were immunostained according to the previous published technique [351] using the same antibodies and concentrations as used for the primary dissociated cultures.

14[C]-α-tocopherol Secretion assay in primary cerebellar cultures

The secretion assay was performed as previously described [33]. Briefly, +/- doxycycline-treated HepG2-TetOn-TTP cells were used as controls for TTP expressing and non-TTP expressing cells. Beginning on days 2 and 6 of primary cerebellar cells in culture, serum-complexed 14C-α-tocopherol was loaded into the cells for 48 hours, extensively washed and further incubated in DMEM for the

116

24 hour secretion period. The secretion media was saved and pooled with the media from two subsequent washes. Finally, cells were lysed to determine the percentage of 14C-α-tocopherol remaining in the cells. A LS 6500 multi-purpose scintillation counter (Beckman Coulter, Ramsey, MN) was used to count the 14C- tocopherol from the “load”, “secretion” and “lysed” cells to determine the percent of 14C-α-tocopherol secreted into the media.

Reactive Oxygen Species

Primary cerebellar cells were plated into 96 well poly-L-lysine coated black plates

(Costar, Corning, NY) and cultured for 1 or 5 days when 16 hour treatments with

10 μM or 100 μM d-α-tocopherol (Acros Organics, NJ) or 1 mM N-acetyl cysteine

(Sigma) were started. The following day the media was changed and the cells were washed. An hour-long incubation in 10 μg/ml dichloro-fluorescein diacetate

(H2DCF-DA) in HBSS without phenol red (Invitrogen) preceded the 3 hour challenge with indicated concentrations of H2O2. The presence of cleaved DCF was determined by reading the washed cells on a Perkin Elmer Victor 3 multilabel plate reader (San Jose, CA) using the 485 nm excitation/ 535 nm emission filters. The amount of DCF fluorescence correlates to the intracellular reactive oxygen species content (ref). DCF was normalized to DNA content by incubation with 2.5 μg/ml Bisbenzamide (Sigma) in 2 M NaCl, 50 mM Na2HPO4 pH 7.4 in the dark at 37C for 60 minutes after the DCF-DA and H2O2.

Bisbenzamide fluorescence was read on a Perkin Elmer Victor 3 plate reader using the 365 nm excitation/ 460 nm emission filters.

117

Chapter 5 Vitamin E levels in mouse models of human disease Abstract: Vitamin E is a family of neutral plant lipids comprised of tocopherols and tocotrienols. Alpha-tocopherol is the form that possesses the highest biological activity and is therefore considered the major lipid soluble antioxidant.

Alpha-tocopherol deficiency is associated with fat mal-absorption and oxidative stress-related diseases such as Cystic fibrosis, Downs’s syndrome and

Alzheimer’s disease. Our investigation into the vitamin E status in mouse models of human disease, including Ataxia Telangiectasia, Alzheimer’s disease,

Ataxia with vitamin E deficiency, Cystic Fibrosis and Niemann-Pick Type C disease, determined that vitamin E levels increased with age at a rate comparable to wild-type control animals. Vitamin E levels were variable in different regions of the brain—cortex, cerebellum and hippocampus. In mouse models of Ataxia Telangiectasia and Cystic Fibrosis vitamin E status was within an acceptable range in brain tissues and liver. However, the hippocampus of

Alzheimer’s disease mice displayed a 2-fold increase in vitamin E compared to

WT controls (p<0.05). This suggested there were “microenvironments” of vitamin

E in the brain which may be influenced by age and disease conditions.

Importantly, vitamin E plasma levels did not correlate with tissue levels in the

Alzheimer’s disease and Niemann-Pick Type C models. Whereas plasma E levels were normal in the AD, Npc1-/- and Npc2-/- mice, tissue levels were altered suggesting plasma vitamin E levels do not always reflect vitamin E tissue status.

Taken together, there seems to be very specific perturbations of vitamin E status in mouse models of human disease that may influence disease progression.

118

Introduction Vitamin E refers to a family of neutral plant lipids comprised of tocopherols and tocotrienols. As a result of hepatic alpha tocopherol transfer protein (TTP) and the CYP450 enzyme Cyp4f2, the naturally-occurring RRR-alpha-tocopherol

(tocopherol) is preferentially retained over all other vitamin E forms [63, 124].

These discriminatory mechanisms result in a 90 % enrichment of plasma and tissue alpha-tocopherol levels compared to non-alpha tocopherols [8, 27]. In the liver alpha-tocopherol is packaged in VLDL lipoproteins and exchanged into HDL and LDL particles in the circulation for delivery to non-hepatic tissues. Thus, vitamin E status often mirrors lipid status. As a result, plasma alpha-tocopherol levels cannot merely be expressed without consideration of cholesterol and/or phospholipid levels [352, 353]. However, the most accurate method of standardization is debatable, in part because disease conditions may affect lipid synthesis, absorption and transport [354, 355].

Alpha-tocopherol serves as the major lipid soluble antioxidant. Vitamin E exerts its protective antioxidant activity by scavenging free radicals generated from lipid peroxidation of polyunsaturated fatty acids (PUFAS) in the cell membranes [85,

356, 357]. Research of diseases that are associated with oxidative stress, like

Cardiovascular disease (CVD), Diabetes and Alzheimer’s disease (AD) have confirmed beneficial effects of vitamin E [88, 358-360]. Furthermore, vitamin E treatment has been shown to be efficacious in combating neuro-inflammatory diseases like AD, Parkinson’s disease (PD), and Down’s syndrome (DS) by decreasing oxidative stress [295-297] [298]. In rodents, vitamin E treatment delayed the loss of cognitive and motor performance that was attributed to

119 oxidative-stress related damage [299]. Additionally, early intervention with vitamin E supplementation in a mouse model of AD (Tg2576) exhibited decreased Aβ levels, amyloid deposition and delayed tau protein development

[193, 361].

Normal human vitamin E plasma levels are in the range of 7.8-12.5 mg/l or 18-29

μmol/l [249]. Primary vitamin E deficiency results from a mutation in the tocopherol transfer protein gene TTPA, which causes a heritable disease, termed

Ataxia with vitamin E deficiency or AVED (OMIM #277460). AVED is characterized by extremely low vitamin E levels, spinocerebellar ataxia and loss of deep tendon reflexes. Secondary vitamin E deficiency results from fat mal- absorption diseases, including Abetalipoproteinemia (OMIM #200100), hypolipoproteinemia (OMIM +107730), chylomicron retention disease (OMIM

#246700), Tangiers disease (OMIM #205400), and cystic fibrosis (OMIM

#219700) (See table below for description of diseases). Like AVED, there is evidence these diseases can lead to a compromised neuropathology. Therefore, vitamin E supplementation is a standard therapy to prevent the neurological maladies [362] [363-367]. Taken together, vitamin E should be considered a critical element in maintaining neurological health.

120

Disease Gene Description defect AVED TTPA Vitamin E not delivered to extra-hepatic tissues due to mutations in TTP [126, 127] Abetalipoproteinemia MTP Mis-regulation of chylomicron and VLDL assembly in the intestine and liver [368] Cystic Fibrosis CFTR Exocrine pancreatic insufficiency results in fat mal-absorption Chylomicron retention SAR1B Defect in intestinal lipid transport resulting disease from incomplete chylomicron formation [369] Hypobetalipoproteinemia Apo-B Decrease apoB and LDL owing to truncated apoB [370] Tangier’s disease ABCA1 Reduced levels of HDL due to ABCA1 mutation [371] Table 5.1 Genetic diseases associated with low plasma vitamin E levels and compromised neurological function.

Considering vitamin E is the major fat-soluble antioxidant and vitamin E supplementation shows promising beneficial effects in disease prevention, it is important to determine the vitamin E status in mouse models of oxidative stress and/or fat mal-absorption. To this end, we obtained tissues and/or plasma from animal models of Ataxia Telangiectasia (OMIM #208900), Cystic Fibrosis,

Niemann-Pick disease, Type C1 (OMIM #257220), Alzheimer’s disease (OMIM

#104300) and AVED mice with the goal to determine if vitamin E status was compromised in these animal models of human disease. Additionally, we aimed to delineate if plasma vitamin E status is a reliable marker for tissue vitamin E levels [27, 29].

Description of human disease and mouse models Ataxia with Vitamin E Deficiency (AVED). AVED is the only syndrome that results in primary vitamin E deficiency [80, 126, 148]. It is an autosomal recessive disease caused by a heritable mutation in TTPA [126, 372-374]. There have been nearly 20 mutations identified in TTPA to date. The severity of the

121 mutation results in a range of onset from 2 - 52 years of age. Characteristics of

AVED include spinocerebellar ataxia, loss of deep motor tendons, retinitis pigmentosia and extremely low vitamin E levels [126, 127]. Doses of at least 800 mg/day, to upwards of 2 g/day of vitamin E supplementation are required to achieve improvement of these symptoms.

The Ttpa-/- (B6.129S4-Ttpatm1Far/J) mouse model was developed by targeted disruption in exons 1 and 2 of the TtpA gene [39]. These mice have a similar phenotype to AVED patients, namely they develop spinocerebellar ataxia

(around 12 months) and have extremely low vitamin E levels. Additionally female

Ttpa-/- mice are infertile, in line with the translation of tocopherol (from the Greek tokos = childbirth, phero = to bear). Consistent with vitamin E’s role as a major lipid soluble antioxidant, markers of oxidative stress are also increased in Ttpa-/- mice [138].

Ataxia Telangiectasia (AT). AT is an autosomal recessive neurological disease that is characterized by progressive cerebellar ataxia, choreoathetosis, growth retardation, incomplete sexual maturation and an increased sensitivity to ionizing radiation, resulting in the manifestation of tumors [375-378]. Death usually occurs between the ages of 10 and 20 years old due to neurodegeneration, specifically of the Purkinje and granule neurons. Most mutations in the ATM gene cause a frameshift to the amino acid sequence which results in the production of a truncated protein. ATM is a serine/threonine protein kinase critical in phosphorylating proteins associated with DNA double-strand break repair and intracellular redox balance [377-379]. Catalytic antioxidant treatments

122 of SOD/catalase mimetic, α-lipoic acid and 5-carboxy-1,1,3,3- tetramethylisoindolin-2-yloxyl (CTMIO), prevented oxidative stress-induced protein and DNA damage, especially to the Purkinje neurons in the cerebellum of

Atm-/- mice [375, 376, 380]. Given low vitamin E levels contribute to neurodegeneration of Purkinje cells, in combination with the fact that antioxidants have been shown to be efficacious, there is reason to analyze the tocopherol levels in the mouse model of AT.

The Atm-/- (C.129S6-Atmtm1Awb/J) mice were generated by gene targeting disruption of exon 15 as described in Barlow et al [381]. The Atm-/- mice have compromised neurological function, as assessed by 3 separate behavioral tests beginning at two months of age. Additionally, both female and male mice are infertile and like AT patients, they are sensitive to irradiation and have mis- regulated redox homeostasis [377, 381, 382]. Increased signs of oxidative stress, including heightened SOD and thioredoxin levels with decreased glutathione levels are evident in Atm-/- mice at three months of age.

Cystic Fibrosis (CF). Cystic fibrosis, the most common lethal autosomal recessive disease, is caused by one of the 1000 identified mutations http://www.genet.sickkids.on.ca/cgi-bin/WebObjects/MUTATION in the cystic fibrosis transmembrane conductance regulator. CFTR functions to regulate sodium chloride transport and loss of function results in thick mucus that is essentially a breeding ground for Pseudomonas aeruginosa lung infections.

Other clinical manifestations of CF include stunted growth, male sterility, and pancreatic insufficiency, resulting in decreased fat absorption [383]. Prior to

123 supplementation with pancreatic enzymes and fat-soluble vitamins, numerous cases of neuropathy associated with vitamin E deficiency were documented [363,

384-386]. Lipid peroxidation has also been documented in CF [387, 388].

Therefore taken the pancreatic insufficiency and oxidative stress associated with

CF, maintaining adequate vitamin E status is essential.

The S489X (B6.129P2-Cftrtm1Unc/J) mutation introduces a stop codon into exon 10 of Cftr, resulting in a truncated protein product that is reminiscent of human mutations. The S489X mice require a liquid diet of Peptamen to avoid premature death associated with intestinal obstruction. Although there are multiple CF mouse models, the S489X is an appropriate model to investigate the intestinal alterations that contribute to decreased fat absorption, including vitamin

E. These mice are described by Snouwert, J et al [389].

Alzheimer’s Disease (AD). Alzheimer’s disease is the most common cause of dementia in aging humans. The cause of the disease is still under investigation, but there is evidence that amyloid plaques, neurofibrillary tangles and oxidative stress all contribute to the neurodegeneration associated with the disease.

Amyloid plaques are produced from the increased cleavage of amyloid precursor proteins (APP) to form Aβ proteins; whereas, the neurofibrillary tangles are products of increased hyperphosphylated tau proteins. The oxidative stress theory of Alzheimer’s disease hypothesizes that reactive oxygen species are signaling initiators of the Aβ plaques and tau proteins. Numerous studies in humans [307, 390-392] and mice [393-397] support the notion that vitamin E has an efficacious role in preventing and/or slowing the progression of AD.

124

Therefore, analyzing the vitamin E levels in AD is fundamental to understanding the oxidative stress progression of the disease.

The B6;129-Psen1tm1Mpm Tg (APPSwe,tauP301L)1Lfa/Mmjax transgenic mouse model for AD is also referred to as the 3xTg-AD mouse. In addition to the

Psen1 mutation, the 3xTg-AD mice are injected with two transgenes: 1) the human Aβ precursor protein harboring the APPSwe mutation, which consists of

LYS670→ASN and MET671→LEU and 2) the mutant tauP301L. The pathologies of these mice mimic the Aβ plaques and tau protein formation found in humans with AD. Additionally, the mice present with increasing markers of oxidative stress at 8 months old followed by impaired learning at 9-10 months of age.

These mice were generated and described in [398].

Niemann-Pick Type C (NPC1, NPC2). Niemann-Pick disease type C (NPC) is an autosomal recessive lysosomal storage disorder that results from the loss-of- function mutations in the NPC1 or NPC2 genes. Mutations in either NPC1 or

NPC2 genes result in the same phenotype, which includes massive accumulation of unesterified cholesterol, gangliosides, sphingolipids and other lipids, especially in the vesicles of the endocytic pathway [194, 195, 399]. The lipid accumulation is accompanied by neurodegeneration (especially localized to the cerebellum

[199, 217, 259), liver dysfunction, hepatosplenomegaly, and premature death usually by the second decade of life {Vanier, 1991 #13394, 400, 401]. Oxidative stress is also reported to be a contributing factor to NPC disease [264, 402].

Thus, taken together, the mis-localization of vitamin E likely compounds the

125 neurodegenerative phenotype and exacerbates the oxidative stress-related consequences of Niemann-Pick type C disease.

Npc1NIH (BALB/cNctr-Npc1m1N/J) mice arise from a spontaneous mutation in

Npc1 and display a phenotype that resembles Niemann-Pick Type C disease.

Npc1-/- mice begin to lose weight and show increasing levels of sphingomyelin and unesterified cholesterol in the liver, an ataxic gait, and tremors at 7 weeks of age. They also present with progressive Purkinje cell degeneration and die prematurely at around 12 to 14 weeks of age [198, 215, 235, 254, 403]. The mice are described in Loftkus, SK [202].

Npc2tm1Plob mice are hypomorphs produced using a gene targeting approach that introduces an immature stop codon in exon 2. The targeted disruption causes

RNA mis-splicing and therefore Npc2-/- mice display only ~4% of the NPC2 protein levels compared to wild-type levels [227]. Npc2-/- mice begin to show signs of lipid accumulation in the liver and cerebellum at 50 days old, followed shortly thereafter by ataxia and neurodegeneration. Their lifespan is about 3 weeks longer than Npc1-/- mice [205].

Materials and Methods Mouse Tissue Samples

AVED (Ttpa-/-): Snap-frozen cortex and liver samples from 23 months old

Ttpa -/- and littermate WT controls were received from K. Gohil (UC Davis).

Ataxia Telegasticesia (Atm-/-): To investigate vitamin E status in Atm-/- mice at a time-point when oxidative stress has been observed [377], Atm+/- animals were

126 transferred to Case Western Reserve University from Michael Weil (Colorado

State University). The Atm+/- animals were used to breed Atm -/- and Atm+/+ control mice. Snap-frozen prefrontal cortex and cerebellum were used for tocopherol and free cholesterol measurements in both the 4 weeks old and older

3 months old animals. Littermate WT animals were used as controls.

Cystic Fibrosis (S489X): Liver, prefrontal cortex and cerebellum were harvested from 4-8 weeks old S489X and control WT mice. Mice were received from Mitch Drumm, Case Western Reserve University, Cleveland, OH.

Importantly, the tissues from the S489X mice were taken from mice that were recently weaned, thus they were only on Peptamen for 7 days, whereas, WT tissues were taken from 8 weeks old mice.

Alzheimer’s disease (3xTg-AD): Prefrontal cortex, cerebellum, liver and plasma samples from 13 months old male 3xTg-AD mice were received from Mark Smith

(Case Western Reserve University, Cleveland, OH).

Niemann-Pick Disease type C1 (Npc1-/- and Npc2-/-): Prefrontal cortex, cerebellum, liver and plasma from Npc1-/- and Npc2-/- mice and WT littermates were received from Steve Walkley (Einstein College of Medicine, Bronx, NY).

Sample collection has been previously described [200].

Human samples: Human serum samples from NPC1 patients and healthy controls were received from Forbes Porter (NICHD, NIH, Bethesda, MD). Details of the approval and acquisition of the human samples were previously published

[404].

127

Tocopherol and cholesterol measurements by GC-MS:

Tissues: 50 mg of snap-frozen tissues were homogenized in isopropanol and

0.9% NaCl after the addition of 100μM d9-alpha-tocopherol, which served as the internal standard. Lipids were extracted, via a two stage method using ethanol, methyl-tertbutylether (MTBE) and hexane, followed by silylation and derivatization; as described in a previous report [63]. Lipids were analyzed by

GC-MS on a Hewlett-Packard 6890 series gas chromatograph coupled to a

Hewlett-Packard 5872 mass selective detector operated in selected ion mode. A hydrophobic Hewlett Packard HP 19091z-433 HP-1 methyl siloxane column was used for the gas phase at a temperature of 280⁰C. The GC-MS m/z settings for analysis were as described in a previous report for long-chain metabolites [63].

Tocopherol concentrations were determined using an internal standard while free cholesterol levels were determined using a previously established correction coefficient. Normalizing results to weight of tissue yielded nmoles tocopherol/g tissue and mmoles free cholesterol/g tissue.

Plasma: 100uM d9-alpha-tocopherol was added to 50μl plasma and lipids extracted as described above, omitting the homogenization step. Tocopherol and cholesterol were both converted to μmoles/L and finally a ratio of tocopherol to cholesterol was determined.

Software: Graphing and data analysis was done using IgorPro 6.21.

Statistics: Statistical significance was determined using Student’s T-test.

