The Role of CtIP in Lymphocyte Development and Lymphomagenesis
Xiaobin Wang
Submitted in partial fulfillment of the Requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences
COLUMBIA UNIVERSITY
2021
© 2021
Xiaobin Wang
All Rights Reserved
Abstract
The role of CtIP in lymphocyte development and lymphomagenesis
Xiaobin Wang
Chromosomal translocation is a characteristic feature of human lymphoid malignancies and a driver of the initiation and progression of the disease. They arise from the mis-repair of physiological DNA double-strand breaks (DSBs) generated during the assembly and subsequent modifications of the antigen receptor gene loci, namely V(D)J recombination and class switch recombination (CSR). Mammalian cells have three DSB repair pathways –classical non-homologous end-joining (cNHEJ), alternative end-joining (A-EJ), and homologous recombination. DNA end-resection that generates a single-strand 3’ overhang is a critical regulator for the repair pathway choice. Specifically, localized end-resection prevents cNHEJ and exposes flanking microhomology (MH) to promote error-prone A-EJ. In addition to DNA repair, DNA end-resection generates extended single-strand DNA, which activates the ATR- mediated cell cycle checkpoint and indirectly contributes to genomic integrity. The central goal of my thesis research is to investigate the physiological role of DNA end-resection initiation in lymphocyte development and lymphomagenesis.
DNA end-resection in mammalian cells is mostly initiated by the endonuclease activity of
MRE11-RAD50-NBS1 (MRN) complex aided by CtIP. In addition, MRN protein also recruits
EXO1 and DNA2 nucleases in combination with Top3 helicase complex for more extensive resection. The CtIP protein is essential for the endonuclease activity of the MRN complex that initiates DNA end-resection. CtIP is essential for embryonic development. Here I utilized B cell- specific conditional deletion models and loss-of-function mutations to investigate the role and regulation of CtIP and CtIP-mediated DNA end-resection in lymphocyte development and tumorigenesis.
The level and extent of CtIP-mediated resection are tightly regulated. For the first aim, we applied the ATAC-Seq and EndSeq methods to test whether chromatin accessibility determines the level of DNA end-resection. Specially, we found that chromatin-bound DNA damage response factors – H2AX and 53BP1- reduced the accessibility of the DNA around the DSBs and antagonized end-resection. Our data also suggest that during DNA damage response, the nucleosome-free or accessible regions are more prone to secondary DNA breakages.
Mechanistically, the preferential vulnerability is correlated with the availability of chromatin- bound DNA damage response factor 53BP1, which protects the nucleosome covered region at the price of the nucleosome-free regions. The work provides one explanation for tissue and cell type-specific translocations in transcriptionally active regions and super-enhancers.
For the second and third aims, I investigated the role of CtIP and CtIP-mediated end-resection in lymphocyte development and lymphomagenesis in vivo using the conditional deletional CtIP allele and a phosphorylation-deficient CtIP-T855A mutant. T855 phosphorylation promotes end- resection but is not essential for cellular viability. I identified a sequence-context-dependent role of CtIP and end-resection in A-EJ mediated repair. We found that the reduced level of end- resection did not alter the frequency of the A-EJ mediated joining during B cell CSR, nor the levels of micro-homology at the junction, a defining feature of A-EJ mediated repair. These findings, for the first time, showed that DNA end-resection is not essential for A-EJ-mediated chromosomal DSBs repair nor for the generation of MH at the junction in vivo. This unexpected observation also highlights a tissue- and cell type-specific regulation of A-EJ and the importance of sequence context for A-EJ. Moreover, we found that ATM kinase suppresses A-EJ mediated translocation and reported the very first cell cycle-dependent analyses of CSR junctions.
In cNHEJ-deficient B cells (e.g., Xrcc4- or DNA-PKcs- deficient), the A-EJ pathway is responsible for both the residual CSR events and the generation of the oncogenic IgH-Myc chromosomal translocations. In the last chapter, I determined how CtIP contributes to
oncogenesis using the CtIP-T855A phospho-deficient mouse model. The result showed that
CtIP T855 phosphorylation is critical for the neonatal development of Xrcc4-/-p53-/- mice and IgH-
Myc translocation driven lymphomagenesis in DNA-PKcs-/-Tp53-/- mice. Mechanistically, phospho-deficient CtIP compromises the extent of end-resection without affecting the initiation.
Reduced end-resection in CtIP-T855A mice and cells attenuated G2/M checkpoints and reduced the tolerance to the oncogene-induced replication stress, thereby limit lymphomagenesis.
Collectively, our data provided the first in vivo characterization for the role of CtIP and its related end-resection pathway in lymphocyte development and lymphomagenesis. The results highlight the importance of end-resection for checkpoint maintenance (§ 4) and the context-dependent regulation of A-EJ and DNA repair pathway choice in vivo (§ 3), explaining why A-EJ is more robust at the repetitive switch regions. Finally, the application of HTGTS, EndSeq, and ATAC-
Seq technologies in lymphocyte-specific gene rearrangements markedly improved the analysis depth and sensitivity while reducing the cost of repair-junction sequencing, allowing the quantitative detection of subtle changes and additional mechanistic insights. Specifically, we showed that end-resection could be regulated at the level of chromatin accessibility, which is determined by both baseline chromatin occupancy and DNA damage-induced changes (§ 2).
These findings provide one explanation for the tissue and cell type-specificity of translocation targeting. These techniques can be used to analyze the impact of other DNA repair factors during lymphocyte development and lymphomagenesis and in translocation in general.
Table of Contents
Table of Figures ...... v
Acknowledgments ...... viii
Dedication ...... xii
Chapter 1: Introduction ...... 1
Overview ...... 1
1. DNA double-stranded break repair pathways in mammalian cells ...... 2
1.1 The classical nonhomologous end-joining pathway ...... 2
1.2 The alternative end-joining pathway ...... 5
1.3 The role of DNA damage response in DNA double-stranded break repair...... 7
2. DNA end-resection and the role and regulation of CtIP...... 8
2.1 The domain structure and the functions of CtIP ...... 9
2.2 CtIP and MRN complex-mediated DNA end-resection ...... 10
2.3. The regulation of CtIP protein levels and its post-translational modifications ...... 12
3. Lymphocyte development and lymphocyte-specific gene rearrangement ...... 13
3.1. V(D)J recombination ...... 14
3.2. Class switch recombination ...... 18
4. The role of CtIP in lymphocyte development ...... 22
5. Chromosomal translocations during lymphoid malignancy ...... 25
Chapter 2: Assessing Chromatin Dynamics and Genome Integrity upon DNA Damage ...... 27
1. Introduction ...... 27
i 2. Results ...... 30
2.1. ATAC-Seq profiles at the TSS are consistent across genotypes and in independent
cell lines...... 30
2.2. EndSeq can effectively detect RAG-generated breaks at highly accessible regions. ...31
2.3. ATAC-Seq reveal a correlation between loss of 53BP1 and higher endonuclease-
induced accessibility...... 35
2.4. The increase of accessibility affects a broader region than physical end-resection. ....39
2.5. Persistent DNA damage response altered the chromatin accessibility at distal
regions ...... 46
3. Discussion ...... 51
Chapter 3: CtIP-mediated DNA resection is dispensable for IgH class switch recombination by alternative end-joining * ...... 56
1. Introduction ...... 56
2. Results ...... 61
2.1 CtIP and ATR/ATM mediated phosphorylation of CtIP(T855) are dispensable for
A-EJ-mediated class switching...... 61
2.2 CtIP and its resection activity are necessary for extensive S-region resection in
cNHEJ-deficient B cells...... 66
2.3 MH-mediated CSR in cNHEJ-deficient cells requires CtIP, but not T855
phosphorylation...... 73
2.4 ATM signaling promotes A-EJ-mediated CSR through both CtIP-T855
phosphorylation-dependent and CtIP-independent mechanisms...... 77
ii 2.5 Earlier Sμ internal deletions tend to use MH-mediated end-joining even in cNHEJ
proficient cells...... 80
3. Discussion ...... 84
Chapter 4: Lack of DNA damage-induced CtIP phosphorylation at T855 delays lymphomagenesis in NHEJ/p53-double deficient mice * ...... 88
1. Introduction ...... 89
2. Results ...... 92
2.1 CtIP-T855A mutation causes early lethality in Xrcc4-/-Tp53-/- mice ...... 92
2.2 CtIPA mutation delayed the lymphomagenesis in DNA-PKcs-/- Tp53-/- mice ...... 95
2.3 T855 phosphorylation promotes end-resection and is dispensable for CE hairpin
opening...... 100
2.4 T855 phosphorylation is dispensable for inter-sister joining ...... 107
2.5 T855 phosphorylation of CtIP plays a role in G2/M checkpoint maintenance...... 107
2.6 CtIPA mutation delays MYC-driven lymphomagenesis ...... 112
3. Discussion ...... 114
Chapter 5: Closing remarks...... 118
Chapter 6: Materials and Methods ...... 121
Mice ...... 121
Class Switch Recombination and Cell Cycle analysis with Flow Cytometry ...... 121
Cell line generation and V(D)J recombination assays ...... 122
FISH ...... 123
High-throughput genome-wide translocation sequencing (HTGTS) ...... 124
iii Transposase-Accessible Chromatin using sequencing (ATAC-seq) ...... 126
EndSeq ...... 128
Sequencing analysis ...... 131
Western blotting ...... 132
References ...... 133
iv Table of Figures
Chapter 1
1. Figure 1-1: Known alterations in cancer and post-translational modifications in CtIP...... 11
2. Figure 1-2: The overview of V(D)J recombination and CSR...... 15
3. Figure 1-3: T859 phosphorylation of CtIP is dispensable for normal B cell development and CSR...... 25
4. Figure 2-1: Experimental schematic and performance for studying RAG generated DSBs. ...33
5. Figure 2-2: Experimental performance and validation...... 34
6. Figure 2-3: Free DNA ends stably accumulated in RAG-generated breaks...... 37
7. Figure 2-4 Experimental schematic and performance of inducible I-PpoI endonuclease system...... 38
8. Figure 2-5: Persistent DSBs caused increased chromatin accessibility in the local region. ...41
9. Figure 2-6: Free DNA ends accumulate surrounding persistent DSB sites...... 44
10. Figure 2-7: Increased amount of free DNA ends accumulate in the absence of 53BP1...... 45
11. Figure 2-8: Free DNA ends can be detected upon persistent DSBs induction...... 48
12. Figure 2-9: Side-by-side comparison of normalized ATAC-Seq signal and EndSeq signal. .49
13. Figure 2-10: DNA damage-induced global accessibility changes are 53BP1 dependent. ....50
14. Figure 2-11: GSEA enrichment...... 52
15. Figure 3-1: Effective deletion of CtIP and Xrcc4 in B cells...... 61
16. Figure 3-2: The nature of the truncated CtIP protein expressed by the CtIP allele...... 62
17. Figure 3-3: CtIP-deficiency or mutation did not reduce A-EJ mediated CSR in Xrcc4- deficient B cells...... 64
18. Figure 3-4: Characterization and CSR efficiency of CtIP-deficiency or mutation in Xrcc4- deficient B cells...... 64
19. Figure 3-5: The impact of DNA2 inhibition on A-EJ mediated CSR...... 66
v 20. Figure 3-6: CtIP deficiency reduces end-resection in Xrcc4-deficient B cells...... 68
21. Figure 3-7: Diagram and relative distribution of S preys in Xrcc4-deficient B cells...... 70
22. Figure 3-8: Diagram and relative distribution of Sγ1 preys in Xrcc4-deficient B cells...... 71
23. Figure 3-9. Diagram and relative distribution of Sε preys in Xrcc4-deficient B cells...... 72
24. Figure 3-10: The MH usage of IgH junctions recovered from Xrcc4-deficient B cells...... 76
25. Figure 3-11. The MH usage by position in the Sµ and Sγ1 regions...... 77
26. Figure 3-12: The impact of ATM inhibition on A-EJ mediated CSR...... 80
27. Figure 3-13: Early CSR events preferred to use MH-mediated joinings...... 81
28. Figure 3-14: CSR junction analyses by cell division...... 83
29. Figure 4-1: Diagram of Breakage-fusion-bridge (BFB) cycles...... 91
30. Figure 4-2: Bone marrow defects or anemia do not explain the early death of
CtIPA/A Xrcc4-/-Tp53-/- mice...... 95
31. Figure 4-4: CtIPA mutation delayed IgH-Myc driven pro-B cell lymphomas and altered tumor spectrum in DNA-PKcs-/-Tp53-/- mice...... 98
32. Figure 4-3: Analyses of olfactory neurons from 16 days old CtIPA/AXrcc4-/-Tp53-/-,
Xrcc4-/-Tp53-/-, and Xrcc4+/+ controls...... 98
33. Figure 4-5: Characterization of tumors found in CtIPA/A DNA-PKcs-/-Tp53-/- mice...... 99
34. Figure 4-6: CtIPA mutation contributes to hairpin processing in DNA-PKcs-/- cells...... 102
35. Figure 4-7: CtIPA mutation does not affect proper repair products from RAG-generated breaks...... 104
36. Figure 4-8: CtIPA mutation does not affect end-resection initiation...... 106
37. Figure 4-10: CtIPA mutation does not alter the MH usage at I-PpoI-induced translocations...... 110
38. Figure 4-9: CtIPA mutation does not alter endonuclease-generated DSBs...... 110
39. Figure 4-11: Phosphorylation of CtIP at T855 contributes to G2/M checkpoint maintenance...... 112
vi 40. Figure 4-12: CtIP inactivation with CD19cre is dispensable for Myc-driven lymphomagenesis...... 113
41. Figure 4-13: CtIPA mutation delays lymphomagenesis in the λ-Myc mouse model...... 114
vii Acknowledgments
This thesis work cannot be accomplished without the help of the collaborative people around me, both the Zha lab and also the entire ICG. First would be my mentor, Dr. Shan Zha, for being nothing but supportive all these years. When I was first doing rotations, I had no understanding of what the Zha lab does and no idea what I would like to do for my thesis research. I rotated here and joined here because of what I see in you, as a mentor and also as a scientist. To this day, I still remember when you first discussed your work with me, and I was impressed by how much you love what you do. To me, that is very crucial. I am very grateful that you took me as your student and really trusted me through my thesis work. Your mentorship is exactly what I need. You give me the freedom to do my work and always be there when I need your help. With our weekly one-to-one meetings and numerous times I stopped by,
I learned not only about research and my project, but more importantly, how to solve problems. I also appreciate you being so open-minded, and it is a rare trace to have nowadays. You never forced me to follow your instructions, but on the other hand, you always encourage me to express myself and discuss things with you. I was, and still am, very impressed by how knowledgeable you are and how dedicated you are in your elegant science. Thank you for your mentorship. I am looking forward to seeing how the Zha lab will keep growing and flourishing.
To all the Zha lab members, I am sure I could not have such a pleasant grad school time if it weren’t for you all. To the Zha lab alumni – Jennifer Crowe, Yu Tao, Xiangyu Liu, Verna
Estes, Maja Milanovic – thank you all for your help and support. Especially Jennie, from issues in our graduate program to inside the lab, I was lucky to have you as a senior graduate student in the lab. To our current members, thank you all for humoring me, as I may talk too much or laugh too loud. Brian Lee, who still helps me solving technical issues and serves as my English teacher all these years. Demis Menolfi, thanks for being such a nice friend to have a coffee break with and the only colleague from a yeast genetics background, so I have someone to
viii share my excitement with our beloved model organism. Lastly, to my nicest colleague, and my warm-hearted friend, Zhengping Shao, I will say this during my talk in case you cannot see it but thank you for being here and help make my everyday life enjoyable. To my summer student,
Joy Lin, you are the type of student that any mentor would dream of having, dedicating, meticulous, great with your hands. It was my first time really mentoring someone, and thank you for being so hard-working and having patience with my teaching, and teaching me special words in Taiwan! I still remember them.
To my committee members – Drs. Riccardo Dalla-Favera, Zhiguo Zhang, and Lorraine
Symington. Thank you for your generous help on my thesis project. Your expertise has provided me novel insights into my project and provided me valuable suggestions in proceeding with my project throughout the years without giving me any unnecessary pressure. Thank you also to my defense committee member, Dr. Barry Sleckman, for joining my examination. There were a countless number of times in the past few years where I went to your previous publications for a specific concept, a piece of evidence, or a protocol to follow. A particularly important thanks to
Tina Gellhorn for helping me scheduling dates and book rooms for all my meetings and other lab activities. I am very grateful for all your time and effort.
To my graduate program, Drs. Ron Liem and Yinghui Mao, and Zaia Sivo. Thank you for helping me whenever I have problems with any school or life matters and make my grad school life so smooth. To Ron, thank you for taking me into the program. You were the only person who replied to my email during my grad school application process. Thank you for all your suggestions during my first year and for being so supportive. It was always nice to run into you on campus, and your laugh is very contagious. To Mao, thanks for your help in applying for the grant and your prompt response in all the small matters I had. To Zaia, I cannot accurately express how important you are in my, and all other students’, grad school process. Thank you for taking care of us, with literally everything. Also to the professors leading our Pathology
ix seminars, Drs. Julie Canman, Ellen Ezratty, Edmund Au, Piero Daleraba, and Hee Yang, thanks for your suggestions and comments for us giving public presentations. I was able to participate in the Med-Into-Grad program, and it provided me a unique chance to see how the benchwork science transformed into the clinics. Thanks to Dr. Ron Liem, Howard Worman, Patrice Spitalnik for giving me such a valuable opportunity. Also, to my mentor, Dr. Maria-Luisa Sulis, you taught me from scratch. Thank you for taking care of me.
Thank you to our fantastic collaborators in the HICCC building, Dalla-Favera lab, Baer lab, Gautier lab, Rabadan lab, Lasorella lab, etc. My thesis work would not be able to finish without your generous help. To Antony Holmes, you taught me how to deal with sequencing data, how to use Command-Line, and even how to better use Excel, not to mention share with us your brilliant software. Thank you for being so patient in teaching me. To Dr. Richard Baer, thank you for all your suggestions for my presentations and manuscripts, and more importantly, for being such a nice person to talk to. To former Dalla-Favera lab people, thank you for being the best co-workers, brainstorming about science, or have a nice cup of beer after work hours.
Thank you all for making ICG such a nice place to work in.
Finally, I cannot imagine where I will end up if it weren’t for the wonderful
Brewer/Raghuraman lab. First, thanks to Dr. Bonny Brewer, who gave me a chance to do real research in your lab even when I was just a sophomore student and taught me everything. You really are everything I have pictured about what a scientist is like. Most importantly, for assigning me to follow Liz. To Liz Kwan, who is one of the most important people in my life, as a mentor and as a friend. You provided me the best training and mentorship that any fresh students could ever ask for. To Raghu, you are the best teacher I have ever had, and any student would be lucky to have you as their professor. To Gina, thank you for being a critical mentor to me and took care of the lab and me. Seeing you again in New York was one of the warmest times.
x Last but not least, I would like to thank my family members for providing me support and freedom all these years. Thanks for your trust in me and for always respect what I want. I also want to thank a very special and important friend of mine, who once told me, if you do not see where you are going, just put your head down and work. I have tried my best to follow it throughout the years.
xi
Dedication
In the memory of my grandfather
who built my interest in cancer research and set a high standard of being a decent person above everything
xii Chapter 1: Introduction
Overview
The DNA of eukaryotic cells experiences various types of damages. One of the most toxic types of DNA damage is the double-strand break (DSB). Besides exogenous sources
(e.g., radiation, genotoxic chemicals), DSBs can occur during a series of regular cellular events, such as DNA replication and programmed gene rearrangements in developing lymphocytes and germ cells. Specifically, developing lymphocytes experience two programmed gene rearrangement events: V(D)J recombination (§1-3.1) that assembles the functional antigen receptor genes in B and T cells, and class switch recombination (CSR) (§1-3.2) that modifies antibody isotypes in mature B cells. While lymphocyte-specific factors initiate both rearrangements, the repair phase is mediated by ubiquitously expressed DNA repair proteins and activates the DNA damage response (DDR). Unrepaired DSBs in developing lymphocytes trigger lymphocyte progenitor apoptosis, development blockade, and eventually lead to immunodeficiency. Mis-repair of those developmental breaks can cause chromosomal translocations and eventually tumorigenesis.
Mammalian cells have three known DNA DSB repair pathways: homologous recombination (HR), classical nonhomologous end-joining (cNHEJ), and alternative end-joining
(A-EJ) pathway (§1-1.1 & 1.2). HR utilizes a homologous template, often sister chromatid, for repair and is error-free by definition. The cNHEJ pathway directly ligates two broken DNA ends together and can be error-prone. A-EJ is used to describe end-ligation in cells lacking core cNHEJ factors (e.g., KU and XRCC4) and preferentially uses microhomology (MH) at the junctions. V(D)J recombination exclusively utilizes the cNHEJ pathway, while CSR can be achieved via cNHEJ and in part through A-EJ. One main factor that determines the choice between cNHEJ and A-EJ is DNA end-resection (§1-1.2 & 2.2), which generates 3' single- stranded DNA (ssDNA) overhangs through a nucleolytic process. End-resection exposes MHs
1 (MH) flanking the DSBs to facilitate A-EJ mediated repair. In eukaryotes, DNA end-resection is initiated by the Mre11-Rad50-Nbs1 (MRN) complex with the help of CtIP (§1-2). While both cNHEJ and A-EJ contribute to oncogenic translocations (Ghezraoui et al., 2014), MHs are often found at the junction of oncogenic chromosomal translocations in lymphoid malignancies
(Nussenzweig & Nussenzweig, 2010). While MRN has other functions beyond end-resection, such as activating ATM kinase, CtIP is critical for the endonuclease activity of the MRN complex. My thesis research uses CtIP conditional or mutant mouse models to investigate the role of CtIP and its phosphorylation in the repair of programmed DSBs (§3) and their associated oncogenic chromosomal translocations (§4).
1. DNA double-stranded break repair pathways in mammalian cells
A breakage in both strands of the DNA double helix, DSB, is the most severe form of
DNA damage and triggers the widespread DDR that halts cell cycle progression, gene transcription, and replication. Mammalian cells have two well-characterized DSB repair pathways –cNHEJ and HR. In recent years, a third pathway, A-EJ has been used to describe end-ligation in cells lacking core cNHEJ factors (e.g., KU, LIG4, XRCC4). A-EJ preferentially uses microhomology (MH) at the junctions and partially overlaps with the microhomology- mediated end-joining (MMEJ) pathway (McVey & Lee, 2008). Like cNHEJ, A-EJ can occur throughout the cell cycle. This section will review the mammalian DSB repair pathways with a focus on the cNHEJ and A-EJ pathways directly implicated in lymphocyte-specific gene rearrangements. In addition to the specific repair pathways that work on the DNA, DSBs also activate ATM kinase and a cascade of post-translational modifications, collectively referred to as the DDR, which promotes precise and efficient DSB repair.
1.1 The classical nonhomologous end-joining pathway
The cNHEJ pathway is conserved in almost all eukaryotes. As its name implies, cNHEJ directly ligates two DNA ends without a requirement for homology (Lieber, 2010). Thus, cNHEJ
2 functions throughout the cell cycle and is the major repair pathway for radiation-induced DNA damages, and is exclusively required for lymphocyte development (§1-3). In vertebrates, the cNHEJ pathway entails both the evolutionarily conserved end-ligation component and the vertebrate-specific end-processing component. Ku70 (gene name XRCC6) and Ku80 (gene name XRCC5) form an obligatory heterodimer – KU, which initiates cNHEJ by encircling the
DNA ends with high affinity. DNA-bound KU then recruits the LIG4-XRCC4-XLF complex for
DNA end-ligation. Among them, XRCC4 is required for the protein stability of LIG4. Loss of either LIG4 or XRCC4 completely abrogates cNHEJ in cell lines and mouse models (Grawunder et al., 1997; Lieber, 2010; Schar, Herrmann, Daly, & Lindahl, 1997; Teo & Jackson, 1997;
Wilson, Grawunder, & Lieber, 1997). XLF (gene name NHEJ1), on the other hand, is only required for a subset of cNHEJ in otherwise wildtype cells (Buck et al., 2006; G. Li et al., 2008).
KU and LIG4-XRCC4-XLF together constitute the end-ligation components of cNHEJ. Mouse models that carry a null mutation of LIG4 or XRCC4 have elevated post-mitotic neuronal apoptosis (Frank et al., 2000; Gao, Sun, et al., 1998; Karanjawala et al., 2002). As such, Lig4-/- and Xrcc4-/- mice die at embryonic day E16.5 with p53-dependent neuronal apoptosis (Barnes,
Stamp, Rosewell, Denzel, & Lindahl, 1998; Frank et al., 2000; Gao et al., 2000). Ku70-/- and
Ku80-/- mice are viable but significantly smaller than their wildtype or heterozygous littermates
(Gu, Seidl, et al., 1997; Nussenzweig et al., 1996). Consistent with the non-essential role of XLF in cNHEJ, Xlf-/- mice are born at the expected ratio and of normal size (G. Li et al., 2008).
In jawed vertebrates, including humans and mice, DNA-bounded KU also recruits and activates the large catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs, gene name PRDKC). Together, KU and DNA-PKcs form the DNA-PK holoenzyme, which phosphorylates DNA-PKcs itself and other cNHEJ factors (Davis, Chen, & Chen, 2014).
Moreover, DNA-PK holoenzyme recruits and activates Artemis endonuclease, which modifies the DNA ends, including opening hairpins, during vertebrate cNHEJ (Y. Ma, Pannicke, Schwarz,
3 & Lieber, 2002; Meek, Dang, & Lees-Miller, 2008). It is estimated that Artemis-mediated end- processing is important for the repair of ~10% of ionizing radiation (IR)-generated DSBs (Riballo et al., 2004). DNA-PKcs and Artemis are also required for opening the hairpin coding ends
(CEs) during V(D)J recombination (Y. Ma et al., 2002; Moshous et al., 2001) (§1-3). Consistent with end-processing functions that are only required for a subset of DSBs, loss of DNA-PKcs or
Artemis only cause moderately increased IR sensitivity, and DNA-PKcs-/- and Artemis-/- mice are born of normal size with isolated lymphocyte development defects (Gao, Chaudhuri, et al.,
1998; Y. Ma et al., 2004; Rooney et al., 2002; Taccioli et al., 1998) (§1-3).
DNA-PKcs is the best-characterized substrate of DNA-PK. In contrast to the normal development of DNA-PKcs null mice (M. Bosma, Schuler, & Bosma, 1988; Gao, Chaudhuri, et al., 1998; Taccioli et al., 1998), early work from our lab showed that mice expressing solely kinase-dead (KD) DNA-PKcs (D3922A, DNA-PKcsKD/KD) die in utero with severe neuronal apoptosis, like Lig4- or Xrcc4-deficient mice (W. Jiang et al., 2015). Complete deletion of Ku70 or Ku80 rescues the embryonic lethality of DNA-PKcsKD/KD mice (W. Jiang et al., 2015), indicating a kinase-activity-dependent structural role of DNA-PKcs in regulating end-ligation. In this context, purified DNA-PKcs blocks DNA ligation by a T4 DNA ligase in the absence of hydrolyzable ATP (Block et al., 2004), suggesting this block in end-ligation by DNA-PKcs is not limited to the cNHEJ pathway. Consistent with this notion, the recent Cryo-EM structure of active DNA-PK holoenzyme on DNA shows that DNA-PKcs N-terminal HEAT repeats directly engage the 3’-OH end of the model DNA substrate upon activation (X. Chen et al., 2020).
Meanwhile, DNA-PKcsKD/KD cells are competent for Artemis recruitment, and Artemis mediated hairpin opening, suggesting DNA-PKcs protein, but not its own kinase activity is required for end-processing. In this context, ATM kinase inhibitor blocks hairpin opening in DNA-PKcsKD/KD cells, but not in DNA-PKcs+/+ cells, indicating ATM kinase activity complements DNA-PKcs' kinase activity for Artemis activation in vivo (W. Jiang et al., 2015; Y. Ma et al., 2002).
4 In the past few years, several new cNHEJ factors have been identified- PAXX and MRI
(gene name CYREN) based on their interaction with KU and their essential role in cNHEJ in mice or cells lacking XLF (Grundy et al., 2016; G. Li et al., 2008; Roch, Abramowski, Chaumeil,
& de Villartay, 2019). More recently, ERCC6L2 has also been identified as an essential cNHEJ factor in XLF-deficient cells(X. Liu et al., 2020; Olivieri et al., 2020). Paxx-/-, Mri-/-, and Ercc6L2-/- mice develop normally and are of normal size, but Xlf/Paxx, Xlf/Mri, Xlf/Ercc6L2-double deficient mice are embryonic lethal with several neuronal apoptosis and hypersensitivity to IR (Arnoult et al., 2017; Hung et al., 2018; Kumar, Alt, & Frock, 2016; Lescale et al., 2016; X. Liu et al., 2020;
X. Liu, Shao, Jiang, Lee, & Zha, 2017). Unlike the evolutionarily conserved core cNHEJ factors
(KU, XRCC4, LIG4, and XLF), the exact roles of PAXX, MRI, and recently identified ERCC6L2 proteins in cNHEJ remain elusive. In comparison to HR, the regulation of cNHEJ has grown significantly even within the vertebrate domains, highlighting the expanded roles of cNHEJ as a rapid and straight-forward DSB repair pathway in multicellular organisms with long life expectance.
1.2 The alternative end-joining pathway
A-EJ is used to describe the significant end-joining in cells lacking essential cNHEJ factors (e.g., XRCC4 or KU). In particular, the residual (up to 25-50% of WT levels) CSR in
XRCC4-deficient B cells provide a piece of strong evidence for the existence of A-EJ pathway(s) for chromosomal DSB repair (Yan et al., 2007a). Although the genetic components of A-EJ are not fully understood (see below), A-EJ shares significant similarity with the MH-mediated end- joining (MMEJ) first characterized on plasmid substrates (Boulton & Jackson, 1996;
Kabotyanski, Gomelsky, Han, Stamato, & Roth, 1998; H. Wang, Perrault, Takeda, Qin, & Iliakis,
2003). Specifically, plasmids ligations recovered from Ku-deficient cells often contain 3-18 bp
MH (J. L. Ma, Kim, Haber, & Lee, 2003; X. Yu & Gabriel, 2003). Similarly, residual CSR junctions recovered from Xrcc4-/- B cells often have increased MH (Yan et al., 2007a). While the
5 length and frequency of MHs decrease in CSR junctions recovered from Lig4-/-Ku70-/- B cells
(Boboila, Yan, et al., 2010).
Mechanistically, A-EJ and the related MMEJ are thought to be initiated by DNA end- resection and annealing of MHs, followed by ends modification and gap filling, and then finally accomplished by ligation steps. The MRN/CtIP complex and their yeast orthologs MRX/Sae2 initiate the 5’-3' nucleolytic end-processing, which exposes the flanking MH sequences
(Mimitou & Symington, 2008). Mre11 attacks the 5' DNA end internally and introduces endonucleolytic cleavage upon activation (Cannavo & Cejka, 2014; Garcia, Phelps, Gray, &
Neale, 2011). Extensive 5’-3' processing can be continued by exonuclease Exo1. MRN also promotes the recruitment of DNA2, which together with BLM helicase (and its yeast ortholog
Sgs1) or WRN (Symington & Gautier, 2011), to serve as a parallel end-resection pathway to clean DNA ends. My thesis focuses on CtIP, which will be discussed in greater detail in §1-2.
