(12) Patent Application Publication (10) Pub. No.: US 2016/0244766A1 Bettencourt Et Al

US 20160244766A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0244766A1 Bettencourt et al. (43) Pub. Date: Aug. 25, 2016

(54) COMPOSITIONS AND METHODS FOR Related U.S. Application Data INHIBITING EXPRESSION OF THE ALAS1 (60) Provisional application No. 61/983,720, filed on Apr. GENE 24, 2014, provisional application No. 61/887,288, (71) Applicants: ALNYLAM PHARMACEUTICALS, filed on Oct. 4, 2013. INC., Cambridge, MA (US); ICAHN SCHOOL OF MEDCINEAT MOUNTSINAI, New York, NY (US) Publication Classification (72) Inventors: Brian Bettencourt, Groton, MA (US); (51) Int. Cl. Kevin Fitzgerald, Brookline, MA (US); CI2N IS/II3 (2006.01) William Querbes, Cambridge, MA CI2O I/68 (2006.01) (US); Robert J. Desnick, New York, NY A619/00 (2006.01) (US); Makiko Yasuda, New York, NY (52) U.S. Cl. (US) CPC ...... CI2N 15/I 137 (2013.01); A61 K9/0019 (2013.01); C12O 1/6876 (2013.01); C12N (73) Assignees: ALNYLAM PHARMACEUTICALS, 23 10/14 (2013.01); C12N 23.10/321 (2013.01); INC., Cambridge, MA (US); ICAHN CI2N 23.10/315 (2013.01); C12N 23.10/351 SCHOOL OF MEDCINEAT (2013.01) MOUNTSINAI, New York, NY (US) (21) Appl. No.: 15/027,176 (57) ABSTRACT (22) PCT Filed: Oct. 3, 2014 The invention relates to double-stranded ribonucleic acid (86). PCT No.: PCT/US2O14/05916O (dsRNA) compositions targeting the ALAS1 gene, and meth S371 (c)(1), ods of using Such dsRNA compositions to alter (e.g., inhibit) (2) Date: Apr. 4, 2016 expression of ALAS1. Patent Application Publication Aug. 25, 2016 Sheet 1 of 61 US 2016/024476.6 A1

Mitochondria Cytoplasm GOO CH goo SUCCINYLCOA C(H2 COO ALA COO CH COAS YS O ALA-SYNTHASE CH DEHYDRATASE CH S.CH 2 H B CoASH do, H2 HOy NH-CH-NH H-C-NH C=O H COO - H-(-NH PORPHOBILINOGEN GLYCINE SYNTHASEHMB p-4 NH Wi (PBG Deaminase) i CH AMINOLEVULINIC Pr CH Vi ACID AC-( N N-4 Pr FEEDBACK REPRESSION HO CH CH Pr Pr Pr HEME HYDROXYMETHYBILANE 2H URO- HO Fe FERROCHELATASE | SYNTHASE 2 Vi CH Pr AC CH Vi AC Pr

CH CH AC AC Pr Pr Pr Pr PROTOPORPHYRINIX UROPORPHYRINOGEN III

URO 4 H 6H - PROTO-OXIDASE DECARBOXYLASE 4CO, Vi CH Pr (H, CH Vi CH Pr COPRO-OXIDASE -e y y CH CH 2CO, 2H CH CH Pr Pr Pr Pr PROTOPORPHYRINOGENIX COPROPORPHYRINOGEN III Fig. 1 Patent Application Publication Aug. 25, 2016 Sheet 2 of 61 US 2016/024476.6 A1

FIG. 2A Enzyme, Reaction Catalyzed Associated Type of Typical Typical Chromosomal Porphyria Porphyria Inheritanc Symptoms location e Pattern 6- Glycine + SuccinylCoA aminolevulinate (ALA) synthase 1 s 6-aminolevulinic acid 3p21 (ALA)

6- Glycine + SuccinylCoA X-linked Erythropoietic X-linked aminolevulinate sideroblastic (ALA) synthase 2 x- anemia (XLSA), (ALAS2) 6-aminolevulinic acid X-linked (ALA) protoporphyria (erythroid (XLP) specific)

Xp11.21

6- 6-aminolevulinic acid ALA dehydratase Hepatic Autosomal Abdominal aminolevulinate (ALA) deficiency recessive pain, dehydratase porphyria (ADP or neuropathy (ALAD) x- DOSS porphyria) Porphobilinogen (PBG) 9q34

PBG deaminase Porphobilinogen (PBG) || Acute intermittent Hepatic Autosomal Periodic (PBGD) porphyria (AIP) dominant abdominal O x- pain, Hydroxymethylbi Hydroxymethylbilane peripheral lane Synthase (HMB) neuropathy, (HMBS) psychiatric disorders, tachycardia 11d23 Patent Application Publication Aug. 25, 2016 Sheet 3 of 61 US 2016/024476.6 A1

FIG.2B Uroporphyrino | Hydroxymethylbilane Congenital Erythropoietic AutoSomal Severe gen III Synthase erythropoietic recessive photosensit ( ) N- porphyria (CEP) ivity with UROS Uroporphyrinogen III erythema, Swelling 10q26 (URO) and blistering. Hemolytic anemia, Splenomega ly Uroporphyrino Uroporphyrinogen III Porphyria cutanea Hepatic Autosomal Photosensit gen (URO) tarda (PCT) dominant ivity with decarboxylase or sporadic vesicles and (UROD) N- bullae Coprophyrinogen III 1q34 Coproporphyrin Coprophyrinogen II Hereditary Hepatic Autosomal Photosensit ogen III oxidase (COPRO) Coproporphyria dominant ivity, (CPOX)3q12 (HCP) neurologic N- Symptoms, Protoporphyrinogen IX Colic

Protoporphyrin Protoporphyrinogen IX Variegate Mixed Autosomal Photosensit ogen oxidase (PROTO) prophyria (VP) dominant ivity, (PPOX) neurologic N- Symptoms, 1d.14 Protoporphyrin IX developme ntal delay Ferrochelatase Protoporphyrin IX Erythropoietic Erythropoietic Autosomal Photosensit protoporphyria recessive ivity with 18q21.3 N- (EPP) skin lesions. Henne Gallstones, mild liver dysfunction

Patent Application Publication Aug. 25, 2016 Sheet 5 of 61 US 2016/024476.6 A1

FIG. 3B

2281 Ctta acccca ggcc attatc at atccagat ggit Cttcaga gttgtctitta tatgttgaatt 2341 aagttatatt aaattittaat Citat agtaala aa Catagt CC toggaaataaa tt CttgCtta 24 Ol 3a tCC, tC (S EO ID NO : 1)

Patent Application Publication Aug. 25, 2016 Sheet 7 of 61 US 2016/024476.6 A1

FIG. 4B 2281 Caagttggta t. Ctgct Cagg CCtgag catg acct Caatta titt Cacttaa CCCC aggc.ca 2341 titat catatc. Cagatggtct tcagagttgt Ctttatatgt gaattaagtt at attaaatt 2401 ttaatctata gtaaaaacat agt cct ggaa at aaattctt gcttaaatgg to aaaaaa (SEO ID NO : 382) Patent Application Publication Aug. 25, 2016 Sheet 8 of 61 US 2016/024476.6 A1

FIG. 5 Patent Application Publication Aug. 25, 2016 Sheet 9 of 61 US 2016/024476.6 A1

*; *--*-- *-- *-- *-- *-- *-- ||2

Patent Application Publication Aug. 25, 2016 Sheet 10 of 61 US 2016/024476.6 A1

FIG 7

a PBS

R w:on ALASl

CA Y

St. e

se ^emow e s E Patent Application Publication Aug. 25, 2016 Sheet 11 of 61 US 2016/024476.6 A1

O i------N.N. Y c : is Seine At ASE siRNA FCS RNA P&n of 3:3 treat &d Patent Application Publication Aug. 25, 2016 Sheet 12 of 61 US 2016/024476.6 A1