128

Results Tocopherol and cholesterol levels are lower in Ttpa-/- mice than Wild-type littermates. TTP functions to maintain whole body levels of vitamin E. Mutations in TTPA result in the heritable disease ataxia with vitamin E deficiency. Thus it is expected that tissues from animals with a mutation in Ttpa would have low vitamin E levels compared to their WT littermates. Indeed, no tocopherol was detected in the cortex of the Ttpa-/- animals, whereas, liver tocopherol levels were about 15% of the WT levels (Figure 5.1). The presence of vitamin E in the liver of Ttpa-/- mice is not surprising considering dietary vitamin E contained in the normal rodent chow is delivered to the liver, independent of TTP expression.

Thus, once dietary vitamin E reaches the liver where no TTP is expressed it is sequestered and unable to be delivered to extra-hepatic tissues. The Cyp4f2 ω- hydroxylase catabolizes the excessive α-tocopherol in the liver for eventual exit via the bile and urine [62, 63]. The tocopherol/cholesterol ratios are lower in the

Ttpa-/- mice compared to the WT mice, suggesting the overall lipid profile of the

Ttpa-/- mice are compromised. In line with this mis-regulated lipid homeostasis, the cholesterol levels are lower in the liver but significantly lower in the cortex of the Ttpa-/- animals compared to the WT levels. Previous research in rabbits and rats demonstrate that tocopherol levels can affect plasma cholesterol levels, especially when tocopherol levels are low [405-407].

129

50 140 A 45 B WT WT 40 120 ttpa-/- 35 100 ttpa-/-

30 gmoles/

μ 80 25 *

20 tissue) 60 tissue) 15 40 10

cholesterol ( cholesterol 20 tocopherol (nmoles/gtocopherol 5 0 0 CX Liver CX Liver

Figure 5.1 Tocopherol (A) and unesterified cholesterol (B) levels in the cortex (CX) and liver of two years old WT and Ttpa-/- mice. Analytes were measured by GC-MS as outlined in Methods. n=5 WT animals and n=4 Ttpa-/- animals. Shown are the averages and standard deviations. Asterisks indicates significance (p <0.01) compared to WT.

Atm-/- mice have similar brain vitamin E status compared to their wild-type littermates. A hallmark of Ataxia Telangiectasia is progressive neurodegeneration accompanied by cerebellar ataxia and oxidative stress [382].

Vitamin E and cholesterol levels in the pre-frontal cortex and cerebellum of three months old Atm-deficient are not significantly different from WT mice (Figure 5.2).

At three months, Atm-/- mice display compromised motor function, as assessed by rotarod, open-field testing and stride length, however, there is no neurodegeneration evident at this time [381]. Segregating the analysis by gender did not yield statistically significant differences in tocopherol or cholesterol comparisons. Gohil et al also reported no differences between female and male lipid levels [408]. At two months old, mice are under increased oxidative stress as determined by the rise in thioredoxin and SOD levels in combination with decreased glutathione levels; however, there was no difference

130 in lipid peroxidation between Atm-/- and WT mice, even at 4 months [377].

Therefore, we speculate the tocopherol levels did not change in the 3 months old

Atm-/- mice because there is no marked increase in lipid peroxidation at this time-point.

25 100 A atm-/- B

atm-/-

WT 20 80 WT

15 60

10 moles/gtissue)

μ 40

5 20 tocopherol (nmole/g tissue)(nmole/gtocopherol

0 ( Cholesterol 0 CB (F) CB (M) CB (B) CX (F) CX (M) CX (B) CB (F) CB (M) CB (B) CX (F) CX (M) CX (B)

Figure 5.2 Tocopherol (A) and unesterified cholesterol (B) levels in the cerebellum (CB) and cortex (CX) of three months old WT and Atm-/- mice. Analytes were measured by GC-MS as outlined in Methods. n=4 female (F), 6 male (M) WT animals; 6 female (F), 4 male (M) Atm-/- animals; combined male and females (B). Shown are the averages and the standard deviations.

The vitamin E status of young Cystic fibrosis is comparable to wild-type controls. The S489X mutation in the cystic fibrosis transmembrane conductance regulator results in truncated Cftr RNA and consequently a nonfunctional Cftr protein. The generation of this mutation in mice serves as a mouse model for the human CF disease, specifically to investigate the consequences of fat mal-absorption. Cystic fibrosis is an autosomal recessive disorder that often presents with pancreatic insufficiency which results in fat mal- absorption. Analysis of both alpha-tocopherol and unesterified cholesterol levels by GC/MS in the S489X mice demonstrates that the levels are comparable to the wild-type controls. A common regimen in cystic fibrosis therapy is to provide

131 patients with pancreatic enzymes that help facilitate fat absorption. Additionally, due to the decreased intestinal absorption of lipids, vitamin E is supplemented in patients with CF up to 50-fold more than the recommended DRI of vitamin E (2-4 mg/d for infants; 10-15 mg/d for children and adults). The S489X mice are neither supplemented with enzymes or vitamin E; however, they are maintained on a liquid diet of colyte to prevent intestinal obstruction. The CF and WT mice do not show disparities between their weights until about 28 days, which is about the time the mice are weaned from their mothers, suggesting that at four weeks of age the mice are receiving adequate nutrition. Therefore, we speculate the 4 weeks old S489X mice that we measured are vitamin E sufficient due to their young age and the maternal nutrition.

60 100 WT WT 50 cftr-/- 80 cftr-/- 40

moles/g

30 μ

40 tissue)

20 tissue)

Tocopherol (nmoles/gTocopherol Cholesterol ( Cholesterol

0 0 CB CX LIVER CB CX LIVER

Figure 5.3 Tocopherol (A) and cholesterol (B) levels in the cerebellum (CB), cortex (CX) and liver of young WT and Cftr-/- mice. Analytes were measured by GC-MS as outlined in Methods. n=3 WT and 3 Cftr-/- mice. Note: WT mice were 8 weeks old and Cftr-/- mice were 4 weeks old. Shown are the averages and standard deviations.

Vitamin E accumulates in the hippocampus of AD-afflicted mice. Amyloid plaques, neurofibrillary tangles and oxidative stress are key features of

Alzheimer’s disease. In the hippocampus, which is the brain region affected in

132

AD, levels of vitamin E are 50% greater in the AD mice compared to the WT control mice (Figure 5.4). The cholesterol levels are also higher in the hippocampus of the AD mice. This supports previous evidence that reported there were higher cholesterol levels in the neurofibrillary tangles of the neurons in

AD mice [409]. Also, in line with the relationship between cholesterol and AD, several epidemiological studies have demonstrated that the cholesterol-lowering statins decreased risk of AD [410-414]. The increase in vitamin E localized to the hippocampus may indicate a mechanism to combat the heightened oxidative stress that accompanies AD. Whether the plasma tocopherol and cholesterol levels are presented separately (data not shown) or together (as in C) there is no difference between the tocopherol, cholesterol or tocopherol: cholesterol ratios between the AD and WT mice. These observations support the notion that plasma tocopherol levels are not always predictive of vitamin E status, regardless of cholesterol status.

133

A 25 B 120

WT WT 100 20 * AD AD 80

moles/g

μ 60 10 tissue) 40 5

20 cholesterol ( cholesterol

tocopherol (nmoles/g tissue)(nmoles/gtocopherol 0 0 HP CB CX HP CB CX

C 8.00E-06

6.00E-06

4.00E-06

(mmol/L) 2.00E-06

tocoperol/cholesterol 0.00E+00 WT AD

Figure 5.4 Tocopherol (A) and cholesterol (B) levels in the hippocampus (HP), cerebellum (CB), and cortex (CX) of 13 months old WT and 3XTg AD mice. Tocopherol normalized to cholesterol in the plasma (C). Analytes were measured by GC-MS as outlined in Methods. n=3 WT and 3 AD mice. Shown are the averages and standard deviations. Asterisks indicates significance (p<0.05) WT versus AD mice.

NPC mice have compromised vitamin status. Niemann-Pick type C disease is characterized by accumulation of free cholesterol, sphigomyelins and other lipids; however, vitamin E status has never been examined in this disease. In general, the data indicates that in the cerebella, cerebral cortex and liver, tocopherol trends mimicked cholesterol levels. Specifically, cerebella of 12 weeks old Npc2-/- animals accumulated 30% more tocopherol and cholesterol than WT and Npc1-/- mice. In Npc1-/- animals of any age there was no difference in cerebellar tocopherol or cholesterol status. Cerebellar regions of Npc diseased generally exhibit no net gain in cholesterol, likely resulting from the balance

134 between neurodegeneration and cholesterol accumulation. In the cortex of 7 weeks old Npc1-/- mice there was a significant increase in tocopherol and slight increase in cholesterol (about 1.5-fold). Conversely, in 12 weeks old Npc1-/- mice both tocopherol and cholesterol levels were depleted by 1.5-fold compared to

WT and Npc2-/- mice. The cortex and corpus callosum are regions of the brain that become hypo-myelinated in NPC disease. Cholesterol comprises 25% of myelin in the brain [252-254]. Additionally, low vitamin E levels have been associated with decreased myelination [255-257]. Taken together, decreased cholesterol and tocopherol may contribute to hypo-myelination in 12 weeks old

Npc1-/- mice. The increase in tocopherol in the younger age mice could be associated with the increased glycosphingolipid storage in specific neuronal cell types. Tocopherol may be sequestered in those specific cells. As anticipated, there was massive accumulation of unesterified cholesterol in all Npc1-/- livers.

However, tocopherol accumulated by 2-fold only in 12 weeks Npc1-/- livers. It was interesting that tocopherol did not accumulate in 7 weeks animals in spite of the 12-fold increase in cholesterol accumulation.

135

Cerebellum tocopherol Cerebellum cholesterol A 25 B 200 WT WT NPC1 * NPC1

20 150 NPC2 NPC2 15 100 p=.056

10 nmoles/g tissuenmoles/g

moles/gtissue 50

5 μ

0 0 7 wks 12 wks 7 wks 12 wks

C Cortex tocopherol D Cortex cholesterol 25 120

WT WT

100 NPC1 20 NPC1 NPC2 NPC2 80 15 * * 60 10

moles/gtissue 40

μ nmoles/g tissuenmoles/g 5 20

0 0 7 wks 12 wks 7 wks 12 wks

E Liver tocopherol Liver cholesterol 40 F

WT WT

35 NPC1 * 150 NPC1 30 NPC2 * NPC2 25 20 100

15 *

moles/g tissuemoles/g

μ nmoles/g tissuenmoles/g

10 50

5 0 0 7 wks 12wks 7 wks 12wks

Figure 5.5 Tocopherol (A, C, E) and cholesterol (B, D, E) levels in the cerebellum, cortex and liver of WT, Npc1-/- and Npc2-/- mice. Analytes were measured by GC-MS as outlined in Methods. Shown are the averages and the standard deviations. n=3 mice of each genotype. Asterisks indicates significance (p<0.05) versus age-matched controls.

Plasma vitamin E levels are normal in NPC mice and humans. Although there were perturbations in the tocopherol and cholesterol levels in the tissues of the Npc-/- mice there was no difference in the plasma levels. The lack of variation in tocopherol plasma levels was consistent with reports describing

136 that there was no difference in free cholesterol plasma levels in Npc mice [196].

Furthermore, we found no differences in the plasma alpha- and gamma- tocopherol as well as the unesterified cholesterol levels in a cohort of NPC1 patients. We included measuring the levels of gamma-tocopherol in our human

NPC1 cohort of patients because it is the most abundant form of the vitamin E family in the western diet. However, as a consequence of alpha tocopherols’ higher affinity for TTP compared to gamma-tocopherol, alpha tocopherol is preferentially retained in the body and is therefore highly enriched in the plasma.

We speculate that although there was no difference in the tocopherol levels in the plasma, the tissue status of NPC patients may be altered, as we observed in the Npc mice. Furthermore, in addition to the tissue status, the location of the vitamin E requires evaluation. The de novo synthesis of cholesterol increases in

Niemann-pick type c disease because the cholesterol sequestered in the vesicles of the endocytic pathway does not reach the endoplasmic reticulum to down- regulate HMGCoA reductase and SREBP1. Therefore, the cholesterol accumulation in the endocytic vesicles is an example of how the location of a particular lipid can affect the homeostatic mechanisms. This mis-localization may have the same deleterious consequences for vitamin E. Identifying an accurate indicator of tissue vitamin E status is critical.

137

Niemann-Pick Type C model Plasma A0.000007 WT 0.000006 NPC1 0.000005 NPC2 0.000004 0.000003 0.000002

0.000001 tocopherol/cholesterol 0 7 wks 12 wks

B C

Figure 5.6 Tocopherol and cholesterol levels in plasma. Tocopherol normalized to cholesterol (A) levels in plasma of WT, Npc1-/- and Npc2-/- mice. n=3 mice of each genotype. Plasma from 45 NPC1 patients and 20 healthy controls were measured for gamma-tocopherol (B), alpha-tocopherol (C) and normalized to free cholesterol. The median values are represented by the middle line in the boxplot, which separates the upper and lower quartiles.

Discussion The ability of alpha-tocopherol to scavenge free radicals designates it as the major lipid soluble antioxidant. Accordingly, alpha-tocopherol is often supplemented in people with oxidative stress-related diseases, including Down’s syndrome, AD and Parkinson’s disease [295, 415-418]. Given tocopherols lipophilic nature, people with fat mal-absorption diseases, including

Abetalipoproteinemia, Cystic fibrosis, chronic liver disease and Tangiers disease are at an increased risk of vitamin E deficiency and developing vitamin E deficient neuropathies [368, 371, 419, 420]. Therefore, it is important to assess

138 the tocopherol status in mouse models of oxidative stress and fat mal-absorption related human diseases. A general observation of the vitamin E analysis, irrespective of various genotypes, was a 2- to 3-fold increase in tocopherol levels with age. This finding has been previously reported in the vitamin E literature comparing Ttpa-/- mice and age matched controls [408, 421, 422]. It has been suggested the age-related increases in tocopherols are a compensatory mechanism to combat increased oxidative stress with age [423]. Additionally, the increased tocopherols can be attributed to the increased intestinal absorption that accompanies aging. In support of this idea, four month old rats absorbed one-fifth of infused tocopherols compared to 24 months old rats which absorbed over half [424]. Another common finding to this study, that has been previously demonstrated [408], amongst the mouse disease models of AT, CF, AD and

NPC, there were higher tocopherol levels in the cortex than the cerebellum.

However, the TTP levels have been shown to be higher in the cerebellum than the cortex [138]. Taken together, these data suggested that the higher TTP facilitated transport of tocopherol from the cerebellum to other regions of the brain, where it is needed.

As expected, the tocopherol status was severely compromised in the cortex and liver of Ttpa-/- mice. Tocopherol levels tend to mimic cholesterol levels. The cholesterol levels were also decreased in the cortex and livers of the Ttpa-/- animals. These results suggested that tocopherol can regulate cholesterol levels. Indeed, HepG2 hepatocytes treated with tocopherol resulted in decreased cholesterol synthesis that was attributed to tocopherols regulation of

139

SREBP-c [118]. Additionally, several studies, in rabbits and rats, have demonstrated that tocopherol levels can alter plasma cholesterol levels [405-407,

425].

ATM is a disease that results in increased susceptibility to irradiation, tumor development, ataxia and oxidative stress. The vitamin E levels in the cortex and cerebellum of Atm-/- animals were similar to the levels in the age matched WT controls. Oxidative stress in the Atm-/- mice begins to appear at 2 months of age, followed by compromised motor function at 3 months and finally a manifestation of ataxia at 8 to 9 months [377, 382]. Therefore, our assay of the mice at the 3 months’ time-point demonstrated the Atm-/- mice have a sufficient amount of tocopherol to combat the early stages of oxidative stress, and it may be meaningful to assess tocopherol status at a more advanced age. These results suggest that decreased tocopherol levels do not contribute to the onset of the disease but may be more critical in the later stages when the animals develop ataxia. This notion is consistent with the fact that vitamin E deficiency causes ataxia [126].

Given the lipophilic nature of tocopherols, there is an increased risk of inefficient absorption of vitamin E and other lipids in the enterocytes of people with fat mal- absorption diseases. Insufficient exocrine pancreatic function in CF patients requires that pancreatic enzymes are administered to aid in absorption of lipids, including vitamin E [426, 427]. Vitamin E supplementation is a standard therapy

140 for CF. In a 6 week study with an extremely high dose supplementation of 400

IU/d RRR-alpha-tocopherol, vitamin E levels rose from 10.5 μmol/l to 25.7

μmol/l, comparable to control patients (23.6 μmol/l) [428]. Low levels of vitamin

E have been correlated with poor neurological function in Cystic fibrosis [363,

384-386, 427, 429]. These compromised neurological manifestations in CF were more prevalent prior to the implementation of increased fats and pancreatic enzymes added to CF patients diets [430, 431]. The lung inflammation in CF is associated with an increased degree of oxidative stress [387, 388]. However, there have been no studies analyzing the effect of vitamin E on the oxidative stress and lung function in CF. Taken together the antioxidant activities of vitamin E have a vital protective role in CF. Mice with a S489X mutation resulting in a truncated Cftr had vitamin E levels comparable to the WT mice. Considering the young age of the CF mice (4 weeks) these tocopherol levels may reflect the vitamin E remaining in the tissues that was transferred to the fetus during pregnancy. The half-life of the tocopherol in the liver is about 2 weeks whereas in the brain it is significantly longer, upwards of 52 weeks; thus, this suggests there would still be residual tocopherol remaining that was transferred to the pup from the mother [79]. Future studies analyzing tocopherol status along with oxidative stress and inflammatory markers from the bronchoalveolar lavage fluid and brains of CF mice at various time points would help to clarify and understand the relationship between vitamin E, oxidative stress and inflammation in CF.

At a more mechanistic level, there have been reports of the cholesterol pathway in CF and NPC diseases sharing common signaling factors, including STAT1 and

141 cAMP [224, 432], which modulate cholesterol accumulation. In indirect experiments analyzing the regulation of TTP, we showed that IBMX, an inhibitor of cAMP degradation, increased endogenous TtpA expression (see chapter 3,

Figure 3.2). These results implied that increased cAMP activated the expression of TTP to increase the distribution of vitamin E. Moreover, we have previously demonstrated that vitamin E decreased key mediators of cholesterol synthesis

[118]. Taken together, the altered and/or mis-localized vitamin E levels may also contribute to perturbed cholesterol synthesis in CF and NPC diseases.

Interestingly, in the cortex and cerebellum of AD mice there was no difference in the tocopherol levels compared to WT controls. However, in the hippocampal region, which is the region of the brain most affected by AD, the tocopherol levels were significantly increased in the AD mice compared to the WT. There are multiple studies in both humans [306, 390, 391, 433, 434] and animals models

[393, 394, 396, 397] supporting the notion that oxidative stress is involved in initiating and perpetuating AD. Therefore it is reasonable to hypothesize the increased tocopherol in the hippocampus may be a protective mechanism to combat oxidative stress-related damage associated with AD. In mouse models of AD, vitamin E supplementation decreased markers of oxidative stress [435], and formation of Aβ plaques and lipid peroxidation [193, 393]. Furthermore, supplementing AD mice with vitamin E followed by injections with Aβ-peptide prevented the formation of plaques [191, 192]. However, vitamin E supplementation after Aβ-peptide injection did not reverse the plaques, implying

142 that vitamin E is required to prevent and/or slow AD pathologies [193].