The MH length at the junctions varies among different experimental systems, depending on the sequence context and the nature of the missing NHEJ factor, suggesting that there might be more than one A-EJ (and likely MMEJ) pathway (Boboila, Yan, et al., 2010). Yeast cells tend to use homology sequences ≥ 6nt, with longer MHs promoting repair efficiency (Villarreal et al.,
2012). Moreover, replication protein A (RPA) can bind to ssDNA and prevent annealing
(Symington, Rothstein, & Lisby, 2014). While Rad52 can anneal ssDNA and promote end joining, it is not required to antagonize RPA's inhibition role with the annealing of short MHs
(<14 nt) (Deng, Gibb, de Almeida, Greene, & Symington, 2014; Villarreal et al., 2012). Upon ssDNA annealing, the gap-filling step is carried out by different DNA polymerases. Yeast cells mostly utilize Polδ and Polβ, while mammalian cells can also rely on Polθ (K. Lee & Lee, 2007;
Sfeir & Symington, 2015), and insertions can be generated de novo to create compatible ends
(Sfeir & Symington, 2015). Therefore, insertions can be found at a subset of A-EJ mediated repair junctions. Polθ contributes A-EJ mediated telomere maintenances, in reporter assays,
6 and chromosomal translocations (Chan, Yu, & McVey, 2010; Mateos-Gomez et al., 2015;
Roerink, van Schendel, & Tijsterman, 2014; A. M. Yu & McVey, 2010). Biochemistry studies showed that Polθ homodimer can stabilize annealed ssDNA partners with just one or two annealed bases and greatly reduce the basic requirement of MH lengths and promote A-EJ
(Brissett et al., 2007; Zahn, Averill, Aller, Wood, & Doublie, 2015). Next, the incompatible overhang is removed by the XPF-ERCC1 (Rad1-Rad10 in yeast) endonucleases on the 5' flap and FEN1 on the 3' flaps (Decottignies, 2007; Y. Liu et al., 2005; J. L. Ma et al., 2003). Finally, two single-strand DNA ligases - Lig3 and Lig1 seal the gaps (Audebert, Salles, & Calsou, 2004;
Simsek, Brunet, et al., 2011; H. Wang et al., 2005). In mammalian cells, the DNA single-strand breaks also activate poly ADP-ribose polymerase 1 (PARP1), which promotes A-EJ by facilitating the recruitment of single-stranded DNA ligase –LIG3-XRCC1 as well as LIG1 by generating poly-ADP ribose chains (Audebert, Salles, & Calsou, 2004). XRCC1 is an obligatory partner of nuclear LIG3 (Ellenberger & Tomkinson, 2008), but neither PARP1-null nor XRCC1- null cells show defects in CSR or alternated MH patterns in the presence or absence of cNHEJ
(Audebert et al., 2004; Boboila, Alt, & Schwer, 2012). While mice lacking Parp1 is healthy and fertile, Xrcc1 is essential for embryonic development (Tebbs et al., 1999; Z. Q. Wang et al.,
1995), suggesting additional heterogenicity within the A-EJ pathways.
1.3 The role of DNA damage response in DNA double-stranded break repair.
In addition to the specific DNA repair pathways mentioned above, DSBs activate the
ATM kinase, and to a lesser extent DNA-PK, mediated signaling cascades referred to as DDR.
Briefly, the MRN complex recruits and activates ATM kinase, which phosphorylates many substrates, including the histones H2AX flanking the DNA breaks at S139 to form H2AX
(Rogakou, Pilch, Orr, Ivanova, & Bonner, 1998). MDC1 directly binds to H2AX (Lou et al.,
2006; Stewart, Wang, Bignell, Taylor, & Elledge, 2003; Stucki et al., 2005) and recruits the E3 ubiquitin ligases RNF8 and RNF168, which further modify H2A and eventually lead to the
7 recruitment of 53BP1, RIF1, and the Shieldin complex (SHLD1, 2, 3 and REV7) (Dev et al.,
2018; Findlay et al., 2018; Ghezraoui et al., 2018; Xu et al., 2015). ATM and its chromatin substrate H2AX, MDC1, and 53BP1 are not required for chromosomal cNHEJ in otherwise wildtype cells, but in XLF-deficient cells or mice with sub-optimal cNHEJ, they become essential for chromosomal cNHEJ (Beck, Castaneda-Zegarra, Huse, Xing, & Oksenych, 2019; X. Liu et al., 2012; Oksenych et al., 2012; Zha, Guo, et al., 2011). Mechanistically, the extended DNA damage foci promote efficient and accurate DNA repair by modulating end-resection and repair pathway choices and also limits the DNA ends to a defined chromatin domain (Arnould et al.,
2021). In chapter 2, I used the ATAC-seq analyses to measure whether chromatin-bound ATM substrates prevent end-resection by regulating chromatin accessibility. In Chapter 4, I showed for the first time that ATM promotes A-EJ in addition to cNHEJ (X. S. Wang, Zhao, et al., 2020).
In addition to its direct role in regulating the chromatin surrounding DSBs, ATM also promotes cell cycle arrest by phosphorylating TP53, CHK1, CHK2, and other checkpoint proteins, and suppresses ongoing transcription on the broken DNA (Hirao et al., 2000; Shanbhag, Rafalska-
Metcalf, Balane-Bolivar, Janicki, & Greenberg, 2010). All of these functions serve to promote accurate repair and limit the growth of cells carrying unrepaired breaks in order to suppress oncogenic translocations.
2. DNA end-resection and the role and regulation of CtIP
Which repair pathway is used at a specific DSB is influenced by many factors. DNA end- resection plays a major role in the DNA repair pathway choice. The long ssDNA overhangs generated via end-resection are coated by RPA and then Rad51 to direct homology search during HR. The limited ssDNA overhang can promote A-EJ by exposing flanking MHs while suppressing cNHEJ by limiting KU binding, while short MHs (< 4nt) are tolerable for NHEJ products (Pannunzio, Watanabe, & Lieber, 2018). Thus, it is not surprising that the initiation and the extent of DNA end-resection are tightly regulated through the cell cycle and during DDR. In
8 mammalian cells, DNA end-resection can be initiated by the MRN complex and extensively processed by the EXO1 nuclease or DNA2 with Sgs1/BLM (Symington & Gautier, 2011). CtIP, and its yeast ortholog Sae2, is critical for the endonuclease activity of MRN (Anand, Ranjha,
Cannavo, & Cejka, 2016; Cannavo & Cejka, 2014). This section will summarize the known functions and the major regulations of CtIP with an emphasis on DNA end-resection.
2.1 The domain structure and the functions of CtIP
CtIP protein contains several functional domains. Despite their primary sequence divergence, the N-terminal region of CtIP and Sae2 both mediate oligomerization necessary for end-resection (Andres et al., 2015; Dubin et al., 2004; H. Wang et al., 2012). CtIP (897 amino acids in humans) is much larger than Sae2 (345 amino acids). The middle part of CtIP contains several motifs unique for CtIP, including those essential for its interaction with CtBP transcriptional repressor (PLDLS) (Schaeper, Subramanian, Lim, Boyd, & Chinnadurai, 1998),
BRCA1 (after CDK mediated phosphorylation at S327) (Wong et al., 1998; X. Yu, Wu, Bowcock,
Aronheim, & Baer, 1998) and Rb (E157) (F. Liu & Lee, 2006) tumor suppressors as well as its proposed intrinsic nuclease activities (Makharashvili et al., 2014; H. Wang et al., 2014). The C- terminus of CtIP shares the highest degree of homology with Sae2 (Sartori et al., 2007), including two conserved phosphorylation sites implicated in end-resection (see below).
CtIP is essential for murine embryonic development (P. L. Chen et al., 2005) and the viability of proliferating mammalian cells (P. L. Chen et al., 2005). A conditional CtIP deletion allele was developed to overcome these hurdles (Bothmer et al., 2013). Conditional inactivation of CtIP in mammalian epithelial cells delayed the development of BRCA1-deficient and p53- deficient breast cancer in vivo (Reczek et al., 2016). We note, given the essential role of CtIP in cell proliferation, complete loss of CtIP is rare in cancer. About 5% of lymphoid or myeloid tumor samples carry mutations or amplifications involving CtIP (Fig. 1.1A). The most prominent
9 alteration is found in pancreatic cancer cases, where CtIP is amplified in about 15% of reported samples (Fig. 1.1B) and is associated with a significantly lower overall survival rate (Fig. 1.1C, p=0.0018), suggesting CtIP overexpression might aid the tolerance to oncogenic replication stress.
2.2 CtIP and MRN complex-mediated DNA end-resection
CtIP is best known as the mammalian ortholog of yeast Sae2, which initiates DNA end- resection together with the MRN complex (Cannavo & Cejka, 2014; Deshpande, Lee, Arora, &
Paull, 2016; Mimitou & Symington, 2008; Sartori et al., 2007). Specifically, CtIP interacts with the NBS1 component of the MRN complex to promote endonuclease cleavage by the MRN complex to initiate end-resection (Williams et al., 2009). In yeast, the active MRX-Sae2 complex
A. B. C.
D.
10 1. Figure 1-1: Known alterations in cancer and post-translational modifications in CtIP.
(A) Alteration frequency from 12845 samples from 12112 patients analyzed in 20 lymphoid studies and 11 myeloid studies. (B-C) Abnormalities found in 1207 samples from 10 pancreatic cancer studies (B), and overall survival of 465 patients (C). (D) Accumulated number of published studies on known modification site on CtIP protein. https://www.phosphosite.org/homeAction is required to recruit Exo1 or Dna2/Sgs1 to proceed with the 5' to 3' exonucleolytic processing
(Mimitou & Symington, 2008, 2009; Shim et al., 2010). As discussed in the previous section, the status of the DNA ends is accountable for repair pathway choice. The dependence on
MRN/CtIP (MRX/Sae2) for end-resection is also influenced by the type of DNA ends and the flanking sequences. Resection can take place at free DNA ends generated from endonuclease cleavage independent from the MRN/CtIP complex. However, processing modified ends, such as topoisomerase-generated covalently linked DNA ends, highly depends on the MRN complex activity (Aparicio, Baer, Gottesman, & Gautier, 2016; Deshpande et al., 2016; Nakamura et al.,
2010; Symington & Gautier, 2011). For example, the MRX/Sae2 complex is necessary to resolve Spo11-bound DNA ends during meiosis in yeasts (Furuse et al., 1998; McKee &
Kleckner, 1997; Moreau, Ferguson, & Symington, 1999). The active MRX/Sae2 can perform endonucleolytic cleavage away from the ends (40 bps or up to around 270 bp) (Zakharyevich et al., 2010), which can release covalently bound Spo11 and create nicks for other processing events to happen (Mimitou, Yamada, & Keeney, 2017). In addition to DNA end-resection,
MRN/CtIP has also been implicated in nucleolytic processing of DNA hairpins (H. Chen et al.,
2015; Lengsfeld, Rattray, Bhaskara, Ghirlando, & Paull, 2007; Lobachev, Gordenin, & Resnick,
2002; Makharashvili et al., 2014; H. Wang et al., 2014) and termination of checkpoint signaling
(H. Chen et al., 2015; Lengsfeld et al., 2007; Makharashvili et al., 2014; H. Wang et al., 2014).
Moreover, an intrinsic endonuclease activity of CtIP has also been proposed and implicated in
DNA repair and replication at complex structures (Makharashvili et al., 2014; H. Wang et al.,
2014). CtIP is also shown to interact with FANCD2 and contribute to DNA inter-stranded
11 crosslink repair via the Fanconi pathway (Murina et al., 2014). Taken together, the MRN/CtIP complex serves as one of the key aspects of the cellular activities of CtIP through participating in free DNA ends processing upon DNA damage. Therefore, it stands to reason that a comprehensive regulatory network must exist to ensure the performance of such activities.
2.3. The regulation of CtIP protein levels and its post-translational modifications
CtIP protein level is cell cycle-regulated with high expression in S and G2 phases and low in G1. The regulation is achieved through both transcriptional and post-translational mechanisms. CtIP mRNA is low in G1 arrested cells and increases upon release to the S phase
(X. Yu & Baer, 2000). CtIP interacts directly with Rb at the G1/S transition to regulate its own and Cyclin D promoter activity (F. Liu & Lee, 2006). Recent studies also identified microRNAs miR-335 and miR-19 as negative regulators of CtIP expression (Huhn, Kousholt, Sorensen, &
Sartori, 2015; Martin et al., 2013), providing a post-transcriptional means to regulate CtIP levels during oncogenic transformation (Srinivasan et al., 2019). The stability of CtIP protein is also controlled through the cell cycle via ubiquitination (Lafranchi et al., 2014; X. Yu, Fu, Lai, Baer, &
Chen, 2006) (Fig. 1.1D). The Cullin3-KLHL15 ubiquitin ligase targets CtIP for ubiquitination and degradation through binding of Y842 on CtIP protein with KLHL15, independent from Y842 phosphorylation but dependent on the aromatic ring (Ferretti et al., 2016). Additionally, the
APC/C-Cdh1 complex targets CtIP for proteasome degradation at the end of G2 (Lafranchi et al., 2014).
Moreover, the ability for CtIP to promote end-resection is also extensively regulated through post-translational modifications (Fig. 1.1D). Specifically, CtIP and Sae2 can be phosphorylated by S phase CDKs at T847 human/S267 yeast to promote MRN-mediated end- resection, providing the mechanism for enhanced HR activity in S/G2 phase cells (Barton et al.,
2014; Huertas, Cortes-Ledesma, Sartori, Aguilera, & Jackson, 2008; Makharashvili et al., 2014).
12 Moreover, CDK phosphorylation at S327 promotes interaction with BRCA1 (Wong et al., 1998;
X. Yu et al., 1998). However, the mouse model carrying the S327A mutation does not have severe end-resection defects (Polato et al., 2014). Moreover, CDK-mediated phosphorylation at
S276 and S347 can promote CtIP binding with Nbs1 and is necessary for downstream ATM phosphorylation (H. Wang et al., 2013). In addition to the cell cycle phase, CtIP is also phosphorylated by ATM and ATR kinase upon DNA damage to promote end-resection.
Specifically, ATM/ATR phosphorylates CtIP at T859 (T855 in mouse CtIP) within the region conserved between CtIP and Sae2 to promote end-resection in part by promoting the chromatin retention of CtIP (Peterson et al., 2012; H. Wang et al., 2013). Several other ATM-mediated phosphorylation sites (e.g., S231, S664, S745) were found to be essential for CtIP nuclease activity in vitro, while CDK-phosphorylation at T847 and ATM/ATR-phosphorylation at T859 was found to promote the HR activity independent of NBS1 (Makharashvili & Paull, 2015). Taken together, transcriptional, translational, and post-translational regulations of CtIP contribute to the increased end-resection in the S/G2 phase and upon DNA damage. In recent years, an increased effort has been put into studying the effect of modifications on CtIP protein. In chapter
3, I will try to address the physiological impact of the T859A (mouse T855A) phospho-mutant, especially its novel role in cell cycle checkpoint regulation.
3. Lymphocyte development and lymphocyte-specific gene rearrangement
The mammalian adaptive immune system is renowned for its specificity, diversity, and memory. This is achieved at the DNA level through three programmed gene rearrangement events– V(D)J recombination, Immunoglobulin class switch recombination (CSR), and somatic hypermutation (SHM). Among them, V(D)J recombination assembles the functional antigen receptor genes and occurs in progenitor B and T cells in the bone marrow and thymus, respectively, while CSR and SHM occur in the germinal centers of naïve and mature B cells.
SHM introduces mutations in the variable regions of Immunoglobulin (Ig) genes without
13 generating DNA DSBs (Methot & Di Noia, 2017). In contrast, lymphocyte-specific genes initiate
V(D)J recombination and CSR by introducing DSBs. Those DSB intermediates activate the ATM kinase-mediated DDR and use the ubiquitously expressed cNHEJ pathway, and, in the case of
CSR, also the A-EJ pathway for completion (Alt, Zhang, Meng, Guo, & Schwer, 2013). Both
V(D)J recombination and CSR are initiated in the G1 phase of the cell cycle. V(D)J recombination is completed within the G1 phase of the cell cycle and involves hairpin end intermediates(Schatz & Swanson, 2011). In contrast, CSR occurs in proliferating cells and involves DSBs at highly repetitive and GC-rich switch regions (K. Yu & Lieber, 2019). Mis-repair of programmed DSBs generated during V(D)J recombination or CSR leads to the underlying oncogenic chromosomal translocations in human lymphoid malignancies. Here I will discuss the mechanisms of V(D)J recombination and CSR, and the role of CtIP in both normal lymphocyte development and lymphomagenesis.
3.1. V(D)J recombination
V(D)J recombination occurs in progenitor B and T lymphocytes, where the variable region exons are assembled from individual Variable (V), Diversity (D), and Joining (J) gene
14 segments through a cut and paste mechanism (Fig. 1.2). V(D)J recombination occurs in all T
Variable region Constant region
D J H H IgH IgL
VH DH JH Sμ Cμ Cδ Sγ3 Cγ3 Sγ1 Cγ1 Sγ2b Cγ2b Sγ2a Cγ2a Sε Cε Sα Cα Tel Cen.
RAG1/2 AID Base excision repair VH DJH
C Mismatch repair
γ 3 CJ Cγ1 Sγ2b Cγ2b Sγ2a Cγ2a Sε Cε Sα Cα RAG1/2 VDJ H Sμ Sγ1 Cδ AID->>SHM V’DJH Sμ’ Sγ1’ Cγ1 Sγ2b Cγ2b Sγ2a Cγ2a Sε Cε Sα Cα + splicing IgG1 antibody Sμ’ Sγ1’
2. Figure 1-2: The overview of V(D)J recombination and CSR.
The Immunoglobulin (Ig) gene product, an antibody, is shown at the top. An antibody is formed by a pair of Ig Heavy chain gene products (IgH, in orange and green) and a pair of Ig light chain
(IgL, in white and blue). The V(D)J recombination (on the lower left) assembles the variable gene exon that encodes the antigen-specific portion of the antibody (orange) from individual V,
D or J gene segments in a two-step process, D to J first, then V to DJ. The reaction is initiated by RAG endonucleases, which introduces DNA double-strand breaks. An insert above shows the pair of RAG cleavage products at Dh and Jh with the hairpin coding ends and blunt signal ends adjacent to RSSs (triangles). Upon ligation by the cNHEJ pathway, the intermediate sequence is removed and the participating V, D, and J segments are fused to form the variable region exon that is spliced with downstream constant region exons (on the right) to form the IgH.
While we only depict the IgH here, V(D)J recombination occurs in all 3 Ig (IgH, Igλ, and Igκ) and
15 4 T cell receptor (TCRσ/δ, TCRγ, TCRβ) gene loci. In naïve B cells, the IgH undergoes two additional modifications initiated by activating induced deaminase (AID). Somatic hypermutation
(SHM) introduces point mutations in the variable region exon without creating DNA double- strand breaks. Class switch recombination (CSR) occurs in the constant region (on the right) and joins DNA double-strand breaks from two different switch (S) regions and effectively replaces the initially expressed IgM constant region (Cµ) with a downstream constant region, such as the Cγ1 for IgG1 depicted in the illustration. The constant region exons dictate the effector function of the antibody. CSR only occurs in the IgH locus of B cells, not in IgL or TCR loci. In contrast to RAG, which directly introduces DNA breaks, AID introduces U:G mismatches, which are processed by the base excision repair and mismatch repair pathways to generate mutations for somatic hypermutation (SHM) and DNA double-strand breaks for CSR. cell receptor (TCR, α/δ, β, γ) and Ig (h, , λ) gene loci (Jung, Giallourakis, Mostoslavsky, & Alt,
2006), including the Ig Heavy Chain (IgH). Recombination activating gene (RAG) - RAG1 and
RAG2 - initiates V(D)J recombination in progenitor lymphocytes by recognizing a pair of compatible recombination signal sequences (RSSs, one with 12bp and one with 23bp spacer) and introducing a DSB between the RSSs and the participating V, D, or J gene segments (Teng
& Schatz, 2015) (Fig. 1.2). RAG cleavage generates a pair of covalently sealed hairpin coding ends (CEs) and a pair of blunt and 5' phosphorylated signal ends (SEs). RAG mRNA expression and protein stability are restricted to G1-arrested progenitor lymphocytes (H. Jiang et al., 2005), which contributes to the exclusive dependence of V(D)J recombination on cNHEJ.
RAG cleavage only occurs in transcriptionally active and epigenetically poised V, D, and J gene segments (Jung et al., 2006; Y. Liu, Zhang, & Desiderio, 2009), leading to the cell type (B vs. T) and developmental stage (pro- vs. pre-) specificity of V(D)J recombination. RAG also dictates the orientation-specific repair outcome of V(D)J recombination.
16 3.1.1. V(D)J recombination requires cNHEJ exclusively.
The cNHEJ pathway is exclusively required for V(D)J recombination (Deriano et al.,
2011). During V(D)J recombination, KU heterodimer binds to both the hairpin CEs and blunt
SEs. The blunt SEs can be directly ligated via LIG4-XRCC4-XLF precisely to form a signal join
(SJ) (Ahnesorg, Smith, & Jackson, 2006; Buck et al., 2006; Lieber, 2010). The CEs hairpin, however, has to be opened by Artemis endonuclease with the help of DNA-PKcs (Y. Ma et al.,
2002; Moshous et al., 2001) before they can be ligated to form a coding join (CJ). Hairpin opening outside the apex introduces palindromic insertions (P elements) (Lieber et al., 1988; Y.
Ma et al., 2002; Moshous et al., 2001; Tonegawa, 1983; Wood & Tonegawa, 1983). Terminal deoxynucleotidyl transferase (TDT) adds non-templated insertions (N nucleotides) (Gilfillan,
Dierich, Lemeur, Benoist, & Mathis, 1993; Komori, Okada, Stewart, & Alt, 1993) to further increase the diversity of the variable region exons. Correspondingly, mouse models deficient in end-ligation (e.g., loss of Ku70, Ku80, Lig4, or Xrcc4) accumulate both CEs and SEs (Frank et al., 2000; Gao et al., 2000; Gu, Jin, Gao, Weaver, & Alt, 1997; Nussenzweig et al., 1996; Zhu,
Bogue, Lim, Hasty, & Roth, 1996). Mice deficient for either DNA-PKcs or Artemis have isolated immunodeficiency due to CE hairpin opening defects but form SJs efficiently (Gao, Chaudhuri, et al., 1998; Rooney et al., 2002; Taccioli et al., 1998). Moreover, RAG heterodimer is suggested to antagonize A-EJ during V(D)J via its interaction with DNA (Corneo et al., 2007).
3.1.2. The impact of DNA damage response on V(D)J recombination
DSBs generated during V(D)J recombination activate the DDR. Briefly, the MRN complex recruits and activates ATM kinase, which phosphorylates many substrates, including the histones H2AX flanking the DNA break at S139 to form H2AX (Rogakou et al., 1998).
MDC1 directly binds to H2AX (Lou et al., 2006; Stewart et al., 2003; Stucki et al., 2005) and recruits the E3 ubiquitin ligases RNF8 and RNF168, which further modify H2A and eventually
17 leads to the recruitment of 53BP1 (Ciccia & Elledge, 2010). ATM and the downstream factors
H2AX and 53BP1 are not required for lymphocyte development, but in mouse models, their absence causes a mild reduction in surface TCRβ/CD3ε levels in CD4+CD8+ double-positive T cells (Borghesani et al., 2000; Difilippantonio et al., 2008; Zha et al., 2010) and the accumulation of unrepaired RAG-dependent DSBs in ~4% of Atm-deficient B cells(Callen et al.,
2007). The need for sequential V(D)J recombination at the TCRα/δ (Carico & Krangel, 2015) likely contributes to its hypersensitivity to DNA repair defects. Correspondingly, loss of ATM,
H2AX, or 53BP1 causes a measurable development blockade associated with V(D)J recombination in the Ig and TCR loci. Using an inversional chromosomal V(D)J recombination substrate, Sleckman and colleagues showed that MRN and ATM prevent hybrid joins – the aberrant ligation of a CE with a SE during inversional V(D)J recombination (Bredemeyer et al.,
2006; Helmink et al., 2009) - providing a mechanism for the mild lymphocyte development defects associated with ATM-deficiency(Callen et al., 2007). Interestingly, ATM and ATM kinase activities are required for SJ formation in DNA-PKcs null cells (Gapud et al., 2011; Zha, Jiang, et al., 2011), supporting the possibility of overlapping roles between ATM and DNA-PKcs kinase activity. Moreover, in cells and mice lacking XLF, a non-essential cNHEJ factor, ATM kinase activity, and its substrates H2AX and 53BP1 are required for SJ formation and end-ligation (X.
Liu et al., 2012; Oksenych et al., 2012; Zha, Guo, et al., 2011), providing genetic evidence for an important role of the DDR in V(D)J recombination. In this context, whether DDR factors have an additional role in V(D)J recombination beyond ligation, such as end-protection, remains to be tested. A major focus of chapter 2 is using the ATAC-Seq technique to measure the role of
53BP1 in chromosomal accessibility regulation during V(D)J recombination.
3.2. Class switch recombination
CSR occurs in naïve B cells in the spleen and lymph nodes secondary lymphoid organs.
Upon antigen exposure and T cell contact, naïve B cells replace the initially expressed IgM
18 constant region (C) with another constant region (e.g., C1 for IgG1) to generate an antibody with a different isotype, thus conferring a different effector function (Fig. 1.2). B cell-specific activation-induced cytidine deaminase (AID) initiates CSR by converting cytosine to uracil in the transcribed S regions preceding each set of constant region coding exons (Franco, Alt, & Manis,
2006). These mismatches are processed by both base excision repair and mismatch repair machinery and are eventually converted to DSBs in proliferating B cells. In the second phase,
DSBs in the upstream IgM switch region (S) are joined with DSBs in the downstream switch region (e.g., S1 for IgG1) to complete IgH isotype switching and generate antibodies with different isotypes. The DSB repair that completes CSR is mediated by the cNHEJ and the A-EJ pathways with the help of ATM kinase and its chromatin substrates H2AX, 53BP1, etc.
3.2.1. The function of cNHEJ during CSR
Different from V(D)J recombination, CSR is not completed in G1 phase-arrested cells, and therefore can access the end-resection mechanism in the S phase. Correspondingly, B cells lacking core cNHEJ factors, such as Xrcc4 or Lig4, can undergo CSR at 25-50% of the WT levels (Boboila, Jankovic, et al., 2010; Yan et al., 2007a), leading to the discovery of the robust chromosomal A-EJ mechanism. The loss of the newly discovered cNHEJ factor PAXX does not affect CSR efficiency (X. Liu et al., 2017). The recently developed high throughput genome-wide translocation sequencing (HTGTS) (Hu et al., 2016) can isolate thousands of CSR junctions.
This assay uses a linear-amplification-based method to isolate junctions involving one or a cluster of DSBs. In the case of CSR, the assay has been used to measure joins involving the 5' end of the S region. The process isolates both internal deletions within S and IgH isotype switching junctions between S and a DSB in the downstream switch regions (e.g., S1). The detailed procedure and primer sequences can be found in the method section of chapter 6.
Using this technology, we and others showed that CSR junctions recovered from Xrcc4-/- and
19 DNA-PKcsKD/KD B cells are enriched for MHs, with nearly 50% of junctions containing 2-3 nt
MHs, in contrast to 20-25% in WT cells (Crowe et al., 2018a). Perhaps most surprising is that the CSR junctions from DNA-PKcs-/- B cells with nearly 90% of WT levels of CSR are also equally enriched for MHs (Crowe et al., 2018a), suggesting MHs facilitate CSR. But whether this
MH-mediated CSR in DNA-PKcs-/- B cells depends on Alt-EJ or LIG4-mediated cNHEJ remains to be determined. Two features of CSR might contribute to the robust residual CSR in cNHEJ deficient cells that prefer the MH-mediated end-joining – the highly repetitive and GC rich switch region that is ideal for MH-mediated repair (Dunnick, Hertz, Scappino, & Gritzmacher, 1993) and the S/G2 phase of the cell cycle that allows resection and promotes end-annealing.
3.2.2. The contribution of A-EJ to CSR
The robustness of Alt-EJ mediated CSR provides a unique tool to study the Alt-EJ pathway. In contrast to cNHEJ that ligates both strands of the DNA double helix simultaneously, the Alt-EJ pathway uses MH-mediated annealing to convert one DSB into two single-strand nicks. The conversion of a DSB to two single-strand nicks bypasses the requirement for LIG4 and allows the single-strand DNA ligases - LIG3 in complex with XRCC1 or LIG1 with PCNA – to complete the A-EJ mediated CSR (Boboila, Oksenych, et al., 2012). End-resection, which is required for MH-mediated repair to expose flanking MHs, is also evident in Xrcc4-/-, DNA-PKcs-/- and DNA-PKcsKD/KD B cells (Crowe et al., 2018a). However, it remains unknown whether end- resection is required for A-EJ mediated CSR in the highly repetitive switch region, a question that we will address in chapter 4. Moreover, the deletion of Ku70 in Lig4-/- B cells reduces the bias toward MHs (Boboila, Jankovic, et al., 2010; Boboila, Yan, et al., 2010), suggesting there might be more than one A-EJ pathway – one that requires long MHs and the that does not.
Also, pol θ expression increases in activating B cells (Kawamura et al., 2004) and might contributes to A-EJ through templated nucleotide insertions. Although Polq-/- B cells have normal CSR efficiency (Y. Li, Gao, & Wang, 2011), the percentage of recovered junctions with
20 insertions is significantly lowered (X. Zhang et al., 2019). Interestingly, Polq-/- B cells also show increased IgH-Myc chromosomal translocations (X. Zhang et al., 2019), suggesting a role of pol
θ in suppressing MH-mediated translocations. The genetic requirement for A-EJ mediated CSR is still being investigated. Loss of A-EJ factors, including XRCC1, an obligatory partner of Lig3 in the nucleus (Simsek, Furda, et al., 2011), PARP1, or POLQ, all did not compromise CSR efficiency alone (Boboila, Oksenych, et al., 2012; Ghosh, Roy, Kamyab, Danzter, & Franco,
2016; Y. Li et al., 2011; Rybanska et al., 2013). Loss of DNA-PKcs (Bjorkman et al., 2015; G.
C. Bosma et al., 2002; Franco et al., 2008; Kiefer et al., 2007; Manis, Dudley, Kaylor, & Alt,
2002) or DNA-PKcs phosphorylation at the T2609 cluster (Crowe et al., 2020) has a mild effect on IgG1 CSR efficiency in vitro. But the CSR junctions recovered from the DNA-PKcs-/- or DNA-
PKcs5A/5A mice are highly enriched for MHs (Crowe et al., 2018a; Crowe et al., 2020). The results suggest that MH-mediated end-joining could be quite robust during CSR. Given the much more severe CSR defects in Lig4-/- B cells, the end-ligation that generates these small
MHs likely includes contributions from both the cNHEJ pathway and the A-EJ pathway. The exact contribution of A-EJ to physiological CSR in cNHEJ-proficient cells also remains to be determined.