FIG. 9

& 2 E - 8. 6 4. O ||;;}£ z-?zºwi?? ?%8-9 -|-+--

~~~~?;;--~~~~~~~~~~~~~ -??+-- ?!!!-08-?zºw??? ************************************************************************************************************************************ ?OTÁG-G?-I?-º?º?-£ 4GT-gº-?zº??? Patent Application Publication Aug. 25, 2016 Sheet 13 of 61 US 2016/024476.6 A1 ****************************************************************************************************************** FIG. 10 Patent Application Publication Aug. 25, 2016 Sheet 14 of 61 US 2016/024476.6 A1

FIG. 11

||;··································---- Phenobati) retail Patent Application Publication Aug. 25, 2016 Sheet 15 of 61 US 2016/024476.6 A1

e e S r

s: 3s e s

o .N.N. ...N.N. Baseline Baseline PBS ALAS1 siRNA ALAS1 siRNA Patent Application Publication US 2016/024476.6 A1

|—^)#|----- ·|-?=??;-š;{|—————- ?|----- « ||—~~~~~|| Patent Application Publication Aug. 25, 2016 Sheet 17 of 61 US 2016/024476.6 A1

s & e - E. & : * . . J. &xw wŠw AAS l 4 ... S.

xSas R & At AS

------RSSS

i- Sax Patent Application Publication Aug. 25, 2016 Sheet 18 of 61 US 2016/024476.6 A1

FG, 15

AA 28 BG

Baseline Saline ALAS-GaNac : 20mpk

w/ Phenobarbitol Patent Application Publication Aug. 25, 2016 Sheet 19 of 61 US 2016/024476.6 A1

FG 16

... 3 s

E. S.

R s 6 s ba . See Patent Application Publication Aug. 25, 2016 Sheet 20 of 61 US 2016/024476.6 A1

FIG. 17

ALAS siRNA PB Plasa-ALAPEG PE Plasma-ALAPBG PE Plasma-ALAPEG " " | " "I I I I I I I I I I I I I 1 - 3 4 5 1516 17 18 9 3CD31 D32 WWeek Week 2 Week 4

e s

... O

a. k s S.

0 Easeline "c Wee Week 2 Patent Application Publication Aug. 25, 2016 Sheet 21 of 61 US 2016/024476.6 A1

FIG. 18 PB+ DDC P x 3 Heme or siRNA

D1 D2 D3 t t Fiasrna-AA/FB3, D4 C-SS:

was wlan ALA Lic & marl ALA S1 , siRNA or hemin &mdan ALA ham

50.00 X

a. O - C s 30.00 R x8. t A 20.00 1000 Š O.C. --~~~~~~~~ Gr 1r 13 ar Hrs after last PB/DDC dose

O. - ww.capiti I.I. siRNA or hemin s\Sa mgar pig alas1 S *x innear pbg home 50.00 Š 540.00 s ? s s & &^ 30.00 s^ys. & ^\S sa Šasy \a *.------,T s & YS ^ &* .x* 20.00 - N ' s N N Ša 10.00 Ya,YS 0.00 i-s-s-s- r 1 hr 13 24r Hrs after last PB/DDC dose Patent Application Publication Aug. 25, 2016 Sheet 22 of 61 US 2016/024476.6 A1

FIG. 19

30 10 AD-53632 Patent Application Publication Aug. 25, 2016 Sheet 23 of 61 US 2016/024476.6 A1

FIG. 20

ALAS1-GalNAc sERPI.V s 4 Daily IP PB s injections X->Measure. SŠ 1. Urinary ALA/PBG 2. ALAS-1 and PBGD - H mRNA D1 D4 D5 D6 D7 D8 24h Urine Patent Application Publication Aug. 25, 2016 Sheet 24 of 61 US 2016/024476.6 A1

FG. 21

1.2

1.0

O.8

O.6

0.4

0.2

O.O PBGD SiRNA - -- -- + ALAS-1-GalNAC - 30mg/kg 10mg/kg PhenObarb + -- -- +

O.O Š PBGD SiRNA ------ALAS-1-GalNAC 30mg/kg 10mg/kg PhenObarb ------Patent Application Publication Aug. 25, 2016 Sheet 25 of 61 US 2016/024476.6 A1

FG. 22

300 15 . CDS an as ?al SD 200 DOg S ES S 9R S 5. 1 OO

O PBGD SiRNA ------ALAS1-GalNAc - 30mg/kg 10mg/kg Phenobarb + ------

PBGD SiRNA ------30mg/kg 10mg/kg PhenObarb + ------Patent Application Publication Aug. 25, 2016 Sheet 26 of 61 US 2016/024476.6 A1

FIG. 23 |—) |--){|—~~'; |—~~';

Patent Application Publication Aug. 25, 2016 Sheet 29 of 61 US 2016/024476.6 A1

FIG. 26

1. ae1. } A.11s AO-53) D-63091 AC-802 A-512S E-63(893 i).309 $895 19/21 19/21 N. f 31 23 NE | 19.19 1 2 3 in?t hf.cymir. Orhang. hydrid, Sye haig hymir. heydmit ve rhing y Patent Application Publication Aug. 25, 2016 Sheet 30 of 61 US 2016/024476.6 A1

WNUU LSW eNhee

Patent Application Publication Aug. 25, 2016 Sheet 32 of 61 US 2016/024476.6 A1

FIG. 29

Study Day: 1 2 3 4 5 7 9 11 13 15, 17 19 21 23 25 27 29 S. & ariaRSX.

Patent Application Publication Aug. 25, 2016 Sheet 33 of 61 US 2016/024476.6 A1

FIG. 30

AD-58632 (mg/kg) AD-60489 (mg/kg) Patent Application Publication US 2016/024476.6 A1

+ºgf------…»<=>–- /[T~-–ZF------?|||(ZO———,,;H-–-,|______j)

*------+------=;! eb.*….--...* ------|-----|------|-^3·?-r|------e<,~|- \©.*

09 OZ

Patent Application Publication Aug. 25, 2016 Sheet 36 of 61 US 2016/024476.6 A1

FIG. 33

|±±• mae|—(ae,§.

84 AD-88 |---- Ai-S la 58532 AD AD-80887 AD-632. ------~~~~ AD 24, A-E445 AD-69----| 28 Patent Application Publication Aug. 25, 2016 Sheet 37 of 61 US 2016/024476.6 A1

FIG. 34

?u?º -----?, ?ºo. |||||||)\, |------» Patent Application Publication Aug. 25, 2016 Sheet 38 of 61 US 2016/024476.6 A1

FIG. 35

ALAS-GalNAC 3mg/kg (TIW)

S Phenobarb E«? D19 (sac)

PEGD LNP

PBS PBS AD-60925, AD-60926, 3mpk TIW 3mpk TIW SiRNA PB AF11-PBGD Patent Application Publication Aug. 25, 2016 Sheet 39 of 61 US 2016/024476.6 A1

FIG. 36

eocoºstounsiºnN-

–!

SiRNA PBS PBS AD-60925 AD-60926 PB AF11-PBGD

SiRNA AD-60925 AD-60926 PB - - AF11-PBGD Patent Application Publication Aug. 25, 2016 Sheet 40 of 61 US 2016/024476.6 A1

600 for - . . . . . PBS xxxxxx.RBSRB SO asses AD-60925 TIW63mpk +PB are AD-60926 TIW63mpk:PBGD KD; +PE

3. O

1.O.

3. ------

------PBS xxy PBSPB asar AD-80325 TWG3mpk +PE -&-AD-60326 TIW63mpkiPBGDKD+PB

15 O

1 O

Patent Application Publication 2

#—(aeº AD-58633&C-S11 AD-51142. A NE+){ Patent Application Publication Aug. 25, 2016 Sheet 43 of 61 US 2016/024476.6 A1

FIG. 40 |praepaeae; –aeº

3. 3 3. 3 3 3 3. AD-50489. AD-605O1 AD-60519. AD-6091. AD-6O495. AD.60900. AD-6Q935. AD-6Q905,

atent Application Publication Aug. 25, 2016 Sheet 44 of 61 US 2016/024476.6 A1

Patent Application Publication Aug. 25, 2016 Sheet 45 of 61 US 2016/024476.6 A1

FIG. 42

CFarent CNN

2. 2. 3.5 3. 3. 2. 2.5 3. 5 Y - 2. ...&St.8 sy...... '.. AD 119 AD,..38A...L 8 A.L. E. 533533S A.E.538A..{38&.38.(S.yE.86 3.S. Patent Application Publication Aug. 25, 2016 Sheet 46 of 61 US 2016/024476.6 A1

FIG. 43

·: -| –aeg

. 3.5 EW SEW 2.5B R. 5E (x2) (x2) 2) ) (x2) FES AD-58632 AD-80892. AD-3419 AD-80.445 AD-60925, AD-3489 AD-8519 A Patent Application Publication Aug. 25, 2016 Sheet 47 of 61 US 2016/024476.6 A1

S DO D7 D14 D18-19 urine

ALAS-GalNAc (BIW) s s s Š S { ) $ 2.5 or 5 mg.kg Ris s $ Ns Phenobarb (PB)

i. 1.

s - S. 5. al

O Š p-R A-51 Patent Application Publication Aug. 25, 2016 Sheet 48 of 61 US 2016/024476.6 A1

O liuoyu, assassis...... awara.says arrassassists 2.5 mg/kg 5mg/kg 2.5 mg/kg, 5mg/kg Baseline Saline AD-60519 BW AD-6O489 BW PB Treatment

AWWWVAsun sums. Nsuns 2.5 mg/kg 5mg/kg 2.5 mg/kg, 5mg/kg Baseline Saline AD-60519 BW AD-6O489 BW

PB Treatment Patent Application Publication Aug. 25, 2016 Sheet 49 of 61 US 2016/024476.6 A1

S D f D1 4 D1 (D25 urine) RSS ALAS-GardAc (BFW 2.5 or 5 mgikg

Penobar BG:

4.5 4.0 3.5 3.O 2.5 2.0 1.5

O.O: PBS AD-60519 AD-60519 AD-60519 (3mpk) (1mpk) (O.3mpk)

SiRNA ------PB PBGD ------Patent Application Publication Aug. 25, 2016 Sheet 50 of 61 US 2016/024476.6 A1

------

s O

3. C

k k k k PB k s

BS PBS Al-SSSA-851 IAD-6051 9. (3mpk) (1mpk) (O.3mpk)

Serrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr's arrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrk Patent Application Publication Aug. 25, 2016 Sheet 51 of 61 US 2016/024476.6 A1

FG. 48

{y-ZXINAMI™E“gxolo)?-9sdnouºpue2-1sdmoue) Patent Application Publication Aug. 25, 2016 Sheet 52 of 61 US 2016/024476.6 A1

FIG. 49

100

8O www.was www.sway was wayw.

2O c -

(Previous 2.5 1.25 2.5 2.5 2.5 Study) X 2.5 5 PBS AD-58632 AD-60519 AD-61193 AD-60819

Patent Application Publication Aug. 25, 2016 Sheet 54 of 61 US 2016/024476.6 A1

FIG. 51

s O L?

o:C. : s: CP s: <1. -a: 2. : h: r r on A : C:

Y: O: y : + CO P :

------C st C. H Co a s r. o y t C O O C (eSop-eduoloe) LSWW pezieu-ON

Patent Application Publication Aug. 25, 2016 Sheet 56 of 61 US 2016/024476.6 A1

FIG. 53 ; s

: s

------

Xu 9%) ei.esse LSWenlee Patent Application Publication Aug. 25, 2016 Sheet 57 of 61 US 2016/024476.6 A1

-0-2.5mg/kg AD-60519 OWX8 -----.5mg/kg AD-60519 OWx8 -O-5mg/kg AD-60519 ODX3, 5mpk OWX7 --K)--.5mg/kg AD-60519 ODX3, 2.5mpk OWX7 -o-5mg/kg AD-60519 BIWx8

-O-1 mg/kg AD-60519 --O-- 10mg/kg AD-60519 14------

1.2------v - C S 1 (R-Isr-f- S \, 0.8- N - N1 - 5 M -1 5 0.6--- S-r 1 2S is 0.4------\, i? 9 ir

Patent Application Publication Aug. 25, 2016 Sheet 58 of 61 US 2016/024476.6 A1

FIG. 55

Patent Application Publication Aug. 25, 2016 Sheet 59 of 61 US 2016/024476.6 A1

1 .2-

1 O

O.8-

O.6- -o-2.5 mg/kg OWx8 0.4- ----5 mg/kg OWx8 -a-5 mg/kgQDX3, 5 mg/kg QWX7 -v-5 mg/kg ODX3, 2.5 mg/kg QWX7 0.2- -0-5 mg/kg BIWx8 O.O- y Y O 1 O 20 30 40 50 60 7O 8O 90 1 OO Days Fig. 56 Patent Application Publication Aug. 25, 2016 Sheet 60 of 61 US 2016/024476.6 A1

_OLO

„eNIZ Patent Application Publication Aug. 25, 2016 Sheet 61 of 61 US 2016/024476.6 A1

F.G. 58

8 O. O. Serum Š Urine

(AHN6AV%)yN×u?.Svºjv

!,AHNA

Norm a AEP Patients Healthy Wounteers US 2016/0244766 A1 Aug. 25, 2016

COMPOSITIONS AND METHODS FOR monal changes during their menstrual cycles. While patients INHIBITING EXPRESSION OF THE ALAS1 generally respond well, its effect is slow, typically taking two GENE to four days or longer to normalize urinary ALA and PBG concentrations towards normal levels. As the intravenous RELATED APPLICATIONS hemin is rapidly metabolized, three to four infusions are 0001. This application claims priority to U.S. provisional usually necessary to effectively treat or prevent an acute application No. 61/887.288 filed on Oct. 4, 2013 and to U.S. attack. In addition, repeated infusions may cause iron over provisional application No. 61/983,720 filed on Apr. 24. load and phlebitis, which may compromise peripheral venous 2014. The entire content of each of the foregoing applications access. Although orthotrophic liver transplantation is cura is hereby incorporated herein by reference. tive, this procedure has significant morbidity and mortality and the availability of liver donors is limited. Therefore, an SEQUENCE LISTING alternative therapeutic approach that is more effective, fast acting, and safe is needed. It would be particularly advanta 0002 The instant application contains a Sequence Listing geous if such treatment could be delivered by subcutaneous which has been submitted electronically in ASCII format and administration, as this would preclude the need for infusions is hereby incorporated by reference in its entirety. Said ASCII and prolonged hospitalization. copy, created on Oct. 2, 2014, is named A2038-7202WO SL. 0007 AIP, also referred to as porphobilinogen deaminase txt and is 1,107,486 bytes in size. (PBGD) deficiency, or hydroxymethylbilane synthase FIELD OF THE INVENTION (HMBS) deficiency, is the most common of the acute hepatic prophyrias. The prevalence of AIP is estimated to be 5-10 in 0003. The invention relates to the specific inhibition of the 100,000, with about 5-10% of patients being symptomatic. expression of the ALAS1 gene. AIP is an autosomal dominant disorder caused by mutations in the HMBS gene that result in reduced, e.g., half-normal BACKGROUND OF THE INVENTION activity of the enzyme. Previously, amouse model of AIP that 0004. The inherited porphyrias are a family of disorders has ~30% of wildtype HMBS activity was generated by resulting from the deficient activity of specific enzymes in the homologous recombination. Like human patients, these mice heme biosynthetic pathway, also referred to herein as the increase hepatic ALAS1 activity and accumulate large quan porphyrin pathway. Deficiency in the enzymes of the porphy tities of plasma and urinary ALA and PBG when adminis rin pathway leads to insufficient heme production and to an tered porphyrinogenic drugs, such as phenobarbital. Thus, accumulation of porphyrin precursors and porphyrins, which they serve as an excellent model to evaluate the efficacy of are toxic to tissue in high concentrations. novel therapeutics for the acute hepatic porphyrias. 0005 Of the inherited porphyrias, acute intermittent por phyria (AIP, e.g., autosomal dominant AIP), variegate por SUMMARY OF THE INVENTION phyria (VP, e.g., autosomal dominant VP), hereditary copro porphyria (copropophyria or HCP, e.g., autosomal dominant 0008. The present invention describes methods and iRNA HCP), and 5' aminolevulinic acid (also known as 8-aminole compositions for modulating the expression of an ALAS1 Vulinic acid or ALA) dehydratase deficiency porphyria (ADP, gene. In certain embodiments, expression of an ALAS1 gene e.g., autosomal recessive ADP) are classified as acute hepatic is reduced or inhibited using an ALAS 1-specific iRNA. Such porphyrias and are manifested by acute neurological attacks inhibition can be useful in treating disorders related to that can be life threatening. The acute attacks are character ALAS1 expression, Such as porphyrias. ized by autonomic, peripheral, and central nervous symp toms, including severe abdominal pain, hypertension, tachy 0009. Accordingly, described herein are compositions and cardias, constipation, motor weakness, paralysis, and methods that effect the RNA-induced silencing complex seizures. If not treated properly, quadriplegia, respiratory (RISC)-mediated cleavage of RNA transcripts of the ALAS1 impairment, and death may ensue. Various factors, including gene. Such as in a cell or in a subject (e.g., in a mammal. Such cytrochrome P450-inducing drugs, dieting, and hormonoal as a human Subject). Also described are compositions and changes can precipitate acute attacks by increasing the activ methods for treating a disorder related to expression of an ity of hepatic 5'-aminolevulinic acid synthase 1 (ALAS1), the ALAS1 gene, Such as a porphyria, e.g., X-linked sideroblastic first and rate-limiting enzyme of the heme biosynthetic path anemia (XLSA), ALA deyhdratase deficiency porphyria way. In the acute porphyrias, e.g., AIP VP, HCP and ADP, the (Doss porphyria or ADP), acute intermittent porphyria (AIP), respective enzyme deficiencies result in hepatic production congenital erythropoietic porphyria (CEP), prophyria cuta and accumulation of one or more Substances (e.g., porphyrins nea tarda (PCT), hereditary coproporphyria (coproporphyria, and/or porphyrin precursors, e.g., ALA and/or PBG) that can or HCP), variegate porphyria (VP), erythropoietic protopor be neurotoxic and can result in the occurrence of acute phyria (EPP), or transient erythroporphyria of infancy. In attacks. See, e.g., Balwani, M and Desnick, R. J., Blood, Some embodiments, the disorder is an acute hepatic porphy 120:4496-4504, 2012. ria, e.g., ALA deyhdratase deficiency porphyria (ADP), AIP. 0006. The current therapy for the acute neurologic attacks HCP or VP. In certain embodiments, the disorder is ALA is the intravenous administration of hemin (PanhematinR), deyhdratase deficiency porphyria (ADP) or AIP. Lundbeck or Normosang R, Orphan Europe), which provides 0010. In embodiments, the porphyria is a hepatic porphy exogenous heme for the negative feedback inhibition of ria, e.g., a porphyria selected from acute intermittent porphy ALAS1, and thereby, decreases production of ALA and PBG. ria (AIP) hereditary coproporphyria (HCP), variegate por Hemin is used for the treatment during an acute attack and for phyria (VP), ALA deyhdratase deficiency porphyria (ADP), prevention of attacks, particularly in women with the actue and hepatoerythropoietic porphyria. In embodiments, the porphyrias who experience frequent attacks with the hor porphyria is a homozygous dominant hepatic porphyria (e.g., US 2016/0244766 A1 Aug. 25, 2016

homozygous dominant AIP, HCP or VP) or hepatoerythro cluding one or more (e.g., all) of the modifications of the poietic porphyria. In embodiments, the porphyria is a dual antisense strand and/or antisense strand of AD-60489, porphyria. AD-60519, or AD-61193). 0011. As used herein, the term “iRNA. “RNAi', “iRNA 0016. In one aspect, a double-stranded ribonucleic acid agent,” “RNAi agent,” or “iRNA molecule” refers to an agent (dsRNA) for inhibiting expression of ALAS1 is provided, that contains RNA as that term is defined herein, and which wherein said dsRNA comprises a sense Strand and an anti mediates the targeted cleavage of an RNA transcript, e.g., via sense Strand, the antisense strand comprising a region of an RNA-induced silencing complex (RISC) pathway. In one complementarity to an ALAS1 RNA transcript, which anti embodiment, an iRNA as described herein effects inhibition sense Strand comprises at least 15 (e.g., at least 16, 17, 18, 19. of ALAS1 expression in a cell or mammal. 20, 21, 22, or 23) contiguous nucleotides differing by no more 0012. The iRNAs included in the compositions featured than 3 (e.g., by no more than 0, 1 or 2) nucleotides from an herein encompass a dsRNA having an RNA strand (the anti antisense sequence listed in any one of Tables 21 to 40, or an sense Strand) having a region, e.g., a region that is 30 nucle unmodified version of an antisense sequence (e.g., a version otides or less, generally 19-24 nucleotides in length, that is having the same nucleotide sequence except that Some or all substantially complementary to at least part of an mRNA of the nucleotides are unmodified) listed in any one of Tables transcript of an ALAS1 gene (e.g., a mouse or human ALAS1 21 to 40. In one embodiment, the antisense sequence com gene) (also referred to herein as an ALAS1-specific iRNA). prises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) Alternatively, or in combination, iRNAs encompass a dsRNA contiguous nucleotides differing by no more than 3 (e.g., by having an RNA strand (the antisense Strand) having a region no more than 0, 1 or 2) nucleotides from (i) the antisense that is 30 nucleotides or less, generally 19-24 nucleotides in sequence of AD-60489, AD-60519, or AD-61193 or (ii) an length, that is Substantially complementary to at least part of unmodified version of any one of these sequences. In embodi an mRNA transcript of an ALAS1 gene (e.g., a human variant ments, the antisense Strand comprises at least 15 (e.g., at least 1 or 2 of an ALAS1 gene) (also referred to herein as a 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides “ALAS1-specific iRNA'). differing by no more than 3 (e.g., by no more than 0, 1 or 2) 0013. In embodiments, the iRNA (e.g., dsRNA) described nucleotides from the sequence of UAAGAUGAGACACU herein comprises an antisense Strand having a region that is CUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGA Substantially complementary to a region of a human ALAS1. CACUCTUUCUGGU (SEQ ID NO: 4154). In an embodi In embodiments, the human ALAS1 has the sequence of ment, the antisense sequence targets positions 871-893 of NM 000688.4 (SEQ ID NO: 1) or NM 000688.5 (SEQ ID NM 000688.4 (SEQ ID NO:1). In embodiments, the sense NO:382). In embodiments, the human ALAS1 has the strand comprises the sequence of CAGAAAGAGUGUCU sequence of NM 199166.1. CAUCUUA (SEQ ID NO: 4155). In embodiments, one or 0014. In embodiments, the antisense sequence of the more nucleotides of the antisense strand and/or sense strand iRNA (e.g., dsRNA) targets within the to 895 (plus or minus are modified as described herein. 5, 4, 3, 2, or 1 nucleotides in either or both directions on the 5' 0017. In some embodiments, the dsRNA is not a sense and/or 3' end) on the ALAS1 transcript NM 000688.4. In and/or antisense sequence listed in any one of Tables 2, 3, 6, embodiments, the antisense sequence targets the nucleotides 7, 8, 9, 14, 15, 18 or 20. 871 to 893, 871 to 892, or 873 to 895 on the ALAS1 transcript NM 000688.4. In embodiments, the antisense sequence 0018. In one embodiment, a double-stranded ribonucleic comprises or consists of a sequence that is fully complemen acid (dsRNA) for inhibiting expression of ALAS1 is pro tary or substantially complementary to nucleotides 871 to vided, wherein said dsRNA comprises a sense strand and an 893, 871 to 892, or 873 to 895 on the ALAS1 transcript antisense Strand, the antisense strand comprising a region of NM 000688.4. complementarity to an ALAS1 RNA transcript, which anti 0015. In one aspect, a double-stranded ribonucleic acid sense Strand comprises at least 15 (e.g., at least 16, 17, 18, 19. (dsRNA) for inhibiting expression of ALAS1 is provided, 20, 21, 22, or 23) contiguous nucleotides differing by no more wherein said dsRNA comprises a sense Strand and an anti than 3 nucleotides, no more than 2 nucleotides, or no more sense Strand, the antisense strand comprising a region of than one nucleotide, from the antisense sequence of complementarity to an ALAS1 RNA transcript, which anti AD-60519. In embodiments, one or more nucleotides are sense Strand comprises at least 15 (e.g., at least 16, 17, 18, 19. modified as described herein. 20, 21, 22, or 23) contiguous nucleotides differing by no more 0019. In one embodiment, a double-stranded ribonucleic than 3, 2 or 1 nucleotides from the sequence of UAA acid (dsRNA) for inhibiting expression of ALAS1 is pro GAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or vided, wherein said dsRNA comprises a sense strand and an UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: antisense Strand, the antisense strand comprising a region of 4154). In embodiments, the antisense Strand comprises the complementarity to an ALAS1 RNA transcript, which anti sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ sense Strand comprises at least 15 (e.g., at least 16, 17, 18, 19. ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU 20, 21, 22, or 23) contiguous nucleotides differing by no more (SEQID NO: 4154). In embodiments, the sense strand com than 3 (e.g., by no more than 0, 1 or 2) nucleotides from the prises the sequence of CAGAAAGAGUGUCUCAUCUUA antisense sequence of AD-60489, or a derivative of (SEQ ID NO: 4155). In embodiments, one or more nucle AD-60489 as described herein. In embodiments, one or more otides of the antisense strand and/or sense Strand are modified nucleotides are modified as described herein, e.g., one or as described herein. In embodiments, the dsRNA comprises more (or all) nucleotides of AD-60489 are modified as (i) an antisense strand that comprises, or consists of the described herein. In embodiments, the derivative of antisense sequence of AD-60489, AD-60519, or AD-61 193 AD-60489 is AD-60501, AD-60519, AD-60901, AD-60495, and/or (ii) a sense Strand that comprises, or consists of the AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, sense sequence of AD-60489, AD-60519, or AD-61193 (in AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, US 2016/0244766 A1 Aug. 25, 2016

AD-60519, or AD-60901. In embodiments, the derivative of AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60489 is AD-60519. In embodiments, the derivative of AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60489 is AD-61193. AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, 0020. In one embodiment, a double-stranded ribonucleic AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, acid (dsRNA) for inhibiting expression of ALAS1 is pro AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, vided, wherein said dsRNA comprises a sense strand and an AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, antisense strand, the antisense strand comprising a region of AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, complementarity to an ALAS1 RNA transcript, which anti AD-6 1144, AD-61145, AD-6 1146, AD-60892, or AD-60419. sense Strand comprises at least 15 (e.g., at least 16, 17, 18, 19. 0025. In embodiments, a double-stranded ribonucleic acid 20, 21, 22, or 23) contiguous nucleotides differing by no more (dsRNA) for inhibiting expression of ALAS1 is provided, than 3 (e.g., by no more than 0, 1 or 2) nucleotides from a wherein the dsRNA comprises (i) an antisense strand that derivative of AD-58632 described herein. In embodiments, comprises, or consists of the sequence of UAAGAUGAGA one or more nucleotides are modified as described herein, CACUCUUUCUGGU (SEQ ID NO: 4153) or UAA e.g., one or more (or all) nucleotides of AD-58632 are modi GAUGAGACACUCTUUCUGGU (SEQID NO: 4154) and/ fied as described herein. In embodiments, the derivative of or (ii) a sense Strand that comprises, or consists of the AD-58632 is AD-60405, AD-60887, AD-60923, AD-60434, sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, NO: 4155). In embodiments, one or more nucleotides of the and AD-60926, AD-60820, AD-60843, AD-60819, antisense Strand and/or sense strand are modified as described AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, herein. AD-61143, AD-61.144, AD-61145, AD-61146, AD-60892, or 0026. In embodiments, a double-stranded ribonucleic acid AD-60419. In embodiments, the derivative of AD-58632 is (dsRNA) for inhibiting expression of ALAS1 is provided, AD-60819. wherein the dsRNA comprises (i) an antisense strand that 0021. In some embodiments, the dsRNA has an ICs of comprises, or consists of the antisense sequence of less than 1 nM. In some embodiments, the dsRNA has an ICso AD-60489 and/or (ii) a sense strand that comprises, or con in the range of 0.01-1 nM. In embodiments, the dsRNA has an sists of the sense sequence of AD-60489 (wherein the sense ICs of less than 0.05 nM. In embodiments, the dsRNA has an and/or antisense sequence includes one or more (e.g., all) of ICs of less than 0.02 nM. In embodiments, the dsRNA has an the modifications of the sense Strand and/or antisense strand ICs of less than 0.01 nM. In embodiments, the ICs is deter of AD-60489). mined as described herein in the Examples. 0027. In embodiments, a double-stranded ribonucleic acid 0022. In some embodiments, the dsRNA has a single dose (dsRNA) for inhibiting expression of ALAS1 is provided, ED50 of less than about 10 mg/kg. In some embodiments, the wherein the dsRNA comprises (i) an antisense strand that dsRNA has a single dose ED50 of less than about 5 mg/kg. In comprises, or consists of the antisense sequence of embodiments, the EC50 is determined as described herein in AD-60519 and/or (ii) a sense strand that comprises, or con the Examples. sists of the sense sequence of AD-60519 (wherein the sense 0023. In some embodiments, the dsRNA shows improved and/or antisense sequence includes one or more (e.g., all) of activity compared with AD-58632. In some embodiments, the modifications of the sense Strand and/or antisense strand the dsRNA shows improved activity compared with of AD-60519). AD-60489. In some embodiments, the dsRNA shows 0028. In embodiments, a double-stranded ribonucleic acid improved activity compared with AD-58632 and AD-60489. (dsRNA) for inhibiting expression of ALAS1 is provided, 0024. In embodiments, the dsRNA is AD-60501, wherein the dsRNA comprises (i) an antisense strand that AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, comprises, or consists of the antisense sequence of AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-61193 and/or (ii) a sense strand that comprises, or con AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, sists of the sense sequence of AD-61193 (wherein the sense AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, and/or antisense sequence includes one or more (e.g., all) of AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, the modifications of the sense Strand and/or antisense strand AD-60820, AD-60843, AD-60819, AD-61140, AD-6 1141, of AD-61193). AD-61142, AD-60835, AD-60839, AD-61143, AD-6 1144, 0029. In embodiments, a double-stranded ribonucleic acid AD-61145, AD-61146, AD-60892, or AD-60419 (e.g., (dsRNA) for inhibiting expression of ALAS1 is provided, including the nucleotide sequence and/or one or more (e.g., wherein the dsRNA comprises (i) an antisense strand that all) of the modifications of the aforesaid dsRNAs). In embodi comprises, or consists of the antisense sequence of ments, the dsRNA comprises an antisense Strand that com AD-60819 and/or (ii) a sense sequence that comprises, or prises, or consists of an antisense sequence (and/or one or consists of the sense sequence of AD-60819 (wherein the more (e.g., all) of the modifications)) selected from sense and/or antisense sequence includes one or more (e.g., AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, all) of the modifications of the sense Strand and/or antisense AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, strand of AD-60819). AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, 0030. In embodiments, a dsRNA for inhibiting expression AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, of ALAS1 is provided, wherein the dsRNA comprises (i) an AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, antisense strand that comprises, or consists of the antisense AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, sequence of AD-60489, AD-60519, AD-61193, or AD-60819 AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, (or a corresponding unmodified antisense sequence) and/or AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419. (ii) a sense Strand that comprises, or consists of the sense In embodiments, the dsRNA comprises a sense strand that sequence of AD-60489, AD-60519, AD-61193, or AD-60819 comprises, or consists of a sense sequence (and/or one or (or a corresponding unmodified antisense sequence). In more (e.g., all) of the modifications)) selected from embodiments, the dsRNA comprises (i) an antisense Strand US 2016/0244766 A1 Aug. 25, 2016

that consists of the antisense sequence of AD-60489. 0036. In embodiments, the dsRNA is, comprises, or con AD-60519, AD-61193, or AD-60819 and/or (ii) a sense sists of AD-61193 (e.g., including the nucleotide sequence strand that consists of the sense sequence of AD-60489. and/or one or more (e.g., all) of the modifications of AD-60519, AD-61193, or AD-60819, except that the anti AD-61193). sense strand and/or sense strand of the dsRNA differs by 1, 2, 0037. In embodiments, the dsRNA is, comprises, or con or 3 nucleotides from the corresponding antisense and/or sists of AD-60819 (e.g., including the nucleotide sequence sense sequence of AD-60489, AD-60519, AD-61193, or and/or one or more (e.g., all) of the modifications of AD-60819. AD-60819). 0031. The sequences and modifications of AD-60489, 0038. In embodiments, the dsRNA (e.g., AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 44 AD-60519, AD-61193, AD-60819, or another dsRNA dis below. closed herein in any one of Tables 21 to 40) is effective to TABL E 44 Sequences and Modifications of AD - 60489, AD-60519, AD-6 1193, AD-6 0819 Target sites of antisense sequence Corresponding Corresponding Col. Duplex Anti sense Sequence unmodified sense unmodified antisense NMOOO 688. 4 Name Sense Sequence (5'-3' ) (5'-3') sequence sequence 871-893 AD - Cfsas GfaafagfaGf Uf G usAfsagfaufgAfgAfcac CAGAAAGAGUGUCUC UAAGAUGAGACACUC 60489 fuCfCfajfcUfuafL96 UfcUfuufcUfgsgsu AUCUUA (SEO ID NO : UUUCUGGU (SEO ID (SEQ ID NO: 4156) (SEO ID NO: 4157) 4158) NO: 4159)

871-893 AD - csasgaaagfadfulGfuCful usAfsAfGfaUfgAfgAfc CAGAAAGAGUGUCUC UAAGAUGAGACACUC 60519 CfaucuuaL96 AfcUfcUfuufcUfgsgsu AUCUUA (SEO ID NO : UUUCUGGU (SEO ID (SEQ ID NO: 416O) (SEQ ID NO: 4161) 4.162) NO: 4163)

871-893 AD - csasgaaagfadfulGfuC usAfsaGfaUfgAfgAfc CAGAAAGAGUGUCUC UAAGAUGAGACACUC 611.93 fuCfaucuuaL96 acUfcdTuOfcUfgsgsu AUCUUA (SEO ID NO : TUUCUGGU (SEO ID (SEO ID NO: 4164) (SEO ID NO: 4165) 4166) NO: 4167)

873-895 AD- Gfsas.AfaGfaGifu Gifu Cf as AfsgAfaGfaugAfgAfc GAAAGAGUGUCUCAU AAGAAGAUGAGACAC 60819 uCfaucuuCfuuL96 Afcucuuuc susg CUUCUU (SEO ID NO: UCUUUCUG (SEO ID (SEQ ID NO: 4168) (SEQ ID NO: 4169) 417O) NO: 41.71) wherein C, a, g, u = 2'-OMe ribonucleosides; Af, Cf, G, Uf = 2 F ribonucleosides; S = phosphorothioate; L96 has the structure depicted in Table 1.

0032. In embodiments, a double-stranded ribonucleic acid suppress the liver level of ALAS1 mRNA, e.g., to achieve (dsRNA) for inhibiting expression of ALAS1 is provided, silencing of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, wherein the dsRNA comprises (i) an antisense strand that or 80% (e.g., such that ALAS1 mRNA levels are decreased to comprises, or consists of the antisense sequence of 90% or less, 80% or less, 70% or less, 60% or less, 50% or AD-60489, AD-60519, or AD-61193 and/or (ii) a sense less, 40% or less, 30% or less, or 20% or less of a control level Strand that comprises, or consists of the sense sequence of of liver ALAS1 mRNA, e.g., the level in an untreated indi AD-60489, AD-60519, or AD-61193 (including the nucle vidual or group of individuals, e.g., an individual or group of otide sequence and one or more (e.g., all) of the modifications individuals treated with PBS only). In embodiments, the of the sense strand and/or antisense strand of AD-60489, effectiveness of the dsRNA in suppressing the liver level of AD-60519, or AD-61193). ALAS1 mRNA is assessed using a non-human primate 0033. In embodiments, a double-stranded ribonucleic acid model, e.g., as described herein in the Examples. (dsRNA) for inhibiting expression of ALAS1 is provided, 0039. In embodiments, the dsRNA (e.g., AD-60489, wherein the dsRNA is AD-60489, AD-60519, AD-61193, or AD-60519, AD-61193, AD-60819, or another dsRNA dis AD-60819. In embodiments, a double-stranded ribonucleic closed herein in any one of Tables 21 to 40) is effective to acid (dsRNA) for inhibiting expression of ALAS1 is pro suppress the circulating level of ALAS1 mRNA, e.g., to vided, wherein the dsRNA is AD-60489, AD-60519, or achieve silencing of at least 10%, 20%, 30%, 40%, 50%, AD-61193 (e.g., including the nucleotide sequence and/or 60%, 70%, or 80% (e.g., such that ALAS1 mRNA levels are one or more (e.g., all) of the modifications of AD-60489. decreased to 90% or less, 80% or less, 70% or less, 60% or AD-60519, or AD-61193). less, 50% or less, 40% or less, 30% or less, or 20% or less of a control level of circulating ALAS1 mRNA, e.g., the level 0034. In embodiments, the dsRNA is, comprises, or con prior to treatment with the dsRNA, or the level in an untreated sists of AD-60489 (e.g., including the nucleotide sequence individual or group of individuals). In embodiments, the and/or one or more (e.g., all) of the modifications of effectiveness of the dsRNA in suppressing the circulating AD-60489). level of ALAS1 mRNA is assessed using a non-human pri 0035. In embodiments, the dsRNA is, comprises, or con mate model, e.g., as described herein in the Examples. In sists of AD-60519 (e.g., including the nucleotide sequence embodiments, the circulating level of ALAS1 mRNA is and/or one or more (e.g., all) of the modifications of assessed using a circulating extracellular RNA detection AD-60519). (cERD) assay, e.g., as described herein or in Sehgal, A. et al. US 2016/0244766 A1 Aug. 25, 2016