Transgenic mice overexpressing human tau protein that were supplemented with tocopherol slowed tau progression [361]. Several lines of evidence from clinical and epidemiological studies point to the association between tocopherol levels and development of AD. Two prospective studies [436, 437] and numerous epidemiological studies found an inverse relationship between vitamin E levels and the risk of AD [438, 439], as well as noted improvements in cognitive function with increased vitamin E intake [440-442]. To strengthen the case for the efficacy of vitamin E to reduce the risk of AD, an intervention study proved tocopherol supplementation attenuated the progression of AD symptoms in moderate-staged patients [443]. Taken the data together, the overall benefits of vitamin E precipitated The American Academy of Neurology and The American

Psychiatric Association to recommend vitamin E supplementation for patients with AD [418].

The Npc1-/- and Npc2-/- mice yielded both variable age-related and tissue-related results. For a complete discussion of the NPC results I refer the reader to the chapter Vitamin E status is altered in Niemann-Pick disease. However, the data from the NPC and AD mouse models of human disease support the notion that plasma vitamin E levels are not always predictive of vitamin E tissue status. In the AD mice, plasma levels were normal but there was increased tocopherol in the hippocampus. In line with these observations, it has been previously reported that the plasma vitamin E levels in patients with cholestatic liver disease do not accurately reflect tocopherols status [27]. This is reasonable to accept

143 given the tocopherol turnover rates of tissues range from days (lung) to many months (spinal cord) [7, 79]. This suggests not all tissues are in equilibrium with the plasma and liver tocopherol pools. However, these observations raise the question what is the optimal way to assess adequate tocopherol status, especially in disease conditions. 90% of vitamin E is in the bulk lipid stores of the adipose tissues [444] and a needle biopsy yields adequate tissue to assess tocopherol levels. However, the caveat to using a needle biopsy of adipose to measure vitamin E status is the results from the depletion study [76] that demonstrated tocopherol in the adipocytes is not mobilized like other tissues, including the liver, heart and muscle. Therefore, there is a critical need to determine the proper way to evaluate vitamin E status. Until a direct and accurate measurement of tocopherol status is delineated, the best option may be to assess biomarkers of oxidative stress, including metabolites of lipid peroxidation [322, 445].

In conclusion, I found there are definite perturbations of vitamin E status in mouse models of human disease. These results lay a precedence to further examine vitamin E levels at various disease stages. A more complete analysis will aid in correlating disease phenotype and vitamin E levels. Information gained from these studies will advance our ability to delineate the causative relationship between vitamin E levels and disease. Finally, long-term studies can address the efficacy of vitamin E supplementation in prevention versus reversal of disease.

144

Chapter 6 Overall Summary and Future Directions

6.1 Overall Summary Vitamin E (tocopherol) is accepted as the major lipid soluble antioxidant. The function of vitamin E is to scavenge free radicals that are propagated during lipid peroxidation of polyunsaturated fatty acids (PUFAS), thereby protecting cellular membranes from damage. Therefore, understanding the mechanisms that govern intracellular tocopherol transport is critical to maintaining human health, especially in oxidative stress-related conditions. A great deal of our understanding about tocopherol transport has been delineated in the liver. It is accepted that vitamin E is preferentially taken up in HDL lipoproteins via the SR-

BI receptor and follows the endocytic pathway to the lysosomes [51]. In support of this Srb1-/- mice have low vitamin E tissue levels [37]. Two functional residential lysosomal proteins, NPC1 and NPC2, are required for vitamin E egress out of the lysosomes [29, 446]. Within 30 minutes after uptake of a fluorescent vitamin E analogue, TTP and tocopherol co-localize [33]. TTP is transiently associated with lysosomes, although it lacks a bona fide lysosomal targeting motif. The recognized function of TTP is to bind and transfer tocopherol between intracellular membranes, thereby regulating the whole body status of vitamin E [33, 44, 45, 51, 156]. The critical function of TTP is underscored when recognizing that mutations in TTP result in a heritable disease characterized by spinocerebellar ataxia and very low vitamin E levels [126, 447]. Evidence to define the unknown intracellular vesicles involved in vitamin E transport arise from the observation that treatment with colchicine, a microtubule depolymerizing

145 agent, inhibits vitamin E secretion in hepatocytes [33, 64]. Finally, secretion of vitamin E into lipoprotein particles is blocked with the ABCA1 inhibitor glyburide, suggesting egress of vitamin E occurs via the ABCA1 transporter. Additional support of ABCA1 participation in vitamin E transport is demonstrated in Abca1-/- mice [58] and patients with Tangiers disease, both conditions resulting in extremely low vitamin E levels. People with Tangier’s disease, which is caused by a disruption in the ABCA1 transporter, also exhibit neuropathy [56, 57, 448].

Figure 6.1 Schematic summarizing tocopherol transport in hepatocytes.

Taken all this information together, it is clear we understand a great deal about the mechanism of tocopherol transport in hepatocytes. Furthermore, it is undeniable that TTP regulates tocopherol localization in the liver. However, many important questions remain unanswered. These include: First, what is the mechanism of tocopherol exiting the lysosomes and how does TTP participate in

146 the removal of the tocopherol from the lysosomes? Second, are there accessory proteins that interact with TTP to facilitate TTP’s localization to the lysosomes?

Third, what are the intracellular transport vesicles that tocopherol uses for transport? Finally, is this defined tocopherol transport pathway in hepatocytes similar to the mechanism in extra-hepatic tissues?

My thesis work aimed to answer some of these questions. Specifically, I investigated the mechanism of tocopherol transport in the lysosomes.

Additionally, I examined the TtpA promoter in order to gain insight into the molecular-level regulation of this gene. Finally, given the major consequence of vitamin E deficiency is a neurological pathology, I localized TTP in the CNS to learn more about its role in this region.

6.2 Regulation of TTP/TtpA It is clear that tocopherol levels are regulated by TTP/TtpA. This is supported by studies performed in our lab, as well as the linear correlation between vitamin E levels in Ttpa+/+, Ttpa+/- and Ttpa-/- mice [138, 158, 267, 290]. Additional evidence of TTP/TtpA regulation is presented in figures 3.1 and 4.1. The TtpA mRNA levels mimic the TTP protein expression in various tissues (Figure 3.1) as well as different regions of the brain (Figure 4.1) suggesting the existence of a transcriptional regulation of TtpA. However, the nature of this regulatory mechanism is unknown. The previous research investigating this conundrum yielded incompatible results [157, 159-162, 268, 291, 449]. I first examine the regulation of TTP/TtpA in immortalized human hepatocytes (IHH). I determined that TtpA is indeed regulated at the transcriptional level by chemical agonists of

147

PPARα, CREB, oxidative stress and validated human single nucleotide polymorphisms (SNPs). The observation that TtpA is responsive to oxidative stress supports the notion that TTP functions to regulate vitamin E— the major lipid soluble antioxidant. Furthermore, a zebrafish model of chemically-induced oxidative stress demonstrated an increase in TtpA mRNA expression in these conditions [162].

Although our study identified important conditions that induce TtpA, the future aim of this research will be to define the mechanism that underlies this regulation. The approach includes delineating the cis- elements responsible for the TtpA transcriptional activation. Electromobility shift assays (EMSAs) will examine the protein:DNA interaction of putative transcription factors found in the

TtpA promoter, with an aim to identify the cis- regulatory elements. These studies will determine whether a specific transcription factor present in the IHH lysate binds the consensus sequence in the TtpA promoter. To further determine whether the ‘suspect’ transcription factors function in regulating transcriptional activity of the TtpA promoter, a chromatin immunoprecipitation assay (ChIP) will be used. The ChIP experiment determines whether the endogenous transcription factor binds specifically to the TtpA promoter. Transcription factors that we identify by the criteria I describe above (EMSA and ChIP) are further examined by site-directed mutagenesis of the TtpA promoter luciferase reporter constructs

(Stratagene QuikChangeXL). Site-directed mutagenesis abolishes binding of the implicated transcription factor to the DNA recognition site of the TTPA/TtpA promoter. Transfection of the mutated promoter luciferase reporter constructs

148 permits determination of the functional significance of the transcription factor.

Taken together these experiments outline an approach to delineate what cis- elements are controlling TtpA regulation. However, it is feasible the element, or an accessory factor (i.e. enhancer, repressor, intronic sequence [277-280]) contributing to TtpA regulation, lies outside the 2 kilobase promoter region we are interrogating.

6.2.1 Single Nucleotide Polymorphisms effect on TtpA regulation In addition to investigating the chemical modulators of TtpA I interrogated the promoter region to identify validated SNPs and examine their effect on TtpA regulation. I choose to examine twelve validated SNPs that occurred in a population at penetrance rate frequent enough to detect the different alleles. The importance of the frequency rate is critical in follow up translational studies with human subjects. If the penetrance of a particular SNP is very low, then future studies will require a larger population to achieve power and significance. I used molecular cloning to mutate the SNPs in a 2 kilobase region proximal to the ATG translational start site of TTP. We concluded that the SNP changes at -1752T

(rs12056582), -1408G (rs6472071), and -345T (rs75371508) nucleotide bases from the 3’ end of the TtpA promoter increase transactivation of TtpA by at least two-fold. Conversely, polymorphic changes at -1408A (rs6472071), -980T

(rs6994076), -674T (rs80169698), -439G (rs73684515) and -934G (rs34358293) resulted in at least a 50% inhibition of promoter activity. Thus, I reported that these SNPs can profoundly affect the regulation of TtpA. I am presently performing a computational analysis to determine what transcription factors are altered as a result of the SNPs. I will pursue the candidate factors using the

149

ChIP methods I describe above. Interestingly, mutating the SNP at -980

(rs6994076) to the minor allele (A>T) virtually abolishes the activity of the promoter in our reporter assays. Moreover, this minor allele correlates with lower plasma vitamin E levels in a human study investigating SNPs and vitamin E plasma levels [287]. Taken together, these data from the SNP at -980T

(rs6994076) suggests that the decrease in TtpA promoter activity results in lower

TTP expression and ultimately contributes to lower plasma vitamin E levels.

These results have important implications for the controversial Selenium and

Vitamin E Cancer Prevention Trial (SELECT) outcomes assessing the risk of prostate cancer following vitamin E and selenium supplementation. The investigators concluded vitamin E supplementation increases the risk of prostate cancer [287, 302, 303, 450]. It is conceivable that those SNPs in the TtpA promoter region of an individual will affect TTP expression levels and in turn influence an individual’s ability to “handle” vitamin E. Therefore, it would be informative to stratify the results of these clinical studies according to specific

SNP alleles. This approach would determine if vitamin E supplementation was beneficial based on the context of an individual’s SNP profile. This idea is supported by research from our lab that concluded TTP expression is necessary to elicit the pro-apoptotic effects of vitamin E on prostate cancer cells [267].

Moreover, African-Americans have a higher rate of prostate cancer compared to

Caucasians [451]. The higher incidence of cancer may correlate with the variable ethnic frequency distributions of the SNP alleles (See Table 3.1 Ethnic frequencies of the SNP alleles in Chapter 3). Taken together, future study

150 designs may benefit from including SNPs and ethnic frequencies with the goal of classifying “responders” of vitamin E supplementation.

Future reporter experiments would allow us to analyze if the various SNP alleles are altered in their response to oxidative stress, and thus we can speculate what the SNPs role is in oxidative stress-related diseases.

6.3 Vitamin E status is altered in Niemann-Pick type C disease We used a lentiviral shRNA technique to ‘knock-down’ expression levels of NPC1 and NPC2 in hepatocytes. We determined that these proteins are required to prevent tocopherol accumulation in hepatocytes. This finding was recently confirmed using an alternative experimental approach to the NBD-tocopherol fluorescent vitamin E analogue [446]. A radiolabelled cholesterol competition assay demonstrated that although tocopherol directly interacts with the purified

NPC1 (N-terminal) and NPC2 proteins, the degree of binding was not on the same order of cholesterol binding to these proteins. These results question the in vivo relevance of tocopherol and NPC1 and NPC2 binding.

We further investigated the role of NPC1 and NPC2 in vitamin E status by measuring tocopherol levels in various tissues of Npc1-/- and Npc2-/- mouse models. Vitamin E levels in the liver and the cerebellar and prefrontal cortex regions of the brain were altered in Npc1-/- and Npc2-/- mice. However the plasma vitamin E levels in both NPC1 patients and Npc1-/- and Npc2-/- mice were within “normal” range. This was a critical observation that has relevance in the evaluation of vitamin E status in Niemann-Pick patients. For several reasons determining an accurate method to present vitamin E and/or antioxidant status is

151 essential. First, there have been suggestions of increased oxidative stress in

NPC disease [264, 402]. A study analyzing coenzyme Q10 and tocopherol equivalent activity capacity (TEAC) in Niemann-Pick type C patients found both these ROS defense systems were decreased [264]. Second, low vitamin E levels contribute to spinocerebellar ataxia and neurodegeneration of Purkinje neurons. Finally, patients afflicted with Niemann-Pick disease present with cerebellar neurodegeneration, specifically of the Purkinje neurons [254, 403, 452,

453]. Taken together, the neurodegeneration of the Purkinje cells and the increased oxidative stress in Niemann-Pick disease may be a consequence of

“mislocalized” vitamin E. Vitamin E is a lipid soluble compound and, therefore, it is routine to normalize vitamin E levels to cholesterol and/or lipid status [28, 454-

456]. However, under conditions of altered lipid status, determining how to accurately present the most accurate levels of vitamin E is confounding.

Furthermore, in conditions like Niemann-Pick, the location of the tocopherol also needs to be evaluated. Thus, vitamin E levels may appear adequate, but accumulation in the lysosomes prevents its access to other cellular locations.

This warrants studies investigating the subcellular location of vitamin E. The inconsistency between plasma vitamin E levels not accurately reflecting status has also been demonstrated in cholestatic liver disease [28]. Importantly, plasma vitamin E levels are not reflective biomarkers for vitamin E status.

Adipose tissue biopsies may be a way to measure tissue vitamin E status.

However, the issue with measuring tocopherol from the adipose tissue is the mobilization of tocopherol from this tissue is not the same as other tissues, like

152 the heart, liver and plasma [76, 444]. Non-invasive measurements of urinary F2- isoprostanes to assess whole body oxidative stress may be a preliminary adjunct measurement to vitamin E until adequate biomarkers are determined [457].

6.3.1 Regulation of NPC1 and NPC2 levels While evaluating the efficiency of the lentiviral shRNA ‘knock-down’ on NPC1 and

NPC2 protein levels we observed a compensatory expression of these proteins.

The expression of the protein that the shRNA was NOT targeted against increased (Figure 5.2). It has been widely accepted that NPC1 and NPC2 function in concert, since mutations in either gene give rise to the same phenotype, including accumulation of unesterified cholesterol and other lipids, as well as neurodegeneration [194, 197, 199, 232, 258, 399]. However, it has been reported that a mutation in the human NPC2 resulted in increased expression levels of NPC1. The authors stated they “did not know what to make of it” [458].

A report published recently suggested independent roles for NPC1 and NPC2

[459] . Finally, although NPC1 is known to be necessary for lipid egress out of the lysosomes, the mechanism of this function is not elucidated [196, 208, 210,

229, 247]. Taken together, these observations suggest the need for further investigation into how the regulation of these two proteins affects each other.

153

Figure 6.2 Compensatory increases in NPC1 and NPC2 expression levels. Immunoblot of IHH lysates from lentiviral shRNA transduced cells (IHH: IHH parental cells not subjected to shRNA; shCONT: control shRNA; shNPC1: NPC1 ‘knock-down’; shNPC2: NPC2 ‘knock-down) probed with anti- NPC1, anti-NPC2 and anti-tubulin.

6.4 Localization of TTP and tocopherol in the CNS Despite the critical role of vitamin E in protecting the brain, exemplified in the spinocerebellar ataxia that accompanies vitamin E deficiency, there is little information regarding the function of TTP in the brain. We hypothesize that TTP in the brain maintains optimal microenvironments of vitamin E to protect the brain from free radical induced damage. We report in that three model systems— primary cerebellar cultures, cerebellar slice cultures and paraffin-embedded cerebellum, TTP preferentially localizes to astrocytes in the cerebellum.

Astrocytes are non-neuronal cells that provide metabolic support to neurons in the central nervous system. By synthesizing and secreting ApoE lipoproteins, astrocytes regulate lipid transport to neurons [324, 336-338]. Although no specific transport mechanism is established for vitamin E, astrocytes secrete

154 cholesterol into ApoE-containing lipoproteins for delivery to neurons [319, 341,

342] and ApoE-/- mice have lower brain vitamin E levels [39, 340]. Our hypothesis that TTP in the astrocytes facilitates the delivery of tocopherol to neurons is corroborated by our radiolabelled secretion studies. Astrocyte enriched cultures significantly secreted higher levels of radiolabeled tocopherol compared to the neuron-enriched cultures (Figure 4.5). This finding is compatible with research that establishes hepatic TTP function in regulating secretion of vitamin E from the liver [44, 51]. Therefore, astrocytes are essentially acting as the distributors of vitamin E in the brain. An area of further investigation will be to determine if ApoE lipoproteins deliver the vitamin E from the astrocytes to neurons. This is in line with the function of ApoE in astrocytes

(reviewed in [346, 347]). In support of the role of ApoE controlling tocopherol levels in the central nervous system, the levels of vitamin E are significantly lower in all brain regions of ApoE-/- mice at 10 weeks of age in comparison to the wild- type controls [340]. Additionally, other lipoproteins may be involved in transporting tocopherol in the brain, like apoD or apoJ, which are both associated with HDL [326]. This is significant considering that a proposed route of tocopherol delivery across the blood-borne barrier is via the HDL SR-B1 receptor

[35]. Density gradient purification of lipoprotein particles followed by GC/MS analysis to determine the vitamin E content may yield insight into the lipoproteins that preferentially transport tocopherol in the CNS [62, 460, 461].

Further investigation into how oxidative stress conditions affect the secretion of tocopherol is important to our understanding the function of TTP in human

155 disease. Levels of the TtpA mRNA significantly increase in astrocyte cultures during conditions of oxidative stress (4.7). These results could be interpreted that increased TTP levels in astrocytes is a compensatory mechanism to deliver and maintain vitamin E homeostasis in neurons during oxidative-stressed conditions (See model Figure 6.2). These findings are consistent with previous research that demonstrated elevation of TTP levels in patients with oxidative stress-related diseases such as Alzheimer’s disease and Downs syndrome [153].

I hypothesize there will be an increase in tocopherol secretion from the astrocyte cultures to protect the neurons form oxidative stress. In rat cortical neurons subjected to H2O2-induced oxidative stress tocopherol treatment is protective against adverse neuronal morphological changes [82].