3.2.3. The role of DNA damage response in CSR
In contrast to V(D)J recombination that is only mildly affected by DDR-deficiency or in sensitized backgrounds, CSR highly depends on the DDR. CSR is significantly (>50%) impaired in cells lacking ATM (Lumsden et al., 2004; Pan-Hammarstrom et al., 2006; Reina-San-Martin, Chen,
Nussenzweig, & Nussenzweig, 2004) or its downstream targets H2AX (Franco, Gostissa, et al.,
2006; Reina-San-Martin et al., 2003), MDC1 (Lou et al., 2006; Manis et al., 2004), RNF8,
RNF168, or 53BP175, or even PTIP (Daniel et al., 2010; Starnes et al., 2016), REV7 (gene name MD2L2) (Ghezraoui et al., 2018; Xu et al., 2015), the SHIELDIN complex (Dev et al.,
2018; Findlay et al., 2018; Ghezraoui et al., 2018), or RIF1 (Chapman et al., 2013; Di Virgilio et
21 al., 2013). ATM kinase inhibitors or expression of kinase-dead ATM have similar impacts on
CSR as Atm loss(Yamamoto et al., 2012), suggesting that ATM contributes to CSR mainly through its kinase activity. Notably, although 53BP1 has a similar, if not a weaker, role in general DSB repair and irradiation resistance than ATM or H2AX, loss of 53BP1 leads to a 95% reduction of CSR that is much more prominent than all other repair factors (Bothmer et al.,
2010; Franco, Gostissa, et al., 2006; Manis et al., 2004). More recently, it has also been proposed that 53BP1 ensures that the orientation of CSR junctions favors productive CSR beyond end-ligation (Daniel et al., 2010). Taken together, the dynamic process of CSR provides us a unique system to study the interplay between DDR factors and repair machinery during the lymphocyte maturation process.
4. The role of CtIP in lymphocyte development
CtIP is essential for embryonic development. Several attempts have been made to address the function of CtIP in B cells, especially during CSR. Knockdown of CtIP using shRNA in purified splenic B cells compromises CSR, which has been attributed to its direct contribution to Alt-EJ, or its indirect effects on CDK2 activation or cell viability (Buis, Stoneham, Spehalski, &
Ferguson, 2012; Lee-Theilen, Matthews, Kelly, Zheng, & Chaudhuri, 2010; Polato et al., 2014).
Knockin mouse models expressing S327A CtIP that cannot interact with BRCA1 can support both embryonic development (Reczek, Szabolcs, Stark, Ludwig, & Baer, 2013) and B cell CSR
(Polato et al., 2014). In transgenic mouse models that express exogenous human CtIP proteins, embryogenesis and CSR can be rescued by expression of the phospho-mimetic CtIP-
T847E mutant, but not the phospho-deficient CtIP-T847A mutant (Polato et al., 2014). In proliferating human cells, CtIP phosphorylation at T847 was proposed as a prerequisite for
ATR/ATM-mediated hyper-phosphorylation of CtIP upon DNA damage (H. Wang et al., 2013).
Yet, in G1 arrested murine B cells, CtIP can still resect unrepaired DSBs in an ATM-dependent manner, but only in the absence of H2AX or 53BP1 (Helmink et al., 2011; X. Liu et al., 2012;
22 Oksenych et al., 2012; Zha, Guo, et al., 2011), suggesting that CtIP can function outside S/G2 when CDK activity is minimal. However, it is unclear which CtIP residues – T859 (Peterson et al., 2012; H. Wang et al., 2013) or other potential ATM sites (Makharashvili et al., 2014) are relevant in G1.
Using developmental stage-specific Cre-recombinase and a conditional CtIP allele
(Bothmer et al., 2012), I collaborated with Dr. Xiangyu Liu in the lab and inactivated CtIP in either pre-B cells via Mb1Cre (Hobeika et al., 2006) or the naïve B cell-specific CD21Cre (Kraus et al., 2001). We found that CtIP is essential for early B cell development, independent of V(D)J recombination, in part due to its ability to support continued proliferation at the G2/M transition.
A genetic complementation screen reveals that the interaction of CtIP with CtBP, RB, and
BRCA1 and its own nuclease activity is dispensable for B cell proliferation. Instead, the T847, but not the T859 phosphorylation of CtIP, is essential for B cell development and switch recombination. In pre-B cell lines, CtIP deletion causes G2/M arrest, hyperactivation of ATM signaling, and increased mitotic defects, suggesting a critical role of CtIP in resolving replication intermediates (X. Liu et al., 2019). In contrast, somatic deletion of CtIP in naïve B cells via the
CD21Cre is very well tolerated, suggesting CtIP is NOT absolutely essential for cellular viability, but rather selectively required during replication/proliferation (X. Liu et al., 2019).
Correspondingly, CtIP depletion significantly reduces CSR in B cells (X. Liu et al., 2019). Using
HTGTS, we compared the CSR and internal deletion junctions involving 5' S breaks in CtIP+/+ and CtIP-/- B cells and found that CtIP-deficiency does not measurably affect the MH usage and end-resection in the residual junctions (Figs. 1.3A&B). Likewise, the T855A phosphorylation site mutation, which impairs ATR/ATM-dependent induction of CtIP-mediated resection, did not affect CSR efficiency or MH usage (Figs. 1.3C). These findings suggest that CtIP, and CtIP- mediated end-resection per se, may play a limited role in CSR, at least when measured within
23 cNHEJ-proficient cells. In chapter 4, I deleted or mutated CtIP in cNHEJ-deficient cells to determine the impact of CtIP mediated resection on A-EJ mediated CSR.
24 3. Figure 1-3: T859 phosphorylation of CtIP is dispensable for normal B cell development and CSR.
(A) The spatial distribution of prey-break sites in Sγ1 presented as the frequency (%) of Sγ1 prey-break sites that falls into each 100-bp bin. The pool of all data from each genotype was plotted. All (−, red, from telomere to centromere orientation) and (+, blue, from centromere to telomere orientation) strand prey breaks add up to 100%. For each genotype, the number of total (+) strand (blue) and (−) strand (red) junctions are marked on the right. The dashed lines indicate the percentage of (−) strand Sγ1 prey that fall outside the core Sγ1 region. (B) The distribution of IgH junctions by junctional sequence features (blunt). This panel represents the pool of IgH junctions from each genotype. The numbers of junctions from each genotype are listed in the small table in the figure (n > 2,300 for each genotype). Statistical significance was assessed using a two-tailed Student’s t test (n.s., P > 0.05; *, P < 0.05). (C) The CTV labeling for cell proliferation in activated splenic B cells from Ctip+/+ and CtipT855A/T855A mice. The switch percentage in each respective cell division is plotted on the right (P = 0.74 via Student’s t test).
5. Chromosomal translocations during lymphoid malignancy
Mis-repair of the programmed DSBs generated during lymphocyte development can participate in oncogenic chromosomal translocations. Indeed, human lymphoid malignancies are often characterized by recurrent chromosomal translocations involving Ig and TCR loci, such as IgH-CyclinD1 translocation in Mantle cell lymphomas, IgH-BCL2 translocation in
Follicular Lymphomas, and the IgH-Myc fusion protein found in Burkitt's lymphoma (Gelmann,
Psallidopoulos, Papas, & Dalla-Favera, 1983; Groffen, Hermans, Grosveld, & Heisterkamp,
1989; Kuppers & Dalla-Favera, 2001; Nowell & Hungerford, 1960). The mechanism of chromosomal translocation has been extensively studied. Using reporter systems and sequencing analyses, Jasin and colleagues suggest that the majority of chromosomal translocations in human cells are mediated by the cNHEJ pathway (Ghezraoui et al., 2014).
In mouse models lacking core cNHEJ factors, programmed DSBs accumulate in immature B and T cells. In p53-deficient backgrounds, a subset of the DSBs at the IgH locus can be mis-joined with spontaneous DSBs downstream of the c-Myc or n-Myc oncogene, eventually leading to the co-amplification of IgH-Myc and aggressive lethal pro-B cell
25 lymphomas (Frank et al., 2000; Gao et al., 2000; Rooney et al., 2004b; Zhu et al., 2002). This is in contrast to the mature B cell lymphomas, in which the active IgH3' enhances can drive the de-regulated expression of oncogenic Myc without amplification (Gostissa et al., 2009).
Analyses of the Igh-Myc junctions in cNHEJ/p53 double deficient B cell lymphomas reveal preferential usage of MHs, providing a good model system to examine the role of CtIP in A-EJ mediated oncogenic chromosomal translocation (Zhu et al., 2002). In addition to the initial translocation, the co-amplification of the IgH-Myc is thought to be mediated by a break-fusion- bridge cycle, which is only possible in check point deficient background. Presumably, the absence of the p53-mediated checkpoint also helps the lymphoma cells to tolerate Myc- deregulation. Accordingly, p53 loss markedly accelerated the development of Eµ-Myc driven lymphomas in mouse models (Post et al., 2010). In Chapter 3, we will use this system to investigate the role of CtIP and DNA damage-induced CtIP phosphorylation (T859) in oncogenic translocations in vivo.
In summary, the goal of my thesis research is to determine the regulation (via chromatin accessibility) and role of CtIP in normal lymphocyte development and lymphomagenesis with a focus on its contribution through the A-EJ pathway. For this goal, I took advantage of mouse models carrying germline mutation or conditional deletion alleles of CtIP on both cNHEJ proficient and deficient backgrounds and applied high-throughput sequencing-based methods.
The results will be summarized in the following chapters.
26 Chapter 2: Assessing Chromatin Dynamics and Genome Integrity upon DNA
Damage
Figures 1B, 1D, 2A, 2B, 3D, 3E, 5, 6, 8A-C, 9, 10A were generated using a generous share of an analytical software made by Dr. Antony Holmes. Analysis in figures 1C, 7, 8D, 11 were done by Dr. Junfei Zhao. Data shown in figures 1-3 B and C were generated by Dr. Xiangyu Liu.
1. Introduction
Human lymphoid malignancies often contain recurrent chromosomal translocations that place oncogenes (e.g., c-Myc, Bcl6, Bcl2) in proximity to the active antigen receptor gene enhancer and/or promoter and causes the deregulated expression of the oncogenic gene products. (Nussenzweig & Nussenzweig, 2010). The chromosomal translocations often rise from the mis-repair of programmed DSBs generated during V(D)J recombination or CSR. The nucleolytic processing could modify unrepaired breaks and facilitate repair events. But excessive processing can lead to large deletions and eventual translocations. Chromatin- associated DDR factors play important roles in regulating end-resection. In this chapter, we utilize ATAC-Seq and EndSeq, two genome-wide sequencing methods, to test the hypothesis that 53BP1 and other chromatin-bound DDR factors limit end-resection by blocking chromatin accessibility around the breaks un-repaired DSBs.
The transcriptional and post-translational regulation of RAG protein is cell cycle- regulated to ensure the initiation and completion of V(D)J recombination in the G1 phase of the cell cycle when HR is not available (Bredemeyer et al., 2006; Schatz, 2004). RAG is also known to exclude A-EJ from V(D)J recombination (Corneo et al., 2007) and limit chromosomal translocations (Chaumeil et al., 2013). In v-abl kinase transformed B cells, STI571, a tyrosine
27 kinase inhibitor, can induce G1 cell cycle arrest, RAG expression, and robust chromosomal
V(D)J recombination (Bredemeyer et al., 2006). Several studies, including our data, suggested that ATM, H2AX, and 53BP1 are essential for chromosomal cNHEJ and V(D)J recombination in
XLF-/- lymphocytes (X. Liu et al., 2012; Oksenych et al., 2012; Zha, Guo, et al., 2011). The unrepaired ends accumulate in ATM/XLF double deficient cells, yet were rapidly degraded by
CtIP-mediated resection in XLF/H2AX or XLF/53BP1 double deficient cells (Helmink et al.,
2011; X. Liu et al., 2012; Zha, Guo, et al., 2011). The processed free DNA ends can serve as substrates for A-EJ that preferentially use MHs at the junctions. Persistent DSB can participate into chromosomal translocations. Indeed, XLF/53BP1-double deficient mice developed spontaneous lymphomas involving antigen receptor gene loci (X. Liu et al., 2012). Taken together these findings provide a robust cellular system to address the role of chromatin- associated DDR factors in DSB processing, error-prone end-joining and translocations events.
DDR factors participate in the maintenance of genomic stability in part through phosphorylation of chromatin-bound DNA repair factors (Hauer & Gasser, 2017). In eukaryotic cells, DNA is wrapped around nucleosomes. Previous studies showed that chromatin remodeling following DDR and involving relaxation and disassembly of nucleosomes was necessary for end-resection and HR (Price & D'Andrea, 2013). But how chromatin dynamics affect cNHEJ remains unknown and will be one of the questions we tried to address in this chapter. DSBs activate ATM kinase. Activated ATM phosphorylates histone H2AX to form γ-
H2AX flanking the DSBs (Rogakou et al., 1998), which in turn recruits other chromatin- associated DDR factors, such as MDC1 as well as RNF8 and RNF168 (Lou et al., 2006;
Stewart et al., 2003; Stucki et al., 2005). The E3 ubiquitin activity of the RNF8/168 together deposit Ub on histone H2A, which contribute to the recruitment of 53BP1, BRCA1, and other proteins (Ciccia & Elledge, 2010). Specifically, H2AK15ub directly recruits 53BP1 to facilitate
NHEJ and binds to the BRCT domain of BARD1 to recruit the BRCA1-BARD1 complex (Becker
28 et al., 2020). While BRCA1 promotes end-resection and eventually homologous recombination,
53BP1 limits end-resection, including those mediated by the CtIP and MRN complex (Bunting et al., 2010; Zhao, Kim, Kloeber, & Lou, 2020). Remarkably, the loss of 53BP1 rescues the embryonic lethality and the homologous recombination defects associated with BRCA1 deletion.
Yet, the molecular basis of this functional division is not known.
Recently, several groups have developed high-throughput sequencing-based methods to map genome-wide DNA features (Buenrostro, Wu, Chang, & Greenleaf, 2015; Canela et al.,
2017; Crosetto et al., 2013; Dorsett et al., 2014; Mimitou et al., 2017) in order to understand chromatin dynamics upon DNA damage or identify fragile sites under stress conditions. Here we performed ATAC-Seq to measure DNA accessibility changes and EndSeq to capture free DNA ends upon targeted DSBs induction. In end-joining deficient B cells (Xrcc4-/-) that also lacks
53BP1, ATM promotes CtIP-facilitated MRN mediated end resection flanking un-repaired RAG- generated DSB ends occurs without detectable changes in DNA accessibility. This might be in part due to the high baseline accessibility of the V(D)J recombination regions. In contrast, endonuclease generated breaks in the same cells (Xrcc4-/- or Lig4-/-) increased local accessibility and show limited resection within a ~ +/-1 kb window flanking the DSB sites. In the absence of
53BP1, local chromatin becomes even more accessible and correlated with higher vulnerability to DNA breakages, showing as longer resection tracks within a +/- 1kb region. These results are in general agreed with the previous data with regards to the range of nucleosome disassembly and reassembly upon DSBs (X. Li & Tyler, 2016). Moreover, we showed that genome-wide DNA breakages were more likely to be found in more accessible regions. Interestingly, we also find a correlation between the DNA damage-triggered accessibility changes and the initial accessibility of the region, and the presence of 53BP1.
29 2. Results
2.1. ATAC-Seq profiles at the TSS are consistent across genotypes and in independent cell lines.
ATAC-Seq was originally developed to measure chromatin accessibility in transcriptionally active regions or super-enhancers (Fig. 2-1A) (Buenrostro et al., 2015), which are relatively consistent and stable features in a population of cells. To adapt ATAC-Seq to measure "heterogeneous" and often "transient" chromatin accessibility changes around DNA double-strand breaks, we made the following modifications: 1) created inducible site-specific breaks at the same genomic locations in all cells to reduce the heterogeneity of the response and enhance signal vs. noise ratio; 2) arrest the cells in the G1 phase of the cell cycle to avoid the impact of DNA replication and chromosomal segregation on the ATAC-Seq signals; 3) block the cNHEJ pathway to cause the accumulation of DSBs; 4) generated cell lines with inducible
CtIP inactivation allele to preserve the otherwise resected DNA and boost the ATAC-Seq signals. Specifically, we generated v-abl kinase transformed pre-B cell lines (referred to as v-abl cells) with the following genotypes, WT, Lig4-/-, Xrcc4-/-, Xrcc4-/-53BP1-/-, and RosaERCRET2Xrcc4-/-
53BP1-/-CtIPC/C from germline engineered mouse models. The v-abl cells are known to have a karyotype-stable diploid genome. As expected, the ATAC-Seq signals were enriched at the known transcriptional start sites (TSSs) (Fig. 2-1B) and highly reproducible between two independently derived WT v-abl cell lines (Fig. 2-1C). As such, nearly 75% of the ATAC-Seq peaks were overlapping between the two cell lines (Fig. 2-2A). Moreover, v-abl cells of different genotypes listed above also showed a high degree of consistency with respect to the location of the peaks at TSSs and the magnitude of the accumulative signals (Fig. 2-1D, 2B-D). Together these data established the low background and high reproducibility of ATAC-Seq in v-abl cells before the induction of DSBs.
30 2.2. EndSeq can effectively detect RAG-generated breaks at highly accessible regions.
In previous studies, we and others showed that in v-abl cells, v-abl kinase inhibitor
STI571 (also known as imatinib, 3M) could induce robust G1 cell cycle arrest, RAG protein accumulation, and efficient V(D)J recombination at the integrated pMX-INV substrate
(Bredemeyer et al., 2006; W. Jiang et al., 2015). The pMX-INV contains an inverted GFP flanked by two recombination signal sequences (RSSs, triangles) followed by IRES-hCD4 (Fig.
2-2C). RAG expression and successful rearrangement lead to GFP expression that can be visualized by FACS (Fig. 2-2C). The completion of the rearrangement requires cNHEJ-mediated end-ligation. Thus, in cNHEJ-deficient cells (e.g., Xrcc4-/- or Lig4-/-), there was an accumulation of the un-repaired coding ends (CEs) and signal ends (SEs) (Fig. 2-3A and B) and no GFP
31 expression after STI571 treatment (Fig. 2-2C). As we and others show, the loss of 53BP1 led to nearly complete
32 4. Figure 2-1: Experimental schematic and performance for studying RAG generated
DSBs.
(A) Simplified experimental setup and workflow. B cells with or without targeted DSBs were collected in parallel for ATAC-Seq or EndSeq analysis. (B) ATAC-Seq signal enrichment within a 2 kb window around all TSSs annotated in the mouse genome (mm10), indicating open chromatin region. (C) A pair of biological replicates of ATAC-Seq were performed on wildtype cells arrested in the G1 phase. Each point represents a peak with fixed width (501bp, +-250bp around the summit) called by MACS2 using the default parameters. (D) Example ATAC-Seq profiles of a random 1 Mb region (chr14:102,700,000-103,700,000) from cells collected at
33 control (STI treated G1 arrest) condition. Locations of reference genes contained within this region are marked at the bottom.
5. Figure 2-2: Experimental performance and validation.
(A) Overlap of all peaks called by MACS2 using the default parameters from biological repeats of wildtype cell lines. (B) Overlay of ATAC-Seq signal enrichment within a 2kb window around all TSS sites from WT, Lig4-/-, Xrcc4-/-, and Xrcc4-/- 53BP1-/- CtIP-/- cells under G1 arrested condition. (C) Left panel: schematic of the pMX-INV substrate. Right panel: representative
FACS analyses of WT and Xrcc4-/- cells with or without 24 hours treatment with 3 µM STI571.
(D) Representative PCR genotyping of CtIP allele in Rosacre/cre CtIPc/c Xrcc4-/- 53BP1-/- cells before and after 24 hours of 1 µM 4OHT treatment with Rosa+/+ CtIPc/c Xrcc4-/- 53BP1-/- cells as control. degradation of the 3'CEs (Fig. 2-3B). ATM inhibitor, and even better, the combination of ATM and DNA-PKcs inhibitors blocked the end-degradation and restored the accumulation of the
3'CEs (Fig. 2-3B). The end-degradation depended on CtIP. Deletion of CtIP completely prevented the end-degradation and restored the 3'CEs (Fig. 2-3C). Restore all the ends including the 3'CEs are important for measuring accessibility via ATAC-Seq since the ATAC-
Seq signal depends on the robust amplification of the involved DNA fragments.
To compare and contrast ATAC-Seq with the degree of DNA end-resection at the nucleotide levels, we adapted the EndSeq method developed by the Nussenzweig laboratory
(Canela et al., 2016) (Fig. 2-1A). Briefly, the DNA ends or ssDNA overhangs were blunted by
Exo T nuclease before ligated with a biotin-hairpin adaptor for signal enrichment and followed by amplification. Upon the induction of RAG cutting, Xrcc4-/- cells displayed a prominent peak at the expected location for the 5' and 3' CEs & SEs (Fig. 2-3D). Consistent with efficient repair,
34 only a very small peak at the correct genomic location can be identified in WT cells (Fig. 2-3D).
No EndSeq peaks were found within the ~5 kb pMX-INV substrate in Xrcc4-/-53bp1-/- cells, consistent with the excessive end-degradation. CtIP-deletion partially restored the CEs and presumably SEs as well (Fig. 2-3D). Those results showed that the DSBs could be effectively mapped via EndSeq in our cells. However, when ATAC-Seq was applied to measure the chromatin accessibility, we noted that samples showed high and similar pMX-INV substrates accessibility, regardless of the genomic integration site and genotypes. While this observation is consistent with the requirement for transcription and acetylated histone for proper RAG-induced cleavage, the high initial accessibility covered any DSBs associated accessibility changes in
Xrcc4-/- cells over the WT controls (Fig. 2-3E). Notably, consistent with excessive end- degradation, almost no ATAC-Seq signal was detected within the pMX-INV substrate in Xrcc4-/-
53bp1-/- cells (Fig. 2-3E). This data suggested that the DSB induced chromatin accessibility changes cannot overwrite the open chromatin at the transcriptionally active regions. It might also imply that the open chromatin might facilitate the aggressive resection at the pMX-INV in
Xrcc4-/-53bp1-/- cells. We hypothesized that DSBs in less accessible regions might provide lower background to measure DSB-induced chromatin accessibility changes, if there is any.
2.3. ATAC-Seq reveal a correlation between loss of 53BP1 and higher endonuclease- induced accessibility.
Next, we adapted the tamoxifen-inducible I-PpoI endonuclease and estrogen receptor
(ER) fusion to generate site-specific breaks in G1 arrest cells. The I-PpoI endonuclease recognizes 18 unique sites in the mouse genome, plus one site within the 28s rDNA repeats. I-
PpoI cleavages generates a four bp 3' overhang on both sides of the DNA ends (Fig. 2-4A).
The I-PpoI-ER-IRES-hCD8 cassette was introduced into v-abl cells via retroviral infection (Fig.
2-4B). The expression of human CD8 serves as an indicator of infection and the nuclear
35 translocation of I-PpoI-ER is induced by 4-hydroxy tamoxifen (4OHT). In the experiments described here, the 4OHT was added after the cells were arrested in G1 via STI571 for 24hr. In contrast to the RAG accumulation and cleavage, which takes a few days (Fig. 2-3A-C), I-PpoI cleavage is fast and very robust. When qPCR was used to measure the loss of intact DNA around the PPO1 site, the DSBs is detectable in WT cells after only 5 hours of 4OHT treatment, in part due to the ability for I-PpoI to continually cut the perfectly repaired junctions (Fig. 2-4C).
In WT cells, the loss of the across-DSB signal (by PCR) at the representative I-PpoI site (site 1) attenuates at 24hr after induction, potentially due to mutagenic repair and the gained resistance to I-PpoI cutting (Fig. 2-4C). Accordingly, in NHEJ-deficient cells (e.g., Lig4-/- or Xrcc4-/-), the unrepaired ends accumulated at both 5 and 24 hours (Fig. 2-4C, lanes 6-10). Similar to the
RAG-generated breaks, loss of 53BP1 promotes extensively end-resection around the unrepaired break, which can be rescued by CtIP conditional deletion or by ATM inhibition (Fig.
2-4C, lanes 11-16, 18-21). Quantitative PCR analyses of additional I-PpoI cutting sites (site 5 and 9) also show similarly effective cutting in cNHEJ-deficient cells (Fig. 2-4D).
36 6. Figure 2-3: Free DNA ends stably accumulated in RAG-generated breaks. (A) Schematic diagram of the pMX-INV substrate for V(D)J recombination. The triangles represent the recombination signal sequence (RSSs), and the location of the Southern probe used in B and C was marked. The 3'conding ends (CEs) were drawn in red. UR: un-rearranged, CJ: coding join, CE: coding end, RV=EcoRV, N=NcoI. (B) Southern blot analyses for V(D)J recombination at the pMX-INV substrates in WT, Xrcc4-/-, and Xrcc4-/-53BP1-/- cells with or without ATM or DNA-PK inhibitor (C) Southern blot analyses of V(D)J recombination in RosaERCreXlf-/-53bp1-/-CtIPC/C cells, with or without genomic CtIP deletion (+/- 4OHT). The predicted location of the 3' CE smear was marked with a red bracket. (D&E) Normalized EndSeq (top, D) or ATAC-Seq (bottom, E) signals within the pMX-INV substrate from WT, Xrcc4-/-, and Xrcc4-/-53bp1-/- CtIP-/- cells arrested in G1 phase, after treated for 48 hours with 3 µM STI571. For EndSeq signals not visible due to differences in signal strength, marked by arrows, traces of the first 2.2 kb with adjusted Y-axises were shown on the side. RSS site was aligned and marked with a dashed box.
37 7. Figure 2-4 Experimental schematic and performance of inducible I-PpoI endonuclease system.
(A) Simplified experimental setup and workflow. Targeted cells were infected with I-PpoI-ER- IRES-htCD8a construct, arrested in the G1 phase using 3 µM STI571 for 24 hours before the addition of 500 nM 4OHT to initiate nuclear translocation of the I-PpoI protein. (B) Representative FACS analyses of WT, Xrcc4-/-, Xrcc4-/-53BP1-/-, and Xrcc4-/-53BP1-/- CtIP-/- cells with 24 hours treatment with 3 µM STI571 after infection. (C) Southern blot analysis of WT, Lig4- /-, Xrcc4-/-, Xrcc4-/-53BP1-/- CtIP-/-, and Xrcc4-/-53BP1-/- cells with or without ATMi, collected at 0 hour, 5 hours or 24 hours after I-PpoI induction, using site 1 specific probe (chr1:191122295- 191122817). EV, empty vector. (D) I-PpoI in vivo cutting efficiency measured by qPCR using primers flanking site 1 (chr1:191121001-191121015), 5 (chrX:116287262-116287276), and 9 (chr4:72028080-72028094), and internal control (200bp upstream from I-PpoI cutting site 1). Fold enrichment (2^(-∆∆CT)) was calculated using 100 ng genomic DNA input relative to WT STI control condition and actin.
38 Next, we performed parallel ATAC-Seq and EndSeq analyses on cells collected before or 24 hours after I-PpoI induction. The accessibility around the 18 I-PpoI sites was similar in STI treated cells regardless of genotypes (Fig. 2-5A, left panel, and 2-5B). I-PpoI induction for 5 or
24 hours did not markedly affect the local accessibility in WT cells, caused a moderate increase of local (+/- 1kb) accessibility at 5 hours yet decreased slightly at 24 hours in Xrcc4-/- or Lig4-/- cells, while caused a persistent marked increase of accessibility in CtIP-/-Xrcc4-/-53bp1-/- cells
(Fig. 2-5A, mid and right panel, and 2-5C-E). No significant increase of accessibility was noted in Xrcc4-/-53bp1-/- cells, potentially due to the loss of DNA template in resection. ATM inhibition does not significantly affect the accessibility changes in Xrcc4-/-53bp1-/- cells (Fig. 2-5A), suggesting that ATM might function downstream of accessibility (e.g., MRN and CtIP) to modulate end-resection. These results revealed that accumulated DSB can increase local chromatin accessibility and 53BP1 suppresses the local accessibility increase.
2.4. The increase of accessibility affects a broader region than physical end-resection.
To understand the cause-effect relationship, we compared the regions affected by increased accessibility vs end-resection. We first performed EndSeq in parallel with ATAC-Seq on the same cell pools. As a highly dynamic region with over 300 repeats, the 28s rDNA loci as a whole contains significant DSBs even without I-PpoI induction, and contributed to 60-80%
(57.7% in WT cells and 82.1% in Xrcc4-/- cells) of EndSeq reads mapped to all I-PpoI sites at 24 hours after induction. Upon I-PpoI induction, sharp EndSeq peaks representing unprocessed
DSBs could be detected in WT cells (Fig. 2-6A). Xrcc4-/- cells accumulated a broader peak within the boundary of the increased accessibility (Fig. 2-6A and B). Xrcc4-/- 53BP1-/- cells had reduced EndSeq signals that were mildly restored by ATM inhibition (Fig. 2-6A). CtIP deletion further restored the DNA ends in Xrcc4-/-53BP1-/- cells, leading to the accumulation of a significant EndSeq signal around the breaks (Fig. 2-6A and C). Nevertheless, the extent of end- resection (~0.5kb) always stayed within the boundary of increased accessibility (~1kb). To
39 better visualize the resection at each I-PpoI site, the EndSeq data were replotted by each site in
Fig. 2-7. The comparison of EndSeq before and after I-PpoI induction among different cell lines was included in Fig. 2-8 A, B, and C. We note, while the I-PpoI only induced a countable number of DSBs on the genome, principal component analyses of all the EndSeq peaks can readily distinguish the cells with I-PpoI induction from those without, suggesting a potential global and indirect impact of I-PpoI-generated breaks (Fig. 2-8D).
40 8. Figure 2-5: Persistent DSBs caused increased chromatin accessibility in the local region.
41 (A) Heatmap for relative accessibility (RPM) measured within 10 kb window of 18 predicted I-
PpoI cutting sites, ranked by signal intensity (100 bp bin). (B) Overlay of accumulative normalized ATAC-Seq signal (RPM) around 6 kb window flanking all I-PpoI sites before I-PpoI cutting in WT, Xrcc4-/-, Xrcc4-/-53BP1-/-, and Xrcc4-/-53BP1-/- CtIP-/- cells (100 bp bin). (C-D)
Overlay of accumulative normalized ATAC-Seq signal (RPM) around 6 kb window flanking all I-
PpoI sites before and after 24 hours I-PpoI cutting in WT (C) or Lig4-/- cells (D) (100 bp bin). (E)
Overlay of accumulative normalized ATAC-Seq signal (RPM) around 6 kb window flanking all I-
PpoI sites after 24 hours I-PpoI cutting in WT, Xrcc4-/-, Xrcc4-/-53BP1-/-, and Xrcc4-/-53BP1-/- CtIP-
/- cells (100 bp bin).
42
43 9. Figure 2-6: Free DNA ends accumulate surrounding persistent DSB sites.
(A) Representative normalized EndSeq signal (RPM) of 2 kb window flanking I-PpoI site 17
(chr17:24665012-24667012) from WT, Xrcc4-/-, Xrcc4-/-53BP1-/- (with and without ATMi), and
Xrcc4-/-53BP1-/- CtIP-/- cells (10 bp bin). A 400 bp window flanking I-PpoI recognition site is marked with a blue bar at the bottom of the trace. (B) Overlay of accumulative normalized
ATAC-Seq (purple) and EndSeq (blue) signal (RPM) within 10 kb window flanking all I-PpoI sites before and after 24 hours I-PpoI cutting in Xrcc4-/- cells (100 bp bin). (C) Overlay of accumulative normalized changes in ATAC-Seq signal (STI baseline subtracted from 24 hours
44 induction) (purple, right secondary vertical axis) and EndSeq (blue left primary vertical axis) signal (RPM) within 10 kb window flanking all I-PpoI sites before and after 24 hours I-PpoI cutting in Xrcc4-/-53BP1-/- CtIP-/ cells (100 bp bin).