Quantitation of tissue-specific target gene modulation using complementarity is 30 nucleotides or less, and at least 15 circulating RNA (Poster presented on Feb. 9, 2012 at the nucleotides in length. Generally, the iRNA is 19 to 24 nucle Keystone Gene Silencing by small RNAS symposium (Van otides in length. couver, Feb. 7-12, 2012) or Sehgal, A. et al. Tissue-specific 0052. In some embodiments, the iRNA is 19-21 nucle gene silencing monitored in circulating RNA, RNA, 20: 1-7, otides in length. In some embodiments, the iRNA is 19-21 published online Dec. 19, 2013. nucleotides in length and is in a lipid formulation, e.g. a lipid 0040. The ceRD method can be applied to any appropriate nanoparticle (LNP) formulation (e.g., an LNP11 formula biological sample. In embodiments, the circulating level of tion). ALAS1 mRNA is assessed using a blood sample, e.g., a serum sample. In embodiments, the circulating level of 0053. In some embodiments, the iRNA is 21-23 nucle ALAS1 mRNA is assessed using a urine sample. otides in length. In some embodiments, the iRNA is 21-23 0041. In embodiments, the dsRNA is a derivative of nucleotides in length and is in the form of a conjugate, e.g., AD-60489 that is disclosed herein, e.g., in any one of the conjugated to one or more GalNAc derivatives as described tables herein. In embodiments, the dsRNA shows improved herein. activity compared with AD-60489. In some such embodi 0054. In some embodiments the iRNA is from about 15 to ments, the dsRNA is AD-60519. about 25 nucleotides in length, and in other embodiments the 0042. In embodiments, the dsRNA is a derivative of iRNA is from about 25 to about 30 nucleotides in length. An AD-58632 that is disclosed herein, e.g., in any one of the iRNA targeting ALAS1, upon contact with a cell expressing tables herein. In embodiments, the dsRNA shows improved ALAS1, inhibits the expression of an ALAS1 gene by at least activity compared with AD-58632. 10%, at least 20%, at least 25%, at least 30%, at least 35% or 0043. In embodiments, improved activity is indicated by a at least 40% or more, such as when assayed by a method as lower IC50, e.g., as determined based on in vitro assays, e.g., described herein. In one embodiment, the iRNA targeting as described herein, e.g., in the Examples. ALAS1 is formulated in a stable nucleic acid lipid particle 0044. In embodiments, improved activity is indicated by a (SNALP). lower effective dose. The effective dose may be determined 0055. In one embodiment, an iRNA (e.g., a dsRNA) fea based on the administration of a single dose or multiple tured herein includes a first sequence of a dsRNA that is repeated doses. selected from the group consisting of the sense sequences of 0045. In embodiments, the effective dose is determined Tables 21 to 40 and a second sequence that is selected from based on the single dose ED50. In embodiments, the effective the group consisting of the corresponding antisense dose or the single dose ED50 is determined based on an in sequences of Tables 21 to 40. Vivo assay. In embodiments, the in vivo assay is conducted in 0056. The iRNA molecules featured herein can include a non-human animal, e.g., in a rat, in a non-human primate, or naturally occurring nucleotides or can include at least one in a mouse. modified nucleotide. In embodiments, the at least one modi 0046. In embodiments, the effective dose is determined fied nucleotide include one or more of a modification on the based on the dose required to obtain a reduction of in a level nucleotide chosen from the group consisting of a locked of ALAS1 mRNA (e.g., a liver level of ALAS1 mRNA and/or nucleic acid (LNA), an acyclic nucleotide, a hexitol or hexose a circulating level of ALAS1 mRNA), e.g., as described nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), herein in the Examples. In embodiments, circulating mRNA 2-methoxyethyl. 2'-O-alkyl. 2'-O-allyl, 2-C-allyl. 2'-fluoro, is assessed using the cFRD assay. 2'-deoxy. 2'-hydroxyl, or any combination thereof. In one 0047. In embodiments, the effective dose is determined embodiment, the at least one modified nucleotide includes, based on the dose required to obtain a reduction of a level but is not limited to a 2'-O-methyl modified nucleotide, (e.g., a urine and/or plasma level) of ALA and/or PBG. 2'-fluoro modified nucleotide, a nucleotide having a 5'-phos 0.048. In embodiments, the effective dose is determined phorothioate group, and a terminal nucleotide linked to a based on the dose required to obtain a particular treatment ligand, e.g., an N-acetylgalactosamine (GalNAc) or a choles effect described herein, e.g., prevention or reduction of symp teryl derivative. Alternatively, the modified nucleotide may toms associated with a porphyria. be chosen from the group of: a 2'-deoxy-2'-fluoro modified 0049. In embodiments, improved activity is indicated by nucleotide, a 2'-deoxy-modified nucleotide, a locked nucle the achievement of a higher liver level of the dsRNA. In otide, an acyclic nucleotide, an abasic nucleotide, 2-amino embodiments, a higher liver level is obtained after a single modified nucleotide, 2-alkyl-modified nucleotide, mor dose of dsRNA (e.g., a dose of 1, 2.5, 3, 5, or 10 mg/kg). In pholino nucleotide, a phosphoramidate, and a non-natural embodiments, a higher liver level is obtained after multiple base comprising nucleotide. Sucha modified sequence can be doses of dsRNA have been administered (e.g., 2-10 daily or based, e.g., on a first sequence of said iRNA selected from the weekly doses of 1, 2.5, 3, 5, or 10 mg/kg). group consisting of the sense sequences of disclosed in Tables 0050. In one embodiment, the iRNA encompasses a 21-40, and a second sequence selected from the group con dsRNA having an RNA strand (the antisense strand) having a sisting of the corresponding antisense sequences disclosed in region that is Substantially complementary to a portion of an Tables 21-40. ALAS1 mRNA, e.g., a human ALAS1 mRNA (e.g., a human 0057. In one embodiment, an iRNA as described herein ALAS1 mRNA as provided in SEQ ID NO:1 or SEQ ID targets a wildtype ALAS1 RNA transcript variant, and in NO:382). another embodiment, the iRNA targets a mutant transcript 0051. In one embodiment, an iRNA for inhibiting expres (e.g., an ALAS1 RNA carrying an allelic variant). For sion of an ALAS1 gene includes at least two sequences that example, an iRNA featured in the invention can target a are complementary to each other. The iRNA includes a sense polymorphic variant, Such as a single nucleotide polymor Strand having a first sequence and an antisense Strand having phism (SNP), of ALAS1. In another embodiment, the iRNA a second sequence. The antisense Strand includes a nucleotide targets both a wildtype and a mutant ALAS1 transcript. In yet sequence that is Substantially complementary to at least part another embodiment, the iRNA targets a particular transcript ofan mRNA encoding an ALAS1 transcript, and the region of variant of ALAS1 (e.g., human ALAS1 variant 1). In yet US 2016/0244766 A1 Aug. 25, 2016

another embodiment, the iRNA agent targets multiple tran attached to the 3' end of the sense strand of the dsRNA. In Script variants (e.g., both variant 1 and variant 2 of human Some embodiments, the conjugate is attached via a linker, ALAS1). e.g., via a bivalent or trivalent branched linker. 0060. In some embodiments, the conjugate comprises one 0.058. In one embodiment, an iRNA featured in the inven or more N-acetylgalactosamine (GalNAc) derivatives. Such a tion targets a non-coding region of an ALAS1 RNA tran conjugate is also referred to hereinas a GalNAc conjugate. In Script, Such as the 5' or 3' untranslated region of a transcript. Some embodiments, the conjugate targets the RNAi agent to 0059. In some embodiments, an iRNA as described herein a particular cell, e.g., a liver cell, e.g., a hepatocyte. The is in the form of a conjugate, e.g., a carbohydrate conjugate, GalNAc derivatives can be attached via a linker, e.g., a biva which may serve as a targeting moiety and/or ligand, as lent or trivalent branched linker. In particular embodiments, described herein. In one embodiment, the conjugate is the conjugate is OH HO

O H H

HO AcHN N-N--O O

OH HO

HO AcHN N-n-n-n-r-

AcHN

0061. In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker, e.g., a linker as shown in the following schematic, wherein X is O or S

OH HO

HO ACHN US 2016/0244766 A1 Aug. 25, 2016 7

0062. In some embodiments, X is O. In some embodi ments, X is S. 0063. In some embodiments, the RNAi agent is conju gated to L96 as defined in Table 1 and shown below

OH OH trans-4-Hydroxyprolinol HOV l-O O ... O -- AcHN n-n-n n1N1 t HO O Ca OH -- OHO 'N H N Site of Triantennary O H H N Conjugation GalNAc HO --~N~N~ O AcHN O O O O OH OH N-- ryu . C12 - Diacroboxylic Acid Tether ACHN n-n-n-r-rH H O O

0064. In one embodiment, the dsRNA has one, two, three, ment, the phosphorothioate linkages are located at the 3' end four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, and at the 5' end of the antisense strand. In one embodiment, fourteen, fifteen, sixteen or all of the following: two phosphorothioate linkages are located at the 3' end and 0065 (i) is chemically synthesized, e.g., is synthesized by two phosphorothioate linkages are located at the 5' end of the Solid phase oligonucleotide synthesis; antisense Strand; 0066 (ii) all the nucleotides in the dsRNA are modified, 0075 (xi) has a sense strand that comprises one or more e.g., all the nucleotides are 2'-OMe or 2'-F modified, or a (e.g., two) phosphorothioate linkages. In one embodiment, combination of 2'-OMe and 2'-F modified; the one or more (e.g., two) phosphorothioate linkages are 0067 (iii) all nucleotides are connected through 3'-5' located at the 5' end of the sense strand; phosphodiester linkages; 0076 (xii) 21 nucleotides of the sense strand hybridize to 0068 (iv) the sense strand comprises or consists of 21 the complementary 21 nucleotides of the antisense strand; nucleotides; 0077 (xiii) forms 21 nucleotide base pairs and a two-base 0069 (v) the antisense sense strand comprises or consists overhang at the 3'-end of the antisense Strand; of 23 nucleotides; 0078 (xiv) comprises, or consists of a sense and antisense 0070 (vi) has a blunt-end at the 3'-end of sense strand; strand having the sequence of AD-60519; 0071 (vii) has a 3'-overhang, e.g., has a two-nucleotide (0079 (XV) has a sense strand with 10, 12, 14, 16, 18, 19, 20 overhang, at the 3'-end of the antisense strand; or all of the modifications of the sense strand of AD-60519; 0072 (viii) is covalently attached to a ligand containing 0080 (xvi) has an antisense strand with 10, 12, 14, 16, 18, three N-acetylgalactosamine (GalNAc) moieties: 19, 20 or all of the modifications of the antisense strand of 0073 (ix) the 3'-end of the sense strand is conjugated to the AD-60519; or triantennary GalNAc moiety (e.g., referred to hereinas L96 as I0081 (xvii) has the duplex sequence and all the modifica defined in Table 1). In one embodiment, the 3'-end is linked to tions of AD-60519. the triantennary GalNAc moiety through a phosphodiester 0082 In embodiments, the dsRNA is in the form of a linkage; conjugate having the following structure (also referred to 0074 (x) has an antisense strand that comprises one or herein as AD-60519 or ALN-60519) (SEQ ID NOS 5238 more (e.g., four) phosphorothioate linkages. In one embodi 5239, respectively, in order of appearance):

US 2016/0244766 A1 Aug. 25, 2016

0.083. In an aspect provided herein is a composition, e.g., a 0092. XXX,YYY,ZZZ, X'X'X',Y'Y'Y', and ZZZ each pharmaceutical composition, that includes one or more of the independently represent one motif of three identical iRNAs described herein and a pharmaceutically acceptable modifications on three consecutive nucleotides; carrier or delivery vehicle. In one embodiment, the composi 0.093 modifications on N, differ from the modification tion is used for inhibiting the expression of an ALAS1 gene in on Y and modifications on N'differ from the modifica an organism, generally a human Subject. In one embodiment, tion on Y". the composition is used for treating a porphyria, e.g., AIP. 0094. In embodiments, the sense strand is conjugated to at least one ligand. 0084. In one aspect, an iRNA provided herein is a double 0095. In embodiments, i is 1: j is 1; or both i and j are 1. stranded ribonucleic acid (dsRNA) for inhibiting expression 0096. In embodiments, k is 1:1 is 1; or both k and l are 1. of ALAS1, wherein said dsRNA comprises a sense strand and (0097. In embodiments, XXX is complementary to X'X'X', an antisense Strand 15-30 base pairs in length and the anti YYY is complementary to Y'Y'Y', and ZZZ is complemen sense strand is complementary to at least 15 contiguous tary to ZZZ'. nucleotides of SEQID NO: 1 or 382. 0098. In embodiments, the Y'Y'Y' motif occurs at the 11, 0085. In a further aspect, an iRNA provided herein is a 12 and 13 positions of the antisense strand from the 5'-end. double stranded RNAi (dsRNA) comprising a sense strand (0099. In embodiments, the Y is 2'-O-methyl. complementary to an antisense strand, wherein said antisense 0100. In embodiments, the duplex region is 15-30 nucle Strand comprises a region of complementarity to an ALAS1 otide pairs in length. RNA transcript, wherein each strand has about 14 to about 30 0101. In embodiments, the duplex region is 17-23 nucle nucleotides, wherein said double stranded RNAi agent is otide pairs in length. represented by formula (III): 0102. In embodiments, the duplex region is 19-21 nucle otide pairs in length. 0103) In embodiments, the duplex region is 21-23 nucle otide pairs in length. 0104. In embodiments, the modification on the nucleotide is selected from the group consisting of a locked nucleic acid (LNA), an acyclic nucleotide, a hexitol or hexose nucleic acid 0086 wherein: (HNA), a cyclohexene nucleic acid (CeNA), 2-methoxy I0087 j, k, and 1 are each independently 0 or 1; ethyl, 2'-O-alkyl. 2'-O-allyl, 2-C-allyl. 2'-fluoro. 2'-deoxy, p, p', q, and q are each independently 0-6: 2'-hydroxyl, and any combination thereof. 0088 0105. In embodiments, the modifications on the nucle I0089 each N and N' independently represents an oli otides are selected from the group consisting of LNA, HNA, gonucleotide sequence comprising 0-25 nucleotides CeNA 2'-methoxyethyl. 2'-O-alkyl. 2'-O-allyl, 2-C-allyl, which are either modified or unmodified or combina 2'-fluoro. 2'-deoxy. 2'-hydroxyl, and combinations thereof. tions thereof, each sequence comprising at least two 0106. In embodiments, the modifications on the nucle differently modified nucleotides; otides are 2'-O-methyl, 2'-fluoro or both. 0090 each N, and N' independently represents an oli 0107. In embodiments, the ligand comprises a carbohy gonucleotide sequence comprising 0-10 nucleotides drate. which are either modified or unmodified or combina 0108. In embodiments, the ligand is attached via a linker. tions thereof; 0109. In embodiments, the linker is a bivalent or trivalent I0091 each n, n., n and n' independently represents branched linker. an overhang nucleotide; 0110. In embodiments, the ligand is

OH HO

HO N-n-r N-1N1 O AcHNC O

OH HO

HO AcHN N-n-r N-1N1 ^- C O O

OH HO

AcHN US 2016/0244766 A1 Aug. 25, 2016

0111. In embodiments, the ligand and linker are as shown in Formula XXIV:

OH HO O H

HOAcHN N-n-n-n-n- O

OH HO O H H --~'sO HOAcHN N-n-r N-1- N~ O O

OH HO HO R O N1\-1n N AcHN n-n-n H H O

0112. In embodiments, the ligand is attached to the 3' end methyl modified nucleotide, a nucleotide comprising a of the sense strand. 5'-phosphorothioate group, and a terminal nucleotide linked 0113. In embodiments, the dsRNA consists of or com to a cholesteryl derivative or dodecanoic acid bisdecylamide prises a nucleotide sequence selected from the group of group. sequences provided in Tables 21-40. 0119. In some embodiments, the modified nucleotide is 0114. In a further aspect, an iRNA provided herein is a chosen from the group consisting of a 2'-deoxy-2'-fluoro double-stranded ribonucleic acid (dsRNA) for inhibiting modified nucleotide, a 2'-deoxy-modified nucleotide, a expression of ALAS1, wherein said dsRNA comprises a locked nucleotide, an acyclic nucleotide, an abasic nucle sense Strand and an antisense strand, the antisense Strand otide, 2-amino-modified nucleotide, 2-alkyl-modified comprising a region of complementarity to an ALAS1 RNA nucleotide, morpholino nucleotide, a phosphoramidate, and a transcript, which antisense Strand comprises at least 15 con non-natural base comprising nucleotide. tiguous nucleotides differing by no more than 3 nucleotides I0120 In some embodiments, the region of complementa from one of the antisense sequences listed in any one of rity is at least 17 nucleotides in length. Tables 21-40. In embodiments, the nucleotides of the anti 0121. In some embodiments, the region of complementa sense strand have fewer modifications, more modifications, rity is between 19 and 21 nucleotides in length. or different modifications compared with the antisense 0122. In some embodiments, the region of complementa sequences listed in any one of Tables 21-40. rity is 19 nucleotides in length. 0115. In embodiments, the sense and antisense sequences (0123. In some embodiments, each strand is no more than are those of a duplex disclosed herein that suppresses ALAS1 30 nucleotides in length. mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 0.124. In some embodiments, at least one strand comprises 90%, e.g., as assessed using an assay disclosed in the a 3' overhang of at least 1 nucleotide. In embodiments, the Examples provided herein. antisense strand comprises a 3' overhang of at least 1 nucle 0116. In embodiments, ALAS1 mRNA expression is otide. assessed based on an ALAS1 mRNA level in the liver, e.g., as 0.125. In some embodiments, at least one strand comprises assessed using a liver biopsy sample. In embodiments, a 3' overhang of at least 2 nucleotides. In embodiments, the ALAS1 mRNA expression is assessed based on an ALAS1 antisense strand comprises a 3' overhang.of at least 2 nucle mRNA level in a biological fluid, e.g., blood, serum, plasma, otides. In embodiments, the antisense strand comprises a 3' cerebrospinal fluid, or urine. In embodiments, ALAS1 overhang.of 2 nucleotides. mRNA expression is assessed using a circulating extracellu 0.126 In some embodiments, a dsRNA described herein lar RNA detection (cERD) assay, e.g., a cBRD assay as further comprises a ligand. described herein or in Sehgal, A. et al. Quantitation of tissue I0127. In some embodiments, the ligand is a GalNAc specific target gene modulation using circulating RNA ligand. (Poster presented on Feb. 9, 2012 at the Keystone Gene I0128. In some embodiments, the ligand targets the dsRNA Silencing by small RNAS symposium (Vancouver, Feb. 7-12. to hepatocytes. 2012) or Sehgal, A. et al. Tissue-specific gene silencing moni I0129. In some embodiments, the ligand is conjugated to tored in circulating RNA, RNA, 20: 1-7, published online the 3' end of the sense strand of the dsRNA. Dec. 19, 2013. 0.130. In some embodiments, the region of complementa 0117. In some embodiments, the dsRNA comprises at rity consists of an antisense sequence selected from the anti least one modified nucleotide. sense sequences listed in Tables 21-40, or a corresponding 0118. In some embodiments, at least one of the modified antisense sequence in which some or all of the nucleotides are nucleotides is chosen from the group consisting of a 2'-O- unmodified. In embodiments, the region of complementarity US 2016/0244766 A1 Aug. 25, 2016

consists of the sequence UAAGAUGAGACACUCUUU 0142. In embodiments, a pharmaceutical composition CUGGU (SEQID NO: 4153) or UAAGAUGAGACACUC comprises an iRNA (e.g., a dsRNA) described herein that TUUCUGGU (SEQ ID NO: 4154). In some embodiments, comprises a ligand (e.g., a GalNAc ligand), and the pharma the region of complementarity consists of the antisense ceutical composition is administered subcutaneously. In sequence of the duplex AD-60489. In some embodiments, the embodiments, the ligand targets the iRNA (e.g., dsRNA) to region of complementarity consists of the antisense sequence hepatocytes. of the duplex AD-60519. 0143. In certain embodiments, a pharmaceutical compo 0131. In embodiments, the region of complementarity sition, e.g., a composition described herein, includes a lipid consists of an antisense sequence selected from a duplex formulation. In some embodiments, the RNAi agent is in a disclosed herein that suppresses ALAS1 mRNA expression LNP formulation, e.g., a MC3 formulation. In some embodi by at least 50%, 60%, 70%, 80%, 85% or 90%, e.g., as ments, the LNP formulation targets the RNAi agent to a assessed using an assay disclosed in the Examples provided particular cell, e.g., a liver cell, e.g., a hepatocyte. In embodi herein. ments, the lipid formulation is a LNP11 formulation. In 0.132. In some embodiments, the dsRNA comprises a embodiments, the composition is administered intravenously. sense Strand consisting of a sense Strand sequence selected 0144. In another embodiment, the pharmaceutical compo from Tables 21-40, and an antisense Strand consisting of an sition is formulated for administration according to a dosage antisense sequence selected from Tables 21-40. In embodi regimen described herein, e.g., not more than once every four ments, the dsRNA comprises a pair of corresponding sense weeks, not more than once every three weeks, not more than and antisense sequences selected from those of the duplexes once every two weeks, or not more than once every week. In disclosed in Tables 21-40. another embodiment, the administration of the pharmaceuti 0133. In one aspect, the invention provides a cell contain cal composition can be maintained for a month or longer, e.g., ing at least one of the iRNAs (e.g., dsRNAs) featured herein. one, two, three, or six months, or one year or longer. The cell is generally a mammalian cell. Such as a human cell. 0145. In another embodiment, a composition containing In some embodiments, the cell is an erythroid cell. In other an iRNA featured in the invention, e.g., a dsRNA targeting embodiments, the cell is a liver cell (e.g., a hepatocyte). ALAS1, is administered with a non-iRNA therapeutic agent, 0134. In an aspect provided herein is a pharmaceutical Such as an agent known to treat a porphyria (e.g., AIP), or a composition for inhibiting expression of an ALAS1 gene, the symptom of a porphyria (e.g., pain). In another embodiment, composition comprising an iRNA (e.g., a dsRNA) described a composition containing an iRNA featured in the invention, e.g., a dsRNA targeting AIP, is administered along with a herein. non-iRNA therapeutic regimen, such as hemin or glucose 0135) In embodiments of the pharmaceutical composi (e.g., glucose infusion (e.g., IV glucose)). For example, an tions described herein, the iRNA (e.g., dsRNA) is adminis iRNA featured in the invention can be administered before, tered in an unbuffered solution. In embodiments, the unbuf after, or concurrent with glucose, dextrose, or a similar treat fered solution is Saline or water, e.g., water for injection. ment that serves to restore energy balance (e.g., total 0136. In embodiments, the pharmaceutical composition parenteral nutrition). An iRNA featured in the invention can comprises AD-60519 and water for injection. In embodi also be administered before, after, or concurrent with the ments, the composition comprises about 100 to 300 mg/mL, administration of a heme product (e.g., hemin, heme arginate, e.g., 200 mg/mL, of AD-60519. In embodiments, the compo or heme albumin), and optionally also in combination with a sition has a pH of 6.0–7.5, e.g., about 7.0. In embodiments, the glucose (e.g. IV glucose) or the like. composition is for Subcutaneous injection. In embodiments, 0146 Typically, glucose administered for the treatment of the pharmaceutical composition is packaged in a container a porphyria is administered intravenously (IV). Administra (e.g., a glass Vial, e.g., a 2 mL glass Vial.) at a Volume of about tion of glucose intravenously is referred to herein as “IV 0.3 to 1 mL, e.g., 0.55 mL. In embodiments, the pharmaceu glucose.” However, alternative embodiments in which glu tical composition is ALN-AS1 as described herein in the cose is administered by other means are also encompassed. examples. 0.147. In one embodiment, an ALAS1 iRNA is adminis 0.137 In embodiments of the pharmaceutical composi tered to a patient, and then the non-iRNA agent ortherapeutic tions described herein, the iRNA (e.g., dsRNA is adminis regimen (e.g., glucose and/or a heme product) is administered tered with a buffer solution. In embodiments, the buffer solu to the patient (or vice versa). In another embodiment, an tion comprises acetate, citrate, prolamine, carbonate, or ALAS1 iRNA and the non-iRNA therapeutic agent or thera phosphate or any combination thereof. In embodiments, the peutic regimen are administered at the same time. buffer solution is phosphate buffered saline (PBS). 0.148. In an aspect provided herein is a method of inhibit 0.138. In embodiments of the pharmaceutical composi ing ALAS1 expression in a cell, the method comprising: (a) tions described herein, the iRNA (e.g., dsRNA) is targeted to introducing into the cell an iRNA (e.g. a dsRNA) described hepatocytes. herein and (b) maintaining the cell of step (a) for a time 0.139. In embodiments of the pharmaceutical composi sufficient to obtain degradation of the mRNA transcript of an tions described herein, the composition is administered intra ALAS1 gene, thereby inhibiting expression of the ALAS1 venously. gene in the cell. 0140. In embodiments of the pharmaceutical composi 0149. In an aspect provided herein is a method for reduc tions described herein, the composition is administered Sub ing or inhibiting the expression of an ALAS1 gene in a cell cutaneously. (e.g., an erythroid cell or a liver cell. Such as, e.g., a hepato 0141. In embodiments, a pharmaceutical composition cyte). The method includes: comprises an iRNA (e.g., a dsRNA) described herein that 0.150 (a) introducing into the cell a double-stranded comprises a ligand (e.g., a GalNAc ligand) that targets the ribonucleic acid (dsRNA), wherein the dsRNA includes iRNA (e.g., dsRNA) to hepatocytes. at least two sequences that are complementary to each US 2016/0244766 A1 Aug. 25, 2016 13

other. The dsRNA has a sense strand having a first homozygous dominant AIP, HCP or VP) or hepatoerythro sequence and an antisense strand having a second poietic porphyria. In embodiments, the porphyria is a dual sequence; the antisense strand has a region of comple porphyria. mentarity that is Substantially complementary to at least (0162. In one embodiment, the dsRNA introduced reduces a part of an mRNA encoding ALAS1, and where the or inhibits expression of an ALAS1 gene in the cell. region of complementarity is 30 nucleotides or less, i.e., (0163. In one embodiment, the dsRNA introduced reduces 15-30 nucleotides in length, and generally 19-24 nucle or inhibits expression of an ALAS1 gene, or the level of one otides in length, and where the dsRNA upon contact or more porphyrins or porphyrin precursors (e.g., Ö-aminole with a cell expressing ALAS1, inhibits expression of an Vulinic acid (ALA), porphopilinogen (PBG), hydroxymeth ALAS1 gene by at least 10%, e.g., at least 20%, at least ylbilane (HMB), uroporphyrinogen I or III, coproporphyrino 30%, at least 40% or more; and gen I or III, protoporphrinogen IX, and protoporphyrin IX) or 0151 (b) maintaining the cell of step (a) for a time porphyrin products or metabolites, by at least 5%, 10%, 15%, sufficient to obtain degradation of the mRNA transcript 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared to of the ALAS1 gene, thereby reducing or inhibiting a reference, (e.g., an untreated cell or a cell treated with a expression of an ALAS1 gene in the cell. non-targeting control dsRNA). Without being bound by 0152. In embodiments of the foregoing methods of inhib theory, ALAS1 is the first enzyme of the porphyrin pathway. iting ALAS1 expression in a cell, the cell is treated ex vivo, in Thus, reducing expression of the ALAS1 gene is likely to vitro, or in vivo. In embodiments, the cell is a hepatocyte. reduce the level of one or more porphyrin precursors, porphy 0153. In embodiments, the cell is present in a subject in rins or porphyrin products or metabolites. need of treatment, prevention and/or management of a disor 0164. In other aspects, the invention provides methods for der related to ALAS1 expression. treating, preventing or managing pathological processes 0154) In embodiments, the disorder is a porphyria. In related to ALAS1 expression (e.g., pathological processes embodiments, the porphyria is acute intermittent porphyria or involving porphyrins, porphyrin precuorsors, or defects in the ALA-dehydratase deficiency porphyria. porphyrin pathway, such as, for example, porphyrias). In one embodiment, the method includes administering to a Subject, 0155. In embodiments, the porphyria is a hepatic porphy e.g., a patient in need of Such treatment, prevention or man ria, e.g., a porphyria selected from acute intermittent porphy agement, an effective (e.g., a therapeutically or prophylacti ria (AIP) hereditary coproporphyria (HCP), variegate por cally effective) amount of one or more of the iRNAs featured phyria (VP), ALA deyhdratase deficiency porphyria (ADP), herein. and hepatoerythropoietic porphyria. In embodiments, the 0.165. In an aspect provided herein is a method of treating porphyria is a homozygous dominant hepatic porphyria (e.g., and/or preventing a disorder related to ALAS1 expression homozygous dominant AIP, HCP or VP) or hepatoerythro comprising administering to a Subject in need of Such treat poietic porphyria. In embodiments, the porphyria is a dual ment a therapeutically effective amount of an iRNA (e.g., a porphyria. dsRNA) described herein, or a composition comprising an 0156. In embodiments, the expression of ALAS1 is inhib iRNA (e.g., a dsRNA) described herein. ited by at least 30%. 0166 In an aspect provided herein is a method of treating 0157. In embodiments, the iRNA (e.g., dsRNA) has an and/or preventing a porphyria comprising administering to a ICso in the range of 0.01-1 nM. subject in need of such treatment a double-stranded ribo 0158. In certain embodiments, the cell (e.g., the hepato nucleic acid (dsRNA), wherein said dsRNA comprises a cyte) is a mammaliancell (e.g., a human, non-human primate, sense strand and an antisense Strand 15-30 base pairs in length or rodent cell). and the antisense strand is complementary to at least 15 0159. In one embodiment, the cell is treated ex vivo, in contiguous nucleotides of SEQID NO:1 or SEQID NO:382. vitro, or in vivo (e.g., the cell is present in a subject (e.g., a 0167. In one embodiment, subject (e.g., the patient) has a patient in need of treatment, prevention and/or management porphyria. In another embodiment, the Subject (e.g., patient) of a disorder related to ALAS1 expression). is at risk for developing a porphyria. In some embodiments, 0160 In one embodiment, the Subject is a mammal (e.g., a administration of the iRNA targeting ALAS1 alleviates or human) at risk, or diagnosed with a porphyria, e.g., X-linked relieves the severity of at least one symptom of a disorder sideroblastic anemia (XLSA), ALA deyhdratase deficiency related to ALAS1 in the patient. porphyria (ADP or Doss porphyria), acute intermittent por 0.168. In one embodiment, the Subject is a mammal (e.g., a phyria (AIP), congenital erythropoietic porphyria (CEP), human) at risk, or that has been diagnosed with, a disorder prophyria cutanea tarda (PCT), hereditary coproporphyria related to ALAS1 expression, e.g., a porphyria, e.g., X-linked (coproporphyria, or HCP), variegate porphyria (VP), eryth sideroblastic anemia (XLSA), ALA deyhdratase deficiency ropoietic protoporphyria (EPP), or transient erythroporphyria porphyria (DoSS porphyria), acute intermittent porphyria of infancy. In some embodiments, the disorder is an acute (AIP), congenital erythropoietic porphyria (CEP), prophyria hepatic porphyria, e.g., ALA deyhdratase deficiency porphy cutanea tarda (PCT), hereditary coproporphyria (copropor ria (ADP), AIP, HCP, or VP. In specific embodiments, the phyria, or HCP), variegate porphyria (VP), erythropoietic disorder is ALA deyhdratase deficiency porphyria (ADP) or protoporphyria (EPP), or transient erythroporphyria of AIP infancy. In a further embodiment, the porphyria is an acute 0161 In embodiments, the porphyria is a hepatic porphy hepatic porphyria, e.g., ALA deyhdratase deficiency porphy ria, e.g., a porphyria selected from acute intermittent porphy ria (ADP), AIP, HCP or VP. In some such embodiments, the ria (AIP) hereditary coproporphyria (HCP), variegate por disorder is ALA deyhdratase deficiency porphyria (ADP) or phyria (VP), ALA deyhdratase deficiency porphyria (ADP), AIP. and hepatoerythropoietic porphyria. In embodiments, the 0169. In embodiments the subject has, or is at risk for porphyria is a homozygous dominant hepatic porphyria (e.g., developing, a porphyria. In embodiments, the porphyria is a US 2016/0244766 A1 Aug. 25, 2016