Figure 6.3 Proposed model of TTP expression in normal and oxidative stress conditions in the brain. TtpA expression is significantly higher in astrocytes than neuronal cells in basal conditions. Additionally, vitamin E is preferentially localized to the TTP- expressing astrocytes, which control the delivery of tocopherol to neuron cells as required, likely via secretion of ApoE particles. In conditions of oxidative stress there is a dramatic increase in TTP expression in astrocytes, suggesting an increased ability to deliver vitamin E to neurons, to protect them from oxidative stress-induced damage.

156

6.5 Levels of vitamin E in animal models of human disease Alpha-tocopherol serves as the major lipid soluble antioxidant. It does so by scavenging free radicals and thereby breaking the chain reaction of polyunsaturated fatty acid peroxidation in cellular membranes [85, 356, 357].

Research of diseases that are associated with oxidative stress, like cardiovascular disease (CVD), diabetes and Alzheimer’s disease (AD) confirm beneficial effects of vitamin E supplementation [88, 358-360]. Furthermore, vitamin E treatment is shown to be efficacious in combating neuro-inflammatory diseases like AD, Parkinson’s disease (PD), and Down’s syndrome (DS) by decreasing oxidative stress [295-298]. In rodent models of AD, vitamin E treatment delays the loss of cognitive and motor performance that is attributed to oxidative-stress related damage [299]. Additionally early intervention with vitamin E supplementation in a mouse model of AD leads to a decrease in Aβ levels, amyloid deposition and delay in tau protein phosphorylation [193, 361].

Taken together, multiple lines of evidence suggest that maintaining adequate vitamin E levels is critical to support human health.

To further investigate the relationship between vitamin E levels in disease we analyzed tocopherol levels in six mouse models of human disease— Ataxia with vitamin E deficiency (AVED), Alzheimer’s disease (AD), Cystic Fibrosis (CF),

Ataxia telangiectasia (ATM) and Niemann-Pick type C1 and C2 diseases. We report in models of ATM, AD, CF and NPC1/2 that the vitamin E levels in the brain and liver increased with age, at a rate comparable to wild-type control animals. The trends for tocopherol levels were consistent with the tocopherol: cholesterol levels in all mouse models of human disease except in the Npc1 -/-

157 and Npc2-/- animals. These results were attributed to the massive accumulation of cholesterol in NPC disease. The confounding factor in these results is the mis-localization of vitamin E (see section 6.2 for more detailed discussion). In general, vitamin E levels were variable in different regions of the brain, with the cortex consistently exhibiting increased levels compared to the cerebellum. The vitamin E levels in the various brain regions are inversely correlated with the expression levels of TTP. This observation suggests that the higher levels of

TTP are functioning to distribute tocopherol to other regions of the brain. In the mouse models of Ataxia telangiectasia and Cystic fibrosis vitamin E status was similar to the wild-type levels in CNS tissues and liver. However, the hippocampus of Alzheimer’s disease mice displayed a 2-fold increase in vitamin

E compared WT controls. Taken together these results raise the possibilities there are “microenvironments” of vitamin E in the brain which may be influenced by age and specific disease conditions. Importantly, vitamin E plasma levels do not correlate with tissue levels in the Alzheimer’s disease and Niemann-Pick type

C models. Whereas plasma E levels were within a “normal” range in the AD strain and Npc1-/- and Npc2-/- mice, tissue levels were altered. These findings suggest that plasma vitamin E levels do not always reflect vitamin E tissue status and thus may not be an accurate indicator (as discussed above). Taken together, I found that specific perturbations of vitamin E status occur in mouse models of human disease, which warrant further investigations. Our analysis was a preliminary ‘snapshot’ of the relationship of vitamin E levels to the disease.

A more thorough investigation that correlates disease phenotype and vitamin E

158 levels [126, 138] will yield more complete information. Monitoring vitamin E levels during disease progression would be beneficial. Data from these studies would aid in delineating the causal relationship between vitamin E levels and disease. Further long-term studies can address the efficacy of vitamin E supplementation in prevention versus reversal of disease.

6.6. Concluding Remarks (in a nutshell)

Vitamin E is a major lipid soluble antioxidant that aids in protecting cells from free-radical induced damage. The information presented in this thesis extends our knowledge and understanding regarding how vitamin E is transported.

These findings are critical in understanding how vitamin E location affects its antioxidant function. Furthermore, this work yields insight into the mechanisms that regulate cellular oxidative stress. The increase in TtpA expression by reactive oxygen species implies TtpA does so to distribute vitamin E to where tocopherol is needed. The presence of TTP in astrocytes, and not neurons, supports the idea that the regulation of TTP in non-neuronal cells is similar to the function in hepatocytes. The overall finding that TTP/TtpA is regulated corroborates our hypothesis that TTP functions to maintain specific microenvironments of vitamin E, likely to protect against free radical induced damage. This information complements our work in the mouse models of human disease where we found that indeed vitamin E levels were variable throughout the brain.

159

In summary, this thesis work supports the notion that TTP/TtpA is regulated by genetic and physiological factors in order to control proper distribution of vitamin

E, and, in turn, offer protection from oxidative stress-related diseases.

160

Literature Cited 1. DellaPenna, D. and B.J. Pogson, Vitamin synthesis in plants: tocopherols and carotenoids. Annu Rev Plant Biol, 2006. 57: p. 711-38. 2. Burton, G.W. and M.G. Traber, Vitamin E: antioxidant activity, biokinetics, and bioavailability. Annu Rev Nutr, 1990. 10: p. 357-82. 3. Hosomi, A., et al., Affinity for alpha-tocopherol transfer protein as a determinant of the biological activities of vitamin E analogs. FEBS Lett, 1997. 409(1): p. 105-8. 4. Panagabko, C., et al., Ligand specificity in the CRAL-TRIO protein family. Biochemistry, 2003. 42(21): p. 6467-74. 5. Burton, G.W., et al., Biokinetics of dietary RRR-alpha-tocopherol in the male guinea pig at three dietary levels of vitamin C and two levels of vitamin E. Evidence that vitamin C does not "spare" vitamin E in vivo. Lipids, 1990. 25(4): p. 199-210. 6. Burton, G.W., et al., Human plasma and tissue alpha-tocopherol concentrations in response to supplementation with deuterated natural and synthetic vitamin E. Am J Clin Nutr, 1998. 67(4): p. 669-84. 7. Leonard, S.W., et al., Incorporation of deuterated RRR- or all-rac-alpha-tocopherol in plasma and tissues of alpha-tocopherol transfer protein--null mice. Am J Clin Nutr, 2002. 75(3): p. 555-60. 8. Bieri, J.G. and R.P. Evarts, Gamma tocopherol: metabolism, biological activity and significance in human vitamin E nutrition. Am J Clin Nutr, 1974. 27(9): p. 980-6. 9. O'Byrne, D., et al., Studies of LDL oxidation following alpha-, gamma-, or delta- tocotrienyl acetate supplementation of hypercholesterolemic humans. Free Radic Biol Med, 2000. 29(9): p. 834-45. 10. Soll, J., M. Kemmerling, and G. Schultz, Tocopherol and plastoquinone synthesis in spinach chloroplasts subfractions. Arch Biochem Biophys, 1980. 204(2): p. 544-50. 11. Soll, J., et al., Localization and synthesis of prenylquinones in isolated outer and inner envelope membranes from spinach chloroplasts. Arch Biochem Biophys, 1985. 238(1): p. 290-9. 12. Sattler, S.E., et al., Vitamin E is essential for seed longevity and for preventing lipid peroxidation during germination. Plant Cell, 2004. 16(6): p. 1419-32. 13. Shintani, D. and D. DellaPenna, Elevating the vitamin E content of plants through metabolic engineering. Science, 1998. 282(5396): p. 2098-100. 14. Gilliland, L.U., et al., Genetic basis for natural variation in seed vitamin E levels in Arabidopsis thaliana. Proc Natl Acad Sci U S A, 2006. 103(49): p. 18834-41. 15. Adams, M.R., et al., Perturbative QCD effects observed in 490 GeV deep-inelastic muon scattering. Phys Rev D Part Fields, 1993. 48(11): p. 5057-5066. 16. Chen, H., et al., Pathological demography of native patients in a nephrology center in China. Chin Med J (Engl), 2003. 116(9): p. 1377-81. 17. Collakova, E. and D. DellaPenna, The role of homogentisate phytyltransferase and other tocopherol pathway enzymes in the regulation of tocopherol synthesis during abiotic stress. Plant Physiol, 2003. 133(2): p. 930-40. 18. Grusak, M.A. and D. DellaPenna, Improving the Nutrient Composition of Plants to Enhance Human Nutrition and Health1. Annu Rev Plant Physiol Plant Mol Biol, 1999. 50: p. 133-161. 19. Fulgoni, V.L., 3rd, et al., Foods, fortificants, and supplements: Where do Americans get their nutrients? J Nutr, 2011. 141(10): p. 1847-54.

161

20. Ford, E.S. and A. Sowell, Serum alpha-tocopherol status in the United States population: findings from the Third National Health and Nutrition Examination Survey. Am J Epidemiol, 1999. 150(3): p. 290-300. 21. Traber, M.G., et al., Impaired discrimination between stereoisomers of alpha-tocopherol in patients with familial isolated vitamin E deficiency. J Lipid Res, 1993. 34(2): p. 201-10. 22. Traber, M.G., et al., RRR- and SRR-alpha-tocopherols are secreted without discrimination in human chylomicrons, but RRR-alpha-tocopherol is preferentially secreted in very low density lipoproteins. J Lipid Res, 1990. 31(4): p. 675-85. 23. Traber, M.G., et al., Studies on the transfer of tocopherol between lipoproteins. Lipids, 1992. 27(9): p. 657-63. 24. Rader, D.J. and H.B. Brewer, Jr., Abetalipoproteinemia. New insights into lipoprotein assembly and vitamin E metabolism from a rare genetic disease. JAMA, 1993. 270(7): p. 865-9. 25. Traber, M.G., Determinants of plasma vitamin E concentrations. Free Radic Biol Med, 1994. 16(2): p. 229-39. 26. Sokol, R.J., et al., Isolated vitamin E deficiency in the absence of fat malabsorption-- familial and sporadic cases: characterization and investigation of causes. J Lab Clin Med, 1988. 111(5): p. 548-59. 27. Sokol, R.J., Vitamin E status in cholestasis. J Pediatr, 1988. 112(2): p. 324-5. 28. Sokol, R.J., et al., Vitamin E deficiency with normal serum vitamin E concentrations in children with chronic cholestasis. N Engl J Med, 1984. 310(19): p. 1209-12. 29. Ulatowski, L., et al., Altered vitamin E status in Niemann-Pick type C disease. J Lipid Res, 2011. 52(7): p. 1400-10. 30. MacMahon, M.T. and G. Neale, The absorption of alpha-tocopherol in control subjects and in patients with intestinal malabsorption. Clin Sci, 1970. 38(2): p. 197-210. 31. Bruno, R.S., et al., Human vitamin E requirements assessed with the use of apples fortified with deuterium-labeled alpha-tocopheryl acetate. Am J Clin Nutr, 2006. 83(2): p. 299-304. 32. Kostner, G.M., et al., Altered metabolism of low density lipoprotein in humans after prolonged incubation in plasma. Clin Sci (Lond), 1985. 68(4): p. 411-8. 33. Qian, J., et al., Intracellular trafficking of vitamin E in hepatocytes: the role of tocopherol transfer protein. J Lipid Res, 2005. 46(10): p. 2072-82. 34. Traber, M.G., Vitamin E regulation. Curr Opin Gastroenterol, 2005. 21(2): p. 223-7. 35. Balazs, Z., et al., Uptake and transport of high-density lipoprotein (HDL) and HDL- associated alpha-tocopherol by an in vitro blood-brain barrier model. J Neurochem, 2004. 89(4): p. 939-50. 36. Munteanu, A., et al., Antagonistic effects of oxidized low density lipoprotein and alpha- tocopherol on CD36 scavenger receptor expression in monocytes: involvement of protein kinase B and peroxisome proliferator-activated receptor-gamma. J Biol Chem, 2006. 281(10): p. 6489-97. 37. Mardones, P., et al., Alpha-tocopherol metabolism is abnormal in scavenger receptor class B type I (SR-BI)-deficient mice. J Nutr, 2002. 132(3): p. 443-9. 38. Cyrus, T., et al., Vitamin E reduces progression of atherosclerosis in low-density lipoprotein receptor-deficient mice with established vascular lesions. Circulation, 2003. 107(4): p. 521-3. 39. Terasawa, Y., et al., Increased atherosclerosis in hyperlipidemic mice deficient in alpha - tocopherol transfer protein and vitamin E. Proc Natl Acad Sci U S A, 2000. 97(25): p. 13830-4.

162

40. Yevenes, L.F., et al., Lysosomal vitamin E accumulation in Niemann-Pick type C disease. Biochim Biophys Acta, 2011. 1822(2): p. 150-160. 41. Tiurin, V.A., et al., [Lipid asymmetry and alpha-tocopherol distribution in outer and inner monolayers of bilayer lipid membranes]. Biull Eksp Biol Med, 1988. 105(6): p. 667-9. 42. Tiurin, V.A., et al., [The interaction of alpha-tocopherol with phospholipid liposomes: the absence of transbilayer mobility]. Biull Eksp Biol Med, 1986. 102(12): p. 689-92. 43. Bennett, W.F., et al., Molecular view of cholesterol flip-flop and chemical potential in different membrane environments. J Am Chem Soc, 2009. 131(35): p. 12714-20. 44. Arita, M., et al., alpha-tocopherol transfer protein stimulates the secretion of alpha- tocopherol from a cultured liver cell line through a brefeldin A-insensitive pathway. Proc Natl Acad Sci U S A, 1997. 94(23): p. 12437-41. 45. Horiguchi, M., et al., pH-dependent translocation of alpha-tocopherol transfer protein (alpha-TTP) between hepatic cytosol and late endosomes. Genes Cells, 2003. 8(10): p. 789-800. 46. Catignani, G.L., An alpha-tocopherol binding protein in rat liver cytoplasm. Biochem Biophys Res Commun, 1975. 67(1): p. 66-72. 47. Catignani, G.L. and J.G. Bieri, Rat liver alpha-tocopherol binding protein. Biochim Biophys Acta, 1977. 497(2): p. 349-57. 48. Kaplowitz, N., et al., Tocopherol-binding proteins of hepatic cytosol. Ann N Y Acad Sci, 1989. 570: p. 85-94. 49. Massey, J.B., Kinetics of transfer of alpha-tocopherol between model and native plasma lipoproteins. Biochim Biophys Acta, 1984. 793(3): p. 387-92. 50. Murphy, D.J. and R.D. Mavis, Membrane transfer of alpha-tocopherol. Influence of soluble alpha-tocopherol-binding factors from the liver, lung, heart, and brain of the rat. J Biol Chem, 1981. 256(20): p. 10464-8. 51. Qian, J., et al., Intracellular localization of alpha-tocopherol transfer protein and alpha- tocopherol. Ann N Y Acad Sci, 2004. 1031: p. 330-1. 52. Bjorneboe, A., et al., Effect of dietary deficiency and supplementation with all-rac-alpha- tocopherol on hepatic content in rats. J Nutr, 1991. 121(8): p. 1208-13. 53. Raabe, M., et al., Analysis of the role of microsomal triglyceride transfer protein in the liver of tissue-specific knockout mice. J Clin Invest, 1999. 103(9): p. 1287-98. 54. Minehira-Castelli, K., et al., Absence of VLDL secretion does not affect alpha-tocopherol content in peripheral tissues. J Lipid Res, 2006. 47(8): p. 1733-8. 55. Oram, J.F. and R.M. Lawn, ABCA1. The gatekeeper for eliminating excess tissue cholesterol. J Lipid Res, 2001. 42(8): p. 1173-9. 56. Oram, J.F., A.M. Vaughan, and R. Stocker, ATP-binding cassette transporter A1 mediates cellular secretion of alpha-tocopherol. J Biol Chem, 2001. 276(43): p. 39898-902. 57. Pollock, M., et al., Peripheral neuropathy in Tangier disease. Brain, 1983. 106 ( Pt 4): p. 911-28. 58. Orso, E., et al., Transport of lipids from golgi to plasma membrane is defective in tangier disease patients and Abc1-deficient mice. Nat Genet, 2000. 24(2): p. 192-6. 59. Oram, J.F., HDL apolipoproteins and ABCA1: partners in the removal of excess cellular cholesterol. Arterioscler Thromb Vasc Biol, 2003. 23(5): p. 720-7. 60. Neufeld, E.B., et al., Cellular localization and trafficking of the human ABCA1 transporter. J Biol Chem, 2001. 276(29): p. 27584-90. 61. Neufeld, E.B., et al., The ABCA1 transporter modulates late endocytic trafficking: insights from the correction of the genetic defect in Tangier disease. J Biol Chem, 2004. 279(15): p. 15571-8.

163

62. Sontag, T.J. and R.S. Parker, Cytochrome P450 omega-hydroxylase pathway of tocopherol catabolism. Novel mechanism of regulation of vitamin E status. J Biol Chem, 2002. 277(28): p. 25290-6. 63. Sontag, T.J. and R.S. Parker, Influence of major structural features of tocopherols and tocotrienols on their omega-oxidation by tocopherol-omega-hydroxylase. J Lipid Res, 2007. 48(5): p. 1090-8. 64. Bjorneboe, A., et al., Secretion of alpha-tocopherol from cultured rat hepatocytes. Biochim Biophys Acta, 1987. 922(2): p. 199-205. 65. Parker, R.S. and C.C. McCormick, Selective accumulation of alpha-tocopherol in Drosophila is associated with cytochrome P450 tocopherol-omega-hydroxylase activity but not alpha-tocopherol transfer protein. Biochem Biophys Res Commun, 2005. 338(3): p. 1537-41. 66. Parazo, M.P., et al., Distribution of alpha- and gamma-tocopherols in Atlantic salmon (Salmo salar) tissues. Lipids, 1998. 33(7): p. 697-704. 67. Surai, P.F., R.C. Noble, and B.K. Speake, Relationship between vitamin E content and susceptibility to lipid peroxidation in tissues of the newly hatched chick. Br Poult Sci, 1999. 40(3): p. 406-10. 68. Hidiroglou, M., J.R. Lessard, and J.M. Wauthy, Blood serum tocopherol levels in calves born from cows winter fed hay or grass silage. Can J Comp Med, 1978. 42(1): p. 128-31. 69. Ando, S., Tocopherol levels in the plasma lipoproteins from Japanese eel Anguilla japonica. Biosci Biotechnol Biochem, 1995. 59(12): p. 2326-7. 70. Traber, M.G. and H. Arai, Molecular mechanisms of vitamin E transport. Annu Rev Nutr, 1999. 19: p. 343-55. 71. Blatt, D.H., S.W. Leonard, and M.G. Traber, Vitamin E kinetics and the function of tocopherol regulatory proteins. Nutrition, 2001. 17(10): p. 799-805. 72. Drevon, C.A., Absorption, transport and metabolism of vitamin E. Free Radic Res Commun, 1991. 14(4): p. 229-46. 73. Bjorneboe, A., G.E. Bjorneboe, and C.A. Drevon, Serum half-life, distribution, hepatic uptake and biliary excretion of alpha-tocopherol in rats. Biochim Biophys Acta, 1987. 921(2): p. 175-81. 74. Kitabchi, A.E. and R.H. Williams, Adrenal gland in vitamin E deficiency. Lipid peroxidation and malonaldehyde production in vitro. J Biol Chem, 1968. 243(12): p. 3248-54. 75. Bourre, J.M. and M. Clement, Kinetics of rat peripheral nerve, forebrain and cerebellum alpha-tocopherol depletion: comparison with different organs. J Nutr, 1991. 121(8): p. 1204-7. 76. Bieri, J.G., Kinetics of tissue -tocopherol depletion and repletion. Ann N Y Acad Sci, 1972. 203: p. 181-91. 77. Machlin, L.J. and E. Gabriel, Kinetics of tissue alpha-tocopherol uptake and depletion following administration of high levels of vitamin E. Ann N Y Acad Sci, 1982. 393: p. 48- 60. 78. Goss-Sampson, M.A., C.J. MacEvilly, and D.P. Muller, Longitudinal studies of the neurobiology of vitamin E and other antioxidant systems, and neurological function in the vitamin E deficient rat. J Neurol Sci, 1988. 87(1): p. 25-35. 79. Ingold, K.U., et al., Biokinetics of and discrimination between dietary RRR- and SRR- alpha-tocopherols in the male rat. Lipids, 1987. 22(3): p. 163-72. 80. Harding, A.E., et al., Spinocerebellar degeneration associated with a selective defect of vitamin E absorption. N Engl J Med, 1985. 313(1): p. 32-5.