10. Figure 2-7: Increased amount of free DNA ends accumulate in the absence of 53BP1.
Normalized EndSeq signal within +- 5kb window flanking I-PpoI sites collected after 24 hours of I-PpoI cutting induction. The top panel shows accumulated signals from all I-PpoI cutting sties (bin =50 bp). In the bottom panel, each lane represents a unique I-PpoI cutting site (bin =50 bp), ranked by signal intensity.
45 2.5. Persistent DNA damage response altered the chromatin accessibility at distal regions
While analyzing the ATAC-Seq, we noted some highly accessible chromatin regions were free of increased breaks, such as increased accessibility around open RAG1 and RAG2 promoters without increase breaks (Fig. 2-9A). A similar phenotype was noted in the enhancer of eukaryotic translation initiation factor 4E transporter (Fig. 2-9B). Yet, the adjacent TSS of
Centrin Binding Protein (Sfi1) showed a significant amount of breakage among all conditions
(Fig. 2-9B). This observation prompted us to ask whether there was a general increase of accessibility in highly accessible regions after persistent DSBs. To do so, we ranked all TSS based on their accessibility before I-PpoI induction in Xrcc4-/- cells (Fig. 2-10A) and plotted the accumulative accessibility change of the 50 most accessible TSSs (Fig. 2-10B), and found a clear increase of accessibility after I-PpoI induction. Curiously, these changes were largely diminished in CtIP-/-Xrcc4-/-53BP1-/- cells (Fig. 2-10C). If we do the same for the moderately accessible TSS (Fig. 2-10D) or the not-so-accessible (Fig. 2-10E) TSS in Xrcc4-/- cells, we noted a positive correlation between basal accessibility and the DSB-induced increase. No significant changes of accessibility were noted in TSSs from CtIP-/-Xrcc4-/-53BP1-/- cells with moderate or low accessibility (Fig. 2-10F and G). Out of the 23938 TSSs, 3 have I-PpoI sites within 5 kb and
5 have within 5-10 kb; the others are not close to any DSB sites (10 kb above distance). These accessibility-dependent changes are abrogated in the absence of 53BP1. Based on these data, we propose that accessible chromatin with lower histone density cannot effectively recruit
53BP1, a histone binding protein, and therefore might be more vulnerable under persistent DNA damage.
Next, we asked whether the increased accessibility has any biological consequence. To do so, we performed gene-set enrichment analyses (GSEA) on EndSeq peaks from each
46 sample. The result showed that DSBs tend to occur in accessible regions regardless of genotypes or the induction of I-PpoI cleavage (Fig. 2-11).
47
11. Figure 2-8: Free DNA ends can be detected upon persistent DSBs induction.
(A-C) Overlay of accumulative normalized EndSeq signal (RPM) within 3 kb window flanking all
I-PpoI sites before and after 24 hours I-PpoI cutting in WT (A), Xrcc4-/- (B) or Xrcc4-/-53BP1-/-
CtIP-/- cells (C) (10 bp bin). (D) Principal component analysis plot of the consensus peaks of all
EndSeq samples, before (light blue) and after (dark blue) DSBs induction.
48 12. Figure 2-9: Side-by-side comparison of normalized ATAC-Seq signal and EndSeq signal.
(A) Normalized ATAC-Seq (left) and EndSeq (right) signal of a 30 kb window containing G1- transcribed RAG1 and RAG2 gene loci among WT, Xrcc4-/- or Xrcc4-/-53BP1-/- CtIP-/- cells before and after DSBs (100 bp bin). (B) Normalized ATAC-Seq (left) and EndSeq (right) signal of a 70 kb window containing highly accessible regions among WT, Xrcc4-/-, or Xrcc4-/-53BP1-/- CtIP-/- cells before and after DSBs (100 bp bin).
49 13. Figure 2-10: DNA damage-induced global accessibility changes are 53BP1 dependent.
(A) Heatmap of normalized accessibility (RPM) at 23,938 annotated TSS before (Ctrl) and after I-PpoI 24 hours induction in Xrcc4-/-and TKO (Xrcc4-/-53BP1-/- CtIP-/-) cells, averaged from two independent repeat experiments. (B-G) Average of accumulative accessibility in a group of 50 TSSs with top signal intensity (rank 1-50) (B-C), medium signal intensity (rank 9951-10000) (D- E), and low signal intensity (rank 14951-15000) (F-G), at before (STI dash line) and after I-PpoI induction (24hr solid line), in Xrcc4-/- (B, D, F) and TKO (Xrcc4-/-53BP1-/- CtIP-/-) (C, E, G) cells, and the ratio (Ln(24hr/STI)) representing changes caused by targeted DSBs.
50 51 14. Figure 2-11: GSEA enrichment.
Results from WT, Xrcc4-/-, Xrcc4-/-53BP1-/-, and Xrcc4-/-53BP1-/- CtIP-/- cells with or without targeted DSBs. Each analysis represents the relative enrichment for the signature ATAC-Seq peaks that overlap with EndSeq peaks from the corresponding sample. The p-value for each individual plot is marked next to the curve.
3. Discussion
The H2AX- and 53BP1- dependent DNA damage response can limit end-resection in the chromatin context. Recent advance in biochemical characterization has identified RIF1,
SHIELDIN complex and CST complex as the downstream effectors. But how those factors prevent extensive end-resection remains elusive. Here we adapted the ATAC-Seq to measure the accessibility changes at site-specific DSBs. We showed that accessibility does not measurably change in WT cells upon endonuclease induced DSBs, but increases in cNHEJ- deficient cells with persistent breaks. Moreover, we found that deletion of 53BP1 further increases the accessibility to flanking regions. By combining EndSeq with ATAC-Seq, we found that increased accessibility often precedes end-resection, supporting the model in which 53BP1 and its downstream factors suppress chromatin accessibility and prevent end-resection.
Perhaps, most unexpectedly, we noted the accessible regions become more accessible upon
DSB. This increase of relative accessibility requires 53BP1 and can potentially contribute to increased DSBs in transcriptionally active regions.
In the course of the studies, we also noticed some limitations of our approach. First, since the DSB induced accessibility is relatively moderate in WT and even in cNHEJ-deficient cells, ATAC-Seq based approach can only detect DSB induced accessibility change in the previously un-accessible region. As an example, the V(D)J recombination substrate is accessible before the DSBs, and no significant changes are noted. Alternatively, the difference could be unique to RAG-generated breaks, which require specific histone modifications for the cleavage (A. G. Matthews et al., 2007; Ramon-Maiques et al., 2007). Second, we note the
ATAC-Seq quantifies relative accessibility, not absolute accessibility. A gain in a region could
52 mean a loss in another region. We have tested whether fly S2 cells could serve as a spike-in standard as they were broadly used in CHIP-seq analyses. Unfortunately, S2 cells were shown to be aneuploidy (Y. Zhang et al., 2010), which cannot serve as a standard for copy number quantifications. Also, we found a different level of preferential amplification between libraries prepared using the same ratio of target B cells and S2 cells, suggesting the penetration ability or preference may vary due to the status of target B cells and can skew the number of signals absorbed by the S2 cells. Third, ATAC-Seq might not be very sensitive to small changes, since we did not find measurable accessibility changes in WT cells. Alternatively, this could be due to the G1 phase arrest, which limits end-processing.
Perhaps most unexpectedly, ATAC-Seq revealed a global change of accessibility in regions distal from the designed DSBs and without a marked increase of DSBs. Specifically, we found that the accessible chromatin region became more accessible after persistent DSBs. Our preliminary data also suggest that such changes might depend on 53BP1 and, by extension, its downstream markers. While speculative, we propose a model in which persistent DSBs and widespread ATM kinase activation might cause the phosphorylation of H2AX and the recruitment of 53BP1 to other "less accessible" chromatin with a relatively high histone density.
As a consequence, the accessible region with low histone density becomes more accessible.
We further hypothesize that this dynamic balance of DNA damage responses based on chromatin might explain why the majority of tissue- or cell type-specific translocations occurred between actively transcribed genes and why the frequencies of spontaneous DSBs have been correlated with transcription. In future studies, we will focus on selected promoters placed at different distances from the DSBs to determine the parameters that affect the relative gain of accessibility. Moreover, we will also test different time points and different cell cycle phases.
Another type of difference we found was between Southern blot analyses and the sequencing-based method. Firstly, different from the recovered CE smear found in the RAG-
53 generated breaks or I-PpoI ends, the addition of ATMi only mildly recovered the EndSeq signal and did not affect the ATAC-Seq signal. This inconsistency could be caused by several factors.
In EndSeq assay, we used Exonuclease T to blunt and modify the free DNA ends before ligating sequencing adaptors, which is a robust enzyme that could digest away some recovered DNA ends in the ATMi treated conditions, such as long single-strand overhangs or nicked DNA substrates that could be detectable via Southern blotting analyses. Early biochemistry studies also suggested that the original Tn5 had a preference towards dsDNA, and the ability to invade ssDNA substrate is less stable or require a dsDNA template nearby (Egner & Berg, 1981).
Therefore, long ssDNA may not be amplifiable in the ATAC-Seq assay.
Unlike the EndSeq method, which is developed for detecting DNA breakages, the ATAC-
Seq method was widely used as a transcriptional tool to measure robust changes in chromatin status. In our hands, the differences caused by induced DSBs did not lead to major alterations in global chromatin accessibility. From the PCA on EndSeq consensus peaks, the WT group with or without DSBs was separated from the rest of the end-joining deficient samples and also from each other. Meanwhile, all samples with XRCC4 deficiency were grouped and separated by with or without DSBs, suggesting that the global DNA breakage pattern was affected by the induced DSBs. In comparison, ATAC-Seq signals did not have clear separation except in
53BP1 deficiency conditions (data not shown), suggesting that we have not altered major players in controlling global chromatin dynamics. Similarly, from GSEA applied on several biological replicates on different conditions (Fig. 1-11), we concluded that DNA breakage tends to take place in the accessible regions. However, we cannot argue any mild differences caused by DNA damage or genetic background due to the limitation of GSEA power. Moreover, we observed a potential 53BP1 dependent redistribution of nucleosome occupancy upon DNA damage. The relaxation of the heterochromatin region upon DNA damage can be modulated by
ATM and ATR (Hauer & Gasser, 2017), which agrees with our observations, but direct
54 measurement of global chromatin accessibility is still lacking without an independent internal control. Also, even the most accessible TSS regions did not show an increased amount of breaks after DNA damage, suggesting multiple players protecting open chromatin from randomized attack.
In conclusion, in this chapter, we applied high-throughput sequencing methods to study the connection between chromatin accessibility and the vulnerability of free DNA ends generated from RAG- or endonuclease-mediated DSBs. To avoid significant contribution from the dynamic S phase activities, all the experiments discussed in this chapter were performed in the G1 phase, and the more complex situation in S and G2 phases are still to be investigated, especially to ask the impact on chromatin dynamics and chromosomal translocations. One aspect we have not looked at is the translocation products or in what portion of the recovered
DNA breakages will lead to a translocation event. Therefore, translocation assays, introduced in the previous chapter and will be widely used in the following chapters, need to be applied to answer the ultimate correlation between DNA damage response, global accessibility changes, the vulnerability of the breaks, and translocations.
55 Chapter 3: CtIP-mediated DNA resection is dispensable for IgH class switch recombination by alternative end-joining *
* Work described in this chapter is published under:
Wang XS, Zhao J, Wu-Baer F, Shao Z, Lee BJ, Cupo OM, Rabadan R, Gautier J, Baer R, Zha
S. CtIP-mediated DNA resection is dispensable for IgH class switch recombination by alternative end-joining. Proc Natl Acad Sci U S A. 2020 Oct 13;117(41):25700-25711. doi:
10.1073/pnas.2010972117. Epub 2020 Sep 28. PMID: 32989150; PMCID: PMC7568320.
XW contributed to all the figures
1. Introduction
In peripheral lymphoid organs, B lymphocytes undergo Immunoglobulin (Ig) class switch recombination (CSR) to generate antibodies with different effector functions. At the DNA level,
CSR replaces the C exons that encode the Ig heavy chain constant region of IgM antibodies with exons encoding other isotypes (e.g., C1 for IgG1) to generate antibodies with different effector functions (Chaudhuri et al., 2007). CSR is initiated by the B cell-specific activation- induced cytidine deaminase (AID), which converts cytosine to uracil in the transcribed switch (S) regions preceding each set of constant region exons (Hwang, Alt, & Yeap, 2015). The mismatches generated by AID are eventually converted to DNA double-strand breaks (DSBs) in proliferating B cells. The IgH isotype switch is then achieved by joining a DSB in the initially expressed IgM switch region (S) with a DSB in a downstream switch region (e.g., S1 for
IgG1). Two DSBs within the S region can also be joined to form an internal deletion that removes intervening S sequences without achieving isotype switch. The ligation of these AID-
56 initiated DSBs is primarily mediated by classical non-homologous end-joining (cNHEJ) that can directly ligate two unprocessed, or minimally processed, DSB ends. B cells deficient for core cNHEJ factors, such as LIG4 or its obligatory binding partner XRCC4, can still achieve a remarkable 25% of normal CSR, using the mechanistically distinct Alternative-End-Joining (A-
EJ) pathway (Boboila, Yan, et al., 2010; Yan et al., 2007b). In addition to the specific repair pathways, ATM kinase and its chromatin bounded substrates (e.g.,53BP1, H2AX, etc.) promote efficient CSR (Franco, Alt, et al., 2006). But whether ATM specifically promotes cNHEJ- mediated CSR or both cNHEJ and A-EJ mediated CSR remains elusive.
Studies using endonuclease-generated DSBs have shown that the A-EJ and the related
MH-mediated end-joining (MMEJ) pathways both depend on DNA end-resection, a nucleolytic process that converts the two ends of a DSB into 3’ single-strand DNA overhangs (Bennardo,
Cheng, Huang, & Stark, 2008; Symington & Gautier, 2011). End-resection is important for A-EJ by exposing the flanking MH (McVey & Lee, 2008; Sfeir & Symington, 2015) Short stretches of
MH within the two opposing overhangs can then anneal to each other and, after further nucleolytic processing (e.g., flap removal by FEN1 or DNA2 nucleases), converting a DSB to two single-stranded DNA gaps or nicks, which can then be filled in and joined by LIG1 or LIG3, both of which have been implicated in A-EJ mediated CSR (Boboila, Oksenych, et al., 2012;
Masani, Han, Meek, & Yu, 2016). Thus, the most widely recognized feature of A-EJ or MMEJ mediated repair is the prevalence of MH at the junctions. In this context, the High-Throughput
Genome-wide Translocation Sequencing (HTGTS) (Hu et al., 2016), a linear-amplification based method to recover thousands of junctions involving a single bait DSB, has greatly improved the efficiency for isolating CSR junctions(Dong et al., 2015; Panchakshari et al.,
2018). When the bait break site is placed at the 5’ Sμ region, HTGTS can efficiently recover thousands of CSR junctions and internal-deletion junctions. Using HTGTS, we and others have shown that the A-EJ events arising in cNHEJ-deficient (e.g., Xrcc4-/- or DNA-PKcs-/-) B cells are
57 markedly enriched for junctions bearing both short (1-3 nt) and long (>=4nt) MHs (Crowe et al.,
2018a; Dong et al., 2015; Panchakshari et al., 2018). In addition, A-EJ mediated CSR correlated with extensive use of junctions beyond the 3’ (distal) boundaries of the core S and S1 regions, suggesting DNA end-resection (Crowe et al., 2018a; Dong et al., 2015; Panchakshari et al.,
2018). Nevertheless, why A-EJ mediated repair is particularly efficient during CSR and whether resection is required for A-EJ mediated CSR (and if so, the pathway of resection), remains poorly understood.
In addition to A-EJ, DNA resection is also essential for homologous recombination (HR) that repairs DSBs using homologous sequences. In eukaryotes, DNA resection can be initiated by the nucleolytic activities of the MRE11-RAD50-NBS1 (MRN) complex in association with the
CtIP protein, while long-range resection was carried by EXO1 or DNA2 (Symington & Gautier,
2011). While both the DNA2 and MRN-CtIP pathways have been implicated in A-EJ mediated repair of endonuclease generated breaks (Bennardo et al., 2008; Howard, Yanez, & Stark,
2015), the study of their yeast orthologs suggests that CtIP promotes both DNA2 and MRN mediated end-resections (T. Y. Yu, Kimble, & Symington, 2018). Specifically, the CtIP mediated end-resection is most active in the S and G2 phases of the cell cycle due to high CtIP protein expression (X. Yu & Baer, 2000) and CDK-mediated phosphorylation of CtIP at residue T847
(Sartori et al., 2007). Moreover, upon DNA damage, the ATM and ATR kinases further promote end-resection by phosphorylating CtIP at T859 (T855 in mouse) and other sites (X. Liu et al.,
2019; Makharashvili et al., 2014; Peterson et al., 2012; H. Wang et al., 2013). CtIP is specifically implicated in A-EJ. Bennardo et al. (2008) showed that CtIP facilitates A-EJ mediated repair of an MMEJ-reporter in murine embryonic stem cells, presumably by promoting end-resection and thereby exposing the flanking MHs in the resulting single-strand DNA overhangs (Bennardo et al., 2008). In this regard, several studies have shown that CtIP-depletion significantly reduces
CSR in B cells activated in vitro (Buis et al., 2012; Lee-Theilen et al., 2010; X. Liu et al., 2019;
58 Polato et al., 2014). In addition to a direct role in A-EJ (Lee-Theilen et al., 2010), other possible mechanisms have also been proposed to explain how CtIP loss impairs CSR, including its ability to modulate AID function (Lee-Theilen et al., 2010) and CDK2 regulation (Buis et al.,
2012). However, since the loss of CtIP abrogates the proliferation of activated B cells (X. Liu et al., 2019; Polato et al., 2014) and proliferation is essential for successful CSR, whether the impact of CtIP loss on CSR is due to impaired end-resection or through other indirect mechanisms, including impairing proliferation, remains difficult to sort out. Using the HTGTS assay, we recently compared the CSR and S internal deletion junctions that arise in CtIP+/+ and CtIP∆/∆ B cells. To our surprise, the CSR junctions recovered from these cells were largely indistinguishable for their MH usage and resection patterns (X. Liu et al., 2019). Likewise, the
T855A phosphorylation site mutation, which partially blocks ATR/ATM-dependent induction of
CtIP-mediated resection, also has no impact on the efficiency, end-resection, or MH usage of
CSR (X. Liu et al., 2019). These findings suggest that CtIP, and by extension CtIP-mediated end-resection may be dispensable for end-ligation required for CSR, at least when measured within cNHEJ-proficient cells. But whether CtIP contributes to A-EJ mediated CSR specifically remains unknown.
Studies of A-EJ-mediated CSR are complicated by the fact that junctional MHs, a characteristic feature of A-EJ, can also be generated by cNHEJ. Although the MHs of cNHEJ junctions are thought to be shorter than those generated by A-EJ, the cutoff is not absolute and junctions with short MHs (1-3nt) cannot be definitively attributed to either DSB repair pathway.
To circumvent this ambiguity, we examined CSR in B cells that are genetically deficient for cNHEJ owing to loss of the core cNHEJ factor XRCC4, an obligatory partner of LIG4. The role of CtIP in A-EJ-mediated CSR in Xrcc4-/- murine B cells was then evaluated by either conditional inactivation of CtIP or non-phosphorylatable CtIP mutation (T855A). Unexpectedly, we found that isotype switching in Xrcc4-/- B cells was unaffected by either deletion or mutation (T855A) of
59 CtIP. Moreover, despite a significant reduction in end-resection, the CSR junctions recovered from Xrcc4-deficient alone and Xrcc4-deficient & CtIP-T855A mutant cells displayed similar MH usage, suggesting that MH-mediated end-ligation can occur without extensive end-resection during CSR. Similarly, ATM kinase inhibitor (ATMi) also attenuated end-resection without affecting MH-usage during A-EJ-mediated CSR. The analysis of ATMi-treated Xrcc4-/- cells also identified an end-resection independent role for ATM in regulating the orientation of CSR by both cNHEJ and A-EJ. Finally, when CSR junctions were analyzed by cell division, MHs (4-15 bps) are significantly enriched in early internal deletion junctions even in cNHEJ-proficient B cells. Taken together, our findings show that A-EJ-mediated CSR can occur independent of
CtIP-mediated end-resection, suggesting that the repetitive IgH switch regions are uniquely prone to MH-mediated repair.
60 2. Results
2.1 CtIP and ATR/ATM mediated phosphorylation of CtIP(T855) are dispensable for A-EJ- mediated class switching.
Xrcc4 and CtIP are both essential for early B cell development (Gao, Sun, et al., 1998;
X. Liu et al., 2019). To investigate the role of CtIP-dependent resection in A-EJ-mediated CSR, we used a CD21-driven Cre recombinase to conditionally inactivate the Xrcc4 and/or CtIP genes in naïve B cells (X. Liu et al., 2019; Pelanda et al., 1997; Yan et al., 2007b). The efficiency of CtIP and Xrcc4 inactivation in splenic B cells was validated by genomic PCR and
15. Figure 3-1: Effective deletion of CtIP and Xrcc4 in B cells.
(A) Representative PCR genotyping of CtIP or Xrcc4 in purified CD43- B cells, and after 3 or 4 days of stimulation. (B) Western blotting for CtIP and Xrcc4 protein in purified splenic B cells collected on day 2 after stimulation. Both short exposure (SE) and long exposure (LE) are shown. *: truncated CtIP protein lacking the N-terminal tetramerization domain. The molecular weight markers for 100 and 150KDa are marked on the figure.
Western blotting (Fig. 3-1 A and B). As noted previously (X. Liu et al., 2019), successful Cre-
61 16. Figure 3-2: The nature of the truncated CtIP protein expressed by the CtIP allele.
(A) Diagram of murine CtIP protein with the N-terminal oligomerization domain (1-165) and C- terminal Sae2 like domain (789-893) annotated. The position of the 2nd (Met98), 3rd (Met 121) and 4th (Met 141) are marked on the diagram. The CDK phosphorylation site (T844) and ATM/ATR phosphorylation site (T855) are marked in green and red, respectively. (B) The sequence of murine CtIP protein with all 16 Met annotated by number (in red). The first 36 aa encoded by exon 2 deleted in the CtIP allele are crossed out. (C) The calculated molecular weight of full length CtIP and putative truncated CtIP protein initiated from different downstream methionines. (D) The classical Kozak seq. distribution (top) and the sequence surrounding the first 4 ATGs (code Met) of murine CtIP. The 2nd has a poor Kozak (-). mediated recombination of the CtIPC allele generates CtIP, which encodes a truncated CtIP protein that lacks most of the oligomerization domain (Fig. 3-2 A-D). The oligomerization domain of CtIP is essential for the end-resection function of CtIP (Davies et al., 2015). Accordingly,
CtIP/ mice died during embryonic development (Bothmer et al., 2012), consistent with the
CtIP-null mice described before (P. L. Chen et al., 2005). Somatic inactivation of CtIPC/C
62 (converted to CtIP/) in progenitor B cells abrogates proliferation and normal B cell development (X. Liu et al., 2019; Polato et al., 2014), suggesting that CtIP acts as a CtIP null allele in vivo. Inactivation of Xrcc4 alone (CD21CreXrcc4C/CCtIP+/+(C)), CtIP alone
(CD21CreXrcc4+/+(C) CtIPC/C) or both together (CD21CreXrcc4C/C CtIPC/C) did not affect the frequency of the IgM+B220+ B cells in the spleen (Fig. 3-3, and 3-4A). In the presence of anti-
CD40 and IL-4, purified splenic B cells undergo CSR to express IgG1 or IgE (Wesemann et al.,
2011). Xrcc4-deletion reduced IgG1 switching to ~25 % of control levels at both days 3 and 4 (at day 4, IgG1+% = 29.02±6.83% in control vs. 8.25±1.23% in CD21CreXrcc4C/CCtIP+/+(C)) (Fig. 3-3,
3-4B, C) (Boboila, Yan, et al., 2010; Yan et al., 2007b). Although CtIP inactivation compromised
B cell proliferation (Fig. 3-3) (X. Liu et al., 2019; Polato et al., 2014), CtIP inactivation did not further reduce the frequency of IgG1+live cells% from Xrcc4-deficient B cells (CD21CreXrcc4C/C
CtIPC/C) (Fig. 3-3, 3-4B, C), suggesting that CtIP is not required for A-EJ-mediated CSR.
63 18. Figure 3-3: CtIP-deficiency or mutation did not reduce A-EJ mediated CSR in Xrcc4- deficient B cells.
Representative flow cytometry analysis of purified splenic B cells, stimulated with IL-4 and anti- CD40, at day 3 or day 4, from control (WT or CD21CreXrcc4C/+CtIP+/+(C)), CD21CreXrcc4C/CCtIP+/+(C), CD21CreXrcc4C/C CtIPC/C, and CD21CreXrcc4C/C CtIPT855A/T855A mice, with representative CTV labeling for cell proliferation upon stimulation. Cells that underwent two cell divisions were gated based on CTV dilution and plotted for IgG1+ frequency.
Given the important role of CtIP in proliferation, we used two additional approaches to
17. Figure 3-4: Characterization and CSR efficiency of CtIP-deficiency or mutation in Xrcc4-deficient B cells.
(A) Splenic naïve B cell (B220+IgM+) percentage by genotype. The data represents the average and standard derivations of n>=4 mice per genotype. (B) The percentage of live and IgG1+ cells at day 3 after stimulation. Two-tailed Mann-Whitney test, **** p<0.0001. (C) The percentage of live and IgG1+ cells at day 4 after stimulation. Two-tailed Mann-Whitney test, **** p<0.0001 (D) The relative (to control analyzed in parallel) percentage of live and IgG1+ cells at day 3 after stimulation in cells with 2 divisions, measured by CTV.
64 ascertain whether CtIP has a proliferation-independent role in A-EJ-mediated CSR. First, we labeled activated B cells with a surface dye (CTV) to monitor cell division and then compared
CSR efficiency between cells with the same number of divisions. As shown in Fig. 3-3 and quantified in Fig. 3-4D, CtIP-loss has no impact on A-EJ-mediated IgG1 switching in Xrcc4- deficient B cells even after controlling for cell division. Second, we took advantage of the
CtIPT855A allele, which harbors a phosphorylation site mutation that partially blocks ATR/ATM- induced CtIP-mediated end-resection without affecting B cell proliferation (Fig. 3-3) (X. Liu et al.,
2019). IgG1 switching is comparable in CD21CreXrcc4C/C or CD21CreXrcc4C/CCtIPT855A/T855A B cells, even after controlling for cell division status (Fig. 3-3 and 3-4B). DNA2 is essential for murine embryonic development (Lin et al., 2013) and a conditional allele for DNA2 is not yet available. We found that a selective inhibitor for DNA2 – C5 (W. Liu et al., 2016) – compromised the viability, but not the A-EJ mediated CSR to IgG1 in CD21CreXrcc4C/C B cells (Fig. 3-5).
65 Together, these data indicate that CtIP, CtIP phosphorylation at T855, and DNA2 activity are dispensable for A-EJ-mediated CSR.
2.2 CtIP and its resection activity are necessary for extensive S-region resection in cNHEJ-deficient B cells.
Next, we performed HTGTS analyses of CSR junctions. Briefly, a linear amplification- based method was used to identify DNA junctions involving AID-generated breaks at the 5’ S region (called the “bait”) and another DSB (called the “prey”) (Crowe et al., 2018a; Dong et al.,
19. Figure 3-5: The impact of DNA2 inhibition on A-EJ mediated CSR.
Representative flow cytometry analyses of CSR in WT or Xrcc4-/- cells treated with DNA2 inhibitor - C5 (7) - at 20M from 24hr after stimulation).
2015; Hu et al., 2016). In switching B cells, most preys reside in the switch regions, representing internal deletion (to another S break) or CSR (to breaks in S1 or S) (Fig. 3-6A). Notably,
66
67 20. Figure 3-6: CtIP deficiency reduces end-resection in Xrcc4-deficient B cells.
(A) Diagram of the HTGTS assay with a single bait site at the 5’ Sμ region. The IgH locus is drawn in its native orientation on mouse chromosome 12. The solid and the dash lines represent junctions made in the (-) (normal internal deletion and CSR) and (+) (inversion) orientation, respectively. The different switch regions are color-coded. The bait site is marked with a red arrow. The bait starts from 114,664,910 near the telomere of Chr. 12. (B) The number of unique junctions in each genotype group. (C) The distribution of prey sites inside (IgH all) and outside (non-IgH) the IgH locus. (D) The distribution of IgH prey sites by switch region - S, Sγ1, Sε, and others. (E-F) Relative frequency of distal preys among the prey in each respective switch region. Two-tailed Mann- Whitney test, * p<0.05; ns is not marked. (E) for S, distal=downstream/centromeric to Chr12: 114,662,100. (F) for Sγ1, distal= downstream/centromeric to Chr12:114,568,500. For (B) to (E), the data represent >=3 independent repeats of each genotype. Error bar= Standard deviation
HTGTS recovers both types of junctions and the orientation of the joining products (Fig. 3-6A).
For this study, we analyzed >5000 junctions from 3 independent mice of each genotype (Fig. 3-
6B). While the majority of the prey resided in the IgH locus (~6% of the prey junctions from wildtype B cells mapped outside the IgH locus (Fig. 3-6C). The frequency of non-IgH prey increased significantly in Xrcc4-deficient (14% in CD21CreXrcc4C/CCtIP+/+(C)), and double- deficient (14% in CD21CreXrcc4C/CCtIPC/C and 13.5% in CD21CreXrcc4C/C CtIPT855A/T855A) B cells
(Fig. 3-6C), consistent with increased chromosomal translocations. Figure 3-6D illustrates the relative distribution of prey junctions within the IgH locus. In wildtype B cells, roughly 20% of all
IgH preys reside in S (majorities are the products of S-S internal deletions), 40% in Sγ1, and another 40% in Sε (Fig. 3-6D). Xrcc4 deficiency preferentially affected the S-Sε junction frequency (to 15%, p=0.016) without affecting S-S1 junction (~40%, p>0.05) (Fig. 3-6D).
These results are consistent with sequential switching, thus two end-joining events are often needed to achieve Sε switching in adult B cells (Tong & Wesemann, 2015). Correspondingly, selective depletion of S-Sε junctions has also been noted for ATM or DNA-PKcs-deficient B cells (Crowe et al., 2018b; Panchakshari et al., 2018). CtIPT855A mutation (CD21CreXrcc4C/C
CtIPT855A/T855A) did not affect the IgH prey distribution in Xrcc4-deficient B cells (Fig. 3-6D).