hepatic porphyria, e.g., a porphyria selected from acute inter 0184. In embodiments, the iRNA (e.g., dsRNA) has an mittent porphyria (AIP) hereditary coproporphyria (HCP), ICso in the range of 0.01-1 nM. variegate porphyria (VP), ALA deyhdratase deficiency por 0185. In embodiments, a method described herein phyria (ADP), and hepatoerythropoietic porphyria. In 0186 (i) ameliorates a symptom associated with an embodiments, the porphyria is a homozygous dominant ALAS1 related disorder (e.g., a porphyria) hepatic porphyria (e.g., homozygous dominant AIP, HCP, or 0187 (ii) inhibits ALAS1 expression in the subject VP) or hepatoerythropoietic porphyria. In embodiments, the (e.g., as assessed using the cFRD assay), porphyria is a dual porphyria. 0188 (iii) decreases a level of a porphyrin precursor 0170 In embodiments, a porphyria, a symptom of porphy (e.g., ALA or PBG) or a porphyrin in the subject, ria, a prodrome, or an attack of porphyria is induced by 0189 (iv) decreases frequency of acute attacks of symp exposure to a precipitating factor, as described herein. In toms associated with a porphyria in the Subject, or Some embodiments, the precipitating factor is a chemical 0.190 (v) decreases incidence of acute attacks of symp exposure. In some embodiments, the precipitating factor is a toms associated with a porphyria in the Subject when the drug, e.g., a prescription drug or an over the counter drug. In Subject is exposed to a precipitating factor (e.g., the Some embodiments, the precipitating factor is the menstrual premenstrual phase or the luteal phase). cycle, e.g., a particular phase of the menstrual cycle, e.g., the 0191 In embodiments, the method ameliorates pain and/ luteal phase. or progressive neuropathy. 0171 In embodiments, the iRNA (e.g., dsRNA) or com 0.192 In embodiments, the iRNA (e.g., dsRNA) or com position comprising the iRNA is administered after an acute position comprising the iRNA is administered according to a attack of porphyria. dosing regimen. 0172. In embodiments, the iRNA (e.g., dsRNA) or com 0193 In some embodiments, the iRNA (e.g., dsRNA) or position comprising the iRNA is administered during an acute composition comprising the iRNA is administered before or attack of porphyria. during an acute attack of porphyria. In some embodiments, 0173. In embodiments, the iRNA (e.g., dsRNA) or com the iRNA is administered before an acute attack of porphyria. position comprising the iRNA is administered prophylacti 0194 In some embodiments, the iRNA (e.g., dsRNA) or cally to prevent an acute attack of porphyria. composition comprising the iRNA is administered during a 0.174. In embodiments, the iRNA (e.g., dsRNA) is formu prodrome. In embodiments, the prodrome is characterized by lated as an LNP formulation. abdominal pain, nausea, psychological symptoms (e.g., anxi (0175. In embodiments, the iRNA (e.g., dsRNA) is in the ety), restlessness and/or insomnia. form of a GalNAc conjugate. 0.195. In embodiments, the iRNA (e.g., dsRNA) or com 0176). In embodiments, iRNA (e.g., dsRNA) is adminis position comprising the iRNA is administered during a par tered at a dose of 0.05-50 mg/kg. ticular phase of the menstrual cycle, e.g., during the luteal 0177. In embodiments, the iRNA (e.g., dsRNA) is admin phase. In embodiments, the method ameliorates or prevents istered at a concentration of 0.01 mg/kg-5 mg/kg bodyweight cyclical attacks of porphyria, e.g., by reducing the severity, of the subject. duration, or frequency of attacks. In embodiments, the cycli 0178. In embodiments, the iRNA (e.g., dsRNA) is formu cal attacks are associated with a precipitating factor. In lated as an LNP formulation and is administered at a dose of embodiments, the precipitating factor is the menstrual cycle, 0.05-5 mg/kg. e.g., a particular phase of the menstrual cycle, e.g., the luteal (0179. In embodiments, the iRNA (e.g., dsRNA) is in the phase. form of a GalNAc conjugate and is administered at a dose of 0196. In embodiments, the subject has an elevated level of 0.5-50 mg/kg. In certain embodiments, the iRNA in the Gal ALA and/or PBG. In embodiments, the level of ALA and/or NAc conjugate is administered at a dose of less than 10 mg/kg PBG is elevated in plasma or urine from the subject. In (e.g., 5 mg/kg or less) e.g., once per week; e.g., a dose of 1 embodiments, the Subject has or is at risk for developing a mg/kg or less, 2.5 mg/kg or less, or 5 mg/kg or less, e.g., once porphyria, e.g., a hepatic porphyria. In embodiments, the per week. In one embodiment, iRNA in the GalNAc conju Subject is asymptomatic. In embodiments, the Subject carries gate is administered at a dose of about 2.5 mg/kg or less, e.g., a genetic alteration (e.g., a gene mutation) associated with a once per week. In one embodiment, the administration of the porphyria, as described herein. In embodiments, the Subject iRNA in the GalNAc conjugate is subcutaneous. has or is at risk for developing a porphyria and Suffers from 0180. In embodiments, the iRNA (e.g., dsRNA) is in the pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or form of a GalNAc conjugate and is administered, e.g., Sub neuropathy (e.g., progressive neuropathy). In embodiments, cutaneously, at a dose of 0-5 mg/kg, e.g. 0-2.5 mg/kg or 1-2.5 the subject does not suffer from acute attacks but suffers from mg/kg. In embodiments, the iRNA is administered weekly. In pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or embodiments, the iRNA is administered as a composition neuropathy (e.g., progressive neuropathy). In embodiments, comprising the iRNA and water for injection. In embodi the pain is abdominal pain. ments, the iRNA is AD-60519. In embodiments, the compo 0.197 In embodiments, the subject (a) has an elevated level sition comprises the iRNA, e.g., AD-60519, at a concentra of ALA and/or PBG and (b) suffers from pain (e.g., chronic tion of about 200 mg/mL. pain, e.g., chronic neuropathic pain) and/or neuropathy (e.g., 0181. In embodiments, the method decreases a level of a progressive neuropathy). In embodiments, the pain is porphyrin or a porphyrin precursor in the Subject. abdominal pain. 0182. In embodiments, the level is decreased by at least 0.198. In embodiments, the subject has a plasma level and/ 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In an or a urine level of ALA and/or PBG that is elevated. In embodiment, the level is decreased by at least 30%. embodiments, the elevated level of ALA and/or PBG is 0183 In embodiments, the porphyrin precursor is 8-ami accompanied by other symptoms, e.g., pain (e.g., chronic nolevulinic acid (ALA) or porphopilinogen (PBG). pain, e.g., chronic neuropathic pain) or neuropathy (e.g., pro US 2016/0244766 A1 Aug. 25, 2016 gressive neuropathy). In embodiments, the pain is abdominal pain, and/or reduction in severity of pain. In embodiments, pain. In embodiments, the Subject is asymptomatic. In the decrease in pain is assessed based on the Subjects use of embodiments, the Subject has a genetic mutation associated pain medication. with a porphyria, e.g., a mutation as described herein. 0206. In embodiments, the method ameliorates or pre 0199. In embodiments, the subject has a level (e.g., a vents acute attacks of porphyria, e.g., by reducing the sever plasma level or a urine level) of a porphyrin precursor, e.g., ity, duration, or frequency of attacks. ALA and/or PBG, that is elevated, e.g., the level is greater 0207. In embodiments, the method decreases or prevents than, or greater than or equal to, a reference value. In embodi nerve damage. ments, the level is greater than the reference value. In embodi ments, the reference value is two standard deviations above 0208. In embodiments, the method prevents deterioration the mean level in a sample of healthy individuals. In embodi (e.g., prevents development of abnormalities) of or results in ments, the reference value is an upper reference limit. an improvement of clinical measures, e.g., clinical measures 0200. In embodiments, the subject has a plasma level and/ of muscle and/or nerve function, e.g., EMG and/or nerve or a urine level of ALA and/or PBG that is greater than, or conduction Velocities. greater than or or equal to, 2 times, 3 times, 4 times, or 5 times 0209. In embodiments, the method decreases heme use by that of an upper reference limit. As used herein, an “upper the subject. reference limit” refers to a level that is the upper limit of the 0210. In embodiments, the method decreases pain medi 95% confidence interval for a reference sample, e.g., a sample cation use by the Subject. of normal (e.g., wild type) or healthy individuals, e.g., indi 0211. In embodiments, the method reduces hospitaliza viduals who do not carry a genetic mutation associated with a tion. porphyria and/or individuals who do not suffer from a por 0212. In embodiments, the method is effective to reduce a phyria. In embodiments, the subject has a urine level of ALA level of ALA and/or PBG (e.g., a plasma or urine level of ALA and/or PBG that is greater than 2 to 4 times that of an upper and/or PBG). In embodiments, the method is effective to reference limit. In embodiments, the subject has a urine level produce a predetermined reduction in the elevated level of of ALA and/or PBG that is greater than 4 times that of an ALA and/or PBG. upper reference limit. 0213. In embodiments, the predetermined reduction is a 0201 In embodiments, the reference value for plasma reduction to a value that is less than or equal to a reference PBG is 0.12 umol/L. In embodiments, the subject is a human value. In some embodiments, the reference value is an upper and has a plasma PBG level that is greater than, or greater than reference limit. In some embodiments, the reference value is or equal to, 0.12 mol/L, 0.24 umol/L, 0.36 umol/L, 0.48 the value that is two standard deviations above the mean level umol/L, or 0.60 mol/L. In embodiments, the subject is a in a reference sample. human and has a plasma level of PBG that is greater than, or greater than or equal to, 0.48 umol/L. 0214. In embodiments, the method is effective to reduce 0202. In embodiments, the reference value for urine PBG the level of ALA and/or PBG in a subject to a level that is is 1.2 mmol/mol creatinine. In embodiments, the Subject is a below two times the upper reference limit. In embodiments, human and has a urine PBG level that is greater than, or the method is effective to reduce the level of ALA to below greater than or equal to, 1.2 mmol/mol creatinine, 2.4 mmol/ two times the upper reference limit. In embodiments, the mol creatinine, 3.6 mmol/mol creatinine, 4.8 mmol/mol crea method is effective to reduce the level of PBG to below two tinine, or 6.0 mmol/mol creatinine. In embodiments, the sub times the upper reference limit. ject is a human and has a urine level of PBG that is greater 0215. In embodiments, the iRNA (e.g., dsRNA) or com than, or greater than or equal to, 4.8 mmol/mol creatinine. position comprising the iRNA is administered as a single dose 0203. In embodiments, the reference value for plasma or at multiple doses, e.g., according to a dosing regimen. ALA is 0.12 Lmol/L. In embodiments, the Subject is a human 0216. In embodiments, the iRNA (e.g., dsRNA) or com and has a plasma ALA level that is greater than, or greater than position comprising the iRNA is administered prophylacti or equal to, 0.12 mol/L, 0.24 umol/L, 0.36 umol/L, 0.48 cally to a subject who is at risk for developing a porphyria. In umol/L, or 0.60 mol/L. In embodiments, the subject is a embodiments, the iRNA (e.g., dsRNA) or composition com human and has a plasma ALA level that is greater than, or prising the iRNA is administered prophylactically beginning greater than or equal to 0.48 umol/L. at puberty. In embodiments, the Subject carries a genetic 0204. In embodiments, the reference value for urine ALA mutation associated with a porphyria and/or has an elevated is 3.1 mmol/mol creatinine. In embodiments, the Subject is a level of ALA and/or PBG (e.g., an elevated plasma or urine human and has a urine ALA level that is greater than, or level of ALA and/or PBG). In embodiments, the mutation greater than or equal to, 3.1 mmol/mol creatinine, 6.2 mmol/ makes an individual Susceptible to an acute attack (e.g., upon mol creatinine, 9.3 mmol/mol creatinine, 12.4 mmol/mol exposure to a precipitating factor, e.g., a drug, dieting or other creatinine, or 15.5 mmol/mol creatinine. precipitating factor, e.g., a precipitating factor as disclosed 0205. In embodiments, the method decreases one or more herein). In embodiments, the mutation is associated with signs or symptoms of a porphyria. In embodiments, the elevated levels of a porphyrin or a porphyrin precursor (e.g., method decreases an elevated level of ALA and/or PBG. In ALA and/or PBG). In embodiments, the mutation is associ embodiments, the method decreases pain (e.g., chronic pain, ated with chronic pain (e.g., chronic neuropathic pain) and/or e.g. chronic neuropathic pain) and/or neuropathy (e.g., pro neuropathy (e.g., progressive neuropathy). gressive neuropathy). In embodiments, the pain is abdominal 0217. In embodiments, the mutation is a mutation in the pain. In embodiments, the pain is neuropathic pain (e.g., pain ALAS1 gene. In embodiments, the mutation is a mutation in associated with the progressive neuropathy of acute porphy the ALAS1 gene promoter, or in regions upstream or down rias). The decrease in pain can include, e.g., prevention of stream from the ALAS1 gene. In embodiments, the mutation pain, delay in the onset of pain, reduction in the frequency of is a mutation in transcription factors or other genes that inter US 2016/0244766 A1 Aug. 25, 2016

act with ALAS1. In embodiments, the mutation is a mutation 0228. In embodiments, the iRNA is administered at a dose in a gene that encodes an enzyme in the heme biosynthetic of less than 5 mg/kg, e.g., at 0.1, 0.35 1.0, or 2.5 mg/kg. In pathway. embodiments, the iRNA is administered in repeated doses, 0218. In embodiments, the iRNA (e.g., dsRNA or a con e.g., weekly doses. jugate thereof) or composition comprising the iRNA is 0229. In another aspect, the invention provides methods administered subcutaneously. In embodiments, the iRNA is for decreasing a level of a porphyrin or a porphyrin precursor in the form of a GalNAc conjugate. In embodiments, the in a cell (e.g., an erythroid cell or a liver cell. Such as, e.g., a iRNA (e.g., the dsRNA) is administered at a dose of 0.5-50 hepatocyte). In one embodiment, the cell is treated ex vivo, in mg/kg. In certain embodiments, the iRNA is administered at vitro, or in vivo (e.g., the cell is present in a subject (e.g., a a dose of less than 10 mg/kg (e.g., 5 mg/kg or less) once per patient in need of treatment, prevention and/or management week; e.g., a dose of 1 mg/kg or less, 2.5 mg/kg or less, or 5 of a disorder related to ALAS1 expression). The method mg/kg or less, e.g., once per week. In one embodiment, iRNA includes contacting the cell with an effective amount of one or is administered at a dose of about 2.5 mg/kg or less, e.g., once more of the iRNAs targeting ALAS1, e.g., one or more of the per week. iRNAs disclosed herein, thereby decreasing the level of a 0219. In embodiments, the subject to be treated is asymp porphyrin or a porphyrin precursor in the cell; or decreasing tomatic and has an elevated level of ALA and/or PBG. In the level of a porphyrin or a porphyrin precursorin other cells, embodiments, the Subject has a porphyria, e.g., AIP. In tissues, or fluids within a subject in which the cell is located: embodiments, the patient suffers from recurrent porphyric relative to the level prior to contacting. Such methods can be attacks. used to treat (e.g., ameliorate the severity) of disorders related 0220. In embodiments, the iRNA (e.g., AD-60519) is to ALAS1 expression, such as porphyrias, e.g., AIP or ALA administered at a dose of less than 5 mg/kg, e.g., at 0.1, 0.35. dehydratase deficiency porphyria. 1.0, or 2.5 mg/kg. In embodiments, the iRNA (e.g., 0230. In one embodiment, the contacting step is effected AD-60519) is administered in repeated doses, e.g., weekly ex vivo, in vitro, or in vivo. For example, the cell can be doses. present in a Subject, e.g., a mammal (e.g., a human) at risk, or that has been diagnosed with, a porphyria. In an embodiment, 0221. In one embodiment, the subject is asymptomatic the porphyria is an acute hepatic porphyria. In embodiments, and has an elevated level of ALA and/or PBG, and the iRNA the porphyria is a hepatic porphyria, e.g., a porphyria selected (e.g., AD-60519) is administered at Single doses, e.g., at 0.1. from acute intermittent porphyria (AIP), hereditary copropor 0.35, 1.0, or 2.5 mg/kg, or in repeatedly weekly dosages, e.g., phyria (HCP), variegate porphyria (VP), ALA deyhdratase of 1 and 2.5 mg/kg for several weeks (e.g., for 4 weeks). deficiency porphyria (ADP), and hepatoerythropoietic por 0222. In one embodiment, the subject has AIP, e.g., is an phyria. In embodiments, the porphyria is a homozygous AIP patient, the iRNA (e.g., AD-60519) is administered at a dominant hepatic porphyria (e.g., homozygous dominant dose of 1-2.5 mg/kg weekly. AIP, HCP, or VP) or hepatoerythropoietic porphyria. In 0223) In embodiments, a treatment regimen is employed embodiments, the porphyria is a dual porphyria. in which the iRNA is initially administered more frequently, 0231. In an aspect provided herein is a method for decreas followed by less frequent administration. In embodiments, ing a level of a porphyrin or a porphyrin precursor (e.g., ALA the iRNA is initially administered once per day for multiple or PBG) in a cell, comprising contacting the cell with an days (e.g., for 2-14 days, e.g., for 2, 3, 4, 5, 6, or 7 days). In iRNA (e.g. a dsRNA), as described herein, in an amount embodiments, the iRNA is subsequently administered once effective to decrease the level of the porphyrin or the porphy per week. In embodiments, the iRNA is subsequently admin rin precursor in the cell. istered once every two weeks. In embodiments, the iRNA is 0232. In embodiments, the cell is a hepatocyte. In embodi Subsequently administered at a frequency that is effective to ments, the porphyrin or porphyrin precursor is 6-aminole reduce one or more signs or symptoms of a porphyria. Vulinic acid (ALA), porphopilinogen (PBG), hydroxymeth 0224. In one aspect provided herein is a method of treating ylbilane (HMB), uroporphyrinogen I or III, a subject with an elevated level of ALA and/or PBG, the coproporphyrinogen I or III, protoporphrinogen IX, or pro method comprising administering to the Subject a double toporphyrin IX. In embodiments, the porphyrin precursor is stranded ribonucleic acid (dsRNA), wherein said dsRNA ALA or PBG. comprises a sense Strand and an antisense strand 15-30 base 0233. In one embodiment, the cell is an erythroid cell. In a pairs in length and the antisense strand is complementary to at further embodiment, the cell is a liver cell (e.g., a hepatocyte). least 15 contiguous nucleotides of SEQID NO:1 or SEQ ID 0234. In an aspect provided herein is a vector encoding at NO:382. least one strand of an iRNA (e.g., a dsRNA) as described 0225. In one aspect provided herein is a method of treating herein. a subject with an elevated level of ALA and/or PBG, the 0235. In an aspect provided herein is a vector encoding at method comprising administering to the Subject a therapeu least one strand of a dsRNA, wherein said dsRNA comprises tically effective amount of an dsRNA or a composition com a region of complementarity to at least a part of an mRNA prising a dsRNA, as described herein. encoding ALAS1, wherein said dsRNA is 30 base pairs or less 0226. In some embodiments, the methods described in length, and wherein said dsRNA targets said mRNA for herein are effective to decrease the level of ALA and/or PBG. cleavage. In some embodiments, the level of ALA and/or PBG is 0236. In embodiments, the region of complementarity is at decreased such that it is less than, or less than or equal to, a least 15 nucleotides in length. reference value, e.g., an upper reference limit. 0237. In embodiments, the region of complementarity is 0227. In embodiments, the subject to be treated is asymp 19 to 21 nucleotides in length. In one aspect, the invention tomatic and has an elevated level of ALA and/or PBG. In provides a vector for inhibiting the expression of an ALAS1 embodiments, the Subject has a porphyria, e.g., AIP. gene in a cell. In one embodiment, the vector comprises an US 2016/0244766 A1 Aug. 25, 2016

iRNA as described herein. In one embodiment, the vector 0247 All publications, patent applications, patents, and includes at least one regulatory sequence operably linked to a other references mentioned herein are incorporated by refer nucleotide sequence that encodes at least one strand of an ence in their entirety. iRNA as described herein. In one embodiment the vector 0248. The details of various embodiments of the invention comprises at least one strand of an ALAS1 iRNA. are set forth in the description below. Other features, objects, 0238. In an aspect provided herein is a cell comprising a and advantages of the invention will be apparent from the vector as described herein. In an aspect provided herein is a description and the drawings, and from the claims. cell containing a vector for inhibiting the expression of an ALAS1 gene in a cell. The vector includes a regulatory DESCRIPTION OF THE DRAWINGS sequence operably linked to a nucleotide sequence that encodes at least one strand of one of the iRNAs as described 0249 FIG. 1 depicts the heme biosynthetic pathway. herein. In one embodiment, the cell is a liver cell (e.g., a (0250 FIG. 2A and FIG. 2B show a table summarizing hepatocyte). In another embodiment, the cell is an erythroid certain porphyrias associated with genetic errors in heme cell. metabolism. (0251 FIG. 3A and FIG. 3B depict a human ALAS1 0239. In another aspect, a method is provided for assaying mRNA sequence transcript (Ref. Seq. NM 000688.4 (GI: the level of circulating extracellular ALAS1 mRNA in a sub ject, said method comprising detecting (e.g., measuring) the 40316942, record dated Nov. 19, 2011), SEQID NO: 1). level of ALAS1 mRNA in a biological fluid sample (e.g., a (0252 FIG. 4A and FIG. 4B depict a human ALAS1 blood sample (e.g., a serum or plasma sample), a cerebrospi mRNA sequence transcript (Ref. Seq. NM 000688.5 (GI: nal fluid sample, or a urine from the Subject, said biological 362999011, record dated Apr. 1, 2012), SEQID NO:382). fluid sample comprising the ALAS1 mRNA, thereby assay (0253 FIG. 5 shows the dose-response of the siRNA ing the level of circulating extracellular ALAS1 mRNA in the AD-53558 in suppressing mouse ALAS1 (mALAS1) mRNA Subject. relative to a PBS control. Results for a luciferase (LUC) AD-1955 control are also shown. 0240. In another aspect, a method is provided for assaying 0254 FIG. 6 shows the dose-response of the siRNA the level of circulating extracellular ALAS1 mRNA in a sub ject, said method comprising (i) providing RNA (e.g., extra AD-53558 in suppressing ALAS1 mRNA in rats relative to a cellular RNA) from a biological fluid sample (e.g., blood or PBS control. Results for a luciferase (LUC) AD-1955 control plasma sample) from the Subject, said biological fluid sample are also shown. comprising the ALAS1 mRNA; (ii) obtaining an ALAS1 0255 FIG. 7 shows the durability of suppression of mouse cDNA from the ALAS1 mRNA; (iii) contacting the ALAS1 ALAS1 (mALAS1) mRNA by the siRNAAD-53558 relative cDNA with a nucleic acid complementary (e.g., probe and/or to a PBS control. primer) to the ALAS1 cDNA or a portion thereof, thereby 0256 FIG. 8 shows meansistandard deviations of plasma producing a reaction mix; and (iv) detecting (e.g., measuring) ALA levels (inuM) at baseline, and after phenobarbital treat the level of ALAS1 cDNA in the reaction mix, wherein the ment in the experimental (ALAS1 siRNA) and control (LUC ALAS1 cDNA level is indicative of the ALAS1 mRNA level, siRNA) groups. thereby assaying the level of circulating extracellular ALAS1 (0257 FIG. 9 shows the plasma ALA levels (in uM) of mRNA in the subject. individual animals at baseline, and after phenobarbital treat 0241. In embodiments, said biological fluid sample is a ment in animals that received ALAS1 siRNA and control blood sample. In embodiments, said biological fluid sample is (LUC siRNA) treatment. a serum sample. In embodiments, said biological fluid sample 0258 FIG. 10 shows meansistandard deviations of plasma PBG levels (in LM) at baseline, and after phenobar is a urine sample. bital treatment in animals that received ALAS1 siRNA and 0242. In embodiments, the method comprises PCR, qPCR control (LUC siRNA) treatment. or 5'-RACE (0259 FIG. 11 shows the plasma PBG levels (in uM) of 0243 In embodiments, said nucleic acid is a probe or individual animals at baseline, and after phenobarbital treat primer. ment in animals that received ALAS1 siRNA and control 0244. In embodiments, said nucleic acid comprises a (LUC siRNA) treatment. detectable moiety and the level of ALAS1 mRNA is deter 0260 FIG. 12 shows the relative mALAS1mRNA level in mined by detection of the amount of the detectable moiety. liver at baseline, and after phenobarbital treatment in select 0245. In embodiments, said method further comprises representative experimental (ALAS1 siRNA) and control obtaining the biological fluid sample from the subject. In (PBS) animals. embodiments, the biological fluid sample is separate from the 0261 FIG. 13 shows the effects of three GalNAc conju tissue and contains exosomes. In embodiments of these meth gated mALAS1 siRNAs on mALAS1 expression (relative to ods, the efficacy of a porphyria treatment is assessed based on a PBS control) in mouse liver tissue. a comparison of the level of circulating extracellular ALAS1 0262 FIG. 14 shows plasma ALA and PBG levels over mRNA in the subject relative to a reference value. time after phenobarbital administration and treatment with 0246. In embodiments, a decrease in the level of circulat ALAS1 siRNA or control LUC siRNA. ing extracellular ALAS1 mRNA in the subject in response to 0263 FIG. 15 shows the effects of a GalNAc conjugated the porphyria treatment, relative to the reference value, indi ALAS1 siRNA on plasma ALA and plasma PBG levels in the cates that the porphyria treatment is efficacious. In embodi mouse AIP phenobarbital induction model. ments, the reference value is the level of circulating extracel 0264 FIG.16 shows dose-dependent effects of an ALAS1 lular ALAS1 mRNA in the subject prior to the porphyria siRNA on plasma ALA and PBG levels in the mouse AIP treatment. phenobarbital induction model. For the animals that received US 2016/0244766 A1 Aug. 25, 2016

ALAS1 siRNA, the dose of siRNA administered (0.05 mg/kg, 0279 FIG.31 shows a comparison of the mRNA suppres 0.1 mg/kg, 0.5 mg/kg, or 1.0 mg/kg) is shown on the horizon sion results obtained from liver biopsies and from the ceRD tal axis. assay in a non-human primate study. 0265 FIG. 17, top panel shows the experimental design 0280 FIG. 32 shows the time course of suppression of used to study suppression of ALA and PBG with an ALAS1 mRNA as assessed using the cFRD assay in a non-human siRNA. The bottom panel shows the plasma ALA and PBG primate study. The horizontal axis shows the time according levels at baseline, in the control (Luc) condition, and follow to the study day. ing treatment with an ALAS1 siRNA at week 0, week 2, and (0281 FIG.33 shows the suppression of ALAS1 mRNA in week 4. rats that received PBS or a single dose of 5 mg/kg of one of the 0266 FIG. 18 shows the experimental design used to com indicated siRNA duplexes. pare the effects of treatment with ALAS1 siRNA or hemin in 0282 FIG.34 shows the liver concentrations of the siRNA an animal model of AIP (top) and the results for plasma ALA in rats that received a single dose of 5 mg/kg of the indicated (umol/L) levels (middle) and plasma PBG (umol/L) levels siRNA. (bottom). 0283 FIG.35 (top) shows the experimental design used to 0267 FIG. 19 shows relative mRNA levels (ALAS1/ investigate the therapeutic efficacy of AD-60925 and GAPDH) in animals treated with 30 mg/kg, 10 mg/kg, or 3 AD-60926. FIG. 35(bottom) shows the relative levels of rat mg/kg of AD-58632 compared with animals treated with PBS ALAS1/GAPDH mRNA in rats treated with (1) AF11 control. PBGD, (2) AF 11-PBGD and PB, (3) AF-11PBGD, PB, and 3 0268 FIG. 20 shows the experimental design used to mg/kg. AD-60925, or (4) AF11-PBGD, PB, and AD-60926. investigate the dose response effect of the AD-58632 ALAS1 (0284 FIG. 36 shows the relative levels of urine PBG (top) GalNAc conjugate in a rat AIP model. and urine ALA (bottom) in rats treated with (1) AF 11-PBGD, 0269 FIG.21 shows relative levels of liver PBGD mRNA (2) AF11-PBGD and PB, (3) AF-11PBGD, PB, and 3 mg/kg (top graph) and relative levels of liver ALAS1 mRNA (bottom AD-60925, or (4) AF 11-PBGD, PB, and AD-60926. graph) in a rat model of AIP. Groups of animals were sub (0285 FIG.37 shows the relative levels of urine PBG (top) jected to one of four treatments: (1) phenobarbital (PB) treat and urine ALA (bottom) over time in rats treated with (1) ment only, (2) phenobarbital and porphobilinogen deaminase AF11-PBGD, (2)AF11-PBGD and PB, (3) AF-11PBGD, PB, (PBGD) siRNA treatment, (3) phenobarbital, PBGD siRNA, and 3 mg/kg. AD-60925, or (4) AF11-PBGD, PB, and and 30 mg/kg of ALAS1 siRNA, (4) phenobarbital, PBGD AD-60926. The arrows indicate the timepoints when PB was siRNA, and 10 mg/kg of ALAS1 siRNA. administered. (0270 FIG. 22 shows urinary PBG (top panel) and ALA 0286 FIG. 38 shows the relative levels of rat ALAS1 (bottom panel) levels relative to creatinine levels in a rat (rALAS1) mRNA in rats that received 4 doses of PBS or 2.5 model of AIP. Groups of animals were subjected to one of four mg/kg of one of the indicated siRNAs. treatments: (1) phenobarbital (PB) treatment only, (2) phe 0287 FIG. 39 shows the relative levels of rat ALAS1 nobarbital and porphobilinogen deaminase (PBGD) siRNA (raLAS1) mRNA in rats that received a single dose of PBS or treatment, (3) phenobarbital, PBGD siRNA, and 30 mg/kg of 2.5 mg/kg of one of the indicated siRNAs. ALAS1 siRNA, (4) phenobarbital, PBGD siRNA, and 10 (0288 FIG. 40 (top) shows the relative levels of rat ALAS1 mg/kg of ALAS1 siRNA. (raLAS1) mRNA in rats that received a single dose of PBS or (0271 FIG. 23 shows the suppression of ALAS-1 mRNA 3 mg/kg of one of the indicated siRNAs. FIG. 40 (bottom) by AD-58632, compared with PBS control, in groups of rats shows the concentration of siRNA in liver. that received five daily doses of siRNA at 6 mg/kg, 2 mg/kg, 0289 FIG. 41 (top) shows the suppression of rat ALAS1 or 1 mg/kg versus single bolus doses of siRNA at 30 mg/kg, (rALAS1) mRNA by AD-60489, AD-60519, and AD-60901. 10 mg/kg, or 5 mg/kg. FIG. 41 (bottom) shows the concentration of siRNA in liver. (0272 FIG. 24 shows the suppression of ALAS-1 mRNA 0290 FIG. 42 shows the relative levels of rat ALAS1 by AD-58632, compared with PBS control, in groups of rats (raLAS1) mRNA in rats that were treated with a single dose that received four weekly doses of siRNA at 10 mg/kg, 5 of PBS or 2.5 mg/kg of one of the indicated siRNAs. mg/kg, or 2.5 mg/kg. 0291 FIG. 43 shows the relative levels of rat ALAS1 (0273 FIG. 25 shows the suppression of ALAS-1 mRNA (rALAS1) mRNA in rats that were treated with PBS or one of by AD-58632 and by five 19/19mer duplexes. the indicated siRNAs at a dose of 2.5 mg/kg twice per week 0274 FIG. 26 shows the results of an evaluation of the for 2 weeks. effect of strand length and overhangs on the best two 19mers. 0292 FIG. 44 (top) shows a schematic of the experimental (0275 FIG. 27 is a graph that shows the levels of ALAS1 design used to investigate the therapeutic efficacy of multiple mRNA in liver (left bars) and in serum (right bars) for each biweekly doses of AD-60519. FIG. 44 (bottom) shows graphs treatment group in the NHP study described in Example 34. depicting the suppression of urine PBG and urine ALA in rats (0276 FIG. 28 shows the suppression of ALAS-1 mRNA, that were treated with (i) PBGD siRNA and six doses of PBS, compared with PBS control, in groups of rats that received 3 (ii) PBGD siRNA, PB, and six doses of PBS, (iii) PBGD mg/kg or 10 mg/kg of AD-58632 or AD-60489. siRNA, PB, and six doses of 2.5 mg/kg. AD-60519, or (iv) 0277 FIG. 29 shows the experimental design used to PBGD siRNA, PB, and six doses of 5 mg/kg. AD-60519. investigate the effectiveness of ALAS1 siRNAs AD-58632 0293 FIG. 45 shows graphs depicting the suppression of and AD-60489 in suppressing liver mRNA in non-human serum PBG (upper graph) and serum ALA (lower graph) in a primates. mouse AIP model that were treated with (i) PBGD siRNA and 0278 FIG. 30 shows the dose-dependent suppression of six doses of PBS (Baseline), (ii) PBGD siRNA, PB, and six liver mRNA in non-human primates following treatment with doses of PBS (Saline), (iii) PBGD siRNA, PB, and six doses 1.25 mg/kg, 2.5 mg/kg, or 5 mg/kg of AD-58632 or of 2.5 mg/kg. AD-60519, or (iv) PBGD siRNA, PB, and six AD-60489. doses of 5 mg/kg. AD-60519. US 2016/0244766 A1 Aug. 25, 2016