164

81. Magalhaes, J., et al., Vitamin E prevents hypobaric hypoxia-induced mitochondrial dysfunction in skeletal muscle. Clin Sci (Lond), 2007. 113(12): p. 459-66. 82. Behl, C., Vitamin E protects neurons against oxidative cell death in vitro more effectively than 17-beta estradiol and induces the activity of the transcription factor NF-kappaB. J Neural Transm, 2000. 107(4): p. 393-407. 83. Goti, D., et al., Uptake of lipoprotein-associated alpha-tocopherol by primary porcine brain capillary endothelial cells. J Neurochem, 2000. 74(4): p. 1374-83. 84. Burton, G.W., A. Joyce, and K.U. Ingold, First proof that vitamin E is major lipid-soluble, chain-breaking antioxidant in human blood plasma. Lancet, 1982. 2(8293): p. 327. 85. Burton, G.W., et al., Vitamin E as an antioxidant in vitro and in vivo. Ciba Found Symp, 1983. 101: p. 4-18. 86. Cheeseman, K.H., et al., Lipid peroxidation and lipid antioxidants in normal and tumor cells. Toxicol Pathol, 1984. 12(3): p. 235-9. 87. Yau, T.M., et al., Vitamin E for coronary bypass operations. A prospective, double-blind, randomized trial. J Thorac Cardiovasc Surg, 1994. 108(2): p. 302-10. 88. Stampfer, M.J., et al., Vitamin E consumption and the risk of coronary disease in women. N Engl J Med, 1993. 328(20): p. 1444-9. 89. Stephens, N.G., et al., Randomised controlled trial of vitamin E in patients with coronary disease: Cambridge Heart Antioxidant Study (CHAOS). Lancet, 1996. 347(9004): p. 781-6. 90. Fukuzawa, K., W. Ikebata, and K. Sohmi, Location, antioxidant and recycling dynamics of alpha-tocopherol in liposome membranes. J Nutr Sci Vitaminol (Tokyo), 1993. 39 Suppl: p. S9-22. 91. Afri, M., et al., Active oxygen chemistry within the liposomal bilayer. Part III: Locating Vitamin E, ubiquinol and ubiquinone and their derivatives in the lipid bilayer. Chem Phys Lipids, 2004. 131(1): p. 107-21. 92. Atkinson, J., R.F. Epand, and R.M. Epand, Tocopherols and tocotrienols in membranes: a critical review. Free Radic Biol Med, 2008. 44(5): p. 739-64. 93. Atkinson, J., et al., The location and behavior of alpha-tocopherol in membranes. Mol Nutr Food Res, 2010. 54(5): p. 641-51. 94. Bendich, A., et al., Interaction of dietary vitamin C and vitamin E on guinea pig immune responses to mitogens. J Nutr, 1984. 114(9): p. 1588-93. 95. Packer, J.E., T.F. Slater, and R.L. Willson, Direct observation of a free radical interaction between vitamin E and vitamin C. Nature, 1979. 278(5706): p. 737-8. 96. Burton, G.W., et al., Application of deuterated alpha-tocopherols to the biokinetics and bioavailability of vitamin E. Free Radic Res Commun, 1990. 11(1-3): p. 99-107. 97. Sies, H. and M.E. Murphy, Role of tocopherols in the protection of biological systems against oxidative damage. J Photochem Photobiol B, 1991. 8(2): p. 211-8. 98. Siess, M.H., et al., Heterogenous effects of natural flavonoids on monooxygenase activities in human and rat liver microsomes. Toxicol Appl Pharmacol, 1995. 130(1): p. 73-78. 99. Wang, H. and J.A. Joseph, Quantifying cellular oxidative stress by dichlorofluorescein assay using microplate reader. Free Radic Biol Med, 1999. 27(5-6): p. 612-6. 100. Wang, X. and P.J. Quinn, Vitamin E and its function in membranes. Prog Lipid Res, 1999. 38(4): p. 309-36. 101. Sondergaard, E. and H. Dam, Influence of the level of dietary linoleic acid on the amount of d-alpha-tocopherol acetate required for protection against encephalomalacia. Z Ernahrungswiss, 1966. 6(4): p. 253-8.

165

102. Evans, H.M. and K.S. Bishop, On the Existence of a Hitherto Unrecognized Dietary Factor Essential for Reproduction. Science, 1922. 56(1458): p. 650-1. 103. Jishage, K., et al., Vitamin E is essential for mouse placentation but not for embryonic development itself. Biol Reprod, 2005. 73(5): p. 983-7. 104. Freedman, J.E., et al., alpha-tocopherol inhibits aggregation of human platelets by a protein kinase C-dependent mechanism. Circulation, 1996. 94(10): p. 2434-40. 105. Koya, D., et al., Characterization of protein kinase C beta isoform activation on the gene expression of transforming growth factor-beta, extracellular matrix components, and prostanoids in the glomeruli of diabetic rats. J Clin Invest, 1997. 100(1): p. 115-26. 106. Koya, D., et al., d-alpha-tocopherol treatment prevents glomerular dysfunctions in diabetic rats through inhibition of protein kinase C-diacylglycerol pathway. Biofactors, 1998. 7(1-2): p. 69-76. 107. Devaraj, S., D. Li, and I. Jialal, The effects of alpha tocopherol supplementation on monocyte function. Decreased lipid oxidation, interleukin 1 beta secretion, and monocyte adhesion to endothelium. J Clin Invest, 1996. 98(3): p. 756-63. 108. Tran, K., P.R. Proulx, and A.C. Chan, Vitamin E suppresses diacylglycerol (DAG) level in thrombin-stimulated endothelial cells through an increase of DAG kinase activity. Biochim Biophys Acta, 1994. 1212(2): p. 193-202. 109. Kunisaki, M., et al., Normalization of diacylglycerol-protein kinase C activation by vitamin E in aorta of diabetic rats and cultured rat smooth muscle cells exposed to elevated glucose levels. Diabetes, 1994. 43(11): p. 1372-7. 110. Cachia, O., et al., alpha-tocopherol inhibits the respiratory burst in human monocytes. Attenuation of p47(phox) membrane translocation and phosphorylation. J Biol Chem, 1998. 273(49): p. 32801-5. 111. Abdala-Valencia, H. and J.M. Cook-Mills, VCAM-1 signals activate endothelial cell protein kinase Calpha via oxidation. J Immunol, 2006. 177(9): p. 6379-87. 112. Azzi, A., et al., The role of hydrogen peroxide and RRR-alpha-tocopherol in smooth muscle cell proliferation. Cell Death Differ, 1996. 3(1): p. 79-90. 113. Cantoni, O., et al., The phosphorylation state of MAP-kinases modulates the cytotoxic response of smooth muscle cells to hydrogen peroxide. FEBS Lett, 1996. 389(3): p. 285-8. 114. Tran, K., et al., Vitamin E potentiates arachidonate release and phospholipase A2 activity in rat heart myoblastic cells. Biochem J, 1996. 319 ( Pt 2): p. 385-91. 115. Chan, A.C., Vitamin E and atherosclerosis. J Nutr, 1998. 128(10): p. 1593-6. 116. Cominacini, L., et al., Effects of troglitazone on in vitro oxidation of LDL and HDL induced by copper ions and endothelial cells. Diabetologia, 1997. 40(2): p. 165-72. 117. Witt, W., et al., Regulation by vitamin E of the scavenger receptor BI in rat liver and HepG2 cells. J Lipid Res, 2000. 41(12): p. 2009-16. 118. Valastyan, S., et al., Novel transcriptional activities of vitamin E: inhibition of cholesterol biosynthesis. Biochemistry, 2008. 47(2): p. 744-52. 119. Murphy, D.J. and R.D. Mavis, A comparison of the in vitro binding of alpha-tocopherol to microsomes of lung, liver, heart and brain of the rat. Biochim Biophys Acta, 1981. 663(2): p. 390-400. 120. Sato, Y., et al., Purification and characterization of the alpha-tocopherol transfer protein from rat liver. FEBS Lett, 1991. 288(1-2): p. 41-5. 121. Sato, Y., et al., Primary structure of alpha-tocopherol transfer protein from rat liver. Homology with cellular retinaldehyde-binding protein. J Biol Chem, 1993. 268(24): p. 17705-10.

166

122. Morley, S., et al., Utility of a fluorescent vitamin E analogue as a probe for tocopherol transfer protein activity. Biochemistry, 2006. 45(4): p. 1075-81. 123. Nava, P., et al., Preparation of fluorescent tocopherols for use in protein binding and localization with the alpha-tocopherol transfer protein. Bioorg Med Chem, 2006. 14(11): p. 3721-36. 124. Arita, M., et al., Human alpha-tocopherol transfer protein: cDNA cloning, expression and chromosomal localization. Biochem J, 1995. 306 ( Pt 2): p. 437-43. 125. Sokol, R.J., Vitamin E deficiency and neurologic disease. Annu Rev Nutr, 1988. 8: p. 351- 73. 126. Cavalier, L., et al., Ataxia with isolated vitamin E deficiency: heterogeneity of mutations and phenotypic variability in a large number of families. Am J Hum Genet, 1998. 62(2): p. 301-10. 127. Ouahchi, K., et al., Ataxia with isolated vitamin E deficiency is caused by mutations in the alpha-tocopherol transfer protein. Nat Genet, 1995. 9(2): p. 141-5. 128. Meier, R., et al., The molecular basis of vitamin E retention: structure of human alpha- tocopherol transfer protein. J Mol Biol, 2003. 331(3): p. 725-34. 129. Min, K.C., R.A. Kovall, and W.A. Hendrickson, Crystal structure of human alpha- tocopherol transfer protein bound to its ligand: implications for ataxia with vitamin E deficiency. Proc Natl Acad Sci U S A, 2003. 100(25): p. 14713-8. 130. Bateman, A., et al., The Pfam protein families database. Nucleic Acids Res, 2002. 30(1): p. 276-80. 131. Sha, B., et al., Crystal structure of the Saccharomyces cerevisiae phosphatidylinositol- transfer protein. Nature, 1998. 391(6666): p. 506-10. 132. Bloch, K., The biological synthesis of cholesterol. Vitam Horm, 1957. 15: p. 119-50. 133. Bloch, K., R.B. Clayton, and P.B. Schneider, Synthesis of lanosterol in vivo. J Biol Chem, 1957. 224(1): p. 175-83. 134. Stocker, A., et al., Crystal structure of the human supernatant protein factor. Structure, 2002. 10(11): p. 1533-40. 135. McLaughlin, P.J. and J.L. Weihrauch, Vitamin E content of foods. J Am Diet Assoc, 1979. 75(6): p. 647-65. 136. Morley, S., et al., Mechanisms of ligand transfer by the hepatic tocopherol transfer protein. J Biol Chem, 2008. 283(26): p. 17797-804. 137. Hosomi, A., et al., Localization of alpha-tocopherol transfer protein in rat brain. Neurosci Lett, 1998. 256(3): p. 159-62. 138. Yokota, T., et al., Delayed-onset ataxia in mice lacking alpha -tocopherol transfer protein: model for neuronal degeneration caused by chronic oxidative stress. Proc Natl Acad Sci U S A, 2001. 98(26): p. 15185-90. 139. Jishage, K., et al., Alpha-tocopherol transfer protein is important for the normal development of placental labyrinthine trophoblasts in mice. J Biol Chem, 2001. 276(3): p. 1669-72. 140. Kaempf-Rotzoll, D.E., et al., Human placental trophoblast cells express alpha-tocopherol transfer protein. Placenta, 2003. 24(5): p. 439-44. 141. Muller-Schmehl, K., et al., Localization of alpha-tocopherol transfer protein in trophoblast, fetal capillaries' endothelium and amnion epithelium of human term placenta. Free Radic Res, 2004. 38(4): p. 413-20. 142. Rotzoll, D.E., et al., Immunohistochemical localization of alpha-tocopherol transfer protein and lipoperoxidation products in human first-trimester and term placenta. Eur J Obstet Gynecol Reprod Biol, 2008.

167

143. Aparicio, J.M., et al., Ataxia with isolated vitamin E deficiency: case report and review of the literature. J Pediatr Gastroenterol Nutr, 2001. 33(2): p. 206-10. 144. Benomar, A., et al., Clinical comparison between AVED patients with 744 del A mutation and Friedreich ataxia with GAA expansion in 15 Moroccan families. J Neurol Sci, 2002. 198(1-2): p. 25-9. 145. Alex, G., M.R. Oliver, and K.J. Collins, Ataxia with isolated vitamin E deficiency: a clinical, biochemical and genetic diagnosis. J Paediatr Child Health, 2000. 36(5): p. 515-6. 146. Traber, M.G., et al., Vitamin E deficiency in dogs does not alter preferential incorporation of RRR-alpha-tocopherol compared with all rac-alpha-tocopherol into plasma. Lipids, 1993. 28(12): p. 1107-12. 147. Mariotti, C., et al., Ataxia with isolated vitamin E deficiency: neurological phenotype, clinical follow-up and novel mutations in TTPA gene in Italian families. Neurol Sci, 2004. 25(3): p. 130-7. 148. Burck, U., et al., Neuromyopathy and vitamin E deficiency in man. Neuropediatrics, 1981. 12(3): p. 267-78. 149. Larnaout, A., et al., Friedreich's ataxia with isolated vitamin E deficiency: a neuropathological study of a Tunisian patient. Acta Neuropathol, 1997. 93(6): p. 633-7. 150. Yokota, T., et al., Retinitis pigmentosa and ataxia caused by a mutation in the gene for the alpha-tocopherol-transfer protein. N Engl J Med, 1996. 335(23): p. 1770-1. 151. Amiel, J., et al., Familial isolated vitamin E deficiency. Extensive study of a large family with a 5-year therapeutic follow-up. J Inherit Metab Dis, 1995. 18(3): p. 333-40. 152. Matsuya, M., et al., [A sporadic case of essential vitamin E deficiency manifested by sensory-dominant polyneuropathy and retinitis pigmentosa]. No To Shinkei, 1994. 46(10): p. 989-94. 153. Copp, R.P., et al., Localization of alpha-tocopherol transfer protein in the brains of patients with ataxia with vitamin E deficiency and other oxidative stress related neurodegenerative disorders. Brain Res, 1999. 822(1-2): p. 80-7. 154. Morley, S., et al., Molecular determinants of heritable vitamin E deficiency. Biochemistry, 2004. 43(14): p. 4143-9. 155. Gotoda, T., et al., Adult-onset spinocerebellar dysfunction caused by a mutation in the gene for the alpha-tocopherol-transfer protein. N Engl J Med, 1995. 333(20): p. 1313-8. 156. Qian, J., J. Atkinson, and D. Manor, Biochemical consequences of heritable mutations in the alpha-tocopherol transfer protein. Biochemistry, 2006. 45(27): p. 8236-42. 157. Shaw, H.M. and C. Huang, Liver alpha-tocopherol transfer protein and its mRNA are differentially altered by dietary vitamin E deficiency and protein insufficiency in rats. J Nutr, 1998. 128(12): p. 2348-54. 158. Thakur, V., S. Morley, and D. Manor, Hepatic alpha-tocopherol transfer protein: ligand- induced protection from proteasomal degradation. Biochemistry, 2010. 49(43): p. 9339- 44. 159. Kim, H.S., et al., Effect of alpha-tocopherol status on alpha-tocopherol transfer protein expression and its messenger RNA level in rat liver. Free Radic Res, 1998. 28(1): p. 87-92. 160. Bella, D.L., et al., Regulation of the alpha-tocopherol transfer protein in mice: lack of response to dietary vitamin E or oxidative stress. Lipids, 2006. 41(2): p. 105-12. 161. Ban, R., et al., alpha-Tocopherol transfer protein expression in rat liver exposed to hyperoxia. Free Radic Res, 2002. 36(9): p. 933-8. 162. Usenko, C.Y., S.L. Harper, and R.L. Tanguay, Fullerene C60 exposure elicits an oxidative stress response in embryonic zebrafish. Toxicol Appl Pharmacol, 2008. 229(1): p. 44-55.

168

163. Salonen, R.M., et al., Six-year effect of combined vitamin C and E supplementation on atherosclerotic progression: the Antioxidant Supplementation in Atherosclerosis Prevention (ASAP) Study. Circulation, 2003. 107(7): p. 947-53. 164. Lee, I.M., et al., Vitamin E in the primary prevention of cardiovascular disease and cancer: the Women's Health Study: a randomized controlled trial. JAMA, 2005. 294(1): p. 56-65. 165. Fang, J.C., et al., Effect of vitamins C and E on progression of transplant-associated arteriosclerosis: a randomised trial. Lancet, 2002. 359(9312): p. 1108-13. 166. Miller, E.R., 3rd, et al., Meta-analysis: high-dosage vitamin E supplementation may increase all-cause mortality. Ann Intern Med, 2005. 142(1): p. 37-46. 167. Dutta-Roy, A.K., et al., Identification of a low molecular mass (14.2 kDa) alpha- tocopherol-binding protein in the cytosol of rat liver and heart. Biochem Biophys Res Commun, 1993. 196(3): p. 1108-12. 168. Leishman, D.J., et al., A low molecular weight (12-15kDa) protein fraction in rat liver binds alpha-tocopherol. Biochem Soc Trans, 1993. 21(4): p. 408S. 169. Dutta-Roy, A.K., et al., Purification and partial characterisation of an alpha-tocopherol- binding protein from rabbit heart cytosol. Mol Cell Biochem, 1993. 123(1-2): p. 139-44. 170. Gordon, M.J., et al., Characterization of a novel alpha-tocopherol-binding protein from bovine heart cytosol. Arch Biochem Biophys, 1995. 318(1): p. 140-6. 171. Shibata, N., et al., Supernatant protein factor, which stimulates the conversion of squalene to lanosterol, is a cytosolic squalene transfer protein and enhances cholesterol biosynthesis. Proc Natl Acad Sci U S A, 2001. 98(5): p. 2244-9. 172. Zimmer, S., et al., A novel human tocopherol-associated protein: cloning, in vitro expression, and characterization. J Biol Chem, 2000. 275(33): p. 25672-80. 173. Bankaitis, V.A., et al., The Saccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that is required for transport of secretory proteins from the yeast Golgi complex. J Cell Biol, 1989. 108(4): p. 1271-81. 174. Bankaitis, V.A., et al., Phosphatidylinositol transfer protein function in the yeast Saccharomyces cerevisiae. Adv Enzyme Regul, 2005. 45: p. 155-70. 175. Yoshida, Y., et al., Evaluation of lipophilic antioxidant efficacy in vivo by the biomarkers hydroxyoctadecadienoic acid and isoprostane. Lipids, 2007. 42(5): p. 463-72. 176. Yoshida, Y., M. Hayakawa, and E. Niki, Total hydroxyoctadecadienoic acid as a marker for lipid peroxidation in vivo. Biofactors, 2005. 24(1-4): p. 7-15. 177. Gurney, M.E., et al., Benefit of vitamin E, riluzole, and gabapentin in a transgenic model of familial amyotrophic lateral sclerosis. Ann Neurol, 1996. 39(2): p. 147-57. 178. Etminan, M., S.S. Gill, and A. Samii, Intake of vitamin E, vitamin C, and carotenoids and the risk of Parkinson's disease: a meta-analysis. Lancet Neurol, 2005. 4(6): p. 362-5. 179. Vatassery, G.T., Vitamin E. Neurochemistry and implications for neurodegeneration in Parkinson's disease. Ann N Y Acad Sci, 1992. 669: p. 97-109; discussion 109-10. 180. Marras, C., et al., A comparison of treatment thresholds in two large Parkinson's disease clinical trial cohorts. Mov Disord, 2009. 24(16): p. 2370-8. 181. Pasbakhsh, P., et al., The protective effect of vitamin E on locus coeruleus in early model of Parkinson's disease in rat: immunoreactivity evidence. Iran Biomed J, 2008. 12(4): p. 217-22. 182. Fariss, M.W. and J.G. Zhang, Vitamin E therapy in Parkinson's disease. Toxicology, 2003. 189(1-2): p. 129-46. 183. Usuki, F. and K. Maruyama, Ataxia caused by mutations in the alpha-tocopherol transfer protein gene. J Neurol Neurosurg Psychiatry, 2000. 69(2): p. 254-6.

169

184. Behl, C. and B. Moosmann, Antioxidant neuroprotection in Alzheimer's disease as preventive and therapeutic approach. Free Radic Biol Med, 2002. 33(2): p. 182-91. 185. Pham, D.Q. and R. Plakogiannis, Vitamin E supplementation in Alzheimer's disease, Parkinson's disease, tardive dyskinesia, and cataract: Part 2. Ann Pharmacother, 2005. 39(12): p. 2065-72. 186. Jeandel, C., et al., Lipid peroxidation and free radical scavengers in Alzheimer's disease. Gerontology, 1989. 35(5-6): p. 275-82. 187. Bourdel-Marchasson, I., et al., Antioxidant defences and oxidative stress markers in erythrocytes and plasma from normally nourished elderly Alzheimer patients. Age Ageing, 2001. 30(3): p. 235-41. 188. Glaso, M., et al., Reduced concentrations of several vitamins in normal weight patients with late-onset dementia of the Alzheimer type without vascular disease. J Nutr Health Aging, 2004. 8(5): p. 407-13. 189. Tohgi, H., et al., Concentrations of alpha-tocopherol and its quinone derivative in cerebrospinal fluid from patients with vascular dementia of the Binswanger type and Alzheimer type dementia. Neurosci Lett, 1994. 174(1): p. 73-6. 190. Jimenez-Jimenez, F.J., et al., Cerebrospinal fluid levels of alpha-tocopherol (vitamin E) in Alzheimer's disease. J Neural Transm, 1997. 104(6-7): p. 703-10. 191. Montiel, T., et al., Role of oxidative stress on beta-amyloid neurotoxicity elicited during impairment of energy metabolism in the hippocampus: protection by antioxidants. Exp Neurol, 2006. 200(2): p. 496-508. 192. Yamada, K., et al., Protective effects of idebenone and alpha-tocopherol on beta- amyloid-(1-42)-induced learning and memory deficits in rats: implication of oxidative stress in beta-amyloid-induced neurotoxicity in vivo. Eur J Neurosci, 1999. 11(1): p. 83- 90. 193. Sung, S., et al., Early vitamin E supplementation in young but not aged mice reduces Abeta levels and amyloid deposition in a transgenic model of Alzheimer's disease. FASEB J, 2004. 18(2): p. 323-5. 194. Pentchev, P.G., et al., A defect in cholesterol esterification in Niemann-Pick disease (type C) patients. Proc Natl Acad Sci U S A, 1985. 82(23): p. 8247-51. 195. Blanchette-Mackie, E.J., et al., Type-C Niemann-Pick disease: low density lipoprotein uptake is associated with premature cholesterol accumulation in the Golgi complex and excessive cholesterol storage in lysosomes. Proc Natl Acad Sci U S A, 1988. 85(21): p. 8022-6. 196. Cruz, J.C., et al., Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein-derived cholesterol. J Biol Chem, 2000. 275(6): p. 4013-21. 197. Xie, C., et al., Cholesterol balance and metabolism in mice with loss of function of Niemann-Pick C protein. Am J Physiol, 1999. 276(2 Pt 1): p. E336-44. 198. Garver, W.S., et al., Characterization of liver disease and lipid metabolism in the Niemann-Pick C1 mouse. J Cell Biochem, 2007. 101(2): p. 498-516. 199. Vanier, M.T., et al., Niemann-Pick disease type C: an update. J Inherit Metab Dis, 1991. 14(4): p. 580-95. 200. Davidson, C.D., et al., Chronic cyclodextrin treatment of murine Niemann-Pick C disease ameliorates neuronal cholesterol and glycosphingolipid storage and disease progression. PLoS One, 2009. 4(9): p. e6951. 201. Pineda, M., et al., Miglustat in patients with Niemann-Pick disease Type C (NP-C): a multicenter observational retrospective cohort study. Mol Genet Metab, 2009. 98(3): p. 243-9.

170

202. Loftus, S.K., et al., Murine model of Niemann-Pick C disease: mutation in a cholesterol homeostasis gene. Science, 1997. 277(5323): p. 232-5. 203. Carstea, E.D., et al., Niemann-Pick C1 disease gene: homology to mediators of cholesterol homeostasis. Science, 1997. 277(5323): p. 228-31. 204. Naureckiene, S., et al., Identification of HE1 as the second gene of Niemann-Pick C disease. Science, 2000. 290(5500): p. 2298-301. 205. Storch, J. and Z. Xu, Niemann-Pick C2 (NPC2) and intracellular cholesterol trafficking. Biochim Biophys Acta, 2009. 1791(7): p. 671-8. 206. Wang, M.L., et al., Identification of surface residues on niemann-pick C2 essential for hydrophobic Handoff of cholesterol to NPC1 in lysosomes. Cell Metab. 12(2): p. 166-73. 207. Kwon, H.J., et al., Structure of N-terminal domain of NPC1 reveals distinct subdomains for binding and transfer of cholesterol. Cell, 2009. 137(7): p. 1213-24. 208. Infante, R.E., et al., NPC2 facilitates bidirectional transfer of cholesterol between NPC1 and lipid bilayers, a step in cholesterol egress from lysosomes. Proc Natl Acad Sci U S A, 2008. 105(40): p. 15287-92. 209. Infante, R.E., et al., Purified NPC1 protein: II. Localization of sterol binding to a 240- amino acid soluble luminal loop. J Biol Chem, 2008. 283(2): p. 1064-75. 210. Infante, R.E., et al., Purified NPC1 protein. I. Binding of cholesterol and oxysterols to a 1278-amino acid membrane protein. J Biol Chem, 2008. 283(2): p. 1052-63. 211. Cheruku, S.R., et al., Mechanism of cholesterol transfer from the Niemann-Pick type C2 protein to model membranes supports a role in lysosomal cholesterol transport. J Biol Chem, 2006. 281(42): p. 31594-604. 212. Lloyd-Evans, E. and F.M. Platt, Lipids on trial: the search for the offending metabolite in Niemann-Pick type C disease. Traffic, 2010. 11(4): p. 419-28. 213. Vanier, M.T., et al., Type C Niemann-Pick disease: spectrum of phenotypic variation in disruption of intracellular LDL-derived cholesterol processing. Biochim Biophys Acta, 1991. 1096(4): p. 328-37. 214. Doerflinger, N., et al., Ataxia with vitamin E deficiency: refinement of genetic localization and analysis of linkage disequilibrium by using new markers in 14 families. Am J Hum Genet, 1995. 56(5): p. 1116-24. 215. Sarna, J.R., et al., Patterned Purkinje cell degeneration in mouse models of Niemann-Pick type C disease. J Comp Neurol, 2003. 456(3): p. 279-91. 216. Yokota, T., et al., Postmortem study of ataxia with retinitis pigmentosa by mutation of the alpha-tocopherol transfer protein gene. J Neurol Neurosurg Psychiatry, 2000. 68(4): p. 521-5. 217. Walkley, S.U. and K. Suzuki, Consequences of NPC1 and NPC2 loss of function in mammalian neurons. Biochim Biophys Acta, 2004. 1685(1-3): p. 48-62. 218. Pillai, S.R., et al., Concomitant brainstem axonal dystrophy and necrotizing myopathy in vitamin E-deficient rats. J Neurol Sci, 1994. 123(1-2): p. 64-73. 219. Sung, J.H., A.R. Mastri, and S.H. Park, Axonal dystrophy in the gracile nucleus in children and young adults. Reappraisal of the incidence and associated diseases. J Neuropathol Exp Neurol, 1981. 40(1): p. 37-45. 220. Landrieu, P. and G. Said, Peripheral neuropathy in type A Niemann-Pick disease. A morphological study. Acta Neuropathol, 1984. 63(1): p. 66-71. 221. Hahn, A.F., et al., Nerve biopsy findings in Niemann-Pick type II (NPC). Acta Neuropathol, 1994. 87(2): p. 149-54. 222. Bascunan-Castillo, E.C., et al., Tamoxifen and vitamin E treatments delay symptoms in the mouse model of Niemann-Pick C. J Appl Genet, 2004. 45(4): p. 461-7.

171

223. Rupar, C.A., S. Albo, and J.D. Whitehall, Rat liver lysosome membranes are enriched in alpha-tocopherol. Biochem Cell Biol, 1992. 70(6): p. 486-8. 224. Manson, M.E., et al., cAMP-mediated regulation of cholesterol accumulation in cystic fibrosis and Niemann-Pick type C cells. Am J Physiol Lung Cell Mol Physiol, 2008. 295(5): p. L809-19. 225. Basu, A., et al., Hepatitis C virus core protein is necessary for the maintenance of immortalized human hepatocytes. Virology, 2002. 298(1): p. 53-62. 226. Ray, R.B., K. Meyer, and R. Ray, Hepatitis C virus core protein promotes immortalization of primary human hepatocytes. Virology, 2000. 271(1): p. 197-204. 227. Sleat, D.E., et al., Genetic evidence for nonredundant functional cooperativity between NPC1 and NPC2 in lipid transport. Proc Natl Acad Sci U S A, 2004. 101(16): p. 5886-91. 228. Asmis, R., Physical partitioning is the main mechanism of alpha-tocopherol and cholesterol transfer between lipoproteins and P388D1 macrophage-like cells. Eur J Biochem, 1997. 250(2): p. 600-7. 229. Liscum, L. and S.L. Sturley, Intracellular trafficking of Niemann-Pick C proteins 1 and 2: obligate components of subcellular lipid transport. Biochim Biophys Acta, 2004. 1685(1- 3): p. 22-7. 230. Harzer, K., G. Massenkeil, and E. Frohlich, Concurrent increase of cholesterol, sphingomyelin and glucosylceramide in the spleen from non-neurologic Niemann-Pick type C patients but also patients possibly affected with other lipid trafficking disorders. FEBS Lett, 2003. 537(1-3): p. 177-81. 231. Kobayashi, T., et al., Late endosomal membranes rich in lysobisphosphatidic acid regulate cholesterol transport. Nat Cell Biol, 1999. 1(2): p. 113-8. 232. Gondre-Lewis, M.C., R. McGlynn, and S.U. Walkley, Cholesterol accumulation in NPC1- deficient neurons is ganglioside dependent. Curr Biol, 2003. 13(15): p. 1324-9. 233. Kulinski, A. and J.E. Vance, Lipid homeostasis and lipoprotein secretion in Niemann-Pick C1-deficient hepatocytes. J Biol Chem, 2007. 282(3): p. 1627-37. 234. Zhang, W.X., et al., Effect of bilayer phospholipid composition and curvature on ligand transfer by the alpha-tocopherol transfer protein. Lipids, 2009. 44(7): p. 631-41. 235. Beltroy, E.P., et al., Cholesterol accumulation and liver cell death in mice with Niemann- Pick type C disease. Hepatology, 2005. 42(4): p. 886-93. 236. Bornig, H. and G. Geyer, Staining of cholesterol with the fluorescent antibiotic "filipin". Acta Histochem, 1974. 50(1): p. 110-5. 237. Pentchev, P.G., et al., Group C Niemann-Pick disease: faulty regulation of low-density lipoprotein uptake and cholesterol storage in cultured fibroblasts. FASEB J, 1987. 1(1): p. 40-5. 238. Storey, S.M., et al., Effect of sterol carrier protein-2 gene ablation on HDL-mediated cholesterol efflux from cultured primary mouse hepatocytes. Am J Physiol Gastrointest Liver Physiol, 2010. 299(1): p. G244-54. 239. Ramirez, D.M., W.W. Ogilvie, and L.J. Johnston, NBD-cholesterol probes to track cholesterol distribution in model membranes. Biochim Biophys Acta, 2010. 1798(3): p. 558-68. 240. White, N.M., et al., Altered cholesterol homeostasis in cultured and in vivo models of cystic fibrosis. Am J Physiol Lung Cell Mol Physiol, 2007. 292(2): p. L476-86. 241. Frolov, A., et al., High density lipoprotein-mediated cholesterol uptake and targeting to lipid droplets in intact L-cell fibroblasts. A single- and multiphoton fluorescence approach. J Biol Chem, 2000. 275(17): p. 12769-80.

172

242. Veyrat-Durebex, C., et al., Internalization and trafficking of the human and rat growth hormone-releasing hormone receptor. J Cell Physiol, 2005. 203(2): p. 335-44. 243. Huang, S.N., M.A. Phelps, and P.W. Swaan, Involvement of endocytic organelles in the subcellular trafficking and localization of riboflavin. J Pharmacol Exp Ther, 2003. 306(2): p. 681-7. 244. Gruger, E.H., Jr. and A.L. Tappel, Reactions of biological antioxidants. 3. Composition of biological membranes. Lipids, 1971. 6(2): p. 147-8. 245. Buttriss, J.L. and A.T. Diplock, The relationship between alpha-tocopherol and phospholipid fatty acids in rat liver subcellular membrane fractions. Biochim Biophys Acta, 1988. 962(1): p. 81-90. 246. Ohgami, N., et al., Binding between the Niemann-Pick C1 protein and a photoactivatable cholesterol analog requires a functional sterol-sensing domain. Proc Natl Acad Sci U S A, 2004. 101(34): p. 12473-8. 247. Liu, B., et al., Cyclodextrin overcomes the transport defect in nearly every organ of NPC1 mice leading to excretion of sequestered cholesterol as bile acid. J Lipid Res, 2010. 51(5): p. 933-44. 248. Liu, R., et al., Characterization of fluorescent sterol binding to purified human NPC1. J Biol Chem, 2009. 284(3): p. 1840-52. 249. Ford, E.S., et al., Distribution of serum concentrations of alpha-tocopherol and gamma- tocopherol in the US population. Am J Clin Nutr, 2006. 84(2): p. 375-83. 250. Brites, F., et al., Evaluation of alpha-tocopherol contained in plasma lipoproteins: How should the data be expressed? Nutr Metab Cardiovasc Dis, 2005. 15(3): p. 234-7. 251. Tanaka, J., H. Nakamura, and S. Miyawaki, Cerebellar involvement in murine sphingomyelinosis: a new model of Niemann-Pick disease. J Neuropathol Exp Neurol, 1988. 47(3): p. 291-300. 252. Dietschy, J.M. and S.D. Turley, Cholesterol metabolism in the brain. Curr Opin Lipidol, 2001. 12(2): p. 105-12. 253. Xie, C., et al., Cholesterol is sequestered in the brains of mice with Niemann-Pick type C disease but turnover is increased. J Neuropathol Exp Neurol, 2000. 59(12): p. 1106-17. 254. German, D.C., et al., Degeneration of neurons and glia in the Niemann-Pick C mouse is unrelated to the low-density lipoprotein receptor. Neuroscience, 2001. 105(4): p. 999- 1005. 255. Podratz, J.L., E.H. Rodriguez, and A.J. Windebank, Antioxidants are necessary for myelination of dorsal root ganglion neurons, in vitro. Glia, 2004. 45(1): p. 54-8. 256. Enrione, E.B., et al., A vitamin E-deficient diet affects nerve regeneration in rats. Nutrition, 1999. 15(2): p. 140-4. 257. Hyland, S., et al., Cortical gene expression in the vitamin E-deficient rat: possible mechanisms for the electrophysiological abnormalities of visual and neural function. Ann Nutr Metab, 2006. 50(5): p. 433-41. 258. Xie, C., S.D. Turley, and J.M. Dietschy, Cholesterol accumulation in tissues of the Niemann-pick type C mouse is determined by the rate of lipoprotein-cholesterol uptake through the coated-pit pathway in each organ. Proc Natl Acad Sci U S A, 1999. 96(21): p. 11992-7. 259. Yamada, A., et al., Progressive neuronal loss in the ventral posterior lateral and medial nuclei of thalamus in Niemann-Pick disease type C mouse brain. Brain Dev, 2001. 23(5): p. 288-97. 260. Garver, W.S., et al., The National Niemann-Pick C1 disease database: report of clinical features and health problems. Am J Med Genet A, 2007. 143A(11): p. 1204-11.