68 HTGTS analyses of wildtype B cells confirm that most CSR junctions fall within the core
S-regions (Crowe et al., 2018b; Dong et al., 2015; Panchakshari et al., 2018), where AID- hotspots and RGYW motifs are slightly enriched (Fig. 3-7 for S, Fig. 3-8 for S1, and Fig. 3-9 for S). In contrast, in Xrcc4-deficient cells, a significant fraction of CSR junctions falls beyond the 3’ boundaries of the core S (~22% vs 2.7% in control, p=0.016) (Fig. 3-6E and 3-7), and
69
21. Figure 3-7: Diagram and relative distribution of S preys in Xrcc4-deficient B cells.
The diagram of ~ 10 Kb (chr12: 114,658,100 - 114,668,100, mm10) Sµ region and the counts of RGYW motifs per 50 bp by orientation ((+), blue and (-), red). The percentage of preys that fall into the distal region ( 70 22. Figure 3-8: Diagram and relative distribution of Sγ1 preys in Xrcc4-deficient B cells. The diagram of ~ 30 Kb (chr12: 114,558,500 - 114,588,500, mm10) Sγ1 region and the counts of RGYW motifs per 150 bp by orientation ((+), blue and (-), red). The percentage of preys that fall into the distal region ( S1 (3.5% vs 0.6% in control, p=0.016) (Fig. 3-6F and Fig. 3-8) regions (Crowe et al., 2018b; Dong et al., 2015; Panchakshari et al., 2018), which defined as extensive resection. We thus categorize junctions beyond the core switch region (114,662,100< in S, 114,568,500 < in S1 and 114,510,500 < in S) as extensive resection. The exact location of the boundary and their 71 base pair numbers are included in the Figures. Distal junctions are less prevalent in Sε (1.9% to 3.5%, p=0.56) (Fig. 3-9), potentially due to the low number of S-S junctions. These distal junctions could arise by extensive resection of unrepaired switch region breaks due to cNHEJ- 23. Figure 3-9. Diagram and relative distribution of Sε preys in Xrcc4-deficient B cells. The diagram of ~ 8 Kb (chr12: 114,506,500 - 114,514,500, mm10) Sε region and the counts of RGYW motifs per 50 bp by orientation ((+), blue and (-), red). The percentage of preys that fall into the distal region ( 72 deficiency. Alternatively, they could reflect the joining with AID-initiated breaks outside the core switch region generated due to the lack of productive CSR. CtIP deletion (CD21CreXrcc4C/CCtIPC/C) largely eliminated the formation of distal CSR junctions at all three switch regions in Xrcc4-deficient B cells (Fig. 3-7 for S, Fig. 3-8 for S1, and Fig. 3-9 for S) and CtIPT855A mutation markedly reduced distal junctions %, especially in S, and to a much less extent in S1 and Sε (Fig. 3-6E, 3-7, 3-8, and 3-9). Together, these observations indicate that CtIP-mediated end-resection is essential for the formation of distal CSR junctions outside the core switch region. 2.3 MH-mediated CSR in cNHEJ-deficient cells requires CtIP, but not T855 phosphorylation. MH is the characteristic feature of A-EJ-mediated DSB repair. We then asked whether reduced resection associated with CtIP deficiency affects MH usage during A-EJ-mediated CSR. To do so, we binned the CSR junctions according to the extent of MH (0=blunt, 1, 2-3, 4- 5, etc.), and the size of insertions (INS, 1-10nt) (Fig. 3-10). Since MH usage cannot be determined at junctions bearing insertions, the INS and MH junctions are mutually exclusive. In wildtype cells, roughly 25% of all IgH junctions are blunt, 25% have 1nt MH, and 25% have 2- 3nt MH (Fig. 3-10A). In wildtype cells, MH-distribution is similar in S-S (Fig. 3-10C) and S- S1 (Fig. 3-10E) junctions. As expected, Xrcc4-deficiency (CD21CreXrcc4C/CCtIP+/+(C)) increased the proportion of junctions with 2-3nt (from 25% to 35%) and >=4nt MH (from ~9% total in WT to ~25%) with a concurrent drop in blunt (from 25% to 8%) and 1nt MH (from 25% to 10%) junctions (p<0.0001, Kolmogorov-Smirnov test) (Fig. 3-10A and B) (Yan et al., 2007b). Co- deletion of both Xrcc4 and CtIP (CD21CreXrcc4C/CCtIPC/C) largely eliminated the skew toward longer MHs (Fig. 3-10A, p<0.0001, Kolmogorov-Smirnov test, relative to CD21CreXrcc4C/CCtIP+/+(C)) in all IgH junctions (Fig. 3-10A and B), suggesting that, although dispensable for A-EJ CSR efficiency, CtIP promotes MH-end joining during CSR. In contrast, 73 although the CtIPT855A mutant (CD21CreXrcc4C/C CtIPT855A/T855A cells) reduced resection, it did not alter the MH pattern of Xrcc4-deficient (CD21CreXrcc4C/CCtIP+/+(C)) cells (Fig. 3-10A-F, p=0.67, Kolmogorov-Smirnov test). Correspondingly, ATM inhibition also reduced resection without affecting MH usage (Fig. 3-10A-F). Thus, in contrast to endonuclease generated breaks, end- resection, and MH usage can be uncoupled during A-EJ mediated CSR. At endonuclease-generated breaks, end-resection facilitates A-EJ by revealing flanking MH in the single-strand DNA overhangs (Sfeir & Symington, 2015). If it is also true during A-EJ mediated CSR, we expect some correlation between the junction location and the MH usage. 74 75 24. Figure 3-10: The MH usage of IgH junctions recovered from Xrcc4-deficient B cells. (A) The graphic distribution of all IgH preys by MH, blunt, and insertion (INS). (B) The percentage of IgH junctions with >= 4nt MH by genotype. (C) The graphic distribution of all S preys by MH, blunt, and insertion (INS). (D) The percentage of S junctions with >= 4nt MH by genotype. (E) The graphic distribution of all Sγ1 preys by MH, blunt, and insertion (INS). (F) The percentage of Sγ1 junctions with >= 4nt MH by genotype. (A), (C) and (E) represent the pool of at least three independent libraries per genotype. For A, C, and E, Kolmogorov-Smirnov test, * p<0.05, **** p<0.0001. In (B), (D), (F), the bar and error bars represent the average and the standard derivations. The p-values in B, D, F were calculated via unpaired student’s t-test. * p<0.05, ** p<0.01, *** p<0.0005, **** p<0.0001 To test this, we divided the S and S1 into three mutually exclusive regions, proximal, middle, and distal (Fig. 3-7 and 3-8) and analyzed MH-usage in each region separately (Fig. 3-11). In WT cells, where the CSR junctions are largely mediated by cNHEJ, there is a clear preference to MH in the middle and distal Sμ regions (Fig. 3-11A), consistent with a correlation between resection (distal junctions) vs MH usage. In contrast, in Xrcc4-/- cells, where all junctions were 76 25. Figure 3-11. The MH usage by position in the Sµ and Sγ1 regions. The MH, blunt, and insertion (INS) distribution among preys recovered from the WT Sµ (A), CD21CreXrcc4C/CCtIP+/+(C) Sµ (B) or Sγ1 (C) regions. The definition of proximal, middle, and distal are marked on Figure 3 for S and Figure 4 for Sγ1. S: Distal <114662100, Middle =114662100-114664100, Proximal=114664100-114666100; Sγ1: Distal <114568500, Middle=114568500-114573500, Proximal=114573500-114578500. Kolmogorov-Smirnov test, n.s. p>0.05, * p<0.05, *** p<0.0005. mediated by the A-EJ pathway, there is no skew of the MH usage (Fig. 3-11B), suggesting that end-resection and MH usage are uncoupled in A-EJ mediated CSR. There were insufficient junctions that fell into the Sγ1 distal region in WT cells, so we only compared the proximal and middle regions (Fig. 3-11C). In both WT and Xrcc4-/- cells, MH usage did not correlate with prey location (Fig. 3-11C). Together, these findings confirm that end-resection and MH usage can be uncoupled during A-EJ-mediated CSR. 2.4 ATM signaling promotes A-EJ-mediated CSR through both CtIP-T855 phosphorylation-dependent and CtIP-independent mechanisms. ATM/ATR phosphorylates several other substrates in addition to CtIP (T855) to promote end-resection. Next, we tested the impact of ATM inhibition on end-resection and A-EJ mediated CSR. In contrast to the CtIP-T855A mutation, ATM kinase inhibition (ATMi, KU55933, 7.5 M) significantly reduced IgG1 switching of Xrcc4-deficient splenic B cells (Fig. 3-12A and 3- 12B), indicating a CtIP independent role of ATM in A-EJ-mediated CSR. HTGTS data show that ATM inhibition reduced the extensive resection at S (Fig. 3-6E and 3-7) and S1 (Fig. 3-6F and 3-8) in Xrcc4-/- B cells, without significantly affecting the MH usage in Xrcc4-/- B cells (CD21CreXrcc4C/CCtIP+/+(C)) (Fig. 3-10). Thus, like in CtIP-mutant cells, end-resection can be uncoupled from MH-usage during A-EJ mediated CSR by ATM inhibition. What is the CtIP independent function of ATM in A-EJ mediated CSR? ATMi-treated cells display several features that are not found in CtIP-deficient cells. First, ATM inhibition, but not CtIP deletion, further reduced the relative frequency of S-S junctions in Xrcc4-/- cells 77 (p=0.036) (Fig. 3-12C and D), suggesting ATM promotes A-EJ mediated end-ligation. Second, ATM inhibition altered the orientation-distribution of the S-S junctions (Fig. 3-12E). As noted in Figure 3-6A, the bait break at the 3’Sμ can either be joined in the centromere-to-telomere orientation (defined as positive, +) or in the telomere-to-centromere orientation (defined as negative, -). Since the IgH locus resides in a telomere (5’ IgH) to centromere (3’ IgH) orientation on murine chromosome 12 (Fig. 3-A), the productive CSR junctions and the S-S internal deletions both fall in the negative orientation (telomere-to-centromere) (Fig. 3-6E, 3-7, 3-8, and 3-9). Indeed, in control cells, the vast majority of IgH preys (76.1% S, 91.8% S1, and 94.9% S) are in the negative orientation (Fig. 3-6E, 3-7, 3-8, and 3-9), consistent with bona fide class 78 79 26. Figure 3-12: The impact of ATM inhibition on A-EJ mediated CSR. (A) Representative flow cytometry of Xrcc4-/- B cells, with or without ATMi (7.5 µM, KU55933), at day 4 of stimulation. (B) Quantification of live IgG1+% at day 4 after stimulation, with and without 7.5 uM ATMi (KU55933). Two-tailed Mann-Whitney test, ** p<0.01, * p<0.05. (C) The % of IgH preys that fall into each Switch region by genotype. (D) The quantification of the fraction of Sε preys among all IgH preys. (E) The ratio of S preys that fall into (-) vs (+) orientation. For (B), (C), (D) and (E), the bars and error bars represent average and standard deviations. Two- tailed Mann-Whitney test, ** p<0.01, * p<0.05 (F) The total number of preys mapped outside of Chr12 by orientation ((-) orientation and (+) orientation). There is a similar number of preys that fall into each orientation. switch recombination and internal deletion (X. Zhang et al., 2019). Meanwhile, prey breaks on other chromosomes (non-Chr12) are evenly distributed between (+) and (–) orientations (Fig. 3- 12F). IgH preys that fall in the positive orientation could arise by true inversional joining (as shown in Fig. 3-6A diagram) or through inter-homolog or inter-sister chromatid translocation (Crowe et al., 2018b; Panchakshari et al., 2018). Loss of Xrcc4 (CD21CreXrcc4C/CCtIP+/+(C)) increased chromosomal translocation and moderately increased the frequencies of positively- oriented preys (24% to 30% in S-S, 8.2% to 16.5% in S-S1, p=0.016, and 5.1% to 7.1% in S-S) (Fig. 3-12E). Further loss of CtIP or CtIP-T855A mutation did not affect the +/- ratio of S junctions recovered from Xrcc4-deficient B cells (Fig. 3-12E). In contrast, ATM inhibition significantly increased the +/- ratio of S preys in both WT cells and Xrcc4-deficient cells (p=0.029, and p=0.036, respectively) (Fig. 3-7 and 3-12E), indicating an important role of ATM in promoting orientation-specific joining mediated by either cNHEJ or A-EJ. Taken together, these observations confirm a role of Atm in end-resection and also identify a CtIP-independent role of ATM in suppressing inter-chromosomal/inter-sister recombination to promote CSR. 2.5 Earlier Sμ internal deletions tend to use MH-mediated end-joining even in cNHEJ proficient cells. A-EJ-mediated CSR is thought to be the backup for cNHEJ and occur slower, potentially due to the time needed for resection (Han & Yu, 2008). Consistent with the dispensible role of 80 27. Figure 3-13: Early CSR events preferred to use MH-mediated joinings. (A) The MH, blunt, and insertion (INS) pattern of all IgH junctions on day 3 or day 4 after stimulation. Kolmogorov-Smirnov test, ** p<0.01. (B) The MH, blunt, and insertion (INS) distribution of WT S and Sγ1 junctions at day 3 or 4 by switch region (S or Sγ1). Kolmogorov- Smirnov test, ** p<0.01. end-resection in A-EJ mediated CSR, CSR junctions recovered from Xrcc4-/- cells at day 3 or day 4 post-stimulation show no difference in MH usage (Fig. 3-13A). Next, we asked whether MH-usage changes in a temporal manner in cNHEJ-proficient cells. To our surprise, WT CSR junctions harvested at day 3 display moderately higher MH usage than those obtained at day 4 (Fig. 3-13A). In particular, early S-S events preferentially use MHs (2-15bp) at day 3, followed by an accumulation of blunt joints at day 4 (Fig. 3-13B). Meanwhile, MH usage at S-S1 junctions does not differ significantly between days 3 and 4 (Fig. 3-13B). 81 As revealed by the Cell Trace Violet (CTV) analyses (Fig. 3-3A), the cells harvested at day 4 contain a mixture of B cells with different post-stimulation proliferation histories (from 2 to 7 cell divisions each). To better understand the kinetics of MH-mediated joining, we sorted the cells by cell division according to CTV staining (Fig. 3-14A): group I with 1 or 2 divisions and moderate CSR (9.33%±2.90% IgG1+%), group II with 3 divisions (13.9%±2.43% IgG1+%), group III with 4 divisions (28.4%±4.56% IgG1+%), and group IV with 5 or more divisions (41.8%±3.77% IgG1+%). As shown in Fig. 3-14A, productive isotype switching steadily increased with the number of cell divisions. Correspondingly, the fraction of Sε preys increases from 24% in group I to 42% in group IV (Fig. 3-14B), consistent with sequential CSR from S- 82 28. Figure 3-14: CSR junction analyses by cell division. (A) Representative CTV labeling analyses of B cells from WT BL6 mice. The IgG1+% of cells with the defined number of cell divisions plotted below. The underlines marked the division groups used for sequence analyses. Cells with the least divisions were in group I and the most divisions in group IV. (B) The relative distribution of IgH preys among different switch regions by cell divisions. The bars and error bars represent average and standard deviations. (C) The MH, blunt, and insertion (INS) usage among S preys by cell division. Kolmogorov-Smirnov test, * p<0.05, ** p<0.01 (D) The frequency of junctions with 4 or more MH (in Sμ) by cell divisions. 83 S1 first, then to Sε (Tong & Wesemann, 2015). Most notably, MHs larger than 4nt was significantly more common in group I + II (22%) than either group III (15%) or group IV (10%) cells, while 1nt MHs were rare in group I + II compared to groups III and IV (10%, 17%, 17%, respectively) cells (p=0.039 and p=0.0053) (Fig. 3-14C and D). Again, this difference is only observed within S-S, but not S-S1, junctions. Collectively, these findings support a model in which MH at the repetitive S regions promote cNHEJ mediated internal deletion in the earlier phases of CSR. 3. Discussion Immunoglobulin CSR is mediated primarily by cNHEJ. But in cNHEJ-deficient cells, a remarkable 25% of CSR can be achieved by the A-EJ repair pathway characterized by extensive usage of MHs in the junctions (Yan et al., 2007b). While subsequent studies established that, in addition to its lymphocyte-specific role in CSR, the A-EJ pathway can also contribute to DSB repair during the DNA damage response in a range of cell types, why CSR is particularly prone to robust A-EJ remains elusive. In this context, Bennardo et al. (2008) showed that efficient A-EJ of an endonuclease-generated DSB in ES cells requires CtIP, presumably reflecting a role for DNA resection in unmasking the flanking MH sequences necessary for A-EJ. Using HTGTS, we examined the role of CtIP and end-resection in A-EJ-mediated CSR. In contrast to endonuclease-mediated breaks (Bennardo et al., 2008), CtIP is dispensable for A- EJ-mediated CSR. Indeed, the ability of cNHEJ-deficient naïve splenic B cells to achieve IgG1- expression was unaffected by either CtIP deletion or a CtIP mutation (T855A). What accounts for the different dependence on CtIP by A-EJ mediated repair at endonuclease-initiated breaks vs during CSR? Perhaps the difference lies in the unique structural and functional features of the switch regions. As these regions are comprised largely of repetitive sequences enriched for somatic hypermutation hotspot motifs, AID can generate 84 multiple DSBs within a given S region(Hwang et al., 2015; K. Yu & Lieber, 2019), mitigating the need for extensive CtIP-mediated end-resection to expose complementary MHs. Moreover, the closely spaced nicks generated by the base excision repair (BER) pathway can lead to staged breaks directly or crease the entry point for Exo1 without MRN-CtIP or DNA2(K. Yu & Lieber, 2019). This notion is supported by the HTGTS analyses, which revealed that A-EJ-mediated CSR occurs efficiently with CtIPT855A and ATM inhibition, and maintains a strong skew toward longer MH stretches. Accordingly, the role of CtIP in A-EJ may be context-dependent: required for general DSB repair by A-EJ in most cell types for a single DSB (Bennardo et al., 2008), but dispensable for CSR by A-EJ in B lymphocytes. In cNHEJ-deficient cells, but not wild-type cells, a proportion of CSR junctions (e.g., 1- 5%) falls beyond the 3’ boundaries of the core S and S1 regions (Crowe et al., 2018b; Dong et al., 2015; Panchakshari et al., 2018). Using HTGTS, our data provide the unequivocal proof that the formation of distal CSR junctions in Xrcc4-deficient cells is indeed achieved by CtIP- mediated end-resection and significantly reduced by CtIP-deletion, the CtIP-T855A mutation, or ATM kinase inhibition. Moreover, the observation that CtIP is required for the generation of CSR junctions lying distal to the switch regions but not for junctions in the core switch regions further supports the argument that core switch sequences are compatible for A-EJ even without additional resections. In addition to the repetitive nature of the switch region, the AID generated breaks might contain natural small overhangs. Notably, A-EJ mediated CSR junctions recovered from KU-deficient B cells have less long MHs (Boboila, Yan, et al., 2010), suggesting that while long MHs promote A-EJ, they are not required for A-EJ mediated CSR. By phosphorylating multiple distinct substrates, ATM can influence different aspects of CSR beyond end-resection. Using HTGTS analysis together with ATM inhibitor treatment, our results indicate that ATM kinase activity regulates the orientation of CSR to promote intrachromosomal deletions, including distal Sµ-Sε joins while suppressing non-productive 85 interchromosomal or inter-sister translocations. Interestingly, the ATM-enforced preference for intra-chromosomal deletions affects CSR events mediated by either cNHEJ or A-EJ – in both cNHEJ proficient and cNHEJ-deficient cells (Fig. 3-12C). While the exact mechanisms remain unclear, ATM is known to phosphorylate several chromatin-bound factors, including H2AX and 53BP1, that have been implicated in establishing and maintaining topologically-associated domains (TAD) during CSR (Dong et al., 2015; X. Zhang et al., 2019). Moreover, ATM- phosphorylated H2AX, and the MDC1 protein that binds phosphorylated H2AX, facilitate the lateral spread of DNA damage signals in cis along the chromosome (Savic et al., 2009). Since CSR requires germline transcription (A. J. Matthews, Zheng, DiMenna, & Chaudhuri, 2014) and ATM facilitates DNA damage-induced transcriptional suppression, ATM may also influence CSR patterns by limiting breaks on sister chromatids or homologs (Shanbhag et al., 2010). Using a surface dye to monitor cell division after B cell activation, we were able to monitor the formation of CSR junctions over time. Interestingly, in both cNHEJ-proficient and cNHEJ-deficient cells, we observed that S-Sε switching occurs later than S- S1 switching and is preferentially suppressed by either cNHEJ deficiency or ATM inhibition. These findings can be potentially explained by the sequential CSRs – first to Sγ1, then to Sε, which would predict that two or more DSB repair events are needed to achieve IgE switching (Tong & Wesemann, 2015). Moreover, Sε is relatively small (4Kb in the BL6 strain used here) and distal from the Sμ. Moreover, we found that short MH (2-14 nt) mediated joining occurs earlier in S- S even in cNHEJ-proficient cells, suggesting annealing mediated by short MHs might promote cNHEJ as well. This finding agrees with the previous in vitro characterization of cNHEJ using a plasmid substrate, which showed that cNHEJ can occur efficiently with 1-2 nt and up to 4nt of MH (Lieber, 2010). 86 Together, the combination of the CtIP and XRCC4 conditional alleles and HTGTS allowed us to uncover several unique features of A-EJ in switch regions and uncovered the temporal regulation of CSR at nucleotide resolution. The results explain the robust CSR in both cNHEJ - and CtIP - deficient cells and why CSR is a unique biological system to study A-EJ in vivo. 87 Chapter 4: Lack of DNA damage-induced CtIP phosphorylation at T855 delays lymphomagenesis in NHEJ/p53-double deficient mice * * Work described in this chapter is under a prepared manuscript Lack of DNA damage-induced CtIP phosphorylation at T855 delays lymphomagenesis in NHEJ/p53-double deficient mice Xiaobin S. Wang1,3, Foon Wu-Baer1, Marco Fangazio1, Stefanie N. Meyer1, Zhengping Shao1, Yunyue Wang1, Brian J. Lee1, Olivia M. Cupo1, Jean Gautier1,6, Laura Pasqualucci1.2, Riccardo Dalla-Favera1.2.5.6, Richard Baer1,2, and Shan Zha1,2,4,5, 1 Institute for Cancer Genetics, Vagelos College for Physicians and Surgeons, Columbia University, New York City, NY 10032 2 Department of Pathology and Cell Biology, Herbert Irvine Comprehensive Cancer Center, Vagelos College for Physicians and Surgeons, Columbia University, New York City, NY 10032 3 Graduate Program of Pathobiology and Molecular Medicine, Vagelos College for Physicians and Surgeons, Columbia University, New York City, NY 10032 4 Division of Pediatric Hematology, Oncology and Stem Cell Transplantation, Department of Pediatrics, Vagelos College for Physicians and Surgeons, Columbia University, New York City, NY 10032 5 Department of Immunology and Microbiology, Vagelos College for Physicians and Surgeons, Columbia University, New York City, NY 10032 6 Department of Genetics and Development, Vagelos College for Physicians and Surgeons, Columbia University, New York City, NY 10032 XW contributed to all the figures except Figure 4-11 A-D 88 1. Introduction Human B cell lymphomas often carry oncogenic chromosomal translocations involving the immunoglobulin (Ig) genes (Nussenzweig & Nussenzweig, 2010), where programmed DSBs are generated during the assembly and subsequent modifications of the Ig loci. While the RAG- generated breaks are exclusively repaired by the cNHEJ pathway during V(D)J recombination that assembles the functional Ig genes, Ig heavy chain (IgH) CSR can be completed at up to 25- 50% of the wildtype level in cNHEJ-deficient cells via the alternative-end joining (A-EJ) pathway that preferentially uses micro homologies (MHs) at the junctions (Boboila, Yan, et al., 2010; Crowe et al., 2018a; Crowe et al., 2020; X. S. Wang, Zhao, et al., 2020; Yan et al., 2007a). DNA end-resection, the selective removal of 5’ strands around a DSB to generate the 3’ single-strand DNA overhang (Symington & Gautier, 2011), promotes A-EJ by exposing the MHs flanking a DNA double-strand breaks. The C-terminal binding protein (CtBP)–interacting protein (CtIP) and its yeast ortholog Sae2 initiated DNA end-resection together with the MRE11-RAD50-NBS1 (MRN) complex (Sartori et al., 2007) and was implicated in A-EJ-mediated chromosomal translocations in reporter systems (Bennardo et al., 2008). CtIP expression and protein levels are cell-cycle-regulated, higher in S and G2 phases, and low in the G1 phase (Limbo et al., 2007; X. Yu & Baer, 2000). Like the MRN complex, CtIP is essential for murine embryonic development (P. L. Chen et al., 2005) and the proliferation of normal lymphocytes (X. Liu et al., 2019; X. S. Wang, Zhao, et al., 2020), rendering it impossible to examine the role of CtIP during oncogenesis using the null or conditional-null alleles. CtIP is phosphorylated by CDK at T847 in S and G2 phases of the cell cycle (Huertas et al., 2008) and by ATM and ATR kinases at T859 (T855 in mouse) and other sites upon DNA damage (Makharashvili et al., 2014; Peterson et al., 2012; H. Wang et al., 2014; H. Wang et al., 2013). While T847 phosphorylation of CtIP is essential for murine development (Polato et al., 2014), mice carrying an alanine substitution at T855 phosphorylation site of CtIP (CtIPA) develop normally with mild end-resection defects (X. 89 Liu et al., 2019). Moreover, lymphocyte development and lymphocyte proliferation are not affected in CtIPA/A mice (X. Liu et al., 2019; X. S. Wang, Zhao, et al., 2020). In addition to supporting CSR, the A-EJ pathway also promotes chromosomal translocation. CtIP has been implicated in A-EJ mediated chromosomal translocations using reporter system (Boboila, Jankovic, et al., 2010; Y. Zhang & Jasin, 2010). But due to the essential role of CtIP in murine development, whether CtIP mediated end-resection has any role in oncogenic chromosomal translocation remains elusive. In this context, almost all cNHEJ/Tp53 double deficient mice succumbed to pro-B cell lymphomas with IgH-Myc translocations and co- amplification (Rooney et al., 2004a; X. S. Wang, Lee, & Zha, 2020; Zhu et al., 2002). Moreover, the translocation junctions recovered from Myc-overexpressing lymphomas routinely have long MHs (Rooney et al., 2004a; Zhu et al., 2002), providing an ideal system to examine the role of A-EJ and CtIP-mediated DNA-end-resection in lymphomagenesis. Mechanistically, the initial translocation joins an accumulated unrepaired DSB at RAG1/2-catalyzed IgH locus with sequences downstream of c-Myc oncogene to form a dicentric (15;12) chromosome in Xrcc4- deficient lymphocytes (Zhu et al., 2002). In the proceeding anaphase, the dicentric intermediate breaks. The genomic fragment contains the IgH-Myc translocation joined with its sister to form a new dicentric chromosome to initiate the breakage-fusion-bridge (BFB) cycle (Figure 4-1), which eventually leads to gene amplification (Nussenzweig & Nussenzweig, 2010; Zhu et al., 2002). 90 Since this occurs in cNHEJ-deficient cells, both the initial translocation and the dicentric formation are mediated by the A-EJ pathway. Moreover, a permissive cell cycle environment (e.g., Tp53 deficiency) is necessary to tolerant the genomic instability and the subsequent overexpression of Myc oncogene. In addition to Xrcc4/Tp53 mice, other cNHEJ/p53 deficient models, including end-processing defective Artemis- deficient and DNA-PKcs-deficient mice, also develop pro-B cell lymphomas with Ig-Myc co-amplification (Gao, Sun, et al., 1998; Nacht et al., 1996; Rooney et al., 2004a; Vanasse et al., 1999), although the exact organization of 29.Figure 4-1: Diagram of Breakage-fusion-bridge (BFB) cycles. Simplified diagram representing the formation of IgH-Myc translocation through Breakage- fusion-bridge (BFB) cycles. amplicons remains undetermined. In addition to the experimental pro-B cell lymphoma models described here, BFB also serves as a general model for oncogenic co-amplicon formation that underlies tumor-initiation and drug resistance in human cancers (Shoshani et al., 2020; Tanaka & Watanabe, 2020). 91 In this study, we examine how CtIP-mediated resection contributes to A-EJ mediated lymphomagenesis by characterizing cNHEJ/Tp53- double deficient mice with or without CtIP- T855A mutation. We found that CtIP-T855A mutation does not affect the embryonic development of Xrcc4-/-Tp53-/- mice, but all the CtIPA/AXrcc4-/-Tp53-/- mice died by three weeks without any sign of lymphoma. Flow cytometry and histology analyses of CtIPA/AXrcc4-/-Tp53-/- mice suggest that T855A mutation does not further compromise hematopoiesis but induced a mild yet consistent G2/M arrest in the olfactory neurons in the CtIPA/AXrcc4-/-Tp53-/- mice, suggesting a role of CtIP in resolving replication errors in Xrcc4-deficient cells. Moreover, CtIP- T855A mutation delayed the lymphomagenesis and changed the tumor spectrum of the DNA- PKcs-/-Tp53-/- mice. High-throughput sequencing analyses of junctions involving RAG- and endonuclease-generated DSBs showed that CtIP T855 phosphorylation is not required for hairpin opening and initiation of end-resection but promotes extensive end-resection. Moreover, we found that CtIPA/A cells show defects in maintaining the DNA damage-induced G2/M checkpoints. Correspondingly, CtIP-T855A mutation delays Myc-induced lymphomagenesis in the λ-Myc model, suggesting a role of CtIP during lymphomagenesis beyond chromosomal translocation. 2. Results 2.1 CtIP-T855A mutation causes early lethality in Xrcc4-/-Tp53-/- mice To elucidate the physiological functions of CtIP phosphorylation and DNA end-resection in lymphomagenesis, we introduced the CtIP-T855A mutation (CtIPA/A) into Xrcc4-/-Tp53-/- mice, which routinely succumbed to pro-B cell lymphomas with A-EJ mediated IgH-Myc translocations (Zhu et al., 2002). Xrcc4-/-Tp53-/- and Xrcc4-/-Tp53+/- mice were small and born at reduced rates (Gao, Sun, et al., 1998), and CtIP-T855A mutation did not further reduce the weight or the birth rate of Xrcc4-/-Tp53-/- mice (Fig. 4-2A, and B). However, all CtIPA/AXrcc4-/-Tp53-/- (n=6) and CtIPA/AXrcc4-/-Tp53+/- mice (n=5) mice died by 21 days of age without any sign of lymphomas. 