0294 FIG.46 (top) shows a schematic of the experimental levels in serum or urine were measured using the ceRD design used to investigate the therapeutic efficacy of multiple method. In AIP patients A and B, a second set of serum and weekly doses of AD-60519. FIG. 46 (bottom) shows a graph urine samples were collected to access ALAS1 mRNA vari depicting the relative levels of rat ALAS1 mRNA (raLAS1/ ability over time. GAPDH) in rats that were treated with (i) PBGD siRNA and four doses of PBS, (ii) PBGD siRNA, PB, and four doses of DETAILED DESCRIPTION OF THE INVENTION PBS, (iii) PBGD siRNA, PB, and four doses of 3 mg/kg 0307 iRNA directs the sequence-specific degradation of AD-60519, (iv) PBGD siRNA, PB, and four doses of 1 mg/kg mRNA through a process known as RNA interference AD-60519, or (v) PBGD siRNA, PB, and four doses of 0.3 (RNAi). Described herein are iRNAs and methods of using mg/kg. AD-60519. them for inhibiting the expression of an ALAS1 gene in a cell 0295 FIG. 47 shows graphs depicting the levels of urine or a mammal where the iRNA targets an ALAS1 gene. Also PBG (upper graph) and urine ALA (lower graph) in rats that provided are compositions and methods for disorders related were treated with (i) PBGD siRNA and four doses of PBS, (ii) to ALAS1 expression, such as porphyrias (e.g., ALA deyh PBGD siRNA, PB, and four doses of PBS, (iii) PBGD siRNA, dratase deficiency porphyria (ADP or Doss porphyria), acute PB, and four doses of 3 mg/kg. AD-60519, (iv) PBGD siRNA, intermittent porphyria, congenital erythropoietic porphyria, PB, and four doses of 1 mg/kg. AD-60519, or (v) PBGD prophyria cutanea tarda, hereditary coproporphyria (copro siRNA, PB, and four doses of 0.3 mg/kg. AD-60519. porphyria), variegate porphyria, erythropoietic protoporphy 0296 FIG. 48 is a schematic that shows the design of a ria (EPP), X-linked sideroblastic anemia (XLSA), and tran non-human primate study in which effects of ALAS1 siRNA sient erythroporphyria of infancy). GalNAc conjugates in suppressing liver ALAS1 mRNA and 0308 Porphyrias are inherited or acquired disorders that circulating ALAS1 mRNA were investigated can be caused by decreased or enhanced activity of specific 0297 FIG. 49 is a graph that shows suppression of liver enzymes in the heme biosynthetic pathway, also referred to mRNA in non-human primates (NHPs) following treatment herein as the porphyrin pathway (See FIG. 1). Porphyrins are with ALAS1 siRNA GalNAc conjugates. the main precursors of heme. Porphyrins and porphyrin pre 0298 FIG.50 is a graph that shows the normalized serum cursors include Ö-aminolevulinic acid (ALA), porphopilino levels of ALAS1 mRNA in non-human primates (NHPs) at gen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen various times during the course of a study in which effects of I or III, coproporphyrinogen I or III, protoporphrinogen IX, treatment with ALAS1 siRNA GalNAc conjugates was inves and protoporphyrin IX. Heme is an essential part of hemo tigated. The days on the horizontal axis correspond to the days globin, myoglobin, catalases, peroxidases, and cytochromes, in the schematic in FIG. 48. the latter including the respiratory and P450 liver cyto 0299 FIG.51 shows the normalized ALAS1 mRNA levels chromes. Heme is synthesized in most or all human cells. (shown as a fraction of the pre-dose level) as assessed in a rat About 85% of heme is made in erythroid cells, primarily for single dose study that used urine chERD to monitor ALAS1 hemoglobin. Most of the remaining heme is made in the liver, Suppression. 80% of which is used for the synthesis of cytochromes. Defi 0300 FIG. 52 is a schematic that shows the design of a ciency of specific enzymes in the porphyrin pathway leads to non-human primate study in which multidose and single dose insufficient heme production and also to an accumulation of effects of AD-60519 in suppressing liver ALAS1 mRNA and porphyrin precursors and/orporphyrins, which can be toxic to circulating ALAS1 mRNA were investigated. cell or organ function in high concentrations. 0301 FIG.53 is a bar graph that shows the average relative 0309 Porphyrias may manifest with neurological compli liver ALAS1 mRNA levels (% of PBS control) at study day 24 cations (“acute), skin problems (“cutaneous') or both. Por (multidose groups) or at study day 4 (single dose groups). phyrias may be classified by the primary site of the overpro 0302 FIG. 54 is a graph that shows normalized serum duction and accumulation of porphyrins or their precursors. ALAS1 mRNA levels (shown as a fraction of the pre-dose In hepatic porphyrias, porphyrins and porphyrin precursors level) as assessed using cFRD for the multidose groups (top are overproduced predominantly in the liver, whereas in graph, showing results up to day 24) and single dose groups erythropoietic porphyrias, porphyrins are overproduced in (bottom graph, showing results up to day 22). the erythroid cells in the bone. The acute or hepatic porphy 0303 FIG.55 is agraph that shows the liver mRNA, serum rias lead to dysfunction of the nervous system and neurologic mRNA, and urine mRNA levels at study day 4 (in the single manifestations that can affect both the central and peripheral dose groups) or at Study day 24 (in the multidose groups). nervous system, resulting in Symptoms such as, for example, Data for individual animals and the averages for each group pain (e.g., abdominal pain and/or chronic neuropathic pain), are shown. Vomiting, neuropathy (e.g., acute neuropathy, progressive 0304 FIG. 56 is a graph that shows normalized serum neuropathy), muscle weakness, seizures, mental disturbances ALAS1 mRNA levels (shown as a fraction of the pre-dose (e.g., hallucinations, depression anxiety, paranoia), cardiac level) after 8 weeks as assessed using chERD for the multidose arrhythmias, tachycardia, constipation, and diarrhea. The groups. Each graphical data point represents the remaining cutaneous or erythropoietic porphyrias primarily affect the ALAS1 mRNA for the group average of 3 animal skin, causing symptoms Such as photosensitivity that can be samples:the standard deviation of the group. painful, blisters, necrosis, itching, Swelling, and increased 0305 FIG. 57 is a schematic of the structure of ALN hair growth on areas Such as the forehead. Subsequent infec 60519 (also referred to herein as AD-60519). FIG. 57 dis tion of skin lesions can lead to bone and tissue loss, as well as closes SEQ ID NOS 5238-5239, respectively, in order of scarring, disfigurement, and loss of digits (e.g., fingers, toes). appearance. Most porphyrias are caused by mutations that encode 0306 FIG. 58 shows ALAS1 mRNA levels as assessed in enzymes in the heme biosynthetic pathway. A Summary of matching serum or urine samples obtained from either AIP porphyrias associated with genetic errors in heme metabo patients or normal healthy volunteers (NHV). ALAS1 mRNA lism is provided in FIG. 2. US 2016/0244766 A1 Aug. 25, 2016 20

0310. Notall porphyrias are genetic. For example, patients severe and poorly localized abdominal pain, nausea/vomit with liver disease may develop porphyria as a result of liver ing, constipation, diarrhea, ileus), urinary symptoms (dys dysfunction, and a transient form of erythroporphria (tran uria, urinary retention/incontinence, or dark urine, e.g., dark sient erythroporphyria of infancy) has been described in red urine), neurologic symptoms (e.g., sensory neuropathy, infancy (see Crawford, R.I. et al. JAm Acad Dermatol. 1995 motor neuropathy (e.g., affecting the cranial nerves and/or August; 33(2 Pt 2):333-6.) Patients with PCT can acquire the leading to weakness in the arms or legs), seizures, neuro deficient activity of uroporphyrinogen decarboxylase (URO pathic pain (e.g., pain associated with progressive neuropa D), due to the formation of a ORO-D enzyme with lower than thy, e.g., chronic neuropathic pain), neuropsychiatric Symp normal enzymatic activity (see Phillips et al. Blood, 98:3179 toms (e.g., mental confusion, anxiety, agitation, 3185, 2001.) hallucination, hysteria, delirium, apathy, depression, phobias, 0311. Acute intermittent porphyria (AIP) (also be referred psychosis, insomnia, Somnolence, coma), autonomic nervous to as porphobilinogen (PBG) deaminase deficiency, or system involvement (resulting e.g., in cardiovascular sySmp hydroxymethylbilane synthase (HMBS) deficiency), is the toms such as tachycardia, hypertension, and/or arrhythmias, most common type of acute hepatic porphyria. Other types of as well as other symptoms. Such as, e.g., increased circulating acute hepatic porphyrias include hereditary coproporphyria catecholamine levels, Sweating, restlessness, and/or tremor), (HCP), variegate porphyria (VP), and ALA deyhdratase defi dehydration, and electrolyte abnormalities. The most com ciency porphyria (ADP). Acute hepatic porphyrias are mon symptoms are abdominal pain and tachycardia. Neuro described, e.g., in Balwani, M and Desnick, R. J. Blood, logical manifestations include motor and autonomic neur 120:4496-4504, 2012. opathy and seizures. Patients frequently have chronic 0312 AIP is typically an autosomal dominant disease that neuropathic pain and develop a progressive neuropathy. is characterized by a deficiency of the enzyme porphobilino Patients with recurring attacks often have a prodrome. Per gen deaminase (PBG deaminase); this enzyme is also known manent paralysis may occur after a severe attack. Recovery as hydroxymethylbilane synthase (HMB synthase or from severe attacks that are not promptly treated may take HMBS). PBG deaminase is the third enzyme of the heme weeks or months. An acute attack may be fatal, for example, biosynthetic pathway (see FIG. 1) and catalyzes the head to due to paralysis of respiratory muscles or cardiovascular fail tail condensation of four porphobilinogen molecules into the ure from electrolyte imbalance. (See, e.g., Thunell S. linear tetrapyrrole, hydroxymethylbilane (HMB). Alterna Hydroxymethylbilane Synthase Deficiency. 2005 Sep. 27 tively spliced transcript variants encoding different isoforms Updated 2011 Sep. 1. In: Pagon RA, Bird TD, Dolan CR, of PBG deaminase have been described. Mutations in the et al., editors. GeneReviewsTM Internet. Seattle (Wash.): PBG deaminase gene are associated with AIP. Such mutations University of Washington, Seattle: 1993—(hereinafter may lead to decreased amounts of PBG deaminase and/or Thunell (1993)), which is hereby incorporated by reference in decreased activity of PBG deaminase (affected individuals its entirety.) Prior to the availability of Hemin treatments, up typically have a ~50% reduction in PBG deaminase activity). to 20% of patients with AIP died from the disease. 0313 There are at least two different models of the patho 0316. In individuals who carry genes for AIP, the risk of physiology of AIP and other acute hepatic porphyrias (see, hepatocellular cancer is increased. In those with recurrent e.g., Lin C S-Y et al., Clinical Neurophysiology, 2011: 122: attacks, the risk of hepatocellular cancer is particularly grave: 2336-44). According to one model, the decreased heme pro after the age of 50, the risk is nearly 100-fold greater than in duction resulting from PBG deaminase deficiency causes the general population. energy failure and axonal degeneration. According to the 0317. Attacks of acute porphyria may be precipitated by other, currently more favored model, the buildup of porphyrin endogenous or exogenous factors. The mechanisms by which precursors (e.g., ALA and PBG) results in neurotoxicity. Such factors induce attacks may include, for example, 0314 AIP has been found to have a prevalence as high as increased demand for hepatic P450 enzymes and/or induction 1 in 10,000 in certain populations (e.g., in Northern Sweden; of ALAS1 activity in the liver. Increased demand for hepatic see Floderus Y, et al. Clin Genet. 2002: 62:288-97). The P450 enzymes results in decreased hepatic freeheme, thereby prevalence in the general population in United States and inducing the synthesis of hepatic ALAS1. Europe, excluding the U.K., is estimated to be about 1 in 0318 Precipitating factors include fasting (or other forms 10,000 to 1 in 20,000. Clinical disease manifests itself in only of reduced or inadequate caloric intake, due to crash diets, approximately 10-15% of individuals who carry mutations long-distance athletics, etc.), metabolic stresses (e.g., infec that are known to be associated with AIP. However, the pen tions, Surgery, international air travel, and psychological etrance is as high as 40% in individuals with certain mutations stress), endogenous hormones (e.g., progesterone), cigarette (e.g., the W198X mutation). AIP is typically latent prior to Smoking, lipid-soluble foreign chemicals (including, e.g., puberty. Symptoms are more common in females than in chemicals present in tobacco Smoke, certain prescription males. The prevalence of the disease is probably underesti drugs, organic solvents, biocides, components in alcoholic mated due to its incomplete penetrance and long periods of beverages), endocrine factors (e.g., reproductive hormones latency. In the United States, it is estimated that there are (women may experience exacerbations during the premen about 2000 patients who have suffered at least one attack. It is strual period), synthetic estrogens, progesterones, ovulation estimated that there are about 150 active recurrent cases in stimulants, and hormone replacement therapy). See, for France, Sweden, the U.K., and Poland; these patients are example, Thunell (1993). predominantly young women, with a median age of 30. See, 0319. Over 1000 drugs are contraindicated in the acute e.g., Elder et al., J. Inherit Metab Dis., published online Nov. 1, hepatic porphyrias (e.g., AIP, HCP, ADP, and VP) including, 2012. for example, alcohol, barbiturates, Carbamazepine, Cariso 0315 AIP affects, for example, the visceral, peripheral, prodol, Clonazepam (high doses), Danazol, Diclofenac and autonomic, and central nervous systems. Symptoms of AIP possibly other NSAIDS, Ergots, estrogens, Ethyclorvynol, are variable and include gastrointestinal symptoms (e.g., Glutethimide, Griseofulvin, Mephenytoin, Meprobamate US 2016/0244766 A1 Aug. 25, 2016

(also mebutamate and tybutamate), Methyprylon, Ö-aminolevulinic acid (ALA) synthase, the enzyme which Metodopramide, Phenytoin, Primidone, progesterone and limits the rate of the porphyrin/heme biosynthetic pathway. synthetic progestins, Pyrazinamide, Pyrazolones (aminopy See PanhematinR product label, Lundbeck, Inc., October rine and antipyrine), Rifampin, Succinimides (ethoSuximide 2010. Inhibition of ALA synthase should result in reduced and methSuximide), Sulfonamide antibiotics, and Valproic production of ALA and PBG as well as porphyrins and por acid. phyrin intermediates. 0320 Objective signs of AIP include discoloration of the 0324 Drawbacks of heme products (e.g., hemin) include urine during an acute attack (the urine may appear red or delayed impact on clinical symptoms and failure to prevent red-brown), and increased concentrations of PBG and ALA in the recurrence of attacks. Adverse reactions associated with urine during an acute attack. Molecular genetic testing iden heme (e.g., hemin) administration may include phlebitis (e.g., tifies mutations in the PBG deaminase (also known as thrombophlebitis), difficulty with venous access, anticoagul HMBS) gene in more than 98% of affected individuals. lation (or coagulopathies), thrombocytopenia, renal shut Thunell (1993). down, or iron overload, which is particularly likely in patients 0321 Diagnosis of porphria can involve assessment of requiring multiple courses of hemin treatment for recurrent family history, assessment of porphyrin precursor levels in attacks. To prevent phlebitis, an indwelling venous catheter is urine, blood, or stool, and/or assessment of enzyme activity needed for access in patients with recurrent attacks. Renal and DNA mutation analysis. The differential diagnosis of damage can occur with high doses. Uncommonly reported porphyrias may involve determining the type of porphyria by side effects include fever, aching, malaise, hemolysis, measuring individual levels of porphyrins or porphyrin pre anaphalaxis, and circulatory collapse. See Anderson, K. E., cursors (e.g., ALA, PBG) in the urine, feces, and/or plasma Approaches to Treatment and Prevention of Human Porphy (e.g., by chromatography and fluorometry) during an attack. rias, in The Porphyrin Handbook: Medical Aspects of Por The diagnosis of AIP can be confirmed by establishing that phyrins, Edited by Karl M. Kadish, Kevin M. Smith, Roger erythrocyte PBG deaminase activity is at 50% or less of the Guilard (2003) (hereinafter Anderson). normal level. DNA testing for mutations may be carried out in 0325 Heme is difficult to prepare in a stable form for patients and at-risk family members. The diagnosis of AIP is intravenous administration. It is insoluble at neutral pH but typically confirmed by DNA testing to identify a specific can be prepared as heme hydroxide at pH 8 or higher. Ander caustative gene mutation (e.g., an HMBS mutation). son. Panhematin is a lyophilized hemin preparation. When 0322 Current management of acute attacks of AIP lyophilized hemin is solubilized for intravenous administra involves hospitalization, monitoring of symptoms, and tion, degradation products form rapidly; these degradation removal of unsafe drugs. Treatment of acute attacks typically products are responsible for a transient anticoagulant effect requires hospitalization to control and treat acute sySmptoms, and for phlebitis at the site of infusion. Anderson. Heme including, e.g., abdominal pain, seizures, dehydration/hy albumin and heme arginate (Normosang, the European Ver ponatremia, nausea/vomiting, tachycardia/hypertension, uri sion of hemin) are more stable and may potentially cause less nary retention/ileus. For example, abdominal pain may be thrombophlebitis. However, heme arginate is not approved treated, e.g., with narcotic analgesics, seizures may be treated for use in the United States. Panhemin may be stabilized by with seizure precautions and possibly medications (although solubilizing it for infusion in 30% human albumin rather than many anti-seizure medications are contraindicated), nausea/ insterile water; however, albumin adds intravascular volume Vomiting may be treated, e.g., with phenothiazines, and expanding effects and increases the cost of treatment as well tachycardia/hypertension may be treated, e.g., with beta as risk of pathogens since it is isolated from human blood. blockers. Treatment may include withdrawal of unsafe medi See, e.g., Anderson Supra. cations, monitoring of respiratory function, as well as muscle 0326. The successful treatment of an acute attack does not strength and neurological status. Mild attacks (e.g., those prevent or delay recurrence. There is a question of whether with no paresis or hyponatremia) may be treated with at least hemin itself can trigger recurring attacks due to induction of 300 g intravenous 10% glucose per day, although increas heme oxygenase. Nonetheless, in some areas (especially ingly heminis provided immediately. Severe attacks are typi France), young women with multiply recurrent attacks are cally treated as soon as possible with intravenous hemin (3-4 being treated with weekly hemin with the goal of achieving mg/kg daily for 4-14 days) and with IV glucose while waiting prophylaxis. Limited experience with liver transplantation for the IV hemin to take effect. Typically, attacks are treated suggests that if successful, it is an effective treatment for AIP. with IV hemin for 4 days and with IV glucose while waiting There have been approximately 12 transplants in Europe in for administration of the IV hemin. Within 3-4 days following human patients, with curative or varying effects. Liver trans the start of hemin administration, there is usually clinical plantation can restore normal excretion of ALA and PBG and improvement accompanying by lowering of ALA and PBG prevent acute attacks. See, e.g., Dar, F. S. et al. Hepatobiliary levels. Pancreat. Dis. Int., 9(1):93-96 (2010). Furthermore, if the 0323 Hemin (Panhematin R) or hemin for injection, previ liver of a patient with AIP is transplanted into another patient ously known as hematin) is the only heme product approved (“domino transplant'), the patient receiving the transplant for use in the United States and was the first drug approved may develop AIP. Among the long-term clinical effects of under the Orphan Drug Act. PanhematinR) is hemin derived acute porphyrias is chronic neuropathic pain that may result from processed red blood cells (PRBCs), and is Protoporphy from a progressive neuropathy due to neurotoxic effects, e.g., rin IX containing a ferric iron ion (Heme B) with a chloride of elevated porphyrin precursors (e.g., ALA and/or PBG). ligand. Heme acts to limit the hepatic and/or marrow synthe The neurotoxic effects can be associated with toxic heme sis of porphyrin. The exact mechanism by which hemin pro intermediate production, for example, altered GABA signal duces symptomatic improvement in patients with acute epi ing and/or production of iron-mediated oxidation and reactive sodes of the hepatic porphyrias has not been elucidated; oxygen species (ROS). Patients may suffer from neuropathic however, its action is likely due to the (feedback) inhibition of pain prior to or during an acute attack. Older patients may US 2016/0244766 A1 Aug. 25, 2016 22 experience increased neuropathic pain with age for which the effects of heme (e.g., hemin) and its poor tolerability slow various narcotic drugs are typically prescribed. Electromyo the time to improvement. Persistence of severe abdominal gram abnormalities and decreased conduction times have pain, even after administration of heme, can require that been documented in patients with acute hepatic porphyrias. patients receive opiates for multiple days. Of note, untreated, uninduced mice with AIP (PBG deami 0329 Delayed administration of heme or continued expo nase deficiency) develop a progressive motor neuropathy that Sure to precipitating factors can lead to more serious compli has been shown to cause progressive quadriceps nerve axon cations, including motor neuropathy and accompanying degeneration and loss presumably due to constitutively symptoms (e.g., weakness, paresis). Respiratory failure and elevated porphyrin precursor (ALA & PBG) levels, porphy paralysis can occur in severe cases. Recovery from neurologi rins and/or heme deficiency (Lindberg et al., J. Clin. Invest. cal symptoms can take much longer to resolve. Accordingly, 103(8): 1127-1134, 1999). In patients with acute porphyria in the context of acute attacks, treatments that have a faster (e.g., ADP, AIP, HCP, or VP), levels of porphyrin precursors onset of action and better tolerability are needed. Pharmaco (ALA & PBG) are often elevated in asymptomatic patients logical validation of ALAS1 as a target for mRNA silencing is and in symptomatic patients between attacks. Thus, reduction supported by at least the following findings: ALAS1 mRNA of the porphyrin precursors and resumption of normal heme is strongly upregulated during an attack; panhematin down biosynthesis by reducing the level of ALAS1 expression and/ modulates ALAS-1; and addition of heme to liver cells in or activity is expected to prevent and/or minimize develop culture leads to reduced ALAS-1 mRNA. Several findings ment of chronic and progressive neuropathy. Treatment, e.g., also indicate that suppression of ALAS1 mRNA can be chronic treatment (e.g., periodic treatment with iERNA as achieved by targeting the liver. For example, liver transplant described herein, e.g., treatment according to a dosing regi has been shown to be curative; and liver derived metabolites men as described herein, e.g., weekly or biweekly treatment) drive attacks (see e.g., Dar et al. Hepatobiliary Pancreat Dis can continuously reduce the ALAS1 expression in acute por Int. 9:93-6 (2010): Dowman et al. Ann Intern Med 154:571-2 phyria patients who have elevated levels of porphyrin precur (2011); and Wu et al. Genes Dev 23:2201-2209 (2009). Thus, sors, porphyrins, porphyrin products or their metabolites. reducing expression of ALAS1, e.g., in the liver, using iRNA Such treatment may be provided as needed to prevent or compositions can be used to treat a porphyria. In certain reduce the frequency or severity of an individual patients embodiments, iRNA compositions can be used for prophy symptoms (e.g., pain and/or neuropathy) and/or to reduce a laxis and acute treatment of porphyrias. For example, iRNA level of a porphyrin precursor, porphyrin, porphyrin product compositions can be used prophylactically in a recurrent or metabolite. attack setting to induce long-term or chronic suppression of 0327. The need exists for identifying novel therapeutics ALAS1 expression (leading to long-term or chronic Suppres that can be used for the treatment of porphyrias. As discussed sion of ALA/PBG), and thus blunting the recurrent ALAS1 above, existing treatments such as heme products (e.g., upregulation that drives the attacks. Such prophylactic treat hemin) have numerous drawbacks. For example, the impact ment can reduce the number and the severity of the attacks. of hemin on clinical symptoms is delayed, it is expensive, and During an acute attack setting, administration of an iRNA it may have side effects (e.g., thrombophlebitis, anticoagula composition can treat an acute attack, e.g., by reducing the tion, thrombocytopenia, iron overload, renal shutdown). levels of ALA/PBG. Novel therapeutics such as those described hereincan address 0330. The present disclosure provides methods and iRNA these drawbacks and the unmet needs of patients acting faster, compositions for modulating the expression of an ALAS1 not inducing phlebitis, providing the convenience of Subcu gene. In certain embodiments, expression of ALAS1 is taneous administration, Successfully preventing recurrent reduced or inhibited using an ALAS1-specific iRNA, thereby attacks, preventing or ameliorating pain (e.g., chronic neuro leading to a decreased expression of an ALAS1 gene. pathic pain) and/or progressive neuropathy, and/or not caus Reduced expression of an ALAS1 gene may reduce the level ing certain adverse effects associated with hemin (e.g., iron of one or more porphyrin precursors, porphyrins, or porphy overload, increased risk of hepatocellular cancer). rin products or metabolites. Decreased expression of an 0328 Patients with AIA include those who suffer from ALAS1 gene, as well as related decreases in the level of one recurrent attacks and those who suffer from acute, sporadic or more porphyrin precursors and/or porphyrins, can be use attacks. In the pateints who suffer from recurrent attacks, ful in treating disorders related to ALAS1 expression, e.g., about 5-10% have recurrent intermittent attacks (2-3 attacks porphyrias. per year) or recurrent attacks (>4 attacks per year). These 0331. The iRNAs of the compositions featured herein patients are most likely to consider liver transplant or to include an RNA strand (the antisense strand) having a region receive prophylactic heme (e.g., hemin) infusions. The recur which is 30 nucleotides or less in length, i.e., 15-30 nucle rent attack patients are likely to have poor quality of life due otides in length, generally 19-24 nucleotides in length, which to long hospital stays, opiate addiction, and/or venous net region is Substantially complementary to at least part of an work toxicity. Chronic heme administration can induce heme mRNA transcript of an ALAS1 gene (also referred to herein oxygenase (HO-1). Thus, it can be difficult to wean patients as an ALAS 1-specific iRNA). The use of such an iRNA off heme and some require more frequent treatment. Some enables the targeted degradation of mRNAS of genes that are clinicials are therefore restricting heme use to the most seri implicated in pathologies associated with ALAS1 expression ous attacks. Accordingly, there is an unmet need for conve in mammals, e.g., porphyrias Such as ALA dehydratase defi nient, effective prophylaxis and treatments with better toler ciency porphyria (also known as Doss porphyria or plum ability. boporphyria) or acute intermittent porphyria. Very low dos For patients who suffer from acute attacks, clinical guidelines ages of ALAS1-specific iRNAs can specifically and Suggest administration of heme as early as possible. However, efficiently mediate RNAi resulting in significant inhibition given the challenges of diagnosis and lack of immediate drug of expression of an ALAS1 gene. iRNAs targeting ALAS1 availability, administration may be delayed. The slow onset of can specifically and efficiently mediate RNAi resulting in US 2016/0244766 A1 Aug. 25, 2016

significant inhibition of expression of an ALAS1 gene, e.g., in ALAS3; EC2.3.1.37; 5-aminolevulinate synthase, nonspe cell based assays. Thus, methods and compositions including cific, mitochondrial; ALAS: MIG4; these iRNAS are useful for treating pathological processes OTTHUMP00000212619; OTTHUMP00000212620; related to ALAS1 expression, such as porphyrias (e.g., OTTHUMP00000212621; OTTHUMP00000212622; X-linked sideroblastic anemia (XLSA), ALA deyhdratase migration-inducing protein 4: EC 2.3.1) refers to a nuclear deficiency porphyria (DoSS porphyria), acute intermittent encoded mitochondrial enzyme that is the first and typically porphyria (AIP), congenital erythropoietic porphyria, pro rate-limiting enzyme in the mammalian heme biosynthetic phyria cutanea tarda, hereditary coproporphyria (copropor pathway. ALAS1 catalyzes the condensation of glycine with phyria), variegate porphyria, erythropoietic protoporphyria succinyl-CoA to form 6-aminolevulinic acid (ALA). The (EPP), and transient erythroporphyria of infancy). human ALAS1 gene is expressed ubiquitously, is found on 0332 The following description discloses how to make chromosome 3p21.1 and typically encodes a sequence of 640 and use compositions containing iRNAS to inhibit the expres amino acids. In contrast, the ALAS-2 gene, which encodes an sion of an ALAS1 gene, as well as compositions and methods isozyme, is expressed only in erythrocytes, is found on chro for treating diseases and disorders caused by or modulated by moXome Xp11.21, and typicallyencodes a sequence of 550 the expression of this gene. Embodiments of the pharmaceu amino acids. As used herein an ALAS1 protein’ means any tical compositions featured in the invention include an iRNA protein variant of ALAS1 from any species (e.g., human, having an antisense strand comprising a region which is 30 mouse, non-human primate), as well as any mutants and nucleotides or less in length, generally 19-24 nucleotides in fragments thereofthat retain an ALAS1 activity. Similarly, an length, which region is Substantially complementary to at *ALAS1 transcript refers to any transcript variant of least part of an RNA transcript of an ALAS1 gene, together ALAS1, from any species (e.g., human, mouse, non-human with a pharmaceutically acceptable carrier. Embodiments of primate). A sequence of a human ALAS1 mRNA transcript compositions featured in the invention also include an iRNA can be found at NM 000688.4 (FIG. 3A and FIG.3B: SEQ having an antisense Strand having a region of complementa ID NO:1). Another human ALAS1 mRNA transcript, can be rity which is 30 nucleotides or less in length, generally 19-24 found at NM 000688.5 (FIG. 4A and FIG. 4B: SEQ ID nucleotides in length, and is substantially complementary to NO:382). The level of the mature encoded ALAS1 protein is at least part of an RNA transcript of an ALAS1 gene. regulated by heme: high levels of heme down-regulate the 0333 Accordingly, in Some aspects, pharmaceutical com mature enzyme in mitochondria while low heme levels up positions containing an ALAS1 iRNA and a pharmaceuti regulate. Multiple alternatively spliced variants, encoding the cally acceptable carrier, methods of using the compositions to same protein, have been identified. inhibit expression of an ALAS1 gene, and methods of using 0336. As used herein, the term “iRNA. “RNAi', “iRNA the pharmaceutical compositions to treat disorders related to agent,” or “RNAi agent” refers to an agent that contains RNA ALAS1 expression are featured in the invention. as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced I. DEFINITIONS silencing complex (RISC) pathway. In one embodiment, an 0334 For convenience, the meaning of certain terms and iRNA as described herein effects inhibition of ALAS1 phrases used in the specification, examples, and appended expression. Inhibition of ALAS1 expression may be assessed claims, are provided below. If there is an apparent discrep based on a reduction in the level of ALAS1 mRNA or a ancy between the usage of a term in other parts of this speci reduction in the level of the ALAS1 protein. As used herein, fication and its definition provided in this section, the defini “target sequence” refers to a contiguous portion of the nucle tion in this section shall prevail. otide sequence of an mRNA molecule formed during the 0335 “G.,” “C.” “A” “T” and “U” each generally stand for transcription of an ALAS1 gene, including mRNA that is a a nucleotide that contains guanine, cytosine, adenine, thymi product of RNA processing of a primary transcription prod dine and uracil as a base, respectively. However, it will be uct. The target portion of the sequence will be at least long understood that the term “ribonucleotide' or “nucleotide' can enough to serve as a substrate for iRNA-directed cleavage at also refer to a modified nucleotide, as further detailed below, or near that portion. For example, the target sequence will or a Surrogate replacement moiety. The skilled person is well generally be from 9-36 nucleotides in length, e.g., 15-30 aware that guanine, cytosine, adenine, and uracil may be nucleotides in length, including all Sub-ranges therebetween. replaced by other moieties without substantially altering the As non-limiting examples, the target sequence can be from base pairing properties of an oligonucleotide comprising a 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, nucleotide bearing such replacement moiety. For example, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, without limitation, a nucleotide comprisinginosine as its base 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, may base pair with nucleotides containing adenine, cytosine, 18-30 nucleotides, 18-26 nucleotides, 18-23 nucleotides, or uracil. Hence, nucleotides containing uracil, guanine, or 18-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, adenine may be replaced in the nucleotide sequences of 19-30 nucleotides, 19-26 nucleotides, 19-23 nucleotides, dsRNA featured in the invention by a nucleotide containing, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, for example, inosine. In another example, adenine and 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, cytosine anywhere in the oligonucleotide can be replaced 20-24 nucleotides, 20-23 nucleotides, 20-22 nucleotides, with guanine and uracil, respectively to form G-U Wobble 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, base pairing with the target mRNA. Sequences containing 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or Such replacement moieties are Suitable for the compositions 21-22 nucleotides. and methods featured in the invention. 0337 As used herein, the term “strand comprising a As used herein, ALAS1 (also known as ALAS-1: 8-ami sequence” refers to an oligonucleotide comprising a chain of nolevulinate synthase 1: 6-ALA synthase 1: 5'-aminole nucleotides that is described by the sequence referred to using Vulinic acid synthase 1: ALAS-H; ALASH: ALAS-N: the standard nucleotide nomenclature. US 2016/0244766 A1 Aug. 25, 2016 24

0338. As used herein, and unless otherwise indicated, the mentary to at least a part of an ALAS1 mRNA if the sequence term “complementary, when used to describe a first nucle is Substantially complementary to a non-interrupted portion otide sequence in relation to a second nucleotide sequence, of an mRNA encoding ALAS1. refers to the ability of an oligonucleotide or polynucleotide 0343. The term “double-stranded RNA or “dsRNA, as comprising the first nucleotide sequence to hybridize and used herein, refers to an iRNA that includes an RNA molecule form a duplex structure under certain conditions with an or complex of molecules having a hybridized duplex region oligonucleotide or polynucleotide comprising the second that comprises two anti-parallel and Substantially comple nucleotide sequence, as will be understood by the skilled mentary nucleic acid strands, which will be referred to as person. Such conditions can, for example, be stringent con having “sense' and “antisense' orientations with respect to a ditions, where stringent conditions may include: 400 mM target RNA. The duplex region can be of any length that NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. permits specific degradation of a desired target RNA, e.g., for 12-16 hours followed by washing. Other conditions, such through a RISC pathway, but will typically range from 9 to 36 as physiologically relevant conditions as may be encountered base pairs in length, e.g., 15-30 base pairs in length. Consid inside an organism, can apply. The skilled person will be able ering a duplex between 9 and 36 base pairs, the duplex can be to determine the set of conditions most appropriate for a test any length in this range, for example, 9, 10, 11, 12, 13, 14, 15. of complementarity of two sequences in accordance with the 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, ultimate application of the hybridized nucleotides. 33, 34, 35, or 36 and any sub-range therein between, includ 0339 Complementary sequences within an iRNA, e.g., ing, but not limited to 15-30 base pairs, 15-26 base pairs, within a dsRNA as described herein, include base-pairing of 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 the oligonucleotide or polynucleotide comprising a first base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base nucleotide sequence to an oligonucleotide or polynucleotide pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, comprising a second nucleotide sequence over the entire 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 length of one or both nucleotide sequences. Such sequences base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base can be referred to as “fully complementary' with respect to pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, each other herein. However, where a first sequence is referred 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 to as “substantially complementary' with respect to a second base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base sequence herein, the two sequences can be fully complemen pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, tary, or they may form one or more, but generally not more 21-23 base pairs, or 21-22 base pairs. dsRNAs generated in than 5, 4.3 or 2 mismatched base pairs upon hybridization for the cell by processing with Dicer and similar enzymes are a duplex up to 30 base pairs, while retaining the ability to generally in the range of 19-22 base pairs in length. One hybridize under the conditions most relevant to their ultimate Strand of the duplex region of a dsDNA comprises a sequence application, e.g., inhibition of gene expression via a RISC that is substantially complementary to a region of a target pathway. However, where two oligonucleotides are designed RNA. The two strands forming the duplex structure can be to form, upon hybridization, one or more single stranded from a single RNA molecule having at least one self-comple overhangs. Such overhangs shall not be regarded as mis mentary region, or can be formed from two or more separate matches with regard to the determination of complementarity. RNA molecules. Where the duplex region is formed from two For example, a dsRNA comprising one oligonucleotide 21 Strands of a single molecule, the molecule can have a duplex nucleotides in length and another oligonucleotide 23 nucle region separated by a single stranded chain of nucleotides otides in length, wherein the longer oligonucleotide com (herein referred to as a “hairpin loop) between the 3'-end of prises a sequence of 21 nucleotides that is fully complemen one strand and the 5'-end of the respective other strand form tary to the shorter oligonucleotide, may yet be referred to as ing the duplex structure. The hairpin loop can comprise at “fully complementary for the purposes described herein. least one unpaired nucleotide; in some embodiments the hair 0340 “Complementary’ sequences, as used herein, may pin loop can comprise at least 3, at least 4, at least 5, at least also include, or be formed entirely from, non-Watson-Crick 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least base pairs and/or base pairs formed from non-natural and 23 or more unpaired nucleotides. Where the two substantially modified nucleotides, in as far as the above requirements with complementary strands of a dsRNA are comprised by sepa respect to their ability to hybridize are fulfilled. Such non rate RNA molecules, those molecules need not, but can be Watson-Crick base pairs includes, but are not limited to, G:U covalently connected. Where the two strands are connected Wobble or Hoogstein base pairing. covalently by means other than a hairpin loop, the connecting 0341 The terms “complementary.” “fully complemen structure is referred to as a “linker.” The term “siRNA is also tary” and “substantially complementary' herein may be used used herein to refer to a dsRNA as described above. with respect to the base matching between the sense strand 0344. In another embodiment, the iRNA agent may be a and the antisense strand of a dsRNA, or between the antisense “single-stranded siRNA that is introduced into a cell or Strand of an iRNA agent and a target sequence, as will be organism to inhibit a target mRNA. Single-stranded RNAi understood from the context of their use. agents bind to the RISC endonuclease Argonaute 2, which 0342. As used herein, a polynucleotide that is “substan then cleaves the target mRNA. The single-stranded siRNAs tially complementary to at least part of a messenger RNA are generally 15-30 nucleotides and are chemically modified. (mRNA) refers to a polynucleotide that is substantially The design and testing of single-stranded siRNAS are complementary to a contiguous portion of the mRNA of described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) interest (e.g., an mRNA encoding an ALAS1 protein). For Cell 150: 883-894, the entire contents of each of which are example, a polynucleotide is complementary to at least a part hereby incorporated herein by reference. Any of the antisense of an ALAS1 mRNA if the sequence is substantially comple nucleotide sequences described herein (e.g., sequences pro mentary to a non-interrupted portion of an mRNA encoding vided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 or in Tables ALAS1. As another example, a polynucleotide is comple 21-40) may be used as a single-stranded siRNA as described US 2016/0244766 A1 Aug. 25, 2016

herein or as chemically modified by the methods described in 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85,90, Lima et al., (2012) Cell 150:883-894. 95% or higher (but not 100%) deoxyribonucleosides, e.g., in 0345. In another aspect, the RNA agent is a “single one or both strands. In other embodiments, the term 'iRNA stranded antisense RNA molecule'. An single-stranded anti does not encompass a double stranded DNA molecule (e.g., a sense RNA molecule is complementary to a sequence within naturally-occurring double stranded DNA molecule or a the target mRNA. Single-stranded antisense RNA molecules 100% deoxynucleoside-containing DNA molecule). In one can inhibit translation in a stoichiometric manner by base aspect, an RNA interference agent includes a single stranded pairing to the mRNA and physically obstructing the transla RNA that interacts with a target RNA sequence to direct the tion machinery, see Dias, N. et al., (2002) Mol Cancer Ther cleavage of the target RNA. Without wishing to be bound by 1:347-355. Alternatively, the single-stranded antisense mol theory, long double stranded RNA introduced into cells is ecules inhibit a target mRNA by hydridizing to the target and broken down into siRNA by a Type III endonuclease known cleaving the target through an RNaseH cleavage event. The as Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a single-stranded antisense RNA molecule may be about 10 to ribonuclease-III-like enzyme, processes the dsRNA into about 30 nucleotides in length and have a sequence that is 19-23 base pair short interfering RNAs with characteristic complementary to a target sequence. For example, the single two base 3' overhangs (Bernstein, et al., (2001) Nature 409: Stranded antisense RNA molecule may comprise a sequence 363). The siRNAs are then incorporated into an RNA-in that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, duced silencing complex (RISC) where one or more helicases or more contiguous nucleotides from any one of the antisense unwind the siRNA duplex, enabling the complementary anti nucleotide sequences described herein, e.g., sequences pro sense Strand to guide target recognition (Nykanen, et al., vided in any one of Tables 2,3,6,7,8,9, 14, 15, 18 and 20 or (2001) Cell 107:309). Upon binding to the appropriate target in Tables 21-40. mRNA, one or more endonucleases within the RISC cleaves 0346. The skilled artisan will recognize that the term the target to induce silencing (Elbashir, et al., (2001) Genes “RNA molecule' or “ribonucleic acid molecule' encom Dev. 15:188). Thus, in one aspect the invention relates to a passes not only RNA molecules as expressed or found in single stranded RNA that promotes the formation of a RISC nature, but also analogs and derivatives of RNA comprising complex to effect silencing of the target gene. one or more ribonucleotide/ribonucleoside analogs or deriva 0348. As used herein, the term “nucleotide overhang tives as described herein or as known in the art. Strictly refers to at least one unpaired nucleotide that protrudes from speaking, a “ribonucleoside' includes a nucleoside base and the duplex structure of an iRNA, e.g., a dsRNA. For example, a ribose Sugar, and a “ribonucleotide' is a ribonucleoside with when a 3'-end of one strand of a dsRNA extends beyond the one, two or three phosphate moieties. However, the terms 5'-end of the other strand, or vice versa, there is a nucleotide “ribonucleoside' and “ribonucleotide' can be considered to overhang. A dsRNA can comprise an overhang of at least one be equivalent as used herein. The RNA can be modified in the nucleotide; alternatively the overhang can comprise at least nucleobase structure, in the ribose structure, or in the ribose two nucleotides, at least three nucleotides, at least four nucle phosphate backbone structure, e.g., as described herein otides, at least five nucleotides or more. A nucleotide over below. However, the molecules comprising ribonucleoside hang can comprise or consist of a nucleotide/nucleoside ana analogs or derivatives must retain the ability to form a duplex. log, including a deoxynucleotide/nucleoside. The overhang As non-limiting examples, an RNA molecule can also include (s) may be on the sense Strand, the antisense Strand or any at least one modified ribonucleoside including but not limited combination thereof. Furthermore, the nucleotide(s) of an to a 2'-O-methyl modified nucleostide, a nucleoside compris overhang can be present on the 5' end, 3' end or both ends of ing a 5' phosphorothioate group, a terminal nucleoside linked either an antisense or sense strand of a dsRNA. to a cholesteryl derivative or dodecanoic acid bisdecylamide 0349. In one embodiment, the antisense strand of a dsRNA group, a locked nucleoside, an abasic nucleoside, an acyclic has a 1-10 nucleotide overhang at the 3' end and/or the 5' end. nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a In one embodiment, the sense strand of a dsRNA has a 1-10 2'-amino-modified nucleoside, 2-alkyl-modified nucleoside, nucleotide overhang at the 3' end and/or the 5' end. In another morpholino nucleoside, a phosphoramidate or a non-natural embodiment, one or more of the nucleotides in the overhang base comprising nucleoside, or any combination thereof. is replaced with a nucleoside thiophosphate. Alternatively, an RNA molecule can comprise at least two 0350. The terms “blunt’ or “bluntended as used herein in modified ribonucleosides, at least 3, at least 4, at least 5, at reference to a dsRNA mean that there are no unpaired nucle least 6, at least 7, at least 8, at least 9, at least 10, at least 15, otides or nucleotide analogs at a given terminal end of a at least 20 or more, up to the entire length of the dsRNA dsRNA, i.e., no nucleotide overhang. One or both ends of a molecule. The modifications need not be the same for each of dsRNA can be blunt. Where both ends of a dsRNA are blunt, such a plurality of modified ribonucleosides in an RNA mol the dsRNA is said to be blunt ended. To be clear, a “blunt ecule. In one embodiment, modified RNAs contemplated for ended' dsRNA is a dsRNA that is blunt at both ends, i.e., no use in methods and compositions described herein are peptide nucleotide overhang at either end of the molecule. Most often nucleic acids (PNAS) that have the ability to form the required such a molecule will be double-stranded over its entire length. duplex structure and that permit or mediate the specific deg 0351. The term “antisense strand’ or “guide strand refers radation of a target RNA, e.g., via a RISC pathway. to the strand of an iRNA, e.g., a dsRNA, which includes a 0347 In one aspect, a modified ribonucleoside includes a region that is Substantially complementary to a target deoxyribonucleoside. In Such an instance, an iRNA agent can sequence. As used herein, the term “region of complementa comprise one or more deoxynucleosides, including, for rity” refers to the region on the antisense strand that is sub example, a deoxynucleoside overhang(s), or one or more stantially complementary to a sequence, for example a target deoxynucleosides within the double stranded portion of a sequence, as defined herein. Where the region of complemen dsRNA. In certain embodiments, the RNA molecule com tarity is not fully complementary to the target sequence, the prises a percentage of deoxyribonucleoses of at least 5, 10. mismatches may be in the internal or terminal regions of the US 2016/0244766 A1 Aug. 25, 2016 26 molecule. Generally, the most tolerated mismatches are in the treated with an iRNA as described herein compared to the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' expression in an untreated cell. Activation of expression by and/or 3' terminus. small dsRNAs is described, for example, in Li et al., 2006 0352. The term “sense strand, or “passenger strand as Proc. Natl. Acad. Sci. U.S.A. 103:17337-42, and in used herein, refers to the strand of an iRNA that includes a US200701 11963 and US2005226.848, each of which is incor region that is Substantially complementary to a region of the porated herein by reference. antisense strand as that term is defined herein. 0358. The terms “silence,” “inhibit expression of,” “down 0353 As used herein, the term “SNALPrefers to a stable regulate expression of “Suppress expression of” and the nucleic acid-lipid particle. A SNALP represents a vesicle of like, in so far as they refer to an ALAS1 gene, herein refer to lipids coating a reduced aqueous interior comprising a the at least partial Suppression of the expression of an ALAS1 nucleic acid Such as an iRNA or a plasmid from which an gene, as assessed, e.g., based on on ALAS1 mRNA expres iRNA is transcribed. SNALPs are described, e.g., in U.S. Sion, ALAS1 protein expression, or another parameter func Patent Application Publication Nos. 20060240093, tionally linked to ALAS1 gene expression (e.g., ALA or PBG 20070135372, and in International Application No. WO concentrations in plasma or urine). For example, inhibition of 2009082817. These applications are incorporated herein by ALAS1 expression may be manifested by a reduction of the reference in their entirety. amount of ALAS1 mRNA which may be isolated from or 0354) “Introducing into a cell, when referring to an detected in a first cell or group of cells in which an ALAS1 iRNA, means facilitating or effecting uptake or absorption gene is transcribed and which has or have been treated Such into the cell, as is understood by those skilled in the art. that the expression of an ALAS1 gene is inhibited, as com Absorption or uptake of an iRNA can occur through unaided pared to a control. The control may be a second cell or group diffusive or active cellular processes, or by auxiliary agents or of cells substantially identical to the first cell or group of cells, devices. The meaning of this term is not limited to cells in except that the second cell or group of cells have not been So vitro; an iRNA may also be “introduced into a cell, wherein treated (control cells). The degree of inhibition is usually the cell is part of a living organism. In such an instance, expressed as a percentage of a control level, e.g., introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, iRNA can be (mRNA in control cells) - (mRNA in treated cells) injected into a tissue site or administered systemically. In vivo ... 100% delivery can also be by a B-glucan delivery system, Such as (mRNA in control cells) those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, which are hereby 0359 Alternatively, the degree of inhibition may be given incorporated by reference in their entirety. In vitro introduc in terms of a reduction of a parameter that is functionally tion into a cell includes methods known in the art such as linked to ALAS1 gene expression, e.g., the amount of protein electroporation and lipofection. Further approaches are encoded by an ALAS1 gene, or the level of one or more described herein below or known in the art. porphyrins. The reduction of a parameter functionally linked 0355 As used herein, the term “modulate the expression to ALAS1 gene expression may similarly be expressed as a of refers to at an least partial “inhibition” or partial “activa percentage of a control level. In principle, ALAS1 gene tion' of an ALAS1 gene expression in a cell treated with an silencing may be determined in any cell expressing ALAS1, iRNA composition as described herein compared to the either constitutively or by genomic engineering, and by any expression of ALAS1 in a control cell. A control cell includes appropriate assay. However, when a reference is needed in an untreated cell, or a cell treated with a non-targeting control order to determine whether a given iRNA inhibits the expres iRNA. sion of the ALAS1 gene by a certain degree and therefore is 0356. The terms “activate,”99 &g“enhance,” “up-regulate the encompassed by the instant invention, the assays provided in expression of “increase the expression of” and the like, in so the Examples below shall serve as such reference. far as they refer to an ALAS1 gene, herein refer to the at least 0360 For example, in certain instances, expression of an partial activation of the expression of an ALAS1 gene, as ALAS1 gene is suppressed by at least about 10%, 15%, 20%, manifested by an increase in the amount of ALAS1 mRNA, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an which may be isolated from or detected in a first cell or group iRNA featured in the invention. In some embodiments, an of cells in which an ALAS1 gene is transcribed and which has ALAS1 gene is suppressed by at least about 60%. 65%, 70%, or have been treated such that the expression of an ALAS1 75%, or 80% by administration of an iRNA featured in the gene is increased, as compared to a second cell or group of invention. In some embodiments, an ALAS1 gene is Sup cells substantially identical to the first cell or group of cells pressed by at least about 85%, 90%, 95%.98%,99%, or more but which has or have not been so treated (control cells). by administration of an iRNA as described herein. 0357. In one embodiment, expression of an ALAS1 gene 0361. As used herein in the context of ALAS1 expression, is activated by at least about 10%, 15%, 20%, 25%, 30%, the terms “treat,” “treating.” “treatment,” and the like, refer to 35%, 40%, 45%, or 50% by administration of an iRNA as relief from or alleviation of pathological processes related to described herein. In some embodiments, an ALAS1 gene is ALAS1 expression (e.g., pathological processes involving activated by at least about 60%, 70%, or 80% by administra porphyrins or defects in the porphyrin pathway, such as, for tion of an iRNA featured in the invention. In some embodi example, porphyrias). In the context of the present invention ments, expression of an ALAS1 gene is activated by at least insofar as it relates to any of the other conditions recited about 85%, 90%, or 95% or more by administration of an herein below (other than pathological processes related to iRNA as described herein. In some embodiments, the ALAS1 ALAS1 expression), the terms “treat,” “treatment,” and the gene expression is increased by at least 1-fold, at least 2-fold, like mean to prevent, relieve oralleviate at least one symptom at least 5-fold, at least 10-fold, at least 50-fold, at least 100 associated with such condition, or to slow or reverse the fold, at least 500-fold, at least 1000 fold or more in cells progression oranticipated progression of Such condition. For US 2016/0244766 A1 Aug. 25, 2016 27 example, the methods featured herein, when employed to agents, binding agents, lubricating agents, Sweetening treat porphyria, may serve to reduce or prevent one or more agents, flavoring agents, coloring agents and preservatives. symptoms associated with porphyria (e.g., pain), to reduce Suitable inert diluents include Sodium and calcium carbonate, the severity or frequency of attacks associated with porphyria, Sodium and calcium phosphate, and lactose, while corn starch to reduce the likelihood that an attack of one or more symp and alginic acid are Suitable disintegrating agents. Binding toms associated with porphyria will occur upon exposure to a agents may include starch and gelatin, while the lubricating precipitating condition, to shorten an attack associated with agent, if present, will generally be magnesium Stearate, porphyria, and/or to reduce the risk of developing conditions stearic acid or talc. If desired, the tablets may be coated with associated with porphyria (e.g., hepatocellular cancer or neu a material Such as glyceryl monostearate or glyceryl distear ropathy (e.g., progressive neuropathy).). Thus, unless the ate, to delay absorption in the gastrointestinal tract. Agents context clearly indicates otherwise, the terms “treat,” “treat included in drug formulations are described further herein ment, and the like are intended to encompass prophylaxis, below. e.g., prevention of disorders and/or symptoms of disorders 0366. The term “about when referring to a number or a related to ALAS1 expression. numerical range means that the number or numerical range 0362 By “lower in the context of a disease marker or referred to is an approximation within experimental variabil symptom is meant a statistically or clinically significant ity (or within statistical experimental error), and thus the decrease in Such level. The decrease can be, for example, at number or numerical range may vary from, for example, least 10%, at least 20%, at least 30%, at least 40% or more, between 1% and 15% of the stated number or numerical and is typically down to a level accepted as within the range range. of normal for an individual without such disorder. 0363 As used herein, the phrases “therapeutically effec II. IRNAAGENTS tive amount” and “prophylactically effective amount” refer to 0367. Described herein are iRNA agents that inhibit the an amount that provides atherapeutic benefit in the treatment, expression of an ALAS1 gene. In one embodiment, the iRNA prevention, or management of pathological processes related agent includes double-stranded ribonucleic acid (dsRNA) to ALAS1 expression. The specific amount that is therapeuti molecules for inhibiting the expression of an ALAS1 gene in cally effective can be readily determined by an ordinary medi a cell or in a Subject (e.g., in a mammal, e.g., in a human cal practitioner, and may vary depending on factors known in having a porphyria), where the dsRNA includes an antisense the art, such as, for example, the type of pathological process, Strand having a region of complementarity which is comple the patients history and age, the stage of pathological pro mentary to at least a part of an mRNA formed in the expres cess, and the administration of other agents. sion of an ALAS1 gene, and where the region of complemen 0364. As used herein, a “pharmaceutical composition' tarity is 30 nucleotides or less in length, generally 19-24 comprises a pharmacologically effective amount of an iRNA nucleotides in length, and where the dsRNA, upon contact and a pharmaceutically acceptable carrier. As used herein, with a cell expressing the ALAS1 gene, inhibits the expres “pharmacologically effective amount,” “therapeutically sion of the ALAS1 gene by at least 10% as assayed by, for effective amount” or simply “effective amount” refers to that example, a PCR or branched DNA (bDNA)-based method, or amount of an iRNA effective to produce the intended phar by a protein-based method, such as by Western blot. In one macological, therapeutic or preventive result. For example, in embodiment, the iRNA agent activates the expression of an a method of treating a disorder related to ALAS1 expression ALAS1 gene in a cell or mammal Expression of an ALAS1 (e.g., in a method of treatingaporphyria), an effective amount gene in cell culture, such as in COS cells, HeLa cells, primary includes an amount effective to reduce one or more symptoms hepatocytes, HepG2 cells, primary cultured cells or in a bio associated with a porphyria, an amount effective to reduce the logical sample from a Subject can be assayed by measuring frequency of attacks, an amount effective to reduce the like ALAS1 mRNA levels, such as by blNA or TaqManassay, or lihood that an attack of one or more symptoms associated by measuring protein levels, such as by immunofluorescence with porphyria will occur upon exposure to a precipitating analysis, using, for example, Western Blotting or flow cyto factor, or an amount effective to reduce the risk of developing metric techniques. conditions associated with porphyria (e.g., neuropathy (e.g., 0368. A dsRNA includes two RNA strands that are suffi progressive neuropathy), hepatocellular cancer). For ciently complementary to hybridize to form a duplex struc example, if a given clinical treatment is considered effective ture under conditions in which the dsRNA will be used. One when there is at least a 10% reduction in a measurable param strand of a dsRNA (the antisense strand) includes a region of eter associated with a disease or disorder, a therapeutically complementarity that is Substantially complementary, and effective amount of a drug for the treatment of that disease or generally fully complementary, to a target sequence, derived disorder is the amount necessary to effect at least a 10% from the sequence of an mRNA formed during the expression reduction in that parameter. For example, a therapeutically of an ALAS1 gene. The other strand (the sense strand) effective amount of an iRNA targeting ALAS1 can reduce includes a region that is complementary to the antisense ALAS1 protein levels by any measurable amount, e.g., by at strand, such that the two strands hybridize and form a duplex least 10%, 20%, 30%, 40% or 50%. structure when combined under suitable conditions. Gener 0365. The term “pharmaceutically acceptable carrier' ally, the duplex structure is between 15 and 30 inclusive, more refers to a carrier for administration of a therapeutic agent. generally between 18 and 25 inclusive, yet more generally Such carriers include, but are not limited to, saline, buffered between 19 and 24 inclusive, and most generally between 19 saline, dextrose, water, glycerol, ethanol, and combinations and 21 base pairs in length, inclusive. Similarly, the region of thereof. The term specifically excludes cell culture medium. complementarity to the target sequence is between 15 and 30 For drugs administered orally, pharmaceutically acceptable inclusive, more generally between 18 and 25 inclusive, yet carriers include, but are not limited to pharmaceutically more generally between 19 and 24 inclusive, and most gen acceptable excipients such as inert diluents, disintegrating erally between 19 and 21 nucleotides in length, inclusive. In US 2016/0244766 A1 Aug. 25, 2016 28 some embodiments, the dsRNA is between 15 and 20 nucle strand is selected from Tables 2 and 3. In a further aspect, a otides in length, inclusive, and in other embodiments, the dsRNA can include at least sense and antisense nucleotide dsRNA is between 25 and 30 nucleotides in length, inclusive. sequences, whereby the sense Strand is selected from the As the ordinarily skilled person will recognize, the targeted groups of sequences provided in Tables 2,3,6,7,8,9, 14, and region of an RNA targeted for cleavage will most often be part 15, and the corresponding antisense Strand of the sense Strand of a larger RNA molecule, often an mRNA molecule. Where is selected from Tables 2, 3, 6, 7, 8, 9, 14, and 15. In a further relevant, a “part of an mRNA target is a contiguous sequence aspect, a dsRNA can include at least sense and antisense of an mRNA target of sufficient length to be a substrate for nucleotide sequences, whereby the sense Strand is selected RNAi-directed cleavage (i.e., cleavage through a RISC path from the groups of sequences provided in Tables 2, 3, 6, 7, 8, way). dsRNAS having duplexes as short as 9 base pairs can, 9, 14, 15, 18 and 20, and the corresponding antisense strand of under some circumstances, mediate RNAi-directed RNA the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, cleavage. Most often a target will be at least 15 nucleotides in 18 and 20. length, e.g., 15-30 nucleotides in length. 0375. In embodiments, the iRNA is AD-60501, 0369. One of skill in the art will also recognize that the AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, duplex region is a primary functional portion of a dsRNA, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, e.g., a duplex region of 9 to 36, e.g., 15-30 base pairs. Thus, in AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, one embodiment, to the extent that it becomes processed to a AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, functional duplex of e.g., 15-30 base pairs that targets a AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, desired RNA for cleavage, an RNA molecule or complex of AD-60820, AD-60843, AD-60819, AD-61140, AD-6 1141, RNA molecules having a duplex region greater than 30 base AD-6 1142, AD-60835, AD-60839, AD-61143, AD-6 1144, pairs is a dsRNA. Thus, an ordinarily skilled artisan will AD-61145, AD-61146, AD-60892, or AD-60419 (e.g., recognize that in one embodiment, then, an miRNA is a including the nucleotide sequence and/or one or more (e.g., dsRNA. In another embodiment, a dsRNA is not a naturally all) of the modifications of the aforesaid dsRNAs). In embodi occurring miRNA. In another embodiment, an iRNA agent ments, the iRNA comprises an antisense strand that com useful to target ALAS1 expression is not generated in the prises, or consists of an antisense sequence (including one or target cell by cleavage of a larger dsRNA. more (e.g., all the modifications)) selected from the antisense 0370. A dsRNA as described herein may further include sequence of AD-60501, AD-60519, AD-60901, AD-60495, one or more single-stranded nucleotide overhangs. The AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, dsRNA can be synthesized by standard methods known in the AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, art as further discussed below, e.g., by use of an automated AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, DNA synthesizer, such as are commercially available from, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, for example, BioSearch, Applied Biosystems, Inc. In one AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, embodiment, an ALAS1 gene is a human ALAS1 gene. In AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, another embodiment the ALAS1 gene is a mouse or a rat AD-61143, AD-61.144, AD-61145, AD-6 1146, AD-60892, or ALAS1 gene. AD-60419. In embodiments, the iRNA comprises a sense 0371. In specific embodiments, the first sequence is a Strand that comprises, or consists of a sense sequence (and/or sense Strand of a dsRNA that includes a sense sequence one or more (e.g., all) of the modifications)) selected from disclosed herein, e.g., in Tables 21-40, and the second AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, sequence is an antisense Strand of a dsRNA that includes an AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, antisense sequence disclosed herein, e.g., in Tables 21-40. AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, 0372. In specific embodiments, the first sequence is a AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, sense Strand of a dsRNA that includes a sense sequence from AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, Table 2 or Table 3, and the second sequence is an antisense AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, Strand of a dsRNA that includes an antisense sequence from AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, Table 2 or Table 3. In embodiments, the first sequence is a AD-6 1144, AD-61145, AD-6 1146, AD-60892, or AD-60419. sense Strand of a dsRNA that includes a sense sequence from 0376. In embodiments, the iRNA comprises (i) an anti Table 2, 3, 6, 7, 8, 9, 14, or 15, and the second sequence is an sense strand that comprises, or consists of the sequence of antisense Strand of a dsRNA that includes an antisense UAAGAUGAGACACUCUUUCUGGU O UAA sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15. In embodi GAUGAGACACUCTUUCUGGU and/or (ii) a sense strand ments, the first sequence is a sense Strand of a dsRNA that that comprises, or consists of the sequence of CAGAAA includes a sense sequence from Table 2,3,6,7,8,9, 14, 15, 18 GAGUGUCUCAUCUUA. In embodiments, one or more or 20, and the second sequence is an antisense Strand of a nucleotides of the antisense Strand and/or sense Strand are dsRNA that includes an antisense sequence from Table 2, 3, 6, modified as described herein. 7, 8, 9, 14, 15, 18 or 20. 0373) In one aspect, a dsRNA can include at least sense 0377. In embodiments, the iRNA comprises (i) an anti and antisense nucleotide sequences, whereby the sense Strand sense Strand that comprises, or consists of the antisense is selected from the sense sequences provided herein, e.g., in sequence of AD-60489 and/or (ii) a sense strand that com Tables 21-40, and the corresponding antisense Strand of the prises, or consists of the sense sequence of AD-60489 (and/ sense strand is selected from the antisense sequences pro or one or more (e.g., all) of the modifications of the sense vided herein, e.g., in Tables 21-40. strand and/or antisense strand of AD-60489). 0374. In one aspect, a dsRNA can include at least sense 0378. In embodiments, the iRNA comprises (i) an anti and antisense nucleotide sequences, whereby the sense Strand sense Strand that comprises, or consists of the antisense is selected from the groups of sequences provided in Tables 2 sequence of AD-60519 and/or (ii) a sense strand that com and 3, and the corresponding antisense Strand of the sense prises, or consists of the sense sequence of AD-60519 (and/ US 2016/0244766 A1 Aug. 25, 2016 29 or one or more (e.g., all) of the modifications of the sense ALAS1 gene gene. As such, a dsRNA will include two oli strand and/or antisense strand of AD-60489). gonucleotides, where one oligonucleotide is described herein 0379. In embodiments, the iRNA comprises (i) an anti as the sense Strand, and the second oligonucleotide is sense Strand that comprises, or consists of the antisense described as the corresponding antisense Strand. As described sequence of AD-61193 and/or (ii) a sense strand that com elsewhere herein and as known in the art, the complementary prises, or consists of the sense sequence of AD-61193 (and/ sequences of a dsRNA can also be contained as self-comple or one or more (e.g., all) of the modifications of the sense mentary regions of a single nucleic acid molecule, as opposed strand and/or antisense strand of AD-60489). to being on separate oligonucleotides. 0380. In embodiments, the iRNA comprises (i) an anti (0385. The skilled person is well aware that dsRNAs hav sense Strand that comprises, or consists of the antisense ing a duplex structure of between 20 and 23, but specifically sequence of AD-60819 and/or (ii) a sense sequence that com 21, base pairs have been hailed as particularly effective in prises, or consists of the sense sequence of AD-60819 (and/ inducing RNA interference (Elbashir et al., EMBO 2001, or one or more (e.g., all) of the modifications of the sense 20:6877-6888). However, others have found that shorter or strand and/or antisense strand of AD-60489). longer RNA duplex structures can be effective as well. In the 0381. In embodiments, the iRNA for inhibiting expression embodiments described above, by virtue of the nature of the of ALAS1 is provided, wherein the dsRNA comprises (i) an oligonucleotide sequences provided in the tables herein, dsR antisense strand that comprises, or consists of the antisense NAs described herein can include at least one strand of a sequence of AD-60489, AD-60519, AD-61193, or AD-60819 length of minimally 21 nucleotides. It can be reasonably (or a corresponding unmodified antisense sequence) and/or expected that shorter duplexes having one of the sequences of (ii) a sense Strand that comprises, or consists of the sense disclosed herein minus only a few nucleotides on one or both sequence of AD-60489, AD-60519, AD-61193, or AD-60819 ends may be similarly effective as compared to the dsRNAs (or a corresponding unmodified antisense sequence). In described above. Hence, dsRNAs having apartial sequence of embodiments, the iRNA comprises (i)anantisense Strand that at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides consists of the antisense sequence of AD-60489, AD-60519, from one of the sequences disclosed herein, and differing in AD-61193, or AD-60819 and/or (ii) a sense strand that con their ability to inhibit the expression of an ALAS1 gene by not sists of the sense sequence of AD-60489, AD-60519, more than 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA AD-61193, or AD-60819, except that the antisense strand comprising the full sequence, are contemplated according to and/or sense strand of the dsRNA differs by 1, 2, or 3 nucle the invention. otides from the corresponding antisense and/or sense 0386. In addition, the RNAs provided in the tables herein, sequence of AD-60489, AD-60519, AD-61193, or identify a site in an ALAS1 transcript that is susceptible to AD-60819. RISC-mediated cleavage. As such, the present invention fur 0382. The sequences and modifications of AD-60489, ther features iRNAs that target within one of such sequences. AD-60519, AD-61193, and AD-60819 are shown in Table 44 As used herein, an iRNA is said to target within a particular disclosed herein. site of an RNA transcript if the iRNA promotes cleavage of 0383. In one embodiment, the iRNA is ALN-60519. ALN the transcript anywhere within that particular site. Such an 60519 is a chemically synthesized double stranded oligo iRNA will generally include at least 15 contiguous nucle nucleotide covalently linked to a ligand containing three otides from one of the sequences provided herein, e.g., in N-acetylgalactosamine (GalNAc) residues (depicted in FIG. Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, 20, and in Tables 21-40, 57). In one embodiment, all nucleotides of ALN-60519 are coupled to additional nucleotide sequences taken from the 2'-OMe or 2'-F modified and are connected through 3'-5' region contiguous to the selected sequence in an ALAS1 gene. phosphodiester linkages, thus forming the Sugar-phosphate 0387 While a target sequence is generally 15-30 nucle backbone of the oligonucleotide. The sense strand and the otides in length, there is wide variation in the suitability of antisense strand of ALN-60519 contain 21 and 23 nucle particular sequences in this range for directing cleavage of otides, respectively. The 3'-end of the sense strand of ALN any given target RNA. Various software packages and the 60519 is conjugated to the triantennary GalNAc moiety (re guidelines set out herein provide guidance for the identifica ferred to as L96) through a phosphodiester linkage. The tion of optimal target sequences for any given gene target, but antisense strand contains four phosphorothioate linkages— an empirical approach can also be taken in which a “window' two at the 3' end and two at the 5' end. The sense strand of or “mask of a given size (as a non-limiting example, 21 ALN-60519 contains two phosphorothioate linkages at the 5' nucleotides) is literally or figuratively (including, e.g., in end. The 21 nucleotides of the sense strand of ALN-60519 silico) placed on the target RNA sequence to identify hybridize with the complementary 21 nucleotides of the anti sequences in the size range that may serve as target sense strand, thus forming 21 nucleotide base pairs and a sequences. By moving the sequence “window progressively two-base overhang at the 3'-end of the antisense strand. The one nucleotide upstream or downstream of an initial target two single strands, the sense Strand and the antisense Strand, sequence location, the next potential target sequence can be of ALN-60519 can be synthesized by conventional solid identified, until the complete set of possible sequences is phase oligonucleotide synthesis, employing standard phos identified for any given target size selected. This process, phoramidite chemistry with the 5'-hydroxyl group protected coupled with Systematic synthesis and testing of the identified as dimethoxytriphenylmethyl (DMT) ether. Each strand can sequences (using assays as described herein or as known in be assembled from the 3' to the 5' terminus by sequential theart) to identify those sequences that perform optimally can addition of protected nucleoside phosphoramidites. identify those RNA sequences that, when targeted with an 0384. In these aspects, one of the two sequences is iRNA agent, mediate the best inhibition of target gene expres complementary to the other of the two sequences, with one of Sion. Thus, while the sequences identified, for example, in the the sequences being Substantially complementary to a tables herein, represent effective target sequences, it is con sequence of an mRNA generated by the expression of an templated that further optimization of inhibition efficiency US 2016/0244766 A1 Aug. 25, 2016 30 can be achieved by progressively “walking the window' one stabilizing bases, destabilizing bases, or bases that base pair nucleotide upstream or downstream of the given sequences to with an expanded repertoire of partners, removal of bases identify sequences with equal or better inhibition character (abasic nucleotides), or conjugated bases, (c) Sugar modifi istics. cations (e.g., at the 2' position or 4' position, or having an 0388 Further, it is contemplated that for any sequence acyclic Sugar) or replacement of the Sugar, as well as (d) identified, e.g., in the tables herein, further optimization can backbone modifications, including modification or replace be achieved by Systematically either adding or removing ment of the phosphodiester linkages. Specific examples of nucleotides to generate longer or shorter sequences and test RNA compounds useful in this invention include, but are not ing those and sequences generated by walking a window of limited to RNAs containing modified backbones or no natural the longer or shorter size up or down the target RNA from that internucleoside linkages. RNAs having modified backbones point. Again, coupling this approach to generating new can include, among others, those that do not have a phosphorus didate targets with testing for effectiveness of iRNAs based atom in the backbone. For the purposes of this specification, on those target sequences in an inhibition assay as known in and as sometimes referenced in the art, modified RNAs that the art or as described herein can lead to further improve do not have a phosphorus atom in their internucleoside back ments in the efficiency of inhibition. Further still, such opti bone can also be considered to be oligonucleosides. In par mized sequences can be adjusted by, e.g., the introduction of ticular embodiments, the modified RNA will have a phospho modified nucleotides as described herein or as known in the rus atom in its internucleoside backbone. art, addition orchanges in overhang, or other modifications as 0391 Modified RNA backbones include, for example, known in the art and/or discussed herein to further optimize phosphorothioates, chiral phosphorothioates, phospho the molecule (e.g., increasing serum stability or circulating rodithioates, phosphotriesters, aminoalkylphosphotriesters, half-life, increasing thermal stability, enhancing transmem methyl and other alkyl phosphonates including 3'-alkylene brane delivery, targeting to a particular location or cell type, phosphonates and chiral phosphonates, phosphinates, phos increasing interaction with silencing pathway enzymes, phoramidates including 3'-amino phosphoramidate and ami increasing release from endosomes, etc.) as an expression noalkylphosphoramidates, thionophosphoramidates, thion inhibitor. oalkylphosphonates, thionoalkylphosphotriesters, and 0389. An iRNA as described herein can contain one or boranophosphates having normal 3'-5' linkages. 2'-5' linked more mismatches to the target sequence. In one embodiment, analogs of these, and those) having inverted polarity wherein an iRNA as described herein contains no more than 3 mis the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or matches. If the antisense strand of the iRNA contains mis 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are matches to a target sequence, it is preferable that the area of also included. mismatch not be located in the center of the region of comple 0392 Representative U.S. patents that teach the prepara mentarity. If the antisense strand of the iRNA contains mis matches to the target sequence, it is preferable that the mis tion of the above phosphorus-containing linkages include, but match be restricted to be within the last 5 nucleotides from are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476, either the 5' or 3' end of the region of complementarity. For 301:5,023,243; 5,177, 195; 5,188,897; 5,264,423: 5,276,019; example, for a 23 nucleotide iRNA agent RNA strand which 5,278.302: 5,286,717; 5,321,131; 5,399,676; 5,405,939; is complementary to a region of an ALAS1 gene, the RNA 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; Strand generally does not contain any mismatch within the 5,536,821; 5,541,316; 5,550,111; 5,563,253: 5,571,799; central 13 nucleotides. The methods described herein or 5,587,361; 5,625,050; 6,028, 188: 6,124,445; 6,160,109: methods known in the art can be used to determine whetheran 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326, 199: iRNA containing a mismatch to a target sequence is effective 6,346,614; 6,444,423: 6,531,590; 6,534,639; 6,608,035: in inhibiting the expression of an ALAS1 gene. Consideration 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; of the efficacy of iRNAs with mismatches in inhibiting 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, expression of an ALAS1 gene is important, especially if the each of which is herein incorporated by reference. particular region of complementarity in an ALAS1 gene is 0393 Modified RNA backbones that do not include a known to have polymorphic sequence variation within the phosphorus atom therein have backbones that are formed by population. short chain alkyl or cycloalkyl internucleoside linkages, 0390. In one embodiment, at least one end of a dsRNA has mixed heteroatoms and alkyl or cycloalkyl internucleoside a single-stranded nucleotide overhang of 1 to 4, generally 1 or linkages, or one or more short chain heteroatomic or hetero 2 nucleotides. dsRNAs having at least one nucleotide over cyclic internucleoside linkages. These include those having hang have unexpectedly Superior inhibitory properties rela morpholino linkages (formed in part from the Sugar portion of tive to their blunt-ended counterparts. In yet another embodi a nucleoside); siloxane backbones; Sulfide, Sulfoxide and Sul ment, the RNA of an iRNA, e.g., a dsRNA, is chemically fone backbones; formacetyl and thioformacetyl backbones: modified to enhance stability or other beneficial characteris methylene formacetyl and thioformacetylbackbones; alkene tics. The nucleic acids featured in the invention may be syn containing backbones; Sulfamate backbones; methylene thesized and/or modified by methods well established in the imino and methylenehydrazino backbones; Sulfonate and Sul art, such as those described in “Current protocols in nucleic fonamide backbones; amide backbones; and others having acid chemistry.” Beaucage, S. L. et al. (Edrs.), John Wiley & mixed N, O, S and CH component parts. Sons, Inc., New York, N.Y., USA, which is hereby incorpo 0394 Representative U.S. patents that teach the prepara rated herein by reference. Modifications include, for tion of the above oligonucleosides include, but are not limited example, (a) end modifications, e.g., 5' end modifications to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214, (phosphorylation, conjugation, inverted linkages, etc.) 3' end 134: 5,216,141, 5,235,033; 5,64,562: 5,264,564; 5,405,938; modifications (conjugation, DNA nucleotides, inverted link 5.434,257; 5,466,677; 5,470,967: 5489,677: 5,541,307; ages, etc.), (b) base modifications, e.g., replacement with 5,561.225; 5,596,086; 5,602,240; 5,608,046; 5,610,289: US 2016/0244766 A1 Aug. 25, 2016

5,618,704; 5,623,070; 5,663,312:5,633,360; 5,677,437; and, 0398. In other embodiments, an iRNA agent comprises 5,677,439, each of which is herein incorporated by reference. one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides (or nucleosides). In certain embodiments, 0395. In other RNA mimetics suitable or contemplated for the sense strand or the antisense Strand, or both sense strand use in iRNAS, both the Sugar and the internucleoside linkage, and antisense Strand, include less than five acyclic nucle i.e., the backbone, of the nucleotide units are replaced with otides per Strand (e.g., four, three, two or one acyclic nucle novel groups. The base units are maintained for hybridization otides per Strand). The one or more acyclic nucleotides can be with an appropriate nucleic acid target compound. One Such found, for example, in the double-stranded region, of the oligomeric compound, an RNA mimetic that has been shown sense or antisense strand, or both Strands; at the 5'-end, the to have excellent hybridization properties, is referred to as a 3'-end, both of the 5' and 3'-ends of the sense or antisense peptide nucleic acid (PNA). In PNA compounds, the sugar strand, or both strands, of the iRNA agent. In one embodi backbone of an RNA is replaced with an amide containing ment, one or more acyclic nucleotides are present at positions backbone, in particular an aminoethylglycine backbone. The 1 to 8 of the sense orantisense strand, or both. In one embodi nucleobases are retained and are bound directly or indirectly ment, one or more acyclic nucleotides are found in the anti to aza nitrogen atoms of the amide portion of the backbone. sense Strand at positions 4 to 10 (e.g., positions 6-8) from the Representative U.S. patents that teach the preparation of PNA 5'-end of the antisense strand. In another embodiment, the one compounds include, but are not limited to, U.S. Pat. Nos. or more acyclic nucleotides are found at one or both 3'-ter 5,539,082; 5,714,331; and 5,719,262, each of which is herein minal overhangs of the iRNA agent. incorporated by reference. Further teaching of PNA com 0399. The term “acyclic nucleotide' or “acyclic nucleo pounds can be found, for example, in Nielsen et al., Science, side' as used herein refers to any nucleotide or nucleoside 1991, 254, 1497-1500. having an acyclic Sugar, e.g., an acyclic ribose. An exemplary 0396. Some embodiments featured in the invention acyclic nucleotide or nucleoside can include a nucleobase, include RNAs with phosphorothioate backbones and oligo e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleosides with heteroatom backbones, and in particular nucleobase as described herein). In certain embodiments, a CH NH-CH , CH N(CH) O CH bond between any of the ribose carbons (C1, C2, C3, C4, or known as a methylene (methylimino) or MMI backbone, C5), is independently or in combination absent from the CH2—O N(CH)—CH2—, CH, N(CH) N nucleotide. In one embodiment, the bond between C2-C3 (CH)—CH2—and N(CH)—CH, CH, wherein the carbons of the ribose ring is absent, e.g., an acyclic 2'-3'-seco native phosphodiester backbone is represented as —O—P- nucleotide monomer. In other embodiments, the bond O CH of the above-referenced U.S. Pat. No.5.489,677, between C1-C2, C3-C4, or C4-05 is absent (e.g., a 1'-2',3'-4" and the amide backbones of the above-referenced U.S. Pat. or 4'-5'-seco nucleotide monomer). Exemplary acyclic nucle No. 5,602.240. In some embodiments, the RNAs featured otides are disclosed in U.S. Pat. No. 8.314,227, incorporated herein have morpholino backbone structures of the above herein by reference in its entirely. For example, an acyclic referenced U.S. Pat. No. 5,034,506. nucleotide can include any of monomers D-J in FIGS. 1-2 of 0397 Modified RNAs may also contain one or more sub U.S. Pat. No. 8.314,227. In one embodiment, the acyclic stituted sugar moieties. The iRNAs, e.g., dsRNAs, featured nucleotide includes the following monomer: herein can include one of the following at the 2' position: OH: F: O— S , or N-alkyl: O S , or N-alkenyl: O S- or N-alkynyl: or O-alkyl-O-alkyl, wherein the alkyl, alkenyland alkynyl may be substituted or unsubstituted C to Coalkyl or O Base C. to Coalkenyl and alkynyl. Exemplary Suitable modifica tions include O(CH), OCH, O(CH).OCH, O(CH) NH, O(CH2)CH, O(CH), ONH, and O(CH), ON (CH),CH), where n and m are from 1 to about 10. In O OH other embodiments, dsRNAs include one of the following at the 2' position: C to Co lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF. OCF, SOCH, SOCHONO., NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, Substituted silyl, an RNA cleaving group, a 04.00 wherein Base is a nucleobase, e.g., a naturally-oc reporter group, an intercalator, a group for improving the curring or a modified nucleobase (e.g., a nucleobase as pharmacokinetic properties of an iRNA, or a group for described herein). improving the pharmacodynamic properties of an iRNA, and 04.01. In certain embodiments, the acyclic nucleotide can other Substituents having similar properties. In some embodi be modified or derivatized, e.g., by coupling the acyclic ments, the modification includes a 2'-methoxyethoxy (2'-O- nucleotide to another moiety, e.g., a ligand (e.g., a GalNAc, a CHCHOCH, also known as 2'-O-(2-methoxyethyl) or cholesterol ligand), an alkyl, a polyamine, a Sugar, a polypep 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) tide, among others. i.e., an alkoxy-alkoxy group. Another exemplary modifica 0402. In other embodiments, the iRNA agent includes one tion is 2'-dimethylaminooxyethoxy, i.e. a O(CH)ON or more acyclic nucleotides and one or more LNAS (e.g., an (CH) group, also known as 2'-DMAOE, as described in LNA as described herein). For example, one or more acyclic examples herein below, and 2'-dimethylaminoethoxyethoxy nucleotides and/or one or more LNAs can be present in the (also known in the art as 2'-O-dimethylaminoethoxyethyl or sense strand, the antisense strand, or both. The number of 2'-DMAEOE), i.e., 2'-O CH, O CH N(CH), also acyclic nucleotides in one strand can be the same or different described in examples herein below. from the number of LNAs in the opposing strand. In certain US 2016/0244766 A1 Aug. 25, 2016 32 embodiments, the sense Strand and/or the antisense Strand 1990, these disclosed by Englischet al., Angewandte Chemie, comprises less than five LNAS (e.g., four, three, two or one International Edition, 1991, 30, 613, and those disclosed by LNAs) located in the double-stranded region or a 3'-over Sanghvi, Y. S., Chapter 15, dsRNA Research and Applica hang. In other embodiments, one or two LNAS are located in tions, pages 289-302, Crooke, S.T. and Lebleu, B., Ed., CRC the double stranded region or the 3'-overhang of the sense Press, 1993. Certain of these nucleobases are particularly Strand. Alternatively, or in combination, the sense Strand and/ useful for increasing the binding affinity of the oligomeric or antisense Strand comprises less than five acyclic nucle compounds featured in the invention. These include 5-substi otides (e.g., four, three, two or one acyclic nucleotides) in the tuted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 double-stranded region or a 3'-overhang. In one embodiment, Substituted purines, including 2-aminopropyladenine, 5-pro the sense strand of the iRNA agent comprises one or two pynyluracil and 5-propynylcytosine. 5-methylcytosine Sub LNAs in the 3'-overhang of the sense strand, and one or two stitutions have been shown to increase nucleic acid duplex acyclic nucleotides in the double-standed region of the anti stability by 0.6-1.2°C. (Sanghvi, Y. S., Crooke, S. T. and sense strand (e.g., at positions 4 to 10 (e.g., positions 6-8) Lebleu, B., Eds., dsRNA Research and Applications, CRC from the 5'-end of the antisense strand) of the iRNA agent. Press, Boca Raton, 1993, pp. 276-278) and are exemplary 0403. In other embodiments, inclusion of one or more base Substitutions, even more particularly when combined acyclic nucleotides (alone or in addition to one or more with 2'-O-methoxyethyl sugar modifications. LNAs) in the iRNA agent results in one or more (orall) of: (i) 0406 Representative U.S. patents that teach the prepara a reduction in an off-target effect; (ii) a reduction in passenger tion of certain of the above noted modified nucleobases as Strand participation in RNAi; (iii) an increase in specificity of well as other modified nucleobases include, but are not lim the guide strand for its target mRNA; (iv) a reduction in a ited to, the above noted U.S. Pat. No. 3,687,808, as well as microRNA off-target effect; (v) an increase instability; or (vi) U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273: an increase in resistance to degradation, of the iRNA mol 5,367,066; 5,432,272; 5.457,187; 5,459.255; 5,484,908: ecule. 5,502,177; 5,525,711; 5,552,540: 5,587,469; 5,594,121, 04.04 Other modifications include 2'-methoxy (2'-OCH), 5,596,091; 5,614,617; 5,681,941; 6,015,886; 6,147,200; 2'-aminopropoxy (2'-OCH2CHCH-NH) and 2'-fluoro (2'- 6,166, 197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; F) Similar modifications may also be made at other positions 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, on the RNA of an iRNA, particularly the 3' position of the each of which is herein incorporated by reference, and U.S. sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs Pat. No. 5,750,692, also herein incorporated by reference. and the 5' position of 5' terminal nucleotide. iRNAs may also 0407. The RNA of an iRNA can also be modified to have Sugar mimetics such as cyclobutyl moieties in place of include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or the pentofuranosyl Sugar. Representative U.S. patents that more) locked nucleic acids (LNA), (also referred to hereinas teach the preparation of Such modified Sugar structures “locked nucleotides’). In one embodiment, a locked nucleic include, but are not limited to, U.S. Pat. Nos. 4,981,957: acid is a nucleotide having a modified ribose moiety in which 5,118,800; 5,319,080; 5,359,044: 5,393,878; 5,446,137; the ribose moiety comprises an extra bridge connecting, e.g., 5,466,786; 5,514,785; 5,519,134: 5,567,811: 5,576.427; the 2' and 4 carbons. This structure effectively “locks” the 5,591,722; 5,597,909; 5,610,300; 5,627,053: 5,639,873; ribose in the 3'-endo structural conformation. The addition of 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of locked nucleic acids to siRNAs has been shown to increase which are commonly owned with the instant application, and siRNA stability in serum, increase thermal stability, and to each of which is herein incorporated by reference. reduce off-target effects (Elmen, J. et al., (2005) Nucleic 04.05 An iRNA may also include nucleobase (often Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol referred to in the art simply as “base') modifications or sub Canc Ther. 6(3):833-843; Grunweller, A. et al., (2003) stitutions. As used herein, “unmodified’ or “natural nucleo Nucleic Acids Research 31(12):3185-3193). bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil 0408 Representative U.S. patents that teach the prepara (U). Modified nucleobases include other synthetic and natu tion of locked nucleic acid nucleotides include, but are not ral nucleobases such as 5-methylcytosine (5-me-C), 5-hy limited to, the following: U.S. Pat. Nos. 6,268,490; 6,670, droxymethyl cytosine, Xanthine, hypoxanthine, 2-aminoad 461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; 7,399,845; enine, 6-methyl and other alkyl derivatives of adenine and and 8.314,227, each of which is herein incorporated by ref guanine, 2-propyl and other alkyl derivatives of adenine and erence in its entirety. Exemplary LNAs include but are not guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, limited to, a 2', 4'-C methylene bicyclo nucleotide (see for 5-halouracil and cytosine, 5-propynyl uracil and cytosine, example Wengel et al., International PCT Publication No. 6-aZO uracil, cytosine and thymine, 5-uracil (pseudouracil), WO 00/66604 and WO 99/14226). 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hy 04.09. In other embodiments, the iRNA agents include one droxyl anal other 8-substituted adenines and guanines, or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) 5-halo, particularly 5-bromo, 5-trifluoromethyl and other G-clamp nucleotides. A G-clamp nucleotide is a modified 5-substituted uracils and cytosines, 7-methylguanine and cytosine analog wherein the modifications confer the ability 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deaza to hydrogen bond both Watson-Crick and Hoogsteen faces of guanine and 7-daaZaadenine and 3-deazaguanine and 3-dea a complementary guanine within a duplex, see for example Zaadenine. Further nucleobases include those disclosed in Lin and Matteucci, 1998, J. Am. Chem. Soc., 120,8531-8532. U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleo A single G-clamp analog Substitution within an oligonucle sides in Biochemistry, Biotechnology and Medicine, otide can result in substantially enhanced helical thermal Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The stability and mismatch discrimination when hybridized to Concise Encyclopedia Of Polymer Science And Engineering, complementary oligonucleotides. The inclusion of Such pages 858-859, Kroschwitz, J. L., ed. John Wiley & Sons, nucleotides in the iRNA molecules can result in enhanced US 2016/0244766 A1 Aug. 25, 2016

affinity and specificity to nucleic acid targets, complementary 0425. When the sense strand is represented as formula sequences, or template strands. (Id), each N, independently represents an oligonucleotide 0410 Potentially stabilizing modifications to the ends of sequence comprising 0-10. 0-7, 0-5, 0-4, 0-2 or 0 modified RNA molecules can include N-(acetylaminocaproyl)-4-hy nucleotides. Preferably, N, is 0,1,2,3,4, 5 or 6. Each N can droxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyproli independently represent an oligonucleotide sequence com nol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), prising 2-20, 2-15, or 2-10 modified nucleotides. thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)- 0426 Each of X, Y and Z may be the same or different 4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine from each other. 3'-phosphate, inverted base dT(idT) and others. Disclosure 0427. In other embodiments, i is 0 and is 0, and the sense of this modification can be found in PCT Publication No. WO strand may be represented by the formula: 2011 FOO5861. iRNA Motifs 0411. In one embodiment, the sense Strand sequence may 0428. When the sense strand is represented by formula be represented by formula (I): (Ia), each N independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucle 5'n-N-(XXX), N. YYY N-(ZZZ), otides. N-n3' (I) 0429. In one embodiment, the antisense strand sequence 0412 wherein: of the RNAi may be represented by formula (II): 0413 i and are each independently 0 or 1; 0414 p and q are each independently 0-6: N'-n'3' (II) 0415 each N independently represents an oligonucle 0430 wherein: otide sequence comprising 0-25 modified nucleotides, each 0431 k and 1 are each independently 0 or 1; sequence comprising at least two differently modified nucle 0432 p' and q are each independently 0-6: otides; 0433 each N independently represents an oligonucle 0416 each N, independently represents an oligonucle otide sequence comprising 0-25 modified nucleotides, each otide sequence comprising 0-10 modified nucleotides; sequence comprising at least two differently modified nucle 0417 each n, and n independently represent an overhang otides; nucleotide; 0434 each N independently represents an oligonucle 0418 wherein Nb and Y do not have the same modifica otide sequence comprising 0-10 modified nucleotides; tion; and 0435 each n, and n independently represent an over 0419 XXX,YYY and ZZZ each independently represent hang nucleotide; one motif of three identical modifications on three consecu 0436 wherein N, and Y do not have the same modifica tive nucleotides. Preferably YYY is all 2'-F modified nucle tion; otides. 0437 and 0420. In one embodiment, the N and/or N, comprise 0438 X'X'X', YYY and ZZZ each independently rep modifications of alternating pattern. resent one motif of three identical modifications on three 0421. In one embodiment, the YYY motifoccurs at or near consecutive nucleotides. the cleavage site of the sense strand. For example, when the 0439. In one embodiment, the N" and/or N. comprise RNAi agent has a duplex region of 17-23 nucleotides in modifications of alternating pattern. length, the YYY motif can occur at or the vicinity of the 0440 The Y'Y'Y' motif occurs at or near the cleavage site cleavage site (e.g.: can occurat positions 6, 7, 8; 7.8, 9, 8, 9. of the antisense strand. For example, when the RNAi agent 10; 9, 10, 11; 10, 11, 12 or 11, 12, 13) of the sense strand, the has a duplex region of 17-23 nucleotide in length, the YYY count starting from the 1 nucleotide, from the 5'-end; or motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; optionally, the count starting at the 1 paired nucleotide 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count within the duplex region, from the 5'-end. starting from the 1 nucleotide, from the 5'-end; or optionally, 0422. In one embodiment, i is 1 and is 0, or i is 0 and is the count starting at the 1 paired nucleotide within the 1, or both i and j are 1. The sense strand can therefore be duplex region, from the 5'-end. Preferably, the YYY motif represented by the following formulas: occurs at positions 11, 12, 13. 5'n-N, YYY N. ZZZ N-n3' (Ib): 0441. In one embodiment, Y'Y'Y' motif is all 2'-OMe modified nucleotides. 5'n-N XXX N. YYY N-n3' (Ic); or 0442. In one embodiment, k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1. 5'n-N XXX N. YYY N. ZZZ N-n3 (Id). 0443) The antisense strand can therefore be represented by 0423. When the sense strand is represented by formula the following formulas: (Ib), N, represents an oligonucleotide sequence comprising 5'n-N, ZZZ N. YYY N'-n3' (IIb): 0-10. 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N independently can represent an oligonucleotide sequence 5'n-N. Y'Y'Y' N, XXX"-na' (IIc); or comprising 2-20, 2-15, or 2-10 modified nucleotides. 0424. When the sense strand is represented as formula 5'n-N. ZZZ N. YYY: N, X'X'X' N'- (Ic), N, represents an oligonucleotide sequence comprising n3' (IId). 0-10. 0-7, 0-5,0-4, 0-2 or 0 modified nucleotides. Each N can 0444. When the antisense strand is represented by formula independently represent an oligonucleotide sequence com (IIb), N represents an oligonucleotide sequence comprising prising 2-20, 2-15, or 2-10 modified nucleotides. 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N US 2016/0244766 A1 Aug. 25, 2016 34 independently represents an oligonucleotide sequence com 0455 wherein: prising 2-20, 2-15, or 2-10 modified nucleotides. 0456 i, j, k, and 1 are each independently 0 or 1; 0445. When the antisense strand is represented as formula 0457 p. p', q, and q are each independently 0-6: (IIc), N.' represents an oligonucleotide sequence comprising 0458 each N and N' independently represents an oligo 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N nucleotide sequence comprising 0-25 modified nucleotides, independently represents an oligonucleotide sequence com each sequence comprising at least two differently modified prising 2-20, 2-15, or 2-10 modified nucleotides. nucleotides; 0446. When the antisense strand is represented as formula (IId), each N' independently represents an oligonucleotide 0459 each N, and N' independently represents an oligo sequence comprising 0-10. 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotide sequence comprising 0-10 modified nucleotides; nucleotides. Each N' independently represents an oligo 0460 wherein nucleotide sequence comprising 2-20, 2-15, or 2-10 modified I0461) each n, n, n, and in each of which may or may nucleotides. Preferably, N, is 0, 1, 2, 3, 4, 5 or 6. not be present, independently represents an overhang nucle 0447. In other embodiments, k is 0 and 1 is 0 and the otide; and antisense strand may be represented by the formula: 0462. XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and ZZZ each independently represent one motif of three identical modifi cations on three consecutive nucleotides. 0448. When the antisense strand is represented as formula 0463. In one embodiment, i is 0 and is 0; or i is 1 and is (IIa), each N' independently represents an oligonucleotide 0; or i is 0 and is 1; or both i and are 0; or both i and are 1. sequence comprising 2-20, 2-15, or 2-10 modified nucle In another embodiment, k is 0 and 1 is 0; or k is 1 and 1 is 0; k otides. is 0 and 1 is 1; or both k and 1 are 0; or both k and 1 are 1. 0449 Each of X, Y and Z may be the same or different 0464 Exemplary combinations of the sense strand and from each other. antisense strand forming a RNAi duplex include the formulas 04.50 Each nucleotide of the sense strand and antisense below: strand may be independently modified with LNA, HNA, CeNA 2'-methoxyethyl, 2'-O-methyl. 2'-O-allyl. 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide of the sense Strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X, Y and Z, in particular, may represent a 2'-O-methyl modification or a 2'-fluoro modification. 0451. In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1° nucleotide from the 5'-end, or optionally, the count starting at the 1° paired nucleotide within the duplex region, from the 5'-end; and Y represents 2'-F modification. The sense Strand may additionally contain 3'n'-N-XXX N. Y'Y'Y' N, ZZZ N XXX motif or ZZZ motifs as wing modifications at the oppo n'5" (IIId) site end of the duplex region; and XXX and ZZZ each inde 0465. When the RNAi agent is represented by formula pendently represents a 2'-OMe modification or 2'-F modifi (IIIa), each N independently represents an oligonucleotide cation. sequence comprising 2-20, 2-15, or 2-10 modified nucle 0452. In one embodiment the antisense strand may contain otides. Y'Y'Y' motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1 nucleotide from the 5'-end, or 0466 When the RNAi agent is represented by formula optionally, the count starting at the 1 paired nucleotide (IIIb), each N, independently represents an oligonucleotide within the duplex region, from the 5'-end; and Y' represents sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucle 2'-O-methyl modification. The antisense strand may addi otides. Each N independently represents an oligonucleotide tionally contain X'X'X' motif or ZZZ motifs as wing modi sequence comprising 2-20, 2-15, or 2-10 modified nucle fications at the opposite end of the duplex region; and X'X'X' otides. and ZZZ each independently represents a 2'-OMe modifi 0467. When the RNAi agent is represented as formula cation or 2'-F modification. (IIIc), each N, N' independently represents an oligonucle 0453 The sense strand represented by any one of the otide sequence comprising 0-10. 0-7, 0-5, 0-4, 0-2 or 0 modi above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a fied nucleotides. Each N independently represents an oligo antisense Strand being represented by any one of formulas nucleotide sequence comprising 2-20, 2-15, or 2-10 modified (IIa), (IIb), (IIc), and (IId), respectively. nucleotides. 0454. Accordingly, the RNAi agents for use in the meth 0468. When the RNAi agent is represented as formula ods of the invention may comprise a sense strand and an (IIId), each N, N' independently represents an oligonucle antisense strand, each Strand having 14 to 30 nucleotides, the otide sequence comprising 0-10. 0-7, 0-5, 0-4, 0-2 or 0 modi RNAi duplex represented by formula (III): fied nucleotides. Each N, N' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 sense: 5'n-N-(XXX), N. YYY N, (ZZ modified nucleotides. Each of N, N', N, and N' indepen dently comprises modifications of alternating pattern. antisense: 3'n'-N'-(X'X'X'), N, YYY N.— 0469 Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (ZZZ) N'-n 5' (III) (IIIc), and (IIId) may be the same or different from each other. US 2016/0244766 A1 Aug. 25, 2016

0470 When the RNAi agent is represented by formula duplexes are connected by a linker. The linker can be cleav (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y able or non-cleavable. Optionally, the multimer further com nucleotides may form a base pair with one of the Y nucle prises a ligand. Each of the duplexes can target the same gene otides. Alternatively, at least two of the Y nucleotides form or two different genes; or each of the duplexes can target same base pairs with the corresponding Y nucleotides; or all three gene at two different target sites. of the Y nucleotides all form base pairs with the correspond 0478. In one embodiment, two RNAi agents represented ing Y nucleotides. by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to 0471. When the RNAi agent is represented by formula each other at the 5' end, and one or both of the 3' ends and are (IIIb) or (IIId), at least one of the Z nucleotides may form a optionally conjugated to to a ligand. Each of the agents can base pair with one of the Z nucleotides. Alternatively, at least target the same gene or two different genes; or each of the two of the Z nucleotides form base pairs with the correspond agents can target same gene at two different target sites. ing Z. nucleotides; or all three of the Z nucleotides all form iRNA Conjugates base pairs with the corresponding Z. nucleotides. 0479. The iRNA agents disclosed hereincan be in the form 0472. When the RNAi agent is represented as formula of conjugates. The conjugate may be attached at any Suitable (IIIc) or (IIId), at least one of the X nucleotides may form a location in the iRNA molecule, e.g., at the 3' end or the 5' end base pair with one of the X nucleotides. Alternatively, at least of the sense or the antisense Strand. The conjugates are two of the X nucleotides form base pairs with the correspond optionally attached via a linker. ing X" nucleotides; or all three of the X nucleotides all form 0480. In some embodiments, an iRNA agent described base pairs with the corresponding X" nucleotides. herein is chemically linked to one or more ligands, moieties 0473. In one embodiment, the modification on the Y or conjugates, which may confer functionality, e.g., by affect nucleotide is different than the modification on the Y nucle ing (e.g., enhancing) the activity, cellular distribution or cel otide, the modification on the Z nucleotide is different than lular uptake of the iRNA. Such moieties include but are not the modification on the Z nucleotide, and/or the modification limited to lipid moieties such as a cholesterol moiety on the X nucleotide is different than the modification on the X (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989,86: 6553 nucleotide. 6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let. 0474. In one embodiment, when the RNAi agent is repre 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol sented by formula (IIId), the N modifications are 2'-O-me (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; thyl or 2'-fluoro modifications. In another embodiment, when Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765 the RNAi agent is represented by formula (IIId), the N modi 2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., fications are 2'-O-methyl or 2'-fluoro modifications and n>0 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or and at least one n is linked to a neighboring nucleotide a via undecyl residues (Saison-Behmoaras et al., EMBOJ, 1991, phosphorothioate linkage. In yet another embodiment, when 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327 the RNAi agent is represented by formula (IIId), the N modi 330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phos fications are 2'-O-methyl or 2'-fluoro modifications, n>0 pholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammo and at least one n is linked to a neighboring nucleotide via nium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate phosphorothioate linkage, and the sense Strand is conjugated (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; to one or more GalNAc derivatives attached through a biva Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a lent or trivalent branched linker. In another embodiment, polyamine or a polyethylene glycol chain (Manoharan et al., when the RNAi agent is represented by formula (IIId), the N. Nucleosides & Nucleotides, 1995, 14:969-973), or adaman modifications are 2'-O-methyl or 2'-fluoro modifications, tane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, n>0 and at least one n' is linked to a neighboring nucleotide 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. via phosphorothioate linkage, the sense strand comprises at Biophys. Acta, 1995, 1264:229-237), or an octadecylamine least one phosphorothioate linkage, and the sense strand is orhexylamino-carbonyloxycholesterol moiety (Crooke et al., conjugated to one or more GalNAc derivatives attached J. Pharmacol. Exp. Ther., 1996, 277:923-937). through a bivalent or trivalent branched linker. 0481. In one embodiment, a ligand alters the distribution, 0475. In one embodiment, when the RNAi agent is repre targeting or lifetime of an iRNA agent into which it is incor sented by formula (IIIa), the N modifications are 2'-O-me porated. In some embodiments, a ligand provides an thyl or 2'-fluoro modifications, n>0 and at least one n' is enhanced affinity for a selected target, e.g., molecule, cell or linked to a neighboring nucleotide via phosphorothioate link cell type, compartment, e.g., a cellular or organ compartment, age, the sense Strand comprises at least one phosphorothioate tissue, organ or region of the body, as, e.g., compared to a linkage, and the sense strand is conjugated to one or more species absent such a ligand. Typicalligands will not take part GalNAc derivatives attached through a bivalent or trivalent in duplex pairing in a duplexed nucleic acid. branched linker. 0482 Ligands can include a naturally occurring Sub 0476. In one embodiment, the RNAi agent is a multimer stance. Such as a protein (e.g., human serum albumin (HSA), containing at least two duplexes represented by formula (III), low-density lipoprotein (LDL), or globulin); carbohydrate (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are con (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin nected by a linker. The linker can be cleavable or non-cleav or hyaluronic acid); or a lipid. The ligand may also be a able. Optionally, the multimer further comprises a ligand. recombinant or synthetic molecule. Such as a synthetic poly Each of the duplexes can target the same gene or two different mer, e.g., a synthetic polyamino acid. Examples of polyamino genes; or each of the duplexes can target same gene at two acids include polyamino acid is a polylysine (PLL), poly different target sites. L-aspartic acid, poly L-glutamic acid, Styrene-maleic acid 0477. In one embodiment, the RNAi agent is a multimer anhydride copolymer, poly(L-lactide-co-glycolied) copoly containing three, four, five, six or more duplexes represented mer, divinyl ether-maleic anhydride copolymer, N-(2-hy by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the droxypropyl)methacrylamide copolymer (HMPA), polyeth US 2016/0244766 A1 Aug. 25, 2016 36 ylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, steroids, phospholipid analogues, peptides, protein binding poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, agents, PEG, vitamins etc. Exemplary PK modulators or polyphosphazine. Example of polyamines include: poly include, but are not limited to, cholesterol, fatty acids, cholic ethylenimine, polylysine (PLL), Spermine, spermidine, acid, lithocholic acid, dialkylglycerides, diacylglyceride, polyamine, pseudopeptide-polyamine, peptidomimetic phospholipids, sphingolipids, naproxen, ibuprofen, vitamin polyamine, dendrimer polyamine, arginine, amidine, prota E. biotin etc. Oligonucleotides that comprise a number of mine, cationic lipid, cationic porphyrin, quaternary Salt of a phosphorothioate linkages are also known to bind to serum polyamine, or an O. helical peptide. protein, thus short oligonucleotides, e.g., oligonucleotides of 0483 Ligands can also include targeting groups, e.g., a about 5 bases, 10 bases, 15 bases or 20 bases, comprising cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid multiple of phosphorothioate linkages in the backbone are or protein, e.g., an antibody, that binds to a specified cell type also amenable to the present invention as ligands (e.g. as PK Such as a kidney cell. A targeting group can be a thyrotropin, modulating ligands). In addition, aptamers that bind serum melanotropin, lectin, glycoprotein, Surfactant protein A, components (e.g. serum proteins) are also suitable for use as Mucin carbohydrate, multivalent lactose, multivalent galac PK modulating ligands in the embodiments described herein. tose, N-acetyl-galactosamine, N-acetyl-gulucosamine multi 0489 Ligand-conjugated oligonucleotides of the inven Valent mannose, multivalent fucose, glycosylated polyami tion may be synthesized by the use of an oligonucleotide that noacids, multivalent galactose, transferrin, bisphosphonate, bears a pendant reactive functionality, such as that derived polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, from the attachment of a linking molecule onto the oligo bile acid, folate, vitamin B12, biotin, or an RGD peptide or nucleotide (described below). This reactive oligonucleotide RGD peptide mimetic. may be reacted directly with commercially-available ligands, 0484. In some embodiments, the ligand is a GalNAc ligands that are synthesized bearing any of a variety of pro ligand that comprises one or more N-acetylgalactosamine tecting groups, or ligands that have a linking moiety attached (GalNAc) derivatives. Additional description of GalNAc thereto. ligands is provided in the section titled Carbohydrate Conju 0490 The oligonucleotides used in the conjugates of the gates. present invention may be conveniently and routinely made 0485. Other examples of ligands include dyes, intercalat through the well-known technique of Solid-phase synthesis. ing agents (e.g. acridines), cross-linkers (e.g. psoralene, mito mycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), poly Equipment for Such synthesis is sold by several vendors cyclic aromatic hydrocarbons (e.g., phenazine, including, for example, Applied BioSystems (Foster City, dihydrophenazine), artificial endonucleases (e.g. EDTA). Calif.). Any other means for Such synthesis known in the art lipophilic molecules, e.g., cholesterol, cholic acid, adaman may additionally or alternatively be employed. It is also tane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, known to use similar techniques to prepare other oligonucle 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, otides, such as the phosphorothioates and alkylated deriva hexadecylglycerol, borneol, menthol. 1,3-propanediol, hep tives. tadecyl group, palmitic acid, myristic acid, O3-(oleoyl)litho 0491 In the ligand-conjugated oligonucleotides and cholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or ligand-molecule bearing sequence-specific linked nucleo phenoxazine) and peptide conjugates (e.g., antennapedia sides of the present invention, the oligonucleotides and oli peptide, Tat peptide), alkylating agents, phosphate, amino, gonucleosides may be assembled on a suitable DNA synthe mercapto, PEG (e.g., PEG-40K), MPEG, MPEG), sizer utilizing standard nucleotide or nucleoside precursors, polyamino, alkyl, Substituted alkyl, radiolabeled markers, or nucleotide or nucleoside conjugate precursors that already enzymes, haptens (e.g. biotin), transport/absorption facilita bear the linking moiety, ligand-nucleotide or nucleoside-con tors (e.g., aspirin, vitamin E, folic acid), synthetic ribonu jugate precursors that already bear the ligand molecule, or cleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of non-nucleoside ligand-bearing building blocks. tetraazamacrocycles), dinitrophenyl, HRP, or AP 0492. When using nucleotide-conjugate precursors that 0486 Ligands can be proteins, e.g., glycoproteins, or pep already bear a linking moiety, the synthesis of the sequence tides, e.g., molecules having a specific affinity for a co-ligand, specific linked nucleosides is typically completed, and the or antibodies e.g., an antibody, that binds to a specified cell ligand molecule is then reacted with the linking moiety to type such as a cancer cell, endothelial cell, or bone cell. form the ligand-conjugated oligonucleotide. In some Ligands may also include hormones and hormone receptors. embodiments, the oligonucleotides or linked nucleosides of They can also include non-peptidic species, such as lipids, the present invention are synthesized by an automated Syn lectins, carbohydrates, vitamins, cofactors, multivalent lac thesizer using phosphoramidites derived from ligand-nucleo tose, multivalent galactose, N-acetyl-galactosamine, side conjugates in addition to the standard phosphoramidites N-acetyl-gulucosamine multivalent mannose, or multivalent and non-standard phosphoramidites that are commercially fucose. The ligand can be, for example, a lipopolysaccharide, available and routinely used in oligonucleotide synthesis. an activator of p38 MAP kinase, or an activator of NF-kB. Lipid Conjugates 0487. The ligand can be a substance, e.g., a drug, which can 0493 increase the uptake of the iRNA agent into the cell, for 0494. In one embodiment, the ligand is a lipid or lipid example, by disrupting the cell's cytoskeleton, e.g., by dis based molecule. Such a lipid or lipid-based molecule can rupting the cell's microtubules, microfilaments, and/or inter typically bind a serum protein, such as human serum albumin mediate filaments. The drug can be, for example, taxon, Vin (HSA). An HSA binding ligand allows for distribution of the cristine, vinblastine, cytochalasin, nocodazole. japlakinolide, conjugate to a target tissue, e.g., a non-kidney target tissue of latrunculin A, phalloidin, Swinholide A, indanocine, or myo the body. For example, the target tissue can be the liver, servin. including parenchymal cells of the liver. Other molecules that 0488. In some embodiments, a ligandattached to an iRNA can bind HSA can also be used as ligands. For example, as described herein acts as a pharmacokinetic modulator (PK neproxin or aspirin can be used. A lipid or lipid-based ligand modulator). PK modulators include lipophiles, bile acids, can (a) increase resistance to degradation of the conjugate, (b) US 2016/0244766 A1 Aug. 25, 2016 37 increase targeting or transport into a target cell or cell mem functioning as delivery peptides. A peptide or peptidomi brane, and/or (c) can be used to adjust binding to a serum metic can be encoded by a random sequence of DNA, such as protein, e.g., HSA. a peptide identified from a phage-display library, or one 0495. A lipid based ligand can be used to modulate, e.g., bead-one-compound (OBOC) combinatorial library (Lam et control (e.g., inhibit) the binding of the conjugate to a target al., Nature, 354:82-84, 1991). Typically, the peptide or pep tissue. For example, a lipid or lipid-based ligand that binds to tidomimetic tethered to a dsRNA agent via an incorporated HSA more strongly will be less likely to be targeted to the monomer unit is a cell targeting peptide such as an arginine kidney and therefore less likely to be cleared from the body. A glycine-aspartic acid (RGD)-peptide, or RGD mimic A pep lipid or lipid-based ligand that binds to HSA less strongly can tide moiety can range in length from about 5 amino acids to be used to target the conjugate to the kidney. about 40 amino acids. The peptide moieties can have a struc 0496. In one embodiment, the lipid based ligand binds tural modification, such as to increase stability or direct con HSA. For example, the ligand can bind HSA with a sufficient formational properties. Any of the structural modifications affinity Such that distribution of the conjugate to a non-kidney described below can be utilized. tissue is enhanced. However, the affinity is typically not so 0503. An RGD peptide for use in the compositions and strong that the HSA-ligand binding cannot be reversed. methods of the invention may be linear or cyclic, and may be 0497. In another embodiment, the lipid based ligand binds modified, e.g., glycosylated or methylated, to facilitate tar HSA weakly or not at all, such that distribution of the conju geting to a specific tissue(s). RGD-containing peptides and gate to the kidney is enhanced. Other moieties that target to peptidiomimemitics may include D-amino acids, as well as kidney cells can also be used in place of or in addition to the synthetic RGD mimics. In addition to RGD, one can use other lipid based ligand. moieties that target the integrin ligand. Preferred conjugates 0498. In another aspect, the ligand is a moiety, e.g., a of this ligand target PECAM-1 or VEGF. Vitamin, which is taken up by a target cell, e.g., a proliferating 0504. An RGD peptide moiety can be used to target a cell. These are particularly useful for treating disorders char particular cell type, e.g., a tumor cell. Such as an endothelial acterized by unwanted cell proliferation, e.g., of the malig tumor cell or a breast cancer tumor cell (Zitzmann et al., nant or non-malignant type, e.g., cancer cells. Exemplary Cancer Res., 62:5139-43, 2002). An RGD peptide can facili vitamins include vitamin A, E, and K. Other exemplary vita tate targeting of an dsRNA agent to tumors of a variety of mins include are B vitamin, e.g., folic acid, B12, riboflavin, other tissues, including the lung, kidney, spleen, or liver (Aoki biotin, pyridoxal or other vitamins or nutrients taken up by et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the cancer cells. Also included are HSA and low density lipopro RGD peptide will facilitate targeting of an iRNA agent to the tein (LDL). kidney. The RGD peptide can be linear or cyclic, and can be 0499 Cell Permeation Agents modified, e.g., glycosylated or methylated to facilitate target 0500. In another aspect, the ligand is a cell-permeation ing to specific tissues. For example, a glycosylated RGD agent, Such as a helical cell-permeation agent. In one embodi peptide can deliver a iRNA agent to a tumor cell expressing ment, the agent is amphipathic. An exemplary agent is a C.f3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). peptide such as tat orantennopedia. If the agent is a peptide, 0505. A “cell permeation peptide' is capable of permeat it can be modified, including a peptidylmimetic, invertomers, ing a cell, e.g., a microbial cell. Such as a bacterial or fungal non-peptide or pseudo-peptide linkages, and use of D-amino cell, or a mammalian cell. Such as a human cell. A microbial acids. The helical agent is typically an O-helical agent, and cell-permeating peptide can be, for example, an O.-helical can have a lipophilic and a lipophobic phase. linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond 0501. The ligand can be a peptide or peptidomimetic. A containing peptide (e.g., C.-defensin, B-defensin or bactene peptidomimetic (also referred to herein as an oligopeptido cin), or a peptide containing only one or two dominating mimetic) is a molecule capable of folding into a defined amino acids (e.g., PR-39 or indolicidin). A cell permeation three-dimensional structure similar to a natural peptide. The peptide can also include a nuclear localization signal (NLS). attachment of peptide and peptidomimetics to iRNA agents For example, a cell permeation peptide can be a bipartite can affect pharmacokinetic distribution of the iRNA, such as amphipathic peptide, such as MPG, which is derived from the by enhancing cellular recognition and absorption. The pep fusion peptide domain of HIV-1 gp41 and the NLS of SV40 tide or peptidomimetic moiety can be about 5-50 amino acids large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717 long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino 2724, 2003). acids long. 0506 Carbohydrate Conjugates 0502. A peptide or peptidomimetic can be, for example, a 0507. In some embodiments of the compositions and cell permeation peptide, cationic peptide, amphipathic pep methods of the invention, an iRNA oligonucleotide further tide, or hydrophobic peptide (e.g., consisting primarily of Tyr, comprises a carbohydrate. The carbohydrate conjugated Trp or Phe). The peptide moiety can be a dendrimer peptide, iRNA are advantageous for the in vivo delivery of nucleic constrained peptide or crosslinked peptide. In another alter acids, as well as compositions Suitable for in vivo therapeutic native, the peptide moiety can include a hydrophobic mem use, as described herein. As used herein, "carbohydrate' brane translocation sequence (MTS). An exemplary hydro refers to a compound which is either a carbohydrate perse phobic MTS-containing peptide is RFGF having the amino made up of one or more monosaccharide units having at least acid sequence AAVALLPAVLLALLAP (SEQID NO:3367). 6 carbonatoms (which can be linear, branched or cyclic) with An RFGF analogue (e.g., amino acid sequence AALLPVL an oxygen, nitrogen or Sulfur atom bonded to each carbon LAAP (SEQ ID NO:3368)) containing a hydrophobic MTS atom; or a compound having as a part thereof a carbohydrate can also be a targeting moiety. The peptide moiety can be a moiety made up of one or more monosaccharide units each “delivery' peptide, which can carry large polar molecules having at least six carbon atoms (which can be linear, including peptides, oligonucleotides, and protein across cell branched or cyclic), with an oxygen, nitrogen or Sulfur atom membranes. For example, sequences from the HIV Tat pro bonded to each carbon atom. Representative carbohydrates tein (GRKKRRQRRRPPQ (SEQ ID NO:3369)) and the include the Sugars (mono-, di-, tri- and oligosaccharides con Drosophila Antennapedia protein (RQIKIWFQNRRMK taining from about 4, 5, 6, 7, 8, or 9 monosaccharide units), WKK (SEQID NO:3370)) have been found to be capable of and polysaccharides such as starches, glycogen, cellulose and US 2016/0244766 A1 Aug. 25, 2016

polysaccharide gums. Specific monosaccharides include C5 some embodiments, the GalNAc conjugate targets the iRNA and above (e.g., C5, C6, C7, or C8) Sugars; di- and trisaccha to liver cells, e.g., by serving as a ligand for the asialoglyco rides include Sugars having two or three monosaccharide protein receptor of liver cells (e.g., hepatocytes). 0509. In some embodiments, the carbohydrate conjugate units (e.g., C5, C6, C7, or C8). comprises one or more GalNAc derivatives. The GalNAc 0508. In one embodiment, a carbohydrate conjugate com derivatives may be attached via a linker, e.g., a bivalent or prises a monosaccharide. In one embodiment, the monosac trivalent branched linker. In some embodiments the GalNAc charide is an N-acetylgalactosamine (GalNAc). GalNAc con conjugate is conjugated to the 3' end of the sense strand. In jugates are described, for example, in U.S. Pat. No. 8,106, Some embodiments, the GalNAc conjugate is conjugated to 022, the entire content of which is hereby incorporated herein the iRNA agent (e.g., to the 3' end of the sense strand) via a by reference. In some embodiments, the GalNAc conjugate linker, e.g., a linker as described herein. serves as a ligand that targets the iRNA to particular cells. In 0510. In some embodiments, the GalNAc conjugate is Formula II OH HO O H H HO O N-1- N O AcHN n-n-r O

OH HO O H H HO O N-1-N-N O

AcHN n-n-r O O r

OH HO O HO O N 1N-1a O H AcHN n-n-r H O

0511. In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the fol lowing schematic, wherein X is O or S

OH HO

AcHN

OH HO

AcHN US 2016/0244766 A1 Aug. 25, 2016

0512. In some embodiments, the RNAi agent is conju gated to L96 as defined in Table 1 and shown below

OH OH trans-4-Hydroxyprolinol HO R O ... O -N- AcHN n-n-n n1n 1 HO C O e OH OH O Qa-oilN Sites of Triantennary R O H H Conjugation GalNAc HOAcHN n-n-n N-n-N-n- O O O OH O H yuO C12 - Diacroboxylic Acid Tether HO O ACHN n-n-n-O N1-1NNH H

0513. In some embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

Formula II OH HO

HO & O Nu-1N1 lo AcHN O

OH HO O & O O HO n-n-r Nu-1N1 AcHN O O O OH HO

O O HO 1-1. O AcHN