173

261. Yu, W., et al., Altered cholesterol metabolism in Niemann-Pick type C1 mouse brains affects mitochondrial function. J Biol Chem, 2005. 280(12): p. 11731-9. 262. Reddy, J.V., I.G. Ganley, and S.R. Pfeffer, Clues to neuro-degeneration in Niemann-Pick type C disease from global gene expression profiling. PLoS One, 2006. 1: p. e19. 263. Porter, F.D., et al., Cholesterol oxidation products are sensitive and specific blood-based biomarkers for Niemann-Pick C1 disease. Sci Transl Med, 2010. 2(56): p. 56ra81. 264. Fu, R., et al., Oxidative stress in Niemann-Pick disease, type C. Mol Genet Metab, 2010. 101(2-3): p. 214-8. 265. Shishehbor, M.H., et al., Systemic elevations of free radical oxidation products of arachidonic acid are associated with angiographic evidence of coronary artery disease. Free Radic Biol Med, 2006. 41(11): p. 1678-83. 266. Yoshida, Y., et al., The role of alpha-tocopherol in motor hypofunction with aging in alpha-tocopherol transfer protein knockout mice as assessed by oxidative stress biomarkers. J Nutr Biochem, 2010. 21(1): p. 66-76. 267. Morley, S., et al., Tocopherol transfer protein sensitizes prostate cancer cells to vitamin E. J Biol Chem, 2010. 285(46): p. 35578-89. 268. Fechner, H., et al., alpha- and delta-tocopherol induce expression of hepatic alpha- tocopherol-transfer-protein mRNA. Biochem J, 1998. 331 ( Pt 2): p. 577-81. 269. Rius, J., et al., NF-kappaB links innate immunity to the hypoxic response through transcriptional regulation of HIF-1alpha. Nature, 2008. 453(7196): p. 807-11. 270. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8. 271. Corpet, F., Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res, 1988. 16(22): p. 10881-90. 272. Quandt, K., et al., MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res, 1995. 23(23): p. 4878-84. 273. Lugnier, C., Cyclic nucleotide phosphodiesterase (PDE) superfamily: a new target for the development of specific therapeutic agents. Pharmacol Ther, 2006. 109(3): p. 366-98. 274. Forman, B.M., J. Chen, and R.M. Evans, Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc Natl Acad Sci U S A, 1997. 94(9): p. 4312-7. 275. Berger, J. and J.A. Wagner, Physiological and therapeutic roles of peroxisome proliferator-activated receptors. Diabetes Technol Ther, 2002. 4(2): p. 163-74. 276. Schroeder, F., et al., Role of fatty acid binding proteins and long chain fatty acids in modulating nuclear receptors and gene transcription. Lipids, 2008. 43(1): p. 1-17. 277. Lee, T.I. and R.A. Young, Transcription of eukaryotic protein-coding genes. Annu Rev Genet, 2000. 34: p. 77-137. 278. Wijgerde, M., F. Grosveld, and P. Fraser, Transcription complex stability and chromatin dynamics in vivo. Nature, 1995. 377(6546): p. 209-13. 279. Muller, M.M., T. Gerster, and W. Schaffner, Enhancer sequences and the regulation of gene transcription. Eur J Biochem, 1988. 176(3): p. 485-95. 280. Myers, L.C. and R.D. Kornberg, Mediator of transcriptional regulation. Annu Rev Biochem, 2000. 69: p. 729-49. 281. Chen, J., et al., Water-soluble antioxidants improve the antioxidant and anticancer activity of low concentrations of curcumin in human leukemia cells. Pharmazie, 2005. 60(1): p. 57-61.

174

282. Dalton, T., R.D. Palmiter, and G.K. Andrews, Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor/antioxidant response element and metal response promoter elements. Nucleic Acids Res, 1994. 22(23): p. 5016-23. 283. Abou Elela, S. and R.N. Nazar, Role of the 5.8S rRNA in ribosome translocation. Nucleic Acids Res, 1997. 25(9): p. 1788-94. 284. Morgan, M.J. and Z.G. Liu, Crosstalk of reactive oxygen species and NF-kappaB signaling. Cell Res, 2011. 21(1): p. 103-15. 285. Pierce, J.W., et al., Novel inhibitors of cytokine-induced IkappaBalpha phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo. J Biol Chem, 1997. 272(34): p. 21096-103. 286. Koedel, U., et al., Pharmacologic interference with NF-kappaB activation attenuates central nervous system complications in experimental Pneumococcal meningitis. J Infect Dis, 2000. 182(5): p. 1437-45. 287. Wright, M.E., et al., Association of variants in two vitamin e transport genes with circulating vitamin e concentrations and prostate cancer risk. Cancer Res, 2009. 69(4): p. 1429-38. 288. Kelly, F.J., R. Lee, and I.S. Mudway, Inter- and intra-individual vitamin E uptake in healthy subjects is highly repeatable across a wide supplementation dose range. Ann N Y Acad Sci, 2004. 1031: p. 22-39. 289. Yoshida, Y., et al., Lipid peroxidation induced by carbon tetrachloride and its inhibition by antioxidant as evaluated by an oxidative stress marker, HODE. Toxicol Appl Pharmacol, 2005. 208(1): p. 87-97. 290. Itoh, N., et al., gamma-Tocopherol attenuates MPTP-induced dopamine loss more efficiently than alpha-tocopherol in mouse brain. Neurosci Lett, 2006. 403(1-2): p. 136- 40. 291. Kim, H.S., et al., Age-related changes of alpha-tocopherol transfer protein expression in rat liver. J Nutr Sci Vitaminol (Tokyo), 1996. 42(1): p. 11-8. 292. Aiguo, W., Y. Zhe, and F. Gomez-Pinilla, Vitamin E protects against oxidative damage and learning disability after mild traumatic brain injury in rats. Neurorehabil Neural Repair, 2010. 24(3): p. 290-8. 293. Hernandez-Pinto, A.M., L. Puebla-Jimenez, and E. Arilla-Ferreiro, alpha-Tocopherol decreases the somatostatin receptor-effector system and increases the cyclic AMP/cyclic AMP response element binding protein pathway in the rat dentate gyrus. Neuroscience, 2009. 162(1): p. 106-17. 294. Carlezon, W.A., Jr., R.S. Duman, and E.J. Nestler, The many faces of CREB. Trends Neurosci, 2005. 28(8): p. 436-45. 295. Liu, Q., et al., Prevention and treatment of Alzheimer disease and aging: antioxidants. Mini Rev Med Chem, 2007. 7(2): p. 171-80. 296. Singh, N., C.A. Cohen, and B.A. Rzigalinski, Treatment of neurodegenerative disorders with radical nanomedicine. Ann N Y Acad Sci, 2007. 1122: p. 219-30. 297. Perrone, S., et al., Oxidative stress and nutrition in the preterm newborn. J Pediatr Gastroenterol Nutr, 2007. 45 Suppl 3: p. S178-82. 298. Winton, M.J., et al., Characterization of tau pathologies in gray and white matter of Guam parkinsonism-dementia complex. Acta Neuropathol, 2006. 111(5): p. 401-12. 299. Joseph, J.A., et al., Membrane and receptor modifications of oxidative stress vulnerability in aging. Nutritional considerations. Ann N Y Acad Sci, 1998. 854: p. 268-76.

175

300. Hardwick, J.P., et al., PPAR/RXR Regulation of Fatty Acid Metabolism and Fatty Acid omega-Hydroxylase (CYP4) Isozymes: Implications for Prevention of Lipotoxicity in Fatty Liver Disease. PPAR Res, 2009. 2009: p. 952734. 301. Yu, S. and J.K. Reddy, Transcription coactivators for peroxisome proliferator-activated receptors. Biochim Biophys Acta, 2007. 1771(8): p. 936-51. 302. Lippman, S.M., et al., Effect of selenium and vitamin E on risk of prostate cancer and other cancers: the Selenium and Vitamin E Cancer Prevention Trial (SELECT). JAMA, 2009. 301(1): p. 39-51. 303. Goodman, G.E., et al., The association between lung and prostate cancer risk, and serum micronutrients: results and lessons learned from beta-carotene and retinol efficacy trial. Cancer Epidemiol Biomarkers Prev, 2003. 12(6): p. 518-26. 304. Weinstein, S.J., et al., Serum alpha-tocopherol and gamma-tocopherol in relation to prostate cancer risk in a prospective study. J Natl Cancer Inst, 2005. 97(5): p. 396-9. 305. Factor, V.M., et al., Vitamin E reduces chromosomal damage and inhibits hepatic tumor formation in a transgenic mouse model. Proc Natl Acad Sci U S A, 2000. 97(5): p. 2196- 201. 306. Lovell, M.A., et al., Elevated thiobarbituric acid-reactive substances and antioxidant enzyme activity in the brain in Alzheimer's disease. Neurology, 1995. 45(8): p. 1594-601. 307. Montine, T.J., et al., Cerebrospinal fluid F2-isoprostane levels are increased in Alzheimer's disease. Ann Neurol, 1998. 44(3): p. 410-3. 308. Kaempf-Rotzoll, D.E., et al., Alpha-tocopherol transfer protein is specifically localized at the implantation site of pregnant mouse uterus. Biol Reprod, 2002. 67(2): p. 599-604. 309. Yokoyama, A., et al., Microglia, a potential source of neurons, astrocytes, and oligodendrocytes. Glia, 2004. 45(1): p. 96-104. 310. Cahoy, J.D., et al., A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function. J Neurosci, 2008. 28(1): p. 264-78. 311. Jacque, C.M., et al., Determination of glial fibrillary acidic protein (GFAP) in human brain tumors. J Neurol Sci, 1978. 35(1): p. 147-55. 312. Reeves, S.A., et al., Molecular cloning and primary structure of human glial fibrillary acidic protein. Proc Natl Acad Sci U S A, 1989. 86(13): p. 5178-82. 313. Caccamo, D.V., et al., An immunohistochemical characterization of the primitive and maturing neuroepithelial components in the OTT-6050 transplantable mouse teratoma. Neuropathol Appl Neurobiol, 1989. 15(5): p. 389-405. 314. Caccamo, D.V., M.M. Herman, and L.J. Rubinstein, An immunohistochemical study of the primitive and maturing elements of human cerebral medulloepitheliomas. Acta Neuropathol, 1989. 79(3): p. 248-54. 315. Burgoyne, R.D., et al., Differential distribution of beta-tubulin isotypes in cerebellum. EMBO J, 1988. 7(8): p. 2311-9. 316. Gahwiler, B.H., et al., Organotypic slice cultures: a technique has come of age. Trends Neurosci, 1997. 20(10): p. 471-7. 317. Guerineau, N.C., et al., Organotypic cultures of the rat anterior pituitary: morphology, physiology and cell-to-cell communication. J Neurosci Methods, 1997. 73(2): p. 169-76. 318. Pfrieger, F.W., Outsourcing in the brain: do neurons depend on cholesterol delivery by astrocytes? Bioessays, 2003. 25(1): p. 72-8. 319. Fagan, A.M., et al., Unique lipoproteins secreted by primary astrocytes from wild type, apoE (-/-), and human apoE transgenic mice. J Biol Chem, 1999. 274(42): p. 30001-7.

176

320. Nalecz, K.A., M.J. Nalecz, and A. Azzi, Isolation of tocopherol-binding proteins from the cytosol of smooth muscle A7r5 cells. Eur J Biochem, 1992. 209(1): p. 37-42. 321. Tanito, M., et al., Acceleration of age-related changes in the retina in alpha-tocopherol transfer protein null mice fed a Vitamin E-deficient diet. Invest Ophthalmol Vis Sci, 2007. 48(1): p. 396-404. 322. Yoshida, Y., et al., Antioxidant effects of 2,3-dihydro-5-hydroxy-4,6-di-tert-butyl-2,2- dipentylbenzofuran and alpha-tocopherol in hyperlipidemic mice as evaluated by hydroxyoctadecadienoic acid and 7-hydroxycholesterol. Biochem Pharmacol, 2007. 74(7): p. 1010-9. 323. Vance, J.E., B. Karten, and H. Hayashi, Lipid dynamics in neurons. Biochem Soc Trans, 2006. 34(Pt 3): p. 399-403. 324. Pitas, R.E., et al., Astrocytes synthesize apolipoprotein E and metabolize apolipoprotein E-containing lipoproteins. Biochim Biophys Acta, 1987. 917(1): p. 148-61. 325. Fagan, A.M., et al., Apolipoprotein E-containing high density lipoprotein promotes neurite outgrowth and is a ligand for the low density lipoprotein receptor-related protein. J Biol Chem, 1996. 271(47): p. 30121-5. 326. LaDu, M.J., et al., Nascent astrocyte particles differ from lipoproteins in CSF. J Neurochem, 1998. 70(5): p. 2070-81. 327. Boyles, J.K., et al., Apolipoprotein E associated with astrocytic glia of the central nervous system and with nonmyelinating glia of the peripheral nervous system. J Clin Invest, 1985. 76(4): p. 1501-13. 328. Arai, H., [Molecular mechanism of vitamin E transport in the body]. Nippon Rinsho, 1999. 57(10): p. 2276-83. 329. Arita, M., H. Arai, and K. Inoue, [Physiological function of alpha-tocopherol transfer protein]. Tanpakushitsu Kakusan Koso, 1999. 44(8 Suppl): p. 1219-26. 330. Goti, D., et al., High-density lipoprotein (HDL3)-associated alpha-tocopherol is taken up by HepG2 cells via the selective uptake pathway and resecreted with endogenously synthesized apo-lipoprotein B-rich lipoprotein particles. Biochem J, 1998. 332 ( Pt 1): p. 57-65. 331. Cohn, W., et al., Plasma clearance and net uptake of alpha-tocopherol and low-density lipoprotein by tissues in WHHL and control rabbits. Biochem J, 1992. 287 ( Pt 1): p. 247- 54. 332. Cohn, W., et al., Tocopherol transport and absorption. Proc Nutr Soc, 1992. 51(2): p. 179-88. 333. Bartlett, W.P. and G.A. Banker, An electron microscopic study of the development of axons and dendrites by hippocampal neurons in culture. II. Synaptic relationships. J Neurosci, 1984. 4(8): p. 1954-65. 334. Bartlett, W.P. and G.A. Banker, An electron microscopic study of the development of axons and dendrites by hippocampal neurons in culture. I. Cells which develop without intercellular contacts. J Neurosci, 1984. 4(8): p. 1944-53. 335. Tanaka, M., et al., Observation of the highly organized development of granule cells in rat cerebellar organotypic cultures. Brain Res, 1994. 641(2): p. 319-27. 336. Neely, M.D. and T.J. Montine, CSF lipoproteins and Alzheimer's disease. J Nutr Health Aging, 2002. 6(6): p. 383-91. 337. Pitas, R.E., et al., Lipoproteins and their receptors in the central nervous system. Characterization of the lipoproteins in cerebrospinal fluid and identification of apolipoprotein B,E(LDL) receptors in the brain. J Biol Chem, 1987. 262(29): p. 14352-60.

177

338. Linton, M.F., et al., Phenotypes of apolipoprotein B and apolipoprotein E after liver transplantation. J Clin Invest, 1991. 88(1): p. 270-81. 339. Vatassery, G.T., et al., Apolipoprotein e deficiency leads to altered brain uptake of alpha tocopherol injected into lateral cerebral ventricles. Biochim Biophys Acta, 2007. 1772(7): p. 797-803. 340. Vatassery, G.T., et al., Apolipoprotein E exerts selective and differential control over vitamin E concentrations in different areas of mammalian brain. J Neurosci Res, 2006. 84(6): p. 1335-42. 341. Pfrieger, F.W., Cholesterol homeostasis and function in neurons of the central nervous system. Cell Mol Life Sci, 2003. 60(6): p. 1158-71. 342. Holtzman, D.M., et al., Expression of human apolipoprotein E reduces amyloid-beta deposition in a mouse model of Alzheimer's disease. J Clin Invest, 1999. 103(6): p. R15- R21. 343. Wahrle, S.E., et al., ABCA1 is required for normal central nervous system ApoE levels and for lipidation of astrocyte-secreted apoE. J Biol Chem, 2004. 279(39): p. 40987-93. 344. Pan, C., et al., CD10 is a key enzyme involved in the activation of tumor-activated peptide prodrug CPI-0004Na and novel analogues: implications for the design of novel peptide prodrugs for the therapy of CD10+ tumors. Cancer Res, 2003. 63(17): p. 5526-31. 345. Bhatia, P., et al., Mitotic DNA damage targets the Aurora A/TPX2 complex. Cell Cycle, 2010. 9(22): p. 4592-9. 346. Martins, I.J., et al., Cholesterol metabolism and transport in the pathogenesis of Alzheimer's disease. J Neurochem, 2009. 111(6): p. 1275-308. 347. Yu, C., K.L. Youmans, and M.J. LaDu, Proposed mechanism for lipoprotein remodelling in the brain. Biochim Biophys Acta, 2010. 1801(8): p. 819-23. 348. Sutherland, L.M., K.M. Hemsley, and J.J. Hopwood, Primary culture of neural cells isolated from the cerebellum of newborn and adult mucopolysaccharidosis type IIIA mice. Cell Mol Neurobiol, 2008. 28(7): p. 949-59. 349. Gogolla, N., et al., Preparation of organotypic hippocampal slice cultures for long-term live imaging. Nat Protoc, 2006. 1(3): p. 1165-71. 350. Atkinson, J.K., et al., Fluorescent tocopherols as probes of inter-vesicular transfer catalyzed by the alpha-tocopherol transfer protein. Ann N Y Acad Sci, 2004. 1031: p. 324- 7. 351. Gogolla, N., et al., Staining protocol for organotypic hippocampal slice cultures. Nat Protoc, 2006. 1(5): p. 2452-6. 352. Goulinet, S. and M.J. Chapman, Plasma LDL and HDL subspecies are heterogenous in particle content of tocopherols and oxygenated and hydrocarbon carotenoids. Relevance to oxidative resistance and atherogenesis. Arterioscler Thromb Vasc Biol, 1997. 17(4): p. 786-96. 353. Perugini, C., et al., DISTRIBUTION OF LIPID-SOLUBLE ANTIOXIDANTS IN LIPOPROTEINS FROM HEALTHY SUBJECTS. II. EFFECTS OF IN VIVO SUPPLEMENTATION WITH alpha- TOCOPHEROL. Pharmacol Res, 2000. 41(1): p. 65-72. 354. Ford, L., et al., The value of measuring serum cholesterol-adjusted vitamin E in routine practice. Ann Clin Biochem, 2006. 43(Pt 2): p. 130-4. 355. Eichhorn, J.C., et al., Alpha- and gamma-tocopherol plasma and urinary biokinetics following alpha-tocopherol supplementation. Ann N Y Acad Sci, 2004. 1031: p. 339-40. 356. Kamal-Eldin, A. and L.A. Appelqvist, The chemistry and antioxidant properties of tocopherols and tocotrienols. Lipids, 1996. 31(7): p. 671-701.

178

357. Tappel, A.L., et al., Increased lysosomal enzymes in genetic muscular dystrophy. Arch Biochem Biophys, 1962. 96: p. 340-6. 358. Papas, A. and E. Vos, Vitamin E, cancer, and apoptosis. Am J Clin Nutr, 2001. 73(6): p. 1113-4. 359. Marchioli, R., Antioxidant vitamins and prevention of cardiovascular disease: laboratory, epidemiological and clinical trial data. Pharmacol Res, 1999. 40(3): p. 227-38. 360. Viana, M., E. Herrera, and B. Bonet, Teratogenic effects of diabetes mellitus in the rat. Prevention by vitamin E. Diabetologia, 1996. 39(9): p. 1041-6. 361. Nakashima, H., et al., Effects of alpha-tocopherol on an animal model of tauopathies. Free Radic Biol Med, 2004. 37(2): p. 176-86. 362. Feranchak, A.P., et al., Prospective, long-term study of fat-soluble vitamin status in children with cystic fibrosis identified by newborn screen. J Pediatr, 1999. 135(5): p. 601- 10. 363. Elias, E., D.P. Muller, and J. Scott, Association of spinocerebellar disorders with cystic fibrosis or chronic childhood cholestasis and very low serum vitamin E. Lancet, 1981. 2(8259): p. 1319-21. 364. Guggenheim, M.A., et al., Progressive neuromuscular disease in children with chronic cholestasis and vitamin E deficiency: diagnosis and treatment with alpha tocopherol. J Pediatr, 1982. 100(1): p. 51-8. 365. Sokol, R.J., et al., Improved neurologic function after long-term correction of vitamin E deficiency in children with chronic cholestasis. N Engl J Med, 1985. 313(25): p. 1580-6. 366. Harding, A.E., et al., Spinocerebellar degeneration secondary to chronic intestinal malabsorption: a vitamin E deficiency syndrome. Ann Neurol, 1982. 12(5): p. 419-24. 367. Howard, L., et al., Reversible neurological symptoms caused by vitamin E deficiency in a patient with short bowel syndrome. Am J Clin Nutr, 1982. 36(6): p. 1243-9. 368. Brin, M.F., et al., Electrophysiologic features of abetalipoproteinemia: functional consequences of vitamin E deficiency. Neurology, 1986. 36(5): p. 669-73. 369. Dannoura, A.H., et al., Anderson's disease: exclusion of apolipoprotein and intracellular lipid transport genes. Arterioscler Thromb Vasc Biol, 1999. 19(10): p. 2494-508. 370. Pulai, J.I., et al., Genetic heterogeneity in familial hypobetalipoproteinemia: linkage and non-linkage to the apoB gene in Caucasian families. Am J Med Genet, 1998. 76(1): p. 79- 86. 371. Engel, W.K., et al., Neuropathy in Tangier disease. Alpha-Lipoprotein deficiency manifesting as familial recurrent neuropathy and intestinal lipid storage. Arch Neurol, 1967. 17(1): p. 1-9. 372. Traber, M.G., et al., Impaired ability of patients with familial isolated vitamin E deficiency to incorporate alpha-tocopherol into lipoproteins secreted by the liver. J Clin Invest, 1990. 85(2): p. 397-407. 373. Ben Hamida, M., et al., Friedreich's ataxia phenotype not linked to chromosome 9 and associated with selective autosomal recessive vitamin E deficiency in two inbred Tunisian families. Neurology, 1993. 43(11): p. 2179-83. 374. Ben Hamida, C., et al., Localization of Friedreich ataxia phenotype with selective vitamin E deficiency to chromosome 8q by homozygosity mapping. Nat Genet, 1993. 5(2): p. 195- 200. 375. Browne, S.E., et al., Treatment with a catalytic antioxidant corrects the neurobehavioral defect in ataxia-telangiectasia mice. Free Radic Biol Med, 2004. 36(7): p. 938-42. 376. Gatei, M., et al., Ataxia-telangiectasia: chronic activation of damage-responsive functions is reduced by alpha-lipoic acid. Oncogene, 2001. 20(3): p. 289-94.

179

377. Kamsler, A., et al., Increased oxidative stress in ataxia telangiectasia evidenced by alterations in redox state of brains from Atm-deficient mice. Cancer Res, 2001. 61(5): p. 1849-54. 378. Lavin, M.F., Ataxia-telangiectasia: from a rare disorder to a paradigm for cell signalling and cancer. Nat Rev Mol Cell Biol, 2008. 9(10): p. 759-69. 379. Reichenbach, J., et al., Elevated oxidative stress in patients with ataxia telangiectasia. Antioxid Redox Signal, 2002. 4(3): p. 465-9. 380. Gueven, N., et al., Dramatic extension of tumor latency and correction of neurobehavioral phenotype in Atm-mutant mice with a nitroxide antioxidant. Free Radic Biol Med, 2006. 41(6): p. 992-1000. 381. Barlow, C., et al., Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell, 1996. 86(1): p. 159-71. 382. Barlow, C., et al., Loss of the ataxia-telangiectasia gene product causes oxidative damage in target organs. Proc Natl Acad Sci U S A, 1999. 96(17): p. 9915-9. 383. Davis, P.B., Cystic fibrosis since 1938. Am J Respir Crit Care Med, 2006. 173(5): p. 475-82. 384. Koscik, R.L., et al., Cognitive function of children with cystic fibrosis: deleterious effect of early malnutrition. Pediatrics, 2004. 113(6): p. 1549-58. 385. Sitrin, M.D., et al., Vitamin E deficiency and neurologic disease in adults with cystic fibrosis. Ann Intern Med, 1987. 107(1): p. 51-4. 386. Willison, H.J., et al., A study of the relationship between neurological function and serum vitamin E concentrations in patients with cystic fibrosis. J Neurol Neurosurg Psychiatry, 1985. 48(11): p. 1097-102. 387. Brown, R.K. and F.J. Kelly, Evidence for increased oxidative damage in patients with cystic fibrosis. Pediatr Res, 1994. 36(4): p. 487-93. 388. Winklhofer-Roob, B.M., Oxygen free radicals and antioxidants in cystic fibrosis: the concept of an oxidant-antioxidant imbalance. Acta Paediatr Suppl, 1994. 83(395): p. 49- 57. 389. Snouwaert, J.N., et al., An animal model for cystic fibrosis made by gene targeting. Science, 1992. 257(5073): p. 1083-8. 390. Montine, T.J., et al., Lipid peroxidation in aging brain and Alzheimer's disease. Free Radic Biol Med, 2002. 33(5): p. 620-6. 391. Markesbery, W.R. and J.M. Carney, Oxidative alterations in Alzheimer's disease. Brain Pathol, 1999. 9(1): p. 133-46. 392. Lovell, M.A., S.P. Gabbita, and W.R. Markesbery, Increased DNA oxidation and decreased levels of repair products in Alzheimer's disease ventricular CSF. J Neurochem, 1999. 72(2): p. 771-6. 393. Smith, M.A., et al., Amyloid-beta deposition in Alzheimer transgenic mice is associated with oxidative stress. J Neurochem, 1998. 70(5): p. 2212-5. 394. Abdul, H.M., et al., Oxidative damage in brain from human mutant APP/PS-1 double knock-in mice as a function of age. Free Radic Biol Med, 2008. 45(10): p. 1420-5. 395. Sompol, P., et al., A neuronal model of Alzheimer's disease: an insight into the mechanisms of oxidative stress-mediated mitochondrial injury. Neuroscience, 2008. 153(1): p. 120-30. 396. Resende, R., et al., Brain oxidative stress in a triple-transgenic mouse model of Alzheimer disease. Free Radic Biol Med, 2008. 44(12): p. 2051-7. 397. Pratico, D., et al., Increased lipid peroxidation precedes amyloid plaque formation in an animal model of Alzheimer amyloidosis. J Neurosci, 2001. 21(12): p. 4183-7.

180

398. Oddo, S., et al., Triple-transgenic model of Alzheimer's disease with plaques and tangles: intracellular Abeta and synaptic dysfunction. Neuron, 2003. 39(3): p. 409-21. 399. Vanier, M.T., et al., Type C Niemann-Pick disease: biochemical aspects and phenotypic heterogeneity. Dev Neurosci, 1991. 13(4-5): p. 307-14. 400. Walkley, S.U. and M.T. Vanier, Secondary lipid accumulation in lysosomal disease. Biochim Biophys Acta, 2009. 1793(4): p. 726-36. 401. Walkley, S.U., Secondary accumulation of gangliosides in lysosomal storage disorders. Semin Cell Dev Biol, 2004. 15(4): p. 433-44. 402. Zampieri, S., et al., Oxidative stress in NPC1 deficient cells: protective effect of allopregnanolone. J Cell Mol Med, 2009. 13(9B): p. 3786-96. 403. German, D.C., et al., Selective neurodegeneration, without neurofibrillary tangles, in a mouse model of Niemann-Pick C disease. J Comp Neurol, 2001. 433(3): p. 415-25. 404. Yanjanin, N.M., et al., Linear clinical progression, independent of age of onset, in Niemann-Pick disease, type C. Am J Med Genet B Neuropsychiatr Genet, 2010. 153B(1): p. 132-40. 405. Eskelson, C.D., H.P. Jacobi, and D.M. Fitch, Some effects of vitamin E deficiency on in vitro cholesterol metabolism. Physiol Chem Phys, 1973. 5(4): p. 319-29. 406. Chen, L.H., S. Liao, and L.V. Packett, Interaction of dietary vitamin E and protein level of lipid source with serum cholesterol level in rats. J Nutr, 1972. 102(6): p. 729-32. 407. Yasuda, M., T. Fujita, and Y. Mizunoya, Liver and plasma lipids in vitamin E-deficient rats. Chem Pharm Bull (Tokyo), 1979. 27(2): p. 447-51. 408. Gohil, K., et al., Mice lacking alpha-tocopherol transfer protein gene have severe alpha- tocopherol deficiency in multiple regions of the central nervous system. Brain Res, 2008. 1201: p. 167-76. 409. Distl, R., V. Meske, and T.G. Ohm, Tangle-bearing neurons contain more free cholesterol than adjacent tangle-free neurons. Acta Neuropathol, 2001. 101(6): p. 547-54. 410. Jick, H., et al., Statins and the risk of dementia. Lancet, 2000. 356(9242): p. 1627-31. 411. Kivipelto, M., et al., Midlife vascular risk factors and Alzheimer's disease in later life: longitudinal, population based study. BMJ, 2001. 322(7300): p. 1447-51. 412. Wolozin, B., Cholesterol, statins and dementia. Curr Opin Lipidol, 2004. 15(6): p. 667-72. 413. Wolozin, B., et al., The cellular biochemistry of cholesterol and statins: insights into the pathophysiology and therapy of Alzheimer's disease. CNS Drug Rev, 2004. 10(2): p. 127- 46. 414. Wolozin, B., Cholesterol and the biology of Alzheimer's disease. Neuron, 2004. 41(1): p. 7-10. 415. Singh, C., I. Ahmad, and A. Kumar, Pesticides and metals induced Parkinson's disease: involvement of free radicals and oxidative stress. Cell Mol Biol (Noisy-le-grand), 2007. 53(5): p. 19-28. 416. Perrone, S., et al., Early oxidative stress in amniotic fluid of pregnancies with Down syndrome. Clin Biochem, 2007. 40(3-4): p. 177-80. 417. Pratico, D., Vitamin E: murine studies versus clinical trials. Ital Heart J, 2001. 2(12): p. 878-81. 418. Berman, K. and H. Brodaty, Tocopherol (vitamin E) in Alzheimer's disease and other neurodegenerative disorders. CNS Drugs, 2004. 18(12): p. 807-25. 419. Koscik, R.L., et al., Quality of life of children with cystic fibrosis. J Pediatr, 2005. 147(3 Suppl): p. S64-8. 420. Rosenblum, J.L., et al., A progressive neurologic syndrome in children with chronic liver disease. N Engl J Med, 1981. 304(9): p. 503-8.

181

421. Lim, Y. and M.G. Traber, Alpha-Tocopherol Transfer Protein (alpha-TTP): Insights from Alpha-Tocopherol Transfer Protein Knockout Mice. Nutr Res Pract, 2007. 1(4): p. 247-53. 422. Cuddihy, S.L., et al., Prolonged alpha-tocopherol deficiency decreases oxidative stress and unmasks alpha-tocopherol-dependent regulation of mitochondrial function in the brain. J Biol Chem, 2008. 283(11): p. 6915-24. 423. van der Loo, B., et al., Cardiovascular aging is associated with vitamin E increase. Circulation, 2002. 105(14): p. 1635-8. 424. Hollander, D. and V. Dadufalza, Lymphatic and portal absorption of vitamin E in aging rats. Dig Dis Sci, 1989. 34(5): p. 768-72. 425. Morgulis, S. and H.P. Jacobi, A perspective of biochemical defects in muscle in vitamin E deficiency. Q Bull Northwest Univ Med Sch, 1946. 20: p. 92-8. 426. Gaskin, K., et al., Improved respiratory prognosis in patients with cystic fibrosis with normal fat absorption. J Pediatr, 1982. 100(6): p. 857-62. 427. Bye, A.M., et al., Symptomatic vitamin E deficiency in cystic fibrosis. Arch Dis Child, 1985. 60(2): p. 162-4. 428. Winklhofer-Roob, B.M., M.A. van't Hof, and D.H. Shmerling, Long-term oral vitamin E supplementation in cystic fibrosis patients: RRR-alpha-tocopherol compared with all-rac- alpha-tocopheryl acetate preparations. Am J Clin Nutr, 1996. 63(5): p. 722-8. 429. Stead, R.J., et al., Effect of abnormal liver function on vitamin E status and supplementation in adults with cystic fibrosis. Gut, 1986. 27(6): p. 714-8. 430. Cannella, P.C., et al., Feeding practices and nutrition recommendations for infants with cystic fibrosis. J Am Diet Assoc, 1993. 93(3): p. 297-300. 431. Lai, H.C., et al., Comparison of growth status of patients with cystic fibrosis between the United States and Canada. Am J Clin Nutr, 1999. 69(3): p. 531-8. 432. White, N.M., D.A. Corey, and T.J. Kelley, Mechanistic similarities between cultured cell models of cystic fibrosis and niemann-pick type C. Am J Respir Cell Mol Biol, 2004. 31(5): p. 538-43. 433. Montine, K.S., et al., Distribution of reducible 4-hydroxynonenal adduct immunoreactivity in Alzheimer disease is associated with APOE genotype. J Neuropathol Exp Neurol, 1998. 57(5): p. 415-25. 434. Markesbery, W.R., The role of oxidative stress in Alzheimer disease. Arch Neurol, 1999. 56(12): p. 1449-52. 435. Nishida, Y., et al., Deletion of vitamin E enhances phenotype of Alzheimer disease model mouse. Biochem Biophys Res Commun, 2006. 350(3): p. 530-6. 436. Engelhart, M.J., et al., Dietary intake of antioxidants and risk of Alzheimer disease. JAMA, 2002. 287(24): p. 3223-9. 437. Morris, M.C., et al., Vitamin E and vitamin C supplement use and risk of incident Alzheimer disease. Alzheimer Dis Assoc Disord, 1998. 12(3): p. 121-6. 438. Morris, M.C., et al., Relation of the tocopherol forms to incident Alzheimer disease and to cognitive change. Am J Clin Nutr, 2005. 81(2): p. 508-14. 439. Morris, M.C., et al., Dietary intake of antioxidant nutrients and the risk of incident Alzheimer disease in a biracial community study. JAMA, 2002. 287(24): p. 3230-7. 440. Perkins, A.J., et al., Association of antioxidants with memory in a multiethnic elderly sample using the Third National Health and Nutrition Examination Survey. Am J Epidemiol, 1999. 150(1): p. 37-44. 441. Morris, M.C., et al., Vitamin E and cognitive decline in older persons. Arch Neurol, 2002. 59(7): p. 1125-32.

182

442. Grodstein, F., J. Chen, and W.C. Willett, High-dose antioxidant supplements and cognitive function in community-dwelling elderly women. Am J Clin Nutr, 2003. 77(4): p. 975-84. 443. Sano, M., et al., A controlled trial of selegiline, alpha-tocopherol, or both as treatment for Alzheimer's disease. The Alzheimer's Disease Cooperative Study. N Engl J Med, 1997. 336(17): p. 1216-22. 444. Traber, M.G. and H.J. Kayden, Tocopherol distribution and intracellular localization in human adipose tissue. Am J Clin Nutr, 1987. 46(3): p. 488-95. 445. Robinet, P., et al., A simple and sensitive enzymatic method for cholesterol quantification in macrophages and foam cells. J Lipid Res, 2010. 51(11): p. 3364-9. 446. Yevenes, L.F., et al., Lysosomal vitamin E accumulation in Niemann-Pick type C disease. Biochim Biophys Acta, 2012. 1822(2): p. 150-60. 447. Martinello, F., et al., Supplemental therapy in isolated vitamin E deficiency improves the peripheral neuropathy and prevents the progression of ataxia. J Neurol Sci, 1998. 156(2): p. 177-9. 448. Shichiri, M., et al., ATP-binding cassette transporter A1 is involved in hepatic alpha- tocopherol secretion. J Nutr Biochem, 2010. 21(5): p. 451-6. 449. Aris, R.M., et al., Guide to bone health and disease in cystic fibrosis. J Clin Endocrinol Metab, 2005. 90(3): p. 1888-96. 450. Cox, J.D., et al., Evaluating quality in clinical cancer research: the M.D. Anderson Cancer Center experience. Oncology, 2009. 77(2): p. 75-81. 451. Bostwick, D.G., et al., Human prostate cancer risk factors. Cancer, 2004. 101(10 Suppl): p. 2371-490. 452. Higashi, Y., et al., Cerebellar degeneration in the Niemann-Pick type C mouse. Acta Neuropathol, 1993. 85(2): p. 175-84. 453. Li, H., et al., Molecular, anatomical, and biochemical events associated with neurodegeneration in mice with Niemann-Pick type C disease. J Neuropathol Exp Neurol, 2005. 64(4): p. 323-33. 454. Behrens, W.A., J.N. Thompson, and R. Madere, Distribution of alpha-tocopherol in human plasma lipoproteins. Am J Clin Nutr, 1982. 35(4): p. 691-6. 455. Carcelain, G., et al., Simple method for quantifying alpha-tocopherol in low-density+very- low-density lipoproteins and in high-density lipoproteins. Clin Chem, 1992. 38(9): p. 1792-5. 456. Lang, J.K., K. Gohil, and L. Packer, Simultaneous determination of tocopherols, ubiquinols, and ubiquinones in blood, plasma, tissue homogenates, and subcellular fractions. Anal Biochem, 1986. 157(1): p. 106-16. 457. Pratico, D., F(2)-isoprostanes: sensitive and specific non-invasive indices of lipid peroxidation in vivo. Atherosclerosis, 1999. 147(1): p. 1-10. 458. Millat, G., et al., Niemann-Pick C1 disease: correlations between NPC1 mutations, levels of NPC1 protein, and phenotypes emphasize the functional significance of the putative sterol-sensing domain and of the cysteine-rich luminal loop. Am J Hum Genet, 2001. 68(6): p. 1373-85. 459. Goldman, S.D. and J.P. Krise, Niemann-Pick C1 functions independently of Niemann-Pick C2 in the initial stage of retrograde transport of membrane-impermeable lysosomal cargo. J Biol Chem, 2010. 285(7): p. 4983-94. 460. Thrift, R.N., et al., Characterization of lipoproteins produced by the human liver cell line, Hep G2, under defined conditions. J Lipid Res, 1986. 27(3): p. 236-50.

183

461. Weidman, S.W., J.B. Ragland, and S.M. Sabesin, Plasma lipoprotein composition in alcoholic hepatitis: accumulation of apolipoprotein E-rich high density lipoprotein and preferential reappearance of "light'-HDL during partial recovery. J Lipid Res, 1982. 23(4): p. 556-69.

184