92 Meanwhile, all Xrcc4-/-Tp53-/- mice succumbed to B220+IgM-CD43+ pro-B cell lymphoma by ~10 weeks of age as described before (Fig. 4-2C and D) (Gao, Sun, et al., 1998; Zhu et al., 2002). The frequency of red blood cells, platelets, and hematopoietic stem and progenitor cells (HSPC, A/A -/- -/- -/- -/- Lin-Scal+cKit+) are comparable between CtIP Xrcc4 Tp53 mice and the viable Xrcc4 Tp53 mice (Fig. 4-2 E-I), excluding anemia and bone marrow failure as the sole reason for the neonatal lethality. Loss of Xrcc4 induces p53-dependent post-mitotic neuronal apoptosis, so then we examined whether CtIP-T855A mutation compromised neuronal development. In mice, neurogenesis in the olfactory bulb continues after birth (Brann & Firestein, 2014). CtIPA/A does not affect the proliferation index (Ki67+% Fig. 4-3A) and the apoptotic rate (cleavage Caspase 3 staining, Fig. 4-3B) of the Xrcc4-/-Tp53-/- olfactory neurons. In this course, we noted that both Xrcc4-/- Tp53-/- and the CtIPA/AXrcc4-/-Tp53-/- mice accumulated large dark nuclei in olfactory bulbs (Fig. 4-3C), consistent with potential G2 arrest and replication stress. Indeed, the mitotic nuclei (positive for phosphorylated Serine 10 of Histone H3, pH3+) reduced in Xrcc4-/-Tp53-/- mice (p=0.0021) and further reduced in CtIPA/AXrcc4-/-Tp53-/- mice (p<0.001 vs. WT, and p=0.044 vs. Xrcc4-/-Tp53-/-) (Fig. 4-3D). There are three types of pH3 staining pattern: small puncta without pan-nuclear staining (purple, type I, late G2 phase), large nucleoli puncta with diffused nuclear stained (blue, type II, early M phase/prophase), and condense dark staining (red, type III, M phase) (Fig. 4-3E). T855A mutation markedly reduced the frequency of type II and type III (mitosis, p<0.0001) nuclei in Xrcc4-/- Tp53-/- mice, suggesting G2/M arrest (Fig. 4- 3F). Taken together, the results show that DNA damage-induced CtIP phosphorylation at T855 is required for the neonatal development of Xrcc4-/-Tp53-/- mice. 93 94 30. Figure 4-2: Bone marrow defects or anemia do not explain the early death of CtIPA/A Xrcc4-/-Tp53-/- mice. (A) The number of mice born from intercrossing between Xrcc4+/- mice. The p-value was calculated with the chi-square test. (B) Bodyweight of CtIP A/AXrcc4-/-Tp53-/-, Xrcc4-/-Tp53-/-, and littermate controls on 8 days or 20 days. Unpaired T-test, ns, not significant. (C) Kaplan-Meier survival curve of CtIP A/AXrcc4-/-Tp53-/-, CtIP A/AXrcc4-/-Tp53+/-, and Xrcc4-/-Tp53-/- controls. Log- rank (Mantel-Cox) test, **** p<0.0001; ns, not significant. (D) Representative flow cytometry analyses of enlarged spleen from Xrcc4-/-Tp53-/- mouse with B220+ clonal expansion and wildtype control. (E) The concentration of red blood cells (RBC) in the peripheral blood of 16-19 days CtIP A/AXrcc4-/-Tp53-/-, Xrcc4-/-Tp53-/-, and wildtype controls. (F) Quantifications of bone marrow hematopoietic stem cell (Lin−SCA1+c-KIT+) absolute counts (G) The concentration of platelets in the peripheral blood of 16-19 days CtIP A/AXrcc4-/-Tp53-/-, Xrcc4-/-Tp53-/-, and wildtype controls. (H) Representative flow cytometry analyses of bone marrow RBCs from 16-19 days old CtIP A/AXrcc4-/-Tp53-/-, Xrcc4-/-Tp53-/-, and Tp53+/- control. The different stages of RBCs development were distinguished by CD71 and TER119 staining. The TER119+ population is projected to forward scatter on the side. (I) Flow cytometry analyses of bone marrow hematopoietic stem cell (Lin−SCA1+c-KIT+) and megakaryocytes and erythroid progenitors from the same groups mentioned above. 2.2 CtIPA mutation delayed the lymphomagenesis in DNA-PKcs-/- Tp53-/- mice To study the impact of CtIPA mutation on lymphomagenesis and circumvent the neonatal lethality, we introduced the CtIP-T855A mutation into the DNA-PKcs-/-Tp53-/- mice that also develop spontaneous pro-B cell lymphomas (Jhappan, Morse, Fleischmann, Gottesman, & Merlino, 1997; Kurimasa et al., 1999; Nacht et al., 1996). CtIP-T855A mutation did not affect the birth rate and embryonic development of DNA-PKcs-/-Tp53-/- mice (Fig. 4-4A). Yet, CtIPA/A mutation moderately extended the overall survival of DNA-PKcs-/-Tp53-/- (Fig. 4-4B). Specifically, the CtIP-T855A mutation reduced the frequency (from 94% to 68%) and extended latency (T1/2 from 73 days to 89 days) of pro-B cell lymphomas (B220+IgM-CD43+) in DNA-PKcs-/-Tp53-/- mice (Fig. 4-4 C and D, 4-5A). While 94% (31 out of 33) DNA-PKcs-/-Tp53-/- mice developed pro- B cell lymphomas, only 68% (17/25) of CtIPA/ADNA-PKcs-/-Tp53-/- mice developed pro-B cell lymphomas, including 3 with concurrent immature thymic lymphomas (CD3lowsTCRneg) (Fig. 4- 4D and 4-5B). The rest (n=8) of the CtIPA/ADNA-PKcs-/-Tp53-/- mice succumbed to thymic lymphomas (n=5), teratomas (n=2) or sarcoma (n=1) (Fig. 4-4C). The oncogenic translocations 95 in the DNA-PKcs-/-Tp53-/- pro-B cell lymphomas were not fully characterized as those in Xrcc4-/- Tp53-/- mice (Zhu et al., 2002). Using fluorescent in situ hybridization (FISH) and probes specific for the IgH (chr.12) and c-Myc (Chr. 15) (Gostissa et al., 2009), we found that 4/4 DNA-PKcs-/- Tp53-/- and 4/5 CtIPA/ADNA-PKcs-/-Tp53-/- pro-B cell lymphomas contained clonal IgH-Myc translocation and co-amplification (Fig. 4-5C and D). One pro-B cell lymphoma sample from an 96 97 32. Figure 4-3: Analyses of olfactory neurons from 16 days old CtIPA/AXrcc4-/-Tp53-/-, Xrcc4-/-Tp53-/-, and Xrcc4+/+ controls. (A) Frequencies of proliferative cells with positive Ki67 staining. (B) Frequency of apoptotic cells with positive cleaved Caspase 3 staining. (C) Top panel, representative histological analyses of sagittal brain sectioning, enlarged cells with darkly stained nuclei are pointed with orange arrows. (D) Frequency of pH3 positive cells. (E) Example picture illustrating different patterns of positive pH3 signal corresponding to different cell stages. (F) Frequency of G2M and M phase cells quantified by positive pH3 signal. Quantifications shown in A, B, D, and F were done from 5 WT, 4 Xrcc4-/-Tp53-/-, and 3 Ctip A/AXrcc4-/-Tp53-/- mice, at least seven independent fields from each mouse. 31. Figure 4-4: CtIPA mutation delayed IgH-Myc driven pro-B cell lymphomas and altered tumor spectrum in DNA-PKcs-/-Tp53-/- mice. (A) The number of mice born from intercrossing between DNA-PKcs+/- mice. The p-value was calculated with the chi-square test. (B) Kaplan-Meier survival curve of DNA-PKcs-/-Tp53-/- and CtIPA/ADNA-PKcs-/-Tp53-/- mice, the median overall survival of DNA-PKcs-/-Tp53-/- mice is 73 days, 80 days for CtIPA/ADNA-PKcs-/-Tp53-/- mice. Log-rank (Mantel-Cox) test, * p<0.05. (C) Kaplan-Meier survival curve of DNA-PKcs-/-Tp53-/- and CtIPA/ADNA-PKcs-/-Tp53-/- mice, the pro-B cell lymphoma only median survival of DNA-PKcs-/-Tp53-/- mice is 73 days, and 89 days for CtIPA/ADNA-PKcs-/-Tp53-/- mice. Log-rank (Mantel-Cox) test, ** p<0.01. (D) Tumor spectrum of DNA-PKcs-/-Tp53-/- and CtIPA/ADNA-PKcs-/-Tp53-/- mice. 98 33. Figure 4-5: Characterization of tumors found in CtIPA/A DNA-PKcs-/-Tp53-/- mice. (A) Representative flow cytometry analysis of BM from DNA-PKcs-/-Tp53-/- and CtIPA/ADNA- PKcs-/-Tp53-/- mice that were analyzed with a sign of tumor growth or discomfort. (B) Representative flow cytometry analyses of enlarged thymus from CtIPA/A DNA-PKcs-/-Tp53-/- mice. (C) Representative FISH images, from wildtype control samples (upper left), IgH-Myc translocations and amplifications in splenic lymphoma cells from DNA-PKcs-/-Tp53-/- mice (lower left), and two splenic cells from CtIPA/ADNA-PKcs-/-Tp53-/- mice with IgH-Myc co-amplification (upper right), or co-localization but less amplification (lower right). (D) Quantifications and breakdowns of FISH analyses. Collective information of 4 DNA-PKcs-/-Tp53-/- tumor samples and 5 CtIPA/ADNA-PKcs-/-Tp53-/- tumor samples harvested for FISH analysis, including the number of metaphases counted for each sample and the number and percentage of metaphases with co-localization and co-amplification of IgH-Myc signal. older CtIPA/ADNA-PKcs-/-Tp53-/- mouse (143 days) with concurrent thymic lymphomas processed an IgH-Myc translocation pattern consistent with a dicentric intermediate and minor amplification (Fig. 4-5C, lower right panel). These data indicated that IgH-Myc translocation and co- 99 amplification drove lymphomagenesis in DNA-PKcs-/-Tp53-/- mice, and CtIP-T855A mutation delays the pro-B cell lymphomagenesis in DNA-PKcs-/-Tp53-/- mice in part by suppressing IgH- Myc co-amplification. 2.3 T855 phosphorylation promotes end-resection and is dispensable for CE hairpin opening. To understand how CtIP-T855A mutation delays the pro-B cell lymphomagenesis, we examined the impact of T855A mutation on the translocation initial and amplification. For the IgH-Myc translocation to form, the coding ends (CEs) hairpins at the IgH loci of the DNA-PKcs- deficient B cells have to be opened (W. Jiang et al., 2015; Y. Ma et al., 2002). CtIP and its yeast ortholog Sae2 have been implicated in the hairpin opening (X. Liu et al., 2019; Oh & Symington, 2018; Trujillo & Sung, 2001; W. Wang, Daley, Kwon, Krasner, & Sung, 2017). To determine whether CtIP-T855 phosphorylation affects hairpin opening, we derived v-abl kinase transformed DNA-PKcs-/-Tp53-/-and CtIPA/ADNA-PKcs-/-Tp53-/- B cells and introduced the integrated V(D)J recombination substrate (pMX-INV) into them (Fig. 4-6A) (Bredemeyer et al., 2006; W. Jiang et al., 2015; B. S. Lee et al., 2013). In these cells, v-abl kinase inhibitor, STI571 (also called imatinib) induced efficient G1 cell cycle arrest (Fig. 4-6 B and C) and RAG initiated cleavage of the pMX-INV substrate (Bredemeyer et al., 2006) (Fig. 4-6A). Since CtIP protein level and end-resection activity increase significantly in S and G2 phases of the cell cycle (Limbo et al., 2007; X. Yu & Baer, 2000), we included two conditions in which the cells were released (wash away STI571) to the S/G2 phase after 12 hours (b) or 24 hours (c) of G1 arrest (Fig. 4-6 B and C). To prevent the cells from entering mitotic and the subsequent cell cycles, we applied a CDK1 inhibitor – Ro3306 to block mitosis (Fig. 4-6C). The effective release and G2 arrested were validated by flow cytometry analyses (Fig. 4-6B). Unrepaired CEs accumulated in G1 arrested (a) DNA-PKcs-/-Tp53-/-and CtIPA/ADNA-PKcs-/-Tp53-/- cells and reduced in the cells released to S/G2, regardless of the CtIP genotype (Fig. 4-6D). While ligation-mediated PCR can 100 readily detect opened CEs in Xrcc4-/-Tp53-/- cells, CEs from G1 arrested or released DNA-PKcs- /-Tp53-/- and CtIPA/ADNA-PKcs-/-Tp53-/- cells cannot be readily amplified even after release to S/G2 (Fig. 4-6E). To recover and compare the pattern of hairpin opening in DNA-PKcs-/-Tp53-/- and CtIPA/ADNA-PKcs-/-Tp53-/- cells, we adapted the High Throughput Genome-wide Translocation Sequencing (HTGTS) method (Hu et al., 2016). HTGTS is a linear-amplification-based sequencing method that can characterize junctions involving a specific DSB (referred to as the bait break). In this case, we chose the 5' CE of the pMX-INV as the bait break. In WT and CtIPA/A cells, > 80% junctions involving the 5' CEs are within the pMX-INV V(D)J recombination 101 34. Figure 4-6: CtIPA mutation contributes to hairpin processing in DNA-PKcs-/- cells. (A) Schematic of pMX-INV substrate including the unrearranged substrate (UR) and hairpin- sealed coding ends (CE). The recombination signal sequence (triangle) and CD4 probe are indicated as well. The opened hairpin structure can be detected by TdT-assisted PCR assay, I4 oligo probe is indicated. Specifically, the TdT enzyme can add a poly(A) tail to the opened hairpin ends, which can be amplified with primers containing poly(T) sequence. (B) Representative cell cycle analyses of PI-stained samples from the asynchronized controls, G1 arrest via STI571 treatment for 72 hours (a), STI571 treated for 12 hours (b) or 24 hours (c) to induce RAG expression and release to S/G2 phase with CDK1 inhibitor (Ro3306) for 48 hours. (C) Workflow for experimental conditions used in C-G: v-abl-transformed B cells were arrested in G1 via STI571 treatment for 72 hours (a), STI571 treated for 12 hours (b) or 24 hours (c) to induce RAG expression and release to S/G2 phase with CDK1 inhibitor (Ro3306) for 48 hours. (D) Southern blot analyses of pMX-INV substrates from the time points (a, b, c) described in (A&B). UR, un-rearranged, CE, coding ends, o: asynchronized. (E) Product of TdT-assisted PCR assays from multiple single clones with accumulated open ends from Xrcc4-/- cells as control. 102 103 35. Figure 4-7: CtIPA mutation does not affect proper repair products from RAG- generated breaks. (A) Frequency of recovered HTGTS junctions mapped to within pMX-INV substrate or elsewhere in the genome (Others) from one G1 arrested sample (STI) and two independent repeats of G1 arrested, and S/G2 released samples (STI CDK1). (B) Relative frequency of preys within the pMX-INV substrate in DNA-PKcs+/+, CtIPA/A, DNA-PKcs-/-, and CtIPA/ADNA- PKcs-/- cells, with black traces indicating preys aligned to the + strand and grey traces indicating preys aligned to the – strand. The frequencies of preys that fall into the 3’CE region (black, CJ) or 5’SE (grey, HJ) were indicated on each graph. (C) Frequency of CJ deletion length by combining two independent repeats. The deletion length was measured by the distance between bait end location and 5’CE location plus the distance between prey start location and 3’CE location. substrate (Fig. 4-7A), and 75-80% are classical CJs with the 3' CEs (Fig. 4-7B). Consistent with hairpin opening defects and increased chromosomal translocations, in DNA-PKcs-/- and CtIPA/ADNA-PKcs-/- cells, only < 40% of the junctions fall into the pMX-INV substrate (Fig. 4-7A). Nevertheless, more than 70% of junctions within the pMX-INV are still the 3'CEs with a moderate increase (3% to 5-8%) of inversions or hybrid join formation (with the SEs) (Fig. 4-7B). Moreover, the CJ recovered from both DNA-PKcs-/- and in CtIPA/ADNA-PKcs-/- cells have much longer deletions than those from WT and CtIPA/A cells (Fig. 4-7C). CtIPA slightly reduced the frequency of very long deletions (> 50bp) in DNA-PKcs-/- cells. Next, we asked whether CtIPA affected hairpin opening in DNA-PKcs-/- cells by examining the 5'CEs recovered from the junctions. In WT and CtIPA/A cells, ~70% of the hairpin opened at or around the apex (-2 to 4bp), regardless of whether the cells were arrested in G1 (Fig. 4-8A) or released to S/G2 (Fig. 4-8B). This pattern is consistent with the preferred cleavage sites of Artemis endonuclease in vitro (Y. Ma et al., 2002; Pannicke et al., 2004). The junction spread broadly in DNA-PKcs-/- cells, consistent with endonuclease cleavage by MRN or DNA2 and T855A mutation limited the spread, especially in G2 arrested cells (Fig. 4-8A and B). The presence of T855A mutation did not affect the spreading to the flanking region (Fig. 4-8A and B), yet partially restored the peak at the first bp of the hairpin end (Fig. 4-8B bottom). As an S-phase expressed protein, samples without the S phase release step did not show obvious restoration of the first bp peak (Fig. 4- 104 8A). Together, these data suggested that CtIP-T855 phosphorylation is not required for end- resection but may play a role in the progression of the resection. Accordingly, meiosis recombination and spermatogenesis that required the endonuclease cleavage of Spo11 covalent complex by MRN-CtIP is not blocked by the CtIPA mutation (Fig. 4-8C). 105 36. Figure 4-8: CtIPA mutation does not affect end-resection initiation. (A) Schematic of pMX-INV substrate for V(D)J recombination (top panel), the black arrow indicating the bait PCR primer starting position. The footprint of hairpin-sealed coding ends opening in the G1 phase, showing as the relative frequencies of the last aligned base pair on the bait end of the junctions with translocation patterns within the substrate. (B) Top panel: schematic diagram of pMX-INV substrate for V(D)J recombination with coordinates of RSSs, the black arrow indicating the bait PCR primer starting position. Middle panel: The footprint of hairpin-sealed coding ends opening in the S/G2 phase, showing as the relative frequencies of the last aligned base pair on the bait end of the junctions with translocation patterns within the substrate. Bottom panel: diagrams of aligned base-pair locations and sequence at the coding end, zoom-in frequency of the adjacent 12 base pairs around the opened hairpin end. (C) Representative histological analyses on testis from CtIP+/+, DNA-PKcs-/-Tp53-/-, and CtIPA/ADNA- PKcs-/-Tp53-/- mice, showing normal spermatogenesis. 106 2.4 T855 phosphorylation is dispensable for inter-sister joining The next step of the BFB cycle is the dicentric chromosome formation that precedes the gene amplification (Zhu et al., 2002). Concurrent breaks at two sister chromatids could be joined together to form a dicentric chromosome. In this context, we asked whether CtIP-T855 mutation affects sister chromatid fusion. Specifically, we transduced the v-abl cells with an inducible I- PpoI endonuclease (Fig. 4-9A), which have 19 predicted cleavage sites in the mouse mm10 genome (X. Li & Tyler, 2016), then performed HTGTS using the cleavage site No.10 on chromosome 5 as the bait break. In WT cells, ~10% of the joining occurs within the four bp overhang generated by I-PpoI (Fig. 4-9B). Consistent with cNHEJ-deficiency, <1% of the local junctions recovered from DNA-PKcs-deficient cells utilized the overhangs (Fig. 4-9B). Joining between sisters or with homologous chromosomes could generate a negative-strand junction (Fig. 4-9A, grey arrowheads), which increased in relative frequency in DNA-PKcs-deficient cells (Fig. 4-9B). CtIP-T855A mutation did not reduce the frequency of the negative strand joining in DNA-PKcs-deficient cells, suggesting T855A mutation is compatible with dicentric chromosomal formation. Given the overhang, most junctions recovered from WT or DNA-PKcs-deficient cells utilized 0-3 bp MH regardless of CtIP genotypes (Fig. 4-10). 2.5 T855 phosphorylation of CtIP plays a role in G2/M checkpoint maintenance In addition to A-EJ, CtIP and Sae2, namely the Mec1 phosphorylation of Sae2, have also been implicated in checkpoint control (H. Chen et al., 2015; Oh & Symington, 2018; Symington & Gautier, 2011). Specifically, extensive resection by CtIP/MRN complex converts DSBs that usually activate ATM kinase to extensive ssDNA that activates ATR kinase (Shiotani & Zou, 2009). Given the relatively moderate effect of T855A mutation in hairpin opening and the repair products, we asked whether T855 phosphorylation plays a role in ionizing radiation (IR) induced cell cycle checkpoint using BrdU labeling cell cycle analysis. To distinguish the mitotic 107 cells from G2 cells, we co-stained the samples with the mitotic marker – pH3. Before IR, WT and CtIPA/A B cells showed similar cell cycle distribution (Fig. 4-11A). Three Gy IR induced robust G2/M arrested in both WT and CtIPA/A B cells at 1 hour, but at 2 hours after IR, CtIPA/A B cells started to enter mitosis while the WT B cells maintained G2 arrest (Fig. 4-11A, B), suggesting that CtIP T855 phosphorylation might play a role in checkpoint maintenance. Western blotting analyses of irradiated WT and CtIPA/A cells showed reduced phosphorylation of ATR substrate – Chk1 and hyper-phosphorylation of ATM kinase substrates – Kap1, Chk2, and Histone H2AX in CtIPA/A cells (Fig. 4-11C). Consistent with reduced end-resection as the cause 108 of damped ATR kinase activity, the marker for ssDNA – phosphorylated RPA (T21) was also attenuated in IR-treated CtIPA/A cells (Fig. 4-11C). Based on these data, we 109 38. Figure 4-9: CtIPA mutation does not alter endonuclease-generated DSBs. (A) Schematic of translocations from I-PpoI-generated breaks, joining directions indicated with dashed arrows. (B) Relative distribution of local preys within + and – 200 bp from the cutting site in DNA-PKcs-/-Tp53-/-, and CtIPA/ADNA-PKcs-/-Tp53-/- v-abl-transformed B cells after 24 hours I- PpoI induction in G1 phase or S/G2 phase. The frequencies of prey that fall into each region are indicated on each graph. With black traces indicating preys aligned to the + strand and grey traces indicating preys aligned to the – strand. Left arrow, -200 bp to -3 bp; middle square, -2 bp to +2 bp sticky ends from enzyme cutting; right arrow, +3 bp to +200 bp. propose that CtIP phosphorylation at T855 promotes end-resection and the transition from ATM to ATR activation and the maintenance of the G2/M checkpoint. 37. Figure 4-10: CtIPA mutation does not alter the MH usage at I-PpoI-induced translocations. The microhomology usage or insertions found in the G1 phase (A) or S/G2 phase (B) among the junctions plotted in Figure 4-8B. Kolmogorov–Smirnov test, * p<0.05, ** p<0.01, **** p<0.0001, ns, not significant. 110 111 39. Figure 4-11: Phosphorylation of CtIP at T855 contributes to G2/M checkpoint maintenance. (A) Representative flow cytometry analyses of cell cycle distribution with BrdU/PI staining and the percentage of pHistone3 Ser10 positive population within BrdU-G2/M subpopulations in CtIP+/+ and CtIPA/A primary B cells before and recovery after 3 Gy IR at 1 hour, 2 hours, and 24 hours. (B) Quantifications of positive pHistone3 Ser10 percentage within BrdU-G2/M populations from five independent experiments. Paired T test, * p<0.05. (C) Western blotting analyses of CtIP+/+ and CtIPA/A primary B cells before or after IR 3 Gy. LE: light exposure, DE: dark exposure 2.6 CtIPA mutation delays MYC-driven lymphomagenesis Next, we asked whether CtIP and its phosphorylation at T855 have a role in lymphomagenesis beyond translocation-driven using the Burkitt Lymphoma λ-Myc transgenic model (Kovalchuk et al., 2000) that develop spontaneous Myc-driven lymphomas. First, we somatically inactivated CtIP in B cells from Myc+ mice using CD19Cre (Rickert, Roes, & Rajewsky, 1997) and the CtIP conditional allele (Polato et al., 2014). Unexpectedly, no difference in overall survival, spleen weight, or immune phenotypes were noted among the λMyc+ mice regardless their CtIP genotypes (CD19Cre+CtIP+/+, CD19Cre+CtIPC/+, or CD19Cre+CtIPC/C) (Fig. 4-12 A-D). Although CtIP was efficiently inactivated in the tumors arisen from CD19Cre+CtIPC/+ mice (T2-T4), lymphomas from CD19Cre+CtIPC/C mice retained significant CtIPC alleles (Fig. 4-12E). Thus, we tested whether germline CtIP T855A mutation affects Myc-driven lymphomagenesis using CtIPA/Aλ-Myc+ and control λ-Myc+ mice. At 100-day of age, 73% (8/11) λ-Myc+ mice have splenomegaly defined as spleen/body weight ratio > 99.7% CI of those of Ctrl WT mice (Fig. 4-13A). Meanwhile, only 20% (2/10) CtIPA/Aλ-Myc+ mice developed splenomegaly at the same age (Fig. 4-13A). Flow cytometry analyses revealed 82% of λ-Myc+ mice showed B cell blasts in the spleen, in contrast to 33% in CtIPA/Aλ-Myc+ mice (Fig. 4-13B-C). These data support the role of CtIP T855 phosphorylation in supporting Myc-driven lymphomagenesis beyond translocation. 112 40. Figure 4-12: CtIP inactivation with CD19cre is dispensable for Myc-driven lymphomagenesis. (A) Kaplan-Meier survival curve for CD19cre+ λ-Myc+ Ctip+/+ (WT), CD19cre+ λ-Myc+ Ctip+/C (HET), and CD19cre+ λ-Myc+ CtipC/C (KO) mice. (B) Percentage of spleen weight (g)/ body weight (g) among WT, HET, and KO groups and wildtype λ-Myc- control. Mann Whitney test, ** p<0.01. (C) Tumor spectrum among WT, HET, and KO groups. (D) Representative flow cytometry analyses of enlarged spleen samples from WT, HET, and KO groups. (E) Representative PCR genotyping of CtIP in enlarged splenic cells. 113 41. Figure 4-13: CtIPA mutation delays lymphomagenesis in the λ-Myc mouse model. (A) Per-mille Spleen weight (g)/ body weight (g) among WT Ctrl (n=9), λ-Myc+ (n=11), and CtIPA/Aλ-Myc+ (n=10) mice. 99.7% CI calculated from the WT Ctrl group is marked on the graph. (B) Representative flow cytometry analyses of spleen samples, enlarged or normal size from all three groups. (C) Percentage of enlarged splenic B cells, calculated using the percentage of B220+ splenic cells multiplied by the percentage of the gate with the largest size (indicated in B). 99.7% CI calculated from the WT Ctrl group is marked on the graph. 3. Discussion The molecular process of the A-EJ pathway and the related MH-mediated end-joining (MMEJ) pathway has been extensively studied and has been widely implicated in chromosomal translocations. CtIP promotes end-resection, a critical step in the repair pathway choice between A-EJ and cNHEJ. In this study, we tried to dissect how the DNA damage-induced CtIP 114 T855 phosphorylation affects A-EJ mediated oncogenic chromosomal translocation in vivo. Unexpectedly, we found that although dispensable for normal murine development, T855 phosphorylation is essential for neonatal development of Xrcc4-/- Tp53-/- mice and delays IgH- Myc driven lymphomagenesis in DNA-PKcs-/- Tp53-/- mice. While we initially thought that CtIP T855 phosphorylation promotes lymphomagenesis via chromosomal translocations, we failed to find consistent and measurable defects in the hairpin opening, sister-chromatid ligation, and junctional feature changes in CtIPA/ADNA-PKcs-/- Tp53-/- cells in comparison to DNA-PKcs-/- Tp53-/- controls. Moreover, we noted that B cell lymphomas that arose in CtIPA/ADNA-PKcs-/- Tp53-/- mice carried the signature IgH-Myc translocation and co-amplification, suggesting CtIPA/A did not prevent the initial translocations and the co-amplification. Indeed, using HTGTS, we documented moderately reduced end-resection and a bias in hairpin opening position in CtIPA/ADNA-PKcs-/- cells, but the overall frequency and pattern of DSB repair at the RAG generated breaks or endonuclease generated breaks did not alter fundamentally. Meanwhile, we note that CtIPA/A B cells display defects in maintaining IR-induced cell cycle arrest, and CtIPA/AXrcc4-/-Tp53-/- olfactory neurons accumulate enlarged cells, implying defects in resolving replication stress. In earlier studies, we and others have found that CtIP promotes end-resection at DSBs accumulated in cNHEJ-deficient cells (Helmink et al., 2011; X. S. Wang, Zhao, et al., 2020), which might explain why Xrcc4-/-Tp53-/- cells and mice are hypersensitive to CtIP defects. This need for CtIP in end-resection is in part due to the presence of KU, which prevents Exo1 mediated extensive end-resection (Karanjawala et al., 2002; Mimitou & Symington, 2010). Consistent with this model, we found that CtIPA/AKu70-/- mice, although small, are viable even in the presence of Wildtype Tp53 (data not shown). While the CtIP-T855A mutant also reduced end-resection in DNA-PKcs-/- cells (Fig. 4-7 and 4-8), the residual cNHEJ activity in DNA-PKcs-/- mice is sufficient for embryonic development. In this context, the normal meiosis and the normal frequency of translocations outside the pMX-INV 115 substrates during V(D)J recombination in CtIPA/A mice and cells suggest that T855 is not required for the initiation of end-resection but likely plays a role in the progression of end- resection. In this regard, T855 phosphorylation was thought to enhance the chromatin retention of CtIP (Peterson et al., 2012), which could promote its processibility. Whether other ATM and ATR-mediated phosphorylation of CtIP have a similar role or distinct roles remains to be determined. If T855 phosphorylation is not required for the hairpin opening and subsequent initial translocations and amplification, how could CtipA/ADNA-PKcs-/-Tp53-/- mice have delayed lymphomagenesis? Three pieces of evidence suggest that the T855A mutation might affect cell cycle checkpoints. First, CtipA/A B cells have attenuated G2/M checkpoints and cannot generate efficient ssDNA and therefore show reduced ATR activation. This might prevent feedback regulation on replication fork progression and allow dormant origin firing that is mostly mediated through the ATR kinase (Saldivar, Cortez, & Cimprich, 2017) rather than the ATM kinase. Second, Myc overexpression has been linked to oncogene-induced replication stress, which often requires ATR kinase to be tolerant (Bartkova et al., 2006). The CtIP and MRN complex have been implicated in ATR activation and replication stress control (Petroni et al., 2018; Syed & Tainer, 2018). The accumulation of giant nuclei in CtIPA/AXrcc4-/-Tp53-/- olfactory neurons is also consistent with replication stress. Finally, the T855A mutation suppressed lymphomagenesis of λ-Myc+ mice that already carry an oncogenic transgene. Together those data support an important role of CtIP phosphorylation in lymphomagenesis beyond chromosomal translocation per se. In summary, our data identified two in vivo functions of CtIP T855 phosphorylation – escape from cNHEJ failure and enforcement of G2/M checkpoints to cope with replication stress. We showed that ATM/ATR mediated phosphorylation of CtIP at T855, while dispensable for normal development, is required in Xrcc4-deficient cells and during Myc-induced 116 lymphomagenesis. These findings might explain why CtIP is amplified in a subset of human cancers. The translocation-independent function of CtIP in tumorigenesis highlights the important role of CtIP in linking DNA repair with cell cycle checkpoint. CtIP is heavily modified upon DNA damage and in the S phase. Our findings suggest that oncogenic stress or cNHEJ might help to reveal the role of other ATM/ATR or CDK mediated phosphorylation sites of CtIP, such as the S327 phosphorylation that is also dispensable for murine development (Polato et al., 2014; Reczek et al., 2016). 117 Chapter 5: Closing remarks Genomic instability resulting from DNA damages generated from regular cellular events or exogenous assaults is a hallmark for human cancer. Mammalian cells have a comprehensive regulatory network to enforce the fidelity of DNA repair. Failure of precise DNA repair can lead to genomic instability, and when accompanied by loss of checkpoint functions, it could lead to tumorigenesis. My thesis work aimed to understand further how DDR, focusing on ATM and its downstream mediators, enforce genomic stability by regulating CtIP-mediated end-resection from three aspects: modulating chromatin accessibility (§ 2), translocations in B cells undergo physiological DSBs (§ 3 & 4). Firstly, we applied the newly developed ATAC-seq methods to monitor chromatin accessibility upon lymphocyte-specific RAG-initiated breaks or endonuclease (I-PpoI) generated breaks. We identified a local gain of chromatin accessibility around persistent DSBs that lead to increased DNA end-resection in end-joining deficient backgrounds. We found that DDR factor 53BP1 limits the increase of accessibility, presumably through its interaction with modified nucleosomes. Correspondingly, we observed an increase in chromatin accessibility (reduced nucleosome occupancy) at the regions with high accessibility before the breaks. We hypothesize that the chromatin-bound DDR factors, such as 53BP1, could protect nucleosome- occupied chromatin from CtIP-mediated DNA end-resection (e.g., 53BP1). We further suggest that nucleosome-free regions are vulnerable to additional DNA damage since they were not protected by the "chromatin-bound DDR factors". In the future, this experimental system we adapted can be used to examine the impact of other factors, such as MDC1 and RIF1, in regulating chromatin accessibility. Moreover, it can be used to measure the effect of chromatin remodelers, like CHD1 or SWI/SNF complexes on chromatin accessibility (Kari et al., 2016; Wiest, Houghtaling, Sanchez, Tomkinson, & Osley, 2017). Such a system can also be used for applications beyond targeted DNA damages. For example, genotoxic therapy (e.g., radiation or 118 chemotherapy) also induces DNA damage response and potentially causes dynamic changes of chromosomal accessibility, which will dictate the type of the 2nd translocation and vulnerability. Studying the breakages and translocations in primary and secondary tumor samples could potentially lead to the identification of the driving mechanisms for the formation of such secondary tumor development and the genomic signature of specific therapy applied. The identification and characterization of chromatin accessibility and vulnerability could not only provide insights on disease progression but also help predict genomic toxicity. Next, we investigated the role of CtIP-mediated end-resection during programmed gene rearrangement, especially CSR, in lymphocytes. Utilizing naive B cell-specific conditional deletion of CtIP and high-throughput translocation assay, we dissected the requirement of CtIP- mediated end-resection in MH-mediated A-EJ during CSR. For the first time, we characterized the temporal regulation of CSR at a nucleotide resolution and demonstrated that in the highly repetitive switch regions, end-resection is not required for A-EJ that preferentially use MH at the junctions. Agreed with the previous studies on the cNHEJ-proficient cells model (Dong et al., 2015; X. Zhang et al., 2019), here we provided strong evidence for a role of ATM kinase activity in ensuring the correct orientation during CSR, potentially by maintaining topologically association between chromosomes by spreading the γ-H2AX linearly around the breaks (2- dimensional spread, instead of 3-dimensional). Lastly, we asked the role of CtIP in oncogenic transformation in vivo. To circumvent the embryonic lethality associated with the complete deletion of CtIP, we characterized the impact of ATM/ATR-dependent phosphorylation of CtIP at the T859 (T855 in mice). While we initially focused on the role of CtIP in regulating end-resection and chromosomal translocation, our study with the T855A mutant mice uncovered an important role of CtIP and its associated resection in enforcing the G2/M checkpoint. Correspondingly, T855A mutation also delays lymphomagenesis in a Myc+ transgenic mouse model with preassembled oncogenic 119 translocation. Moreover, while dispensable for murine development, the T859A phosphorylation of CtIP is critical for Xrcc4-/-Tp53-/- mice's neonatal development. Thus, we concluded that CtIP- mediated resection suppresses oncogenic transformation in part by promoting resection and ATR mediated replication checkpoints. Recently, studies of CtIP highly focused on its role in DNA repair, such as its interaction with other repair factors, MRN complex or BRCA1, and the impact of post-translational modifications. With a more complex understanding combining structural and biochemical studies with physiological models, we can investigate more into the players of DNA repair pathways and the interplay among them. My thesis work contributed to the molecular mechanism of the initiation step of the DNA repair pathway. It also provided direct evidence for a novel connection between specific DNA damage-induced phosphorylation and cell cycle progression, proliferation under stress conditions. It opened several new angles in studying the maintenance of genomic stability during normal development and tumorigenesis. 120 Chapter 6: Materials and Methods Mice CD21Cre (Kraus et al., 2001), CtIPC (Reczek et al., 2016), CtIPT855A (X. Liu et al., 2019; X. S. Wang, Zhao, et al., 2020), Xrcc4C (Yan et al., 2007b) Xrcc4-/- (Gao, Sun, et al., 1998), DNA-PKcs-/- (Gao, Chaudhuri, et al., 1998), p53-/- (Jacks et al., 1994), CD19Cre (Rickert et al., 1997), and Lambda-Myc (Kovalchuk et al., 2000) mice were previously described. Mice in the Xrcc4-/--, or DNA-PKcs-/-Tp53-/-cohorts were aged until they showed evident signs of a tumor and/or discomfort and then sacrificed for flow cytometry or cytogenetic analysis. CtIPA/A mice were crossed with Lambda-Myc+ mice, and Lambda-Myc+ mice or CtIPA/A Lambda-Myc+ mice were analyzed at 100 days. Bone marrow, spleen, lymph nodes, and thymus were analyzed by FACS, and tissue was also fixed for further histological analysis. All animal work was conducted in a specific pathogen-free facility, and all procedures were approved by the Institutional Animal Care and Use Committee at Columbia University Medical Center. Flow cytometry was performed on a FACS Calibur flow cytometer (BD Bioscience), LSR II (BD Bioscience), or an Attune NxT flow cytometer (Thermo Fisher Scientific). Class Switch Recombination and Cell Cycle analysis with Flow Cytometry Class switch recombination experiments were performed with 6-10-wk-old mice as previously described (Crowe et al., 2018b; X. Liu et al., 2019). Splenic B cells were purified with anti-murine CD43 magnetic beads (MACS; Miltenyi Biotech) and cultured at 1 × 106 cells ml−1 in RPMI medium supplemented with 15% FBS, anti-CD40 (1 ng/mL; BD Pharmingen), and IL-4 (20 ng/mL; R&D). Purified B cells were stained with FITC-conjugated anti-CD43 (BD Pharmigen), PE-conjugated anti-IgM (Southern Biotech), Cy5-conjugated anti-B220 (eBioscience), and APC-conjugated anti-Ter119 and analyzed by flow cytometry to confirm over 90% purity. Each CSR sample was collected on day 3 and day 4 after activation for flow 121 cytometry with FITC-conjugated anti-IgG1 (BD PharMingen) and Cy5-conjugated anti-murine B220 (eBioscience). For the CTV experiment, purified B cells were stained at 6 × 106 cells ml−1 in PBS with 1 uL of 5 mM Cell Trace Violet (CTV) dye dissolved in DMSO (Thermo Scientific), following the standard protocol with two additional washes with the medium. Stained B cells were stimulated the same way and harvested on day 4 for flow cytometry analysis, stained with FITC-conjugated anti-IgG1 (BD PharMingen) and Cy7-conjugated anti-murine B220 (eBioscience). For the wildtype CTV sorting experiment, splenic B cells from three wildtype 6- wk-old C57BL/6J mice purchased from the Jackson Laboratory were pooled together and stained following the same protocol, analyzed, and sorted on day 4 after stimulation. To test cell cycle progression in primary B cells upon irradiation (IR), purified B cells were stimulated as described above for 60 hours before IR. For each time point, about 10 million cells were collected and fixed two times with cold 75% ethanol. Fixed cells were blocked with staining solution (5% BSA in PBS with 0.1% Tween-20) and permeabilized with a final concentration of 0.05% Triton for 10 minutes at room temperature. After washout, cells were incubated with primary pH3 antibody (Millipore, 06-570, Rabbit anti-mouse) diluted 1:1000 in staining solution at 32°C for 45 minutes, and then secondary antibody Alexa 647 anti-rabbit diluted 1:3000 at 32°C for 45 minutes. This was followed by the BrdU/PI cell cycle staining protocol as described before (Menolfi et al., 2018). Flow cytometry was performed on a FACS Calibur Flow Cytometer (BD Bioscience) or Attune NxT Flow Cytometer (Thermo Fisher Scientific). Sorting was done with Aria II Cell Sorter (BD Bioscience). Cell line generation and V(D)J recombination assays Total bone marrow was harvested from 4-week-old mice and introduced with v-abl kinase through retrovirus infection as previously described (Bredemeyer et al., 2006). Cells were cultured in DMEM with 15% FBS for at least two months to achieve stable immortalized cell lines. We then infected target cell lines with V(D)J recombination substrate as reported 122 before (Bredemeyer et al., 2006) and then purified to enrich for cells with a stable expression level of the substrate. To investigate the repair events in RAG generated breaks, we treated v- abl-transformed B cells with the substrate with STI571 (3 µM; Novartis Pharmaceuticals) for 48 or 72 hours, or first for 24 hours and then switched to CDK1 inhibitor (10 uM RO3306) containing medium for 48 hours. Samples were collected at these time points for cell cycle analysis and harvested for genomic DNA. For Southern blotting analysis to check substrate rearrangement, 20 ug of genomic DNA from each time point was digested with EcoRV and probed with C4 probe, which is the 960bp fragment generated by digestion of the pMX-INV substrate plasmid by HindIII and NheI as previously documented (Helmink et al., 2011; B. S. Lee et al., 2013). TdT-assisted PCR assay of pMX-INV coding ends was performed as previously described (Helmink et al., 2011). To be specific, genomic DNA was treated with TdT (NEB M0315L) according to the commercial protocol. 20 ng of treated template DNA was amplified (15 cycles) with primers IRES-REV5 (5′ REV5; 5′-CTCGACTAAACACATGTAAAG CCTCGACTAAACACATGTAAAGC-3′) and T17- UNIV (5′-GTAAAACGACGGCCAGTCGAC TTTTTTTTTTTTTTTTT-3′) with 52°C annealing temperature. 2% of the primary amplification product and two 1:10 serial dilutions were then used for secondary amplification (30 cycles) with primers IRES-REV4 (5′-AGTGTAGAATTCCCCTTGTTGAATACGCTTG-3′) and UNIV (5′-AGA GCTGGATCCGTAAAACGACGGCCAGT-3′) with 56°C annealing temperature. The end products were analyzed on a 1% agarose gel, transferred onto a Zeta-Probe membrane (Bio- Rad), and hybridized with the I4 oligo probe (TAAGATACACCTGCAAAGGCG) using γ-dATP. FISH Samples harvested from mice with enlarged spleens or lymph nodes were cultured in RPMI medium with 100 ng/mL colcemid (Gibco 15212-012) for 4 hours and harvested for metaphase analysis. Standard two-color FISH was performed with BAC199 as Igh locus probe and BAC RP23-307D14 as c-myc locus probe. The Igh probe was primarily labeled with biotin 123 (Invitrogen 18047-015), and Avidin-FITC (Sigma A2901) as secondary. The c-myc probe was labeled with DIG (Roche 11745816910), and DyLight 594 goat anti-Dig (Vector DI-7594-.5) as the secondary antibody for visualization. Images were acquired using ZEISS Imager Z2 and Metafer 4 system. About 15-50 metaphases were analyzed for each sample. High-throughput genome-wide translocation sequencing (HTGTS) High-throughput genome-wide translocation sequencing (HTGTS) experiments and analyses were performed as previously described (Crowe et al., 2018b; Hu et al., 2016; X. Liu et al., 2019). To study translocations in CSR samples, we harvested B cells after 3 or 4 days of cytokine stimulation to obtain genomic DNA. From each sample, about 20 µg of genomic DNA was sonicated (Diagenode Bioruptor) to 300bp – 1kb fragments, and linear amplified with an Sµ-specific biotinylated primer (5′/5BiosG/CAGACCTGGGAATGTATGGT3′) and then a nested (5′CACACAAAGACTCTGGACCTC3′) primer. Restriction enzyme (NEB) AflII was used to remove the germline sequence. When mice with mixed backgrounds were used, the IgH locus was genotyped to distinguish between the 129 vs BL6 alleles (primers: IgH_F: TGTGGACCTCCTTGTGAGACTG, and IgH_R: GGGACAGCAGAGGGATTAGG, 129 allele shows ~300bp band and BL6 allele shows ~360bp band). Only mice with both IgH loci from the C57/BL6 background were used for the HTGTS analyses. All sequencing reads for CSR samples were aligned to the mm9 (BL6) genome. To study RAG-generated breaks, 20 ug of genomic DNA at each time point from v-abl-transformed B cells with stable expression of the pMX-INV substrate was used as input. Sonicated DNA was linear amplified with biotinylated primer (/5BiosA/CAACCACTACCTGAGCACC) and nested amplified with (5’ CAAAGACCCCAACGAGAAGC3’) primer. The germline sequence was removed with BstBI (NEB) digestion. To study endonuclease-generated breaks, v-abl-transformed B cells were transiently introduced with a construct carrying ER-Cre induced I-PpoI. 20 hours after retrovirus infection, half of the cells were arrested in G1 phase with STI571 (3 µM; Novartis 124 Pharmaceuticals) for 24 hours, and then treated with 500 nM 4OHT to induce I-PpoI cutting for 24 hours. The other half was arrested in the S/G2 phase with CDK1 inhibitor (10 uM RO3306) for 16 hours, and 500 nM 4OHT to induce I-PpoI cutting for 24 hours. Cells were collected at the end from both conditions for genomic DNA. Here, sonicated DNA was linear amplified with biotinylated primer (/5BiosG/ACTTAGAACTGGCGCTGAC) and nested amplified with (5’ AACCCCAAAGCATCGCGAAG3’) primer. The germline sequence was removed with I-PpoI (Promega) digestion. To specifically study the DNA repair junctions on the pMX-INV substrate, we added the substrate sequence as an additional chromosome on top of the mm10 genome during the alignment process. Downstream analyses were performed as described before (Dong et al., 2015; Hu et al., 2016), with the pipeline deposited on Github (https://github.com/robinmeyers/transloc_pipeline). In brief, we took the Bowtie2-ranked top alignments, with a score bigger than 50, and ran through the best-path searching algorithm (Faust & Hall, 2012) to identify optimal sequences. Several filters were applied additionally, including, but not limited to, mispriming PCR products, multiple joinings, and duplications. To be specific, if the bait and prey sequences from two individual reads were aligned within 2 nt of each other, respectively, only one unique read would be kept after applying the “duplication” filter. Overlapping homologous sequences between the bait and the prey sites were characterized as MHs. Unaligned nucleotides in between bait and prey sites were defined as insertions. Reads containing no MHs or insertions were considered blunt junctions. To compare the MH use in distal vs. proximal areas within each switch region, the Sµ was divided at Chr 12: 114,662,500 and the Sγ1 at Chr 12: 114,570,500. We deposited all of the sequencing raw data used in chapter 4 to the Gene Expression Omnibus database with the accession number GSE156392. 125 Transposase-Accessible Chromatin using sequencing (ATAC-seq) The Transposase-Accessible Chromatin using sequencing (ATAC-seq) was performed using the published standard protocol (Buenrostro et al., 2015) or Fast-ATAC protocol (M. R. Corces et al., 2016). Specifically, v-abl transformed B cells arrested in G1 phase or after 24 hours of I-PpoI induction were harvested for ATAC-Seq assays. About 50,000 cells were collected and spun down at 500g for 10 minutes at 4°C, and the supernatant was removed with great care. The loose pellets were washed twice with 100 μL of cold PBS buffer, spun down, and the supernatant was discarded, with all steps performed on ice. For the standard ATAC- Seq assay, the cell pellet was resuspended gently in freshly made cold lysis buffer (10 mM Tris- Cl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% (Vol/Vol) Igpal CA630) and centrifuged at 500g at 4°C for 12 minutes to pellet nuclei. The supernatant was removed, and nuclei were washed once with 2X TD buffer (2 mM Tris base, 10 mM MgCl2, adjust pH to 7.6, and 20% (Vol/Vol) DMF) (Q. Wang et al., 2013) to reduce mitochondria contaminants in the nuclei pellet. The washed nuclei were then directly suspended in the transposition reaction mix (25 μL of 2X TD buffer, 2.5 μL of Nextera Tn5 Transposase, and 22.5 μL of nuclease-free H2O) and incubated at 37°C for 30 minutes with gentle taps on the tubes every 5-10 minutes to increase the transposition reaction efficiency. For the Fast-ATAC assay, the lysis step and wash step were skipped, and cells were directly suspended in Fast-ATAC transposition reaction mix (25 μL of 2X TD buffer, 2.5 μL of Nextera Tn5 Transposase, 0.5 μL of 1% digitonin and 22 μL of nuclease-free H2O). The transposed DNA was collected using the Qiagen MinElute PCR purification kit and eluted in 15 μL of buffer EB. Transposed DNA were stored in -20°C until ready to perform the later amplification steps. Briefly, transposed DNA was first amplified 5 cycles with 63°C annealing temperature to introduce sequencing primers (Ad1: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG, and Ad 2.#: CAAGCAGAAGACGGCATACGAGATBarcode GTCTCGTGGGCTCGGAGATGT) as follows: 126 10 μL of transposed DNA 10 μL of nuclease-free H2O 2.5 μL of 25 uM Ad1 primer (no barcode) 2.5 μL of 25 uM Ad2.# primer (with 8bp barcode) 25 μL of NEBNext High-Fidelity 2x PCR Master Mix 5 μL of amplified transposed DNA was used to perform a side qPCR reaction to determine additional amplification cycles needed for each individual library as follows: 5 μL of amplified transposed DNA 1.6 μL of nuclease-free H2O 1.25 μL of 5 uM Ad1 primer (no barcode) 1.25 μL of 5 uM Ad2.# primer (with 8bp barcode) 0.9 μL of 10X SYBER Green 5 μL of NEBNext High-Fidelity 2x PCR Master Mix The number of additional cycles needed was dteremined by plotting Rn vs. cycle number and calculating the number of cycles needed to reach one-third of the maximum fluorescence intensity. Depends on samples, usually between 4-7 additional cycles were needed. The rest of the amplified transposed DNA was then further amplified based on the calculated cycle number using the same PCR conditions in the protocol. The final PCR product was purified using the Qiagen PCR purification kit and sent for Bioanalyzer at 1:3 dilution to visualize the DNA fragment. Successful libraries showed major peaks with lengths of integral nucleosome distance between them (~140bp). The concentrations of individual libraries and the pooled library was quantified using KAPA qPCR-based quantification kit or Qubit and sequenced on an Illumina HiSeq 2500, Illumina HiSeq 4000, or Illumina NextSeq 500 platform, using 2*100bp or 2*75bp pair-end sequencing. Usually, 9-12 samples were pooled together for one sequencing run to 127 ensure read depth and quality. Raw sequencing output data was trimmed first to ensure no leftover adaptor sequences carried by the Tn5 transposases and aligned to the customized mm10 genome described above using Bowtie2 (Langmead & Salzberg, 2012). Peaks were called using MACS2 (Feng, Liu, Qin, Zhang, & Liu, 2012). EndSeq The EndSeq assays were performed with modifications based on the published protocol (Canela et al., 2017). Detailed steps are as follows: Prepare DNA in agarose plugs Premade 1.6% agarose (low melting temperature agarose in 1X PBS) was melted in a 68°C water bath and then moved to a 42°C water bath. The v-abl transformed B cells arrested in G1 phase or after 24 hours of I-PpoI induction were harvested for DNA. Cells with I-PpoI induction can suffer from cell death, therefore, we used Ficoll (Ficoll® Paque Plus, GE Healthcare) to remove dead cells and reduce noise caused by them, following the user protocol (1:2 Ficoll: cell suspension (Vol/Vol), centrifuge at 2000 rpm for 20 minutes with 0 descending force, and washed twice with 1X PBS). Cells were pelleted at 1200 rpm for 5 minutes at room temperature. The supernatant was discarded and cells were resuspended in 1X PBS to be counted. Cells were then pelleted again and resuspended in the desired volume of 1.6% melted agarose as 20 million cells per agarose plug (~70 μL) and put into the plug cast. Plug casts were put at 4°C to let the agarose solidify. Every 2 solidified plugs of the same genotype and treatment were transferred into 500 μL of ESP buffer (10 g of N-lauroylsarcosine (Sigma) in 500 ml of 0.5 M EDTA solution, pH 8.0) (Zhou & Paull, 2015), freshly supplemented with 1mg/mL of Proteinase K and 1 mM CaCl2, and incubated overnight in 12-well or 24-well plates floating in a 50°C water bath. The ESP buffer was aspirated the next morning, and plugs were rinsed 4 times with 1X wash buffer (50 mM EDTA pH 8.0 and 10 mM Tris∙HCl pH 8.0) and then 4 times with 1X TE buffer (10 mM Tris pH 8.0, 1 mM EDTA pH 8.0) for 10-15 minutes at 128 room temperature to completely remove the residual Proteinase K in the plugs. For each well containing 1-2 plugs, 200 μg of RNase A was added to 1X TE buffer with gentle shaking for 5 minutes to dissolve, and then incubated at 37°C for 1 hour to digest the leftover RNA in the plugs. The plugs were washed 4 times with 1X TE buffer at the end of the RNase treatment and stored in 1X TE at 4°C. The first END blunting and ligation Desired plugs were collected and transferred to 24 well plates, and washed one time with EB buffer and three times with 1X NEB buffer 4 (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, 1 mM DTT, pH 7.9) at room temperature. Plugs were then incubated with ExoT reaction mix (12.5 μL of 10X NEB buffer 4, 3-5 μL of Exonuclease T (NEB, 5 U/μL), 107.5 μL of H2O) at room temperature, with gentle shaking for 1 hour. The mix was aspirated after incubation, followed by four 15-minute washes with 500 μL to 1 mL EB buffer at room temperature. Plugs were then equilibrated with 1X dA-tailing buffer (10 mM Tris, 10 mM MgCl2, 50 mM NaCl, 1 mM DTT, 0.2 mM dATP) with three 15-minute washes, and then incubated with dA-tailing reaction mix (12.5 μL 10X dA-tailing buffer, 5 μL of Klenow (Exo-) (NEB), 108 μL of H2O). The plate was placed on a room temperature shaker for 15 minutes to diffuse the enzyme and the plate was floated in a 37°C water bath for 1.5 hours. The dA-tailing mix was aspirated and the plugs were washed twice with EB buffer and twice with 1x NEB buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9) for 15 minutes each to prepare for the ligation reaction. The plugs were transferred into Eppendorf tubes and the ligation reaction mix (112 μL 2X Quick ligase buffer (NEB), 1 μL of annealed biotinylated bridge adaptor (50 μM) (/5Phos/GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGUU/iBiodT/U/iBiodT/UUACACTCTTT CCCTACACGACGCTCTTCCGATC*T, *phosphorothioate bond) was added, 2 μL Quick ligase (NEB), 10.5 μL H2O). The tubes were shook at room temperature for 1.5 hours and transferred to a cold room 16°C heat block to continue overnight. After ligation, plugs were transferred back 129 to 24 well plates, and washed four times with 1X wash buffer, and four times with EB buffer for 15 minutes each. Agarose melting and DNA shearing Each individual plug was transferred into a new Eppendorf tube, and the agarose plugs were melted in a 70°C water bath for 2 minutes and a 43°C water bath for another 5 minutes. 2.5 μL of β-agarase (NEB) was added with 10 μL of 10X buffer to each plug, mixed gently with cut tips, and incubated at 43°C for 1 hour without disturbing. Dialysis and DNA shearing were performed according to the protocol. Sheared DNA was transferred to a clean Eppendorf tube, bringing up the volume to 200 μL with EB. 1 μL of glycogen, 20 μL of 3M NaOAc pH 5.2, and 500 μL of 100% EtOH was added, vortexed briefly, and placed on dry ice or -80°C for 15 minutes. Precipitated DNA was spun down at max speed for 15 minutes at 4°C, and washed twice with cold 70% EtOH. The DNA pellets were dried, and 70 μL of TE’ (0.1 mM EDTA, 10 mM Tris) was added into each tube, incubated at 50°C for 5 hours, and left overnight at 4°C to dissolve completely. Biotin capture, second END ligation and PCR 35 μL of Dynabeads Myone C1 was washed per sample and washed again with 1x B&W buffer (10 Mm Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.1% Tween-20). The beads were resuspended in 70 μL of 2X B&W buffer and mixed with the dissolved DNA samples. The samples were incubated for biotin capture at room temperature for 1-2 hours while shaking. The beads-DNA mixture was then washed with 1X B&W 3 times and twice with 1X EB buffer, and resuspended in 50 μL of H2O to bring up the volume to 55.5 μL. The blunting of the second END and ligation of the second adaptor (/5Phos/GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC* T) were performed using the NEBNext® Ultra™ kits (NEBNext® Ultra™ End Repair/dA-Tailing Module and NEBNext® Ultra™ Ligation Module, respectively). Hairpins were digested by adding 1.5 μL of USER enzyme (NEB) and incubating at 37°C for 45 minutes. The end product was purified using the Qiagen PCR purification kit and amplified using the NEB primers to add in sequencing 130 adaptors. The libraries were quantified using Bioanalyzer and Qubit. Sequencing was performed on an Illumina HiSeq 4000 or Illumina NextSeq 500 platform, using 100bp or 75bp single-end sequencing. 9-12 samples were pooled together for one sequencing run to ensure read depth and quality. Raw sequencing output data was aligned to the customized mm10 genome described above using Bowtie2 (Langmead & Salzberg, 2012). Peaks were called using MACS2 (Feng et al., 2012). Sequencing analysis Peak calling For each EndSeq/ATAC-seq sample, the peak summits were extended by 250 bp on either side to generate a list of peaks with a fixed width of 501 bp. Then peaks within a single sample were processed using an iterative procedure designed by the previous study to remove any overlapping peaks (M Ryan Corces et al., 2018). We then merged all these high-quality, fixed-width peaks from all the samples of interest to build a consensus peak set. Similarly, the overlapping peaks in the consensus peak set were handled by the iterative procedure previously mentioned. Constructing counts matrix and normalization Based on the consensus peak set, we used bedtools to count the number of reads in each peak for each sample and compiled a consensus counts matrix. The counts matrix was then normalized by using edgeR’s counts per million (CPM) (matrix , log = FALSE, prior.count = 5) followed by a quantile normalization using preprocessCore’s normalize.quantiles() function in R. GSEA analysis For each ATAC-Seq sample, a signature peak set was constructed using the overlap peaks with the corresponding EndSeq sample. Then pre-ranked GSEA was performed against the full ATAC-Seq peak set using Python package gseapy. 131 Western blotting Samples at different time points after IR were collected and lysed with RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP-40, and fresh 1mM PMSF, 10mM NaF, and proteinase inhibitor cocktail) followed by the standard Western blotting protocols. The following antibodies were used for detection and analysis: blotted with antibodies anti-CtIP (1:1,000 (X. Yu & Baer, 2000)), and anti-XRCC4 (1:1000; Santa Cruz, sc-8285) , anti-pho-KAP1 (1:1,000, A300-767A; Bethyl Laboratories), anti-KAP1 (1:1,000, 4124S; Cell Signaling), anti-CHK1 (1:1,000, 2348S; Cell Signaling), anti-pho-CHK1(S345) (1:1,000, 2348S; Cell Signaling), anti-RPA32 (1:10,000, A300-244A; Bethyl Laboratories), and anti-pho-RPA(T21) (1:10,000, ab19109394; Abcam). HRP-conjugated anti-mouse secondary antibody (GE Healthcare), and anti-goat secondary antibody (Santa Cruz, sz2020) were used, and an ECL Western blotting detection system (ThermoScientific) was used for detection. 132 References Ahnesorg, P., Smith, P., & Jackson, S. P. (2006). XLF interacts with the XRCC4-DNA ligase IV complex to promote DNA nonhomologous end-joining. Cell, 124(2), 301-313. Retrieved from PM:16439205 Alt, F. W., Zhang, Y., Meng, F. L., Guo, C., & Schwer, B. (2013). Mechanisms of programmed DNA lesions and genomic instability in the immune system. Cell, 152(3), 417-429. doi:10.1016/j.cell.2013.01.007 Anand, R., Ranjha, L., Cannavo, E., & Cejka, P. (2016). Phosphorylated CtIP Functions as a Co-factor of the MRE11-RAD50-NBS1 Endonuclease in DNA End Resection. Mol Cell, 64(5), 940-950. doi:10.1016/j.molcel.2016.10.017 Andres, S. N., Appel, C. D., Westmoreland, J. W., Williams, J. S., Nguyen, Y., Robertson, P. D., . . . Williams, R. S. (2015). Tetrameric Ctp1 coordinates DNA binding and DNA bridging in DNA double-strand-break repair. Nat Struct Mol Biol, 22(2), 158-166. doi:10.1038/nsmb.2945 Aparicio, T., Baer, R., Gottesman, M., & Gautier, J. (2016). MRN, CtIP, and BRCA1 mediate repair of topoisomerase II-DNA adducts. J Cell Biol, 212(4), 399-408. doi:10.1083/jcb.201504005 Arnould, C., Rocher, V., Finoux, A. L., Clouaire, T., Li, K., Zhou, F., . . . Legube, G. (2021). Loop extrusion as a mechanism for formation of DNA damage repair foci. Nature, 590(7847), 660-665. doi:10.1038/s41586-021-03193-z Arnoult, N., Correia, A., Ma, J., Merlo, A., Garcia-Gomez, S., Maric, M., . . . Karlseder, J. (2017). Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature, 549(7673), 548-552. doi:10.1038/nature24023 Audebert, M., Salles, B., & Calsou, P. (2004). Involvement of poly(ADP-ribose) polymerase-1 and XRCC1/DNA ligase III in an alternative route for DNA double-strand breaks rejoining. J Biol Chem, 279(53), 55117-55126. doi:10.1074/jbc.M404524200 Barnes, D. E., Stamp, G., Rosewell, I., Denzel, A., & Lindahl, T. (1998). Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr Biol, 8(25), 1395-1398. doi:10.1016/s0960-9822(98)00021-9 Bartkova, J., Rezaei, N., Liontos, M., Karakaidos, P., Kletsas, D., Issaeva, N., . . . Gorgoulis, V. G. (2006). Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature, 444(7119), 633-637. doi:nature05268 [pii] 10.1038/nature05268 Barton, O., Naumann, S. C., Diemer-Biehs, R., Kunzel, J., Steinlage, M., Conrad, S., . . . Lobrich, M. (2014). Polo-like kinase 3 regulates CtIP during DNA double-strand break repair in G1. J Cell Biol, 206(7), 877-894. doi:10.1083/jcb.201401146 133 Beck, C., Castaneda-Zegarra, S., Huse, C., Xing, M., & Oksenych, V. (2019). Mediator of DNA Damage Checkpoint Protein 1 Facilitates V(D)J Recombination in Cells Lacking DNA Repair Factor XLF. Biomolecules, 10(1). doi:10.3390/biom10010060 Becker, J. R., Bonnet, C., Clifford, G., Groth, A., Wilson, M. D., & Chapman, J. R. (2020). BARD1 links histone H2A Lysine-15 ubiquitination to initiation of BRCA1-dependent homologous recombination. BioRxiv, 2020.2006.2001.127951. doi:10.1101/2020.06.01.127951 Bennardo, N., Cheng, A., Huang, N., & Stark, J. M. (2008). Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet, 4(6), e1000110. doi:10.1371/journal.pgen.1000110 Bjorkman, A., Du, L., Felgentreff, K., Rosner, C., Pankaj Kamdar, R., Kokaraki, G., . . . Pan- Hammarstrom, Q. (2015). DNA-PKcs Is Involved in Ig Class Switch Recombination in Human B Cells. J Immunol, 195(12), 5608-5615. doi:10.4049/jimmunol.1501633 Boboila, C., Alt, F. W., & Schwer, B. (2012). Classical and alternative end-joining pathways for repair of lymphocyte-specific and general DNA double-strand breaks. Adv Immunol, 116, 1-49. doi:10.1016/B978-0-12-394300-2.00001-6 Boboila, C., Jankovic, M., Yan, C. T., Wang, J. H., Wesemann, D. R., Zhang, T., . . . Alt, F. W. (2010). Alternative end-joining catalyzes robust IgH locus deletions and translocations in the combined absence of ligase 4 and Ku70. Proc Natl Acad Sci U S A, 107(7), 3034- 3039. doi:0915067107 [pii] 10.1073/pnas.0915067107 Boboila, C., Oksenych, V., Gostissa, M., Wang, J. H., Zha, S., Zhang, Y., . . . Schwer, B. (2012). Robust chromosomal DNA repair via alternative end-joining in the absence of X-ray repair cross-complementing protein 1 (XRCC1). Proc Natl Acad Sci U S A, 109(7), 2473- 2478. doi:1121470109 [pii] 10.1073/pnas.1121470109 Boboila, C., Yan, C., Wesemann, D. R., Jankovic, M., Wang, J. H., Manis, J., . . . Alt, F. W. (2010). Alternative end-joining catalyzes class switch recombination in the absence of both Ku70 and DNA ligase 4. J Exp Med, 207(2), 417-427. doi:10.1084/jem.20092449 Borghesani, P. R., Alt, F. W., Bottaro, A., Davidson, L., Aksoy, S., Rathbun, G. A., . . . Gu, Y. (2000). Abnormal development of Purkinje cells and lymphocytes in Atm mutant mice. Proc.Natl.Acad.Sci.U.S.A, 97(7), 3336-3341. Retrieved from PM:10716718 Bosma, G. C., Kim, J., Urich, T., Fath, D. M., Cotticelli, M. G., Ruetsch, N. R., . . . Bosma, M. J. (2002). DNA-dependent protein kinase activity is not required for immunoglobulin class switching. J.Exp.Med., 196(11), 1483-1495. Bosma, M., Schuler, W., & Bosma, G. (1988). The scid mouse mutant. Curr.Top.Microbiol.Immunol., 137, 197-202. Retrieved from PM:3416632 Bothmer, A., Robbiani, D. F., Feldhahn, N., Gazumyan, A., Nussenzweig, A., & Nussenzweig, M. C. (2010). 53BP1 regulates DNA resection and the choice between classical and 134 alternative end joining during class switch recombination. J Exp Med, 207(4), 855-865. doi:jem.20100244 [pii] 10.1084/jem.20100244 Bothmer, A., Rommel, P. C., Gazumyan, A., Polato, F., Reczek, C. R., Muellenbeck, M. F., . . . Robbiani, D. F. (2012). Mechanism of DNA resection during intrachromosomal recombination and immunoglobulin class switching. J Exp Med. doi:jem.20121975 [pii] 10.1084/jem.20121975 Bothmer, A., Rommel, P. C., Gazumyan, A., Polato, F., Reczek, C. R., Muellenbeck, M. F., . . . Robbiani, D. F. (2013). Mechanism of DNA resection during intrachromosomal recombination and immunoglobulin class switching. J Exp Med, 210(1), 115-123. doi:10.1084/jem.20121975 Boulton, S. J., & Jackson, S. P. (1996). Saccharomyces cerevisiae Ku70 potentiates illegitimate DNA double-strand break repair and serves as a barrier to error-prone DNA repair pathways. EMBO J, 15(18), 5093-5103. Retrieved from http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation &list_uids=8890183 Brann, J. H., & Firestein, S. J. (2014). A lifetime of neurogenesis in the olfactory system. Front Neurosci, 8, 182. doi:10.3389/fnins.2014.00182 Bredemeyer, A. L., Sharma, G. G., Huang, C. Y., Helmink, B. A., Walker, L. M., Khor, K. C., . . . Sleckman, B. P. (2006). ATM stabilizes DNA double-strand-break complexes during V(D)J recombination. Nature, 442(7101), 466-470. Retrieved from PM:16799570 Brissett, N. C., Pitcher, R. S., Juarez, R., Picher, A. J., Green, A. J., Dafforn, T. R., . . . Doherty, A. J. (2007). Structure of a NHEJ polymerase-mediated DNA synaptic complex. Science, 318(5849), 456-459. doi:10.1126/science.1145112 Buck, D., Malivert, L., de Chasseval, R., Barraud, A., Fondaneche, M. C., Sanal, O., . . . Revy, P. (2006). Cernunnos, a novel nonhomologous end-joining factor, is mutated in human immunodeficiency with microcephaly. Cell, 124(2), 287-299. Retrieved from PM:16439204 Buenrostro, J. D., Wu, B., Chang, H. Y., & Greenleaf, W. J. (2015). ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide. Curr Protoc Mol Biol, 109, 21 29 21-21 29 29. doi:10.1002/0471142727.mb2129s109 Buis, J., Stoneham, T., Spehalski, E., & Ferguson, D. O. (2012). Mre11 regulates CtIP- dependent double-strand break repair by interaction with CDK2. Nat Struct Mol Biol, 19(2), 246-252. doi:nsmb.2212 [pii] 10.1038/nsmb.2212 Bunting, S. F., Callen, E., Wong, N., Chen, H. T., Polato, F., Gunn, A., . . . Nussenzweig, A. (2010). 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks. Cell, 141(2), 243-254. doi:S0092-8674(10)00285-0 [pii] 10.1016/j.cell.2010.03.012 135 Callen, E., Jankovic, M., Difilippantonio, S., Daniel, J. A., Chen, H. T., Celeste, A., . . . Nussenzweig, A. (2007). ATM prevents the persistence and propagation of chromosome breaks in lymphocytes. Cell., 130(1), 63-75. Canela, A., Maman, Y., Jung, S., Wong, N., Callen, E., Day, A., . . . Nussenzweig, A. (2017). Genome Organization Drives Chromosome Fragility. Cell, 170(3), 507-521 e518. doi:10.1016/j.cell.2017.06.034 Canela, A., Sridharan, S., Sciascia, N., Tubbs, A., Meltzer, P., Sleckman, B. P., & Nussenzweig, A. (2016). DNA Breaks and End Resection Measured Genome-wide by End Sequencing. Mol Cell, 63(5), 898-911. doi:10.1016/j.molcel.2016.06.034 Cannavo, E., & Cejka, P. (2014). Sae2 promotes dsDNA endonuclease activity within Mre11- Rad50-Xrs2 to resect DNA breaks. Nature, 514(7520), 122-125. doi:10.1038/nature13771 Carico, Z., & Krangel, M. S. (2015). Chromatin Dynamics and the Development of the TCRalpha and TCRdelta Repertoires. Adv Immunol, 128, 307-361. doi:10.1016/bs.ai.2015.07.005 Chan, S. H., Yu, A. M., & McVey, M. (2010). Dual roles for DNA polymerase theta in alternative end-joining repair of double-strand breaks in Drosophila. PLoS Genet, 6(7), e1001005. doi:10.1371/journal.pgen.1001005 Chapman, J. R., Barral, P., Vannier, J. B., Borel, V., Steger, M., Tomas-Loba, A., . . . Boulton, S. J. (2013). RIF1 is essential for 53BP1-dependent nonhomologous end joining and suppression of DNA double-strand break resection. Mol Cell, 49(5), 858-871. doi:10.1016/j.molcel.2013.01.002 Chaudhuri, J., Basu, U., Zarrin, A., Yan, C., Franco, S., Perlot, T., . . . Alt, F. W. (2007). Evolution of the immunoglobulin heavy chain class switch recombination mechanism. Adv Immunol, 94, 157-214. doi:10.1016/S0065-2776(06)94006-1 Chaumeil, J., Micsinai, M., Ntziachristos, P., Roth, D. B., Aifantis, I., Kluger, Y., . . . Skok, J. A. (2013). The RAG2 C-terminus and ATM protect genome integrity by controlling antigen receptor gene cleavage. Nat Commun, 4, 2231. doi:10.1038/ncomms3231 Chen, H., Donnianni, R. A., Handa, N., Deng, S. K., Oh, J., Timashev, L. A., . . . Symington, L. S. (2015). Sae2 promotes DNA damage resistance by removing the Mre11-Rad50-Xrs2 complex from DNA and attenuating Rad53 signaling. Proc Natl Acad Sci U S A, 112(15), E1880-1887. doi:10.1073/pnas.1503331112 Chen, P. L., Liu, F., Cai, S., Lin, X., Li, A., Chen, Y., . . . Lee, W. H. (2005). Inactivation of CtIP leads to early embryonic lethality mediated by G1 restraint and to tumorigenesis by haploid insufficiency. Mol Cell Biol, 25(9), 3535-3542. doi:25/9/3535 [pii] 10.1128/MCB.25.9.3535-3542.2005 Chen, X., Xu, X., Chen, Y., Cheung, J. C., Wang, H., Jiang, J., . . . Yang, W. (2020). Structure of an activated DNA-PK and its implications for NHEJ. Mol Cell. doi:10.1016/j.molcel.2020.12.015 136 Ciccia, A., & Elledge, S. J. (2010). The DNA damage response: making it safe to play with knives. Mol Cell, 40(2), 179-204. doi:10.1016/j.molcel.2010.09.019 Corces, M. R., Buenrostro, J. D., Wu, B., Greenside, P. G., Chan, S. M., Koenig, J. L., . . . Chang, H. Y. (2016). Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution. Nat Genet, 48(10), 1193-1203. doi:10.1038/ng.3646 Corces, M. R., Granja, J. M., Shams, S., Louie, B. H., Seoane, J. A., Zhou, W., . . . Cho, S. W. (2018). The chromatin accessibility landscape of primary human cancers. Science, 362(6413). Corneo, B., Wendland, R. L., Deriano, L., Cui, X., Klein, I. A., Wong, S. Y., . . . Roth, D. B. (2007). Rag mutations reveal robust alternative end joining. Nature., 449(7161), 483- 486. Crosetto, N., Mitra, A., Silva, M. J., Bienko, M., Dojer, N., Wang, Q., . . . Dikic, I. (2013). Nucleotide-resolution DNA double-strand break mapping by next-generation sequencing. Nat Methods, 10(4), 361-365. doi:10.1038/nmeth.2408 Crowe, J. L., Shao, Z., Wang, X. S., Wei, P. C., Jiang, W., Lee, B. J., . . . Zha, S. (2018a). Kinase-dependent structural role of DNA-PKcs during immunoglobulin class switch recombination. Proc Natl Acad Sci U S A. doi:10.1073/pnas.1808490115 Crowe, J. L., Shao, Z., Wang, X. S., Wei, P. C., Jiang, W., Lee, B. J., . . . Zha, S. (2018b). Kinase-dependent structural role of DNA-PKcs during immunoglobulin class switch recombination. Proc Natl Acad Sci U S A, 115(34), 8615-8620. doi:10.1073/pnas.1808490115 Crowe, J. L., Wang, X. S., Shao, Z., Lee, B. J., Estes, V. M., & Zha, S. (2020). DNA-PKcs phosphorylation at the T2609 cluster alters the repair pathway choice during immunoglobulin class switch recombination. BioRxiv. doi:https://doi.org/10.1101/2020.04.23.057877 Daniel, J. A., Santos, M. A., Wang, Z., Zang, C., Schwab, K. R., Jankovic, M., . . . Nussenzweig, A. (2010). PTIP promotes chromatin changes critical for immunoglobulin class switch recombination. Science, 329(5994), 917-923. doi:10.1126/science.1187942 Davies, O. R., Forment, J. V., Sun, M., Belotserkovskaya, R., Coates, J., Galanty, Y., . . . Pellegrini, L. (2015). CtIP tetramer assembly is required for DNA-end resection and repair. Nat Struct Mol Biol, 22(2), 150-157. doi:10.1038/nsmb.2937 Davis, A. J., Chen, B. P., & Chen, D. J. (2014). DNA-PK: a dynamic enzyme in a versatile DSB repair pathway. DNA Repair (Amst), 17, 21-29. doi:10.1016/j.dnarep.2014.02.020 Decottignies, A. (2007). Microhomology-mediated end joining in fission yeast is repressed by pku70 and relies on genes involved in homologous recombination. Genetics, 176(3), 1403-1415. doi:10.1534/genetics.107.071621 Deng, S. K., Gibb, B., de Almeida, M. J., Greene, E. C., & Symington, L. S. (2014). RPA antagonizes microhomology-mediated repair of DNA double-strand breaks. Nat Struct Mol Biol, 21(4), 405-412. doi:10.1038/nsmb.2786 137 Deriano, L., Chaumeil, J., Coussens, M., Multani, A., Chou, Y., Alekseyenko, A. V., . . . Roth, D. B. (2011). The RAG2 C terminus suppresses genomic instability and lymphomagenesis. Nature, 471(7336), 119-123. doi:10.1038/nature09755 Deshpande, R. A., Lee, J. H., Arora, S., & Paull, T. T. (2016). Nbs1 Converts the Human Mre11/Rad50 Nuclease Complex into an Endo/Exonuclease Machine Specific for Protein-DNA Adducts. Mol Cell, 64(3), 593-606. doi:10.1016/j.molcel.2016.10.010 Dev, H., Chiang, T. W., Lescale, C., de Krijger, I., Martin, A. G., Pilger, D., . . . Jackson, S. P. (2018). Shieldin complex promotes DNA end-joining and counters homologous recombination in BRCA1-null cells. Nat Cell Biol, 20(8), 954-965. doi:10.1038/s41556- 018-0140-1 Di Virgilio, M., Callen, E., Yamane, A., Zhang, W., Jankovic, M., Gitlin, A. D., . . . Nussenzweig, M. C. (2013). Rif1 prevents resection of DNA breaks and promotes immunoglobulin class switching. Science, 339(6120), 711-715. doi:10.1126/science.1230624 Difilippantonio, S., Gapud, E., Wong, N., Huang, C. Y., Mahowald, G., Chen, H. T., . . . Nussenzweig, A. (2008). 53BP1 facilitates long-range DNA end-joining during V(D)J recombination. Nature, 456(7221), 529-533. doi:nature07476 [pii] 10.1038/nature07476 Dong, J., Panchakshari, R. A., Zhang, T., Zhang, Y., Hu, J., Volpi, S. A., . . . Alt, F. W. (2015). Orientation-specific joining of AID-initiated DNA breaks promotes antibody class switching. Nature, 525(7567), 134-139. doi:10.1038/nature14970 Dorsett, Y., Zhou, Y., Tubbs, A. T., Chen, B. R., Purman, C., Lee, B. S., . . . Sleckman, B. P. (2014). HCoDES reveals chromosomal DNA end structures with single-nucleotide resolution. Mol Cell, 56(6), 808-818. doi:10.1016/j.molcel.2014.10.024 Dubin, M. J., Stokes, P. H., Sum, E. Y., Williams, R. S., Valova, V. A., Robinson, P. J., . . . Matthews, J. M. (2004). Dimerization of CtIP, a BRCA1- and CtBP-interacting protein, is mediated by an N-terminal coiled-coil motif. J Biol Chem, 279(26), 26932-26938. doi:10.1074/jbc.M313974200 Dunnick, W., Hertz, G. Z., Scappino, L., & Gritzmacher, C. (1993). DNA sequences at immunoglobulin switch region recombination sites. Nucleic Acids Res, 21(3), 365-372. doi:10.1093/nar/21.3.365 Egner, C., & Berg, D. E. (1981). Excision of transposon Tn5 is dependent on the inverted repeats but not on the transposase function of Tn5. Proc Natl Acad Sci U S A, 78(1), 459-463. doi:10.1073/pnas.78.1.459 Ellenberger, T., & Tomkinson, A. E. (2008). Eukaryotic DNA ligases: structural and functional insights. Annu Rev Biochem, 77, 313-338. doi:10.1146/annurev.biochem.77.061306.123941 Faust, G. G., & Hall, I. M. (2012). YAHA: fast and flexible long-read alignment with optimal breakpoint detection. Bioinformatics, 28(19), 2417-2424. doi:10.1093/bioinformatics/bts456 138 Feng, J., Liu, T., Qin, B., Zhang, Y., & Liu, X. S. (2012). Identifying ChIP-seq enrichment using MACS. Nat Protoc, 7(9), 1728-1740. doi:10.1038/nprot.2012.101 Ferretti, L. P., Himmels, S. F., Trenner, A., Walker, C., von Aesch, C., Eggenschwiler, A., . . . Sartori, A. A. (2016). Cullin3-KLHL15 ubiquitin ligase mediates CtIP protein turnover to fine-tune DNA-end resection. Nat Commun, 7, 12628. doi:10.1038/ncomms12628 Findlay, S., Heath, J., Luo, V. M., Malina, A., Morin, T., Coulombe, Y., . . . Orthwein, A. (2018). SHLD2/FAM35A co-operates with REV7 to coordinate DNA double-strand break repair pathway choice. EMBO J, 37(18). doi:10.15252/embj.2018100158 Franco, S., Alt, F. W., & Manis, J. P. (2006). Pathways that suppress programmed DNA breaks from progressing to chromosomal breaks and translocations. DNA Repair (Amst), 5(9- 10), 1030-1041. Retrieved from PM:16934538 Franco, S., Gostissa, M., Zha, S., Lombard, D. B., Murphy, M. M., Zarrin, A. A., . . . Alt, F. W. (2006). H2AX prevents DNA breaks from progressing to chromosome breaks and translocations. Mol.Cell, 21(2), 201-214. Retrieved from PM:16427010 Franco, S., Murphy, M. M., Li, G., Borjeson, T., Boboila, C., & Alt, F. W. (2008). DNA-PKcs and Artemis function in the end-joining phase of immunoglobulin heavy chain class switch recombination. J.Exp.Med., 205(3), 557-564. Frank, K. M., Sharpless, N. E., Gao, Y., Sekiguchi, J. M., Ferguson, D. O., Zhu, C., . . . Alt, F. W. (2000). DNA ligase IV deficiency in mice leads to defective neurogenesis and embryonic lethality via the p53 pathway. Mol.Cell, 5(6), 993-1002. Retrieved from PM:10911993 Furuse, M., Nagase, Y., Tsubouchi, H., Murakami-Murofushi, K., Shibata, T., & Ohta, K. (1998). Distinct roles of two separable in vitro activities of yeast Mre11 in mitotic and meiotic recombination. EMBO J, 17(21), 6412-6425. doi:10.1093/emboj/17.21.6412 Gao, Y., Chaudhuri, J., Zhu, C., Davidson, L., Weaver, D. T., & Alt, F. W. (1998). A targeted DNA-PKcs-null mutation reveals DNA-PK-independent functions for KU in V(D)J recombination. Immunity., 9(3), 367-376. Retrieved from PM:9768756 Gao, Y., Ferguson, D. O., Xie, W., Manis, J. P., Sekiguchi, J., Frank, K. M., . . . Alt, F. W. (2000). Interplay of p53 and DNA-repair protein XRCC4 in tumorigenesis, genomic stability and development. Nature, 404(6780), 897-900. Retrieved from PM:10786799 Gao, Y., Sun, Y., Frank, K. M., Dikkes, P., Fujiwara, Y., Seidl, K. J., . . . Alt, F. W. (1998). A critical role for DNA end-joining proteins in both lymphogenesis and neurogenesis. Cell, 95(7), 891-902. Retrieved from PM:9875844 Gapud, E. J., Dorsett, Y., Yin, B., Callen, E., Bredemeyer, A., Mahowald, G. K., . . . Sleckman, B. P. (2011). Ataxia telangiectasia mutated (Atm) and DNA-PKcs kinases have overlapping activities during chromosomal signal joint formation. Proc Natl Acad Sci U S A, 108(5), 2022-2027. doi:1013295108 [pii] 10.1073/pnas.1013295108 139 Garcia, V., Phelps, S. E., Gray, S., & Neale, M. J. (2011). Bidirectional resection of DNA double- strand breaks by Mre11 and Exo1. Nature, 479(7372), 241-244. doi:10.1038/nature10515 Gelmann, E. P., Psallidopoulos, M. C., Papas, T. S., & Dalla-Favera, R. (1983). Identification of reciprocal translocation sites within the c-myc oncogene and immunoglobulin mu locus in a Burkitt lymphoma. Nature, 306(5945), 799-803. doi:10.1038/306799a0 Ghezraoui, H., Oliveira, C., Becker, J. R., Bilham, K., Moralli, D., Anzilotti, C., . . . Chapman, J. R. (2018). 53BP1 cooperation with the REV7-shieldin complex underpins DNA structure- specific NHEJ. Nature, 560(7716), 122-127. doi:10.1038/s41586-018-0362-1 Ghezraoui, H., Piganeau, M., Renouf, B., Renaud, J. B., Sallmyr, A., Ruis, B., . . . Brunet, E. (2014). Chromosomal translocations in human cells are generated by canonical nonhomologous end-joining. Mol Cell, 55(6), 829-842. doi:10.1016/j.molcel.2014.08.002 Ghosh, R., Roy, S., Kamyab, J., Danzter, F., & Franco, S. (2016). Common and unique genetic interactions of the poly(ADP-ribose) polymerases PARP1 and PARP2 with DNA double- strand break repair pathways. DNA Repair (Amst), 45, 56-62. doi:10.1016/j.dnarep.2016.06.001 Gilfillan, S., Dierich, A., Lemeur, M., Benoist, C., & Mathis, D. (1993). Mice lacking TdT: mature animals with an immature lymphocyte repertoire. Science., 261(5125), 1175-1178. Gostissa, M., Yan, C. T., Bianco, J. M., Cogne, M., Pinaud, E., & Alt, F. W. (2009). Long-range oncogenic activation of Igh-c-myc translocations by the Igh 3' regulatory region. Nature, 462(7274), 803-807. doi:nature08633 [pii] 10.1038/nature08633 Grawunder, U., Wilm, M., Wu, X., Kulesza, P., Wilson, T. E., Mann, M., & Lieber, M. R. (1997). Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature, 388(6641), 492-495. doi:10.1038/41358 Groffen, J., Hermans, A., Grosveld, G., & Heisterkamp, N. (1989). Molecular analysis of chromosome breakpoints. Prog Nucleic Acid Res Mol Biol, 36, 281-300. doi:10.1016/s0079-6603(08)60177-4 Grundy, G. J., Rulten, S. L., Arribas-Bosacoma, R., Davidson, K., Kozik, Z., Oliver, A. W., . . . Caldecott, K. W. (2016). The Ku-binding motif is a conserved module for recruitment and stimulation of non-homologous end-joining proteins. Nat Commun, 7, 11242. doi:10.1038/ncomms11242 Gu, Y., Jin, S., Gao, Y., Weaver, D. T., & Alt, F. W. (1997). Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity, and inability to support V(D)J recombination. Proc.Natl.Acad.Sci.U.S.A, 94(15), 8076-8081. Retrieved from PM:9223317 Gu, Y., Seidl, K. J., Rathbun, G. A., Zhu, C., Manis, J. P., van der Stoep, N., . . . Alt, F. W. (1997). Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity, 7(5), 653-665. doi:10.1016/s1074-7613(00)80386-6 140 Han, L., & Yu, K. (2008). Altered kinetics of nonhomologous end joining and class switch recombination in ligase IV-deficient B cells. J Exp Med, 205(12), 2745-2753. doi:jem.20081623 [pii] 10.1084/jem.20081623 Hauer, M. H., & Gasser, S. M. (2017). Chromatin and nucleosome dynamics in DNA damage and repair. Genes Dev, 31(22), 2204-2221. doi:10.1101/gad.307702.117 Helmink, B. A., Bredemeyer, A. L., Lee, B. S., Huang, C. Y., Sharma, G. G., Walker, L. M., . . . Sleckman, B. P. (2009). MRN complex function in the repair of chromosomal Rag- mediated DNA double-strand breaks. J.Exp.Med., 206(3), 669-679. Helmink, B. A., Tubbs, A. T., Dorsett, Y., Bednarski, J. J., Walker, L. M., Feng, Z., . . . Sleckman, B. P. (2011). H2AX prevents CtIP-mediated DNA end resection and aberrant repair in G1-phase lymphocytes. Nature, 469(7329), 245-249. doi:nature09585 [pii] 10.1038/nature09585 Hirao, A., Kong, Y. Y., Matsuoka, S., Wakeham, A., Ruland, J., Yoshida, H., . . . Mak, T. W. (2000). DNA damage-induced activation of p53 by the checkpoint kinase Chk2. Science, 287(5459), 1824-1827. doi:10.1126/science.287.5459.1824 Hobeika, E., Thiemann, S., Storch, B., Jumaa, H., Nielsen, P. J., Pelanda, R., & Reth, M. (2006). Testing gene function early in the B cell lineage in mb1-cre mice. Proc Natl Acad Sci U S A, 103(37), 13789-13794. doi:0605944103 [pii] 10.1073/pnas.0605944103 Howard, S. M., Yanez, D. A., & Stark, J. M. (2015). DNA damage response factors from diverse pathways, including DNA crosslink repair, mediate alternative end joining. PLoS Genet, 11(1), e1004943. doi:10.1371/journal.pgen.1004943 Hu, J., Meyers, R. M., Dong, J., Panchakshari, R. A., Alt, F. W., & Frock, R. L. (2016). Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing. Nat Protoc, 11(5), 853-871. doi:10.1038/nprot.2016.043 Huertas, P., Cortes-Ledesma, F., Sartori, A. A., Aguilera, A., & Jackson, S. P. (2008). CDK targets Sae2 to control DNA-end resection and homologous recombination. Nature, 455(7213), 689-692. doi:nature07215 [pii] 10.1038/nature07215 Huhn, D., Kousholt, A. N., Sorensen, C. S., & Sartori, A. A. (2015). miR-19, a component of the oncogenic miR-17 approximately 92 cluster, targets the DNA-end resection factor CtIP. Oncogene, 34(30), 3977-3984. doi:10.1038/onc.2014.329 Hung, P. J., Johnson, B., Chen, B. R., Byrum, A. K., Bredemeyer, A. L., Yewdell, W. T., . . . Sleckman, B. P. (2018). MRI Is a DNA Damage Response Adaptor during Classical Non-homologous End Joining. Mol Cell, 71(2), 332-342 e338. doi:10.1016/j.molcel.2018.06.018 141 Hwang, J. K., Alt, F. W., & Yeap, L. S. (2015). Related Mechanisms of Antibody Somatic Hypermutation and Class Switch Recombination. Microbiol Spectr, 3(1), MDNA3-0037- 2014. doi:10.1128/microbiolspec.MDNA3-0037-2014 Jacks, T., Remington, L., Williams, B. O., Schmitt, E. M., Halachmi, S., Bronson, R. T., & Weinberg, R. A. (1994). Tumor spectrum analysis in p53-mutant mice. Curr Biol, 4(1), 1- 7. doi:10.1016/s0960-9822(00)00002-6 Jhappan, C., Morse, H. C., III, Fleischmann, R. D., Gottesman, M. M., & Merlino, G. (1997). DNA-PKcs: a T-cell tumour suppressor encoded at the mouse scid locus. Nat.Genet., 17(4), 483-486. Jiang, H., Chang, F. C., Ross, A. E., Lee, J., Nakayama, K., Nakayama, K., & Desiderio, S. (2005). Ubiquitylation of RAG-2 by Skp2-SCF links destruction of the V(D)J recombinase to the cell cycle. Mol Cell, 18(6), 699-709. doi:10.1016/j.molcel.2005.05.011 Jiang, W., Crowe, J. L., Liu, X., Nakajima, S., Wang, Y., Li, C., . . . Zha, S. (2015). Differential phosphorylation of DNA-PKcs regulates the interplay between end-processing and end- ligation during nonhomologous end-joining. Mol Cell, 58(1), 172-185. doi:10.1016/j.molcel.2015.02.024 Jung, D., Giallourakis, C., Mostoslavsky, R., & Alt, F. W. (2006). Mechanism and Control of V(D)J Recombination at the Immunoglobulin Heavy Chain Locus. Annu.Rev.Immunol. Retrieved from PM:16411851 Kabotyanski, E. B., Gomelsky, L., Han, J. O., Stamato, T. D., & Roth, D. B. (1998). Double- strand break repair in Ku86- and XRCC4-deficient cells. Nucleic Acids Res., 26(23), 5333-5342. Karanjawala, Z. E., Adachi, N., Irvine, R. A., Oh, E. K., Shibata, D., Schwarz, K., . . . Lieber, M. R. (2002). The embryonic lethality in DNA ligase IV-deficient mice is rescued by deletion of Ku: implications for unifying the heterogeneous phenotypes of NHEJ mutants. DNA Repair (Amst), 1(12), 1017-1026. doi:S1568786402001519 [pii] Kari, V., Mansour, W. Y., Raul, S. K., Baumgart, S. J., Mund, A., Grade, M., . . . Johnsen, S. A. (2016). Loss of CHD1 causes DNA repair defects and enhances prostate cancer therapeutic responsiveness. EMBO Rep, 17(11), 1609-1623. doi:10.15252/embr.201642352 Kawamura, K., Bahar, R., Seimiya, M., Chiyo, M., Wada, A., Okada, S., . . . J, O. W. (2004). DNA polymerase theta is preferentially expressed in lymphoid tissues and upregulated in human cancers. Int J Cancer, 109(1), 9-16. doi:10.1002/ijc.11666 Kiefer, K., Oshinsky, J., Kim, J., Nakajima, P. B., Bosma, G. C., & Bosma, M. J. (2007). The catalytic subunit of DNA-protein kinase (DNA-PKcs) is not required for Ig class-switch recombination. Proc.Natl.Acad.Sci.U.S.A., %20;104(8), 2843-2848. Komori, T., Okada, A., Stewart, V., & Alt, F. W. (1993). Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes. Science, 261(5125), 1171-1175. Retrieved from PM:8356451 142 Kovalchuk, A. L., Qi, C. F., Torrey, T. A., Taddesse-Heath, L., Feigenbaum, L., Park, S. S., . . . Morse, H. C., 3rd. (2000). Burkitt lymphoma in the mouse. J Exp Med, 192(8), 1183- 1190. doi:10.1084/jem.192.8.1183 Kraus, M., Pao, L. I., Reichlin, A., Hu, Y., Canono, B., Cambier, J. C., . . . Rajewsky, K. (2001). Interference with immunoglobulin (Ig)alpha immunoreceptor tyrosine-based activation motif (ITAM) phosphorylation modulates or blocks B cell development, depending on the availability of an Igbeta cytoplasmic tail. J Exp Med, 194(4), 455-469. doi:10.1084/jem.194.4.455 Kumar, V., Alt, F. W., & Frock, R. L. (2016). PAXX and XLF DNA repair factors are functionally redundant in joining DNA breaks in a G1-arrested progenitor B-cell line. Proc Natl Acad Sci U S A, 113(38), 10619-10624. doi:10.1073/pnas.1611882113 Kuppers, R., & Dalla-Favera, R. (2001). Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene, 20(40), 5580-5594. doi:10.1038/sj.onc.1204640 Kurimasa, A., Ouyang, H., Dong, L. J., Wang, S., Li, X., Cordon-Cardo, C., . . . Li, G. C. (1999). Catalytic subunit of DNA-dependent protein kinase: impact on lymphocyte development and tumorigenesis. Proc Natl Acad Sci U S A, 96(4), 1403-1408. doi:10.1073/pnas.96.4.1403 Lafranchi, L., de Boer, H. R., de Vries, E. G., Ong, S. E., Sartori, A. A., & van Vugt, M. A. (2014). APC/C(Cdh1) controls CtIP stability during the cell cycle and in response to DNA damage. EMBO J, 33(23), 2860-2879. doi:10.15252/embj.201489017 Langmead, B., & Salzberg, S. L. (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods, 9(4), 357-359. doi:10.1038/nmeth.1923 Lee-Theilen, M., Matthews, A. J., Kelly, D., Zheng, S., & Chaudhuri, J. (2010). CtIP promotes microhomology-mediated alternative end joining during class-switch recombination. Nat Struct Mol Biol, 18(1), 75-79. doi:nsmb.1942 [pii] 10.1038/nsmb.1942 Lee, B. S., Gapud, E. J., Zhang, S., Dorsett, Y., Bredemeyer, A., George, R., . . . Sleckman, B. P. (2013). Functional Intersection of ATM and DNA-PKcs in Coding End Joining During V(D)J Recombination. Mol Cell Biol. doi:MCB.00308-13 [pii] 10.1128/MCB.00308-13 Lee, K., & Lee, S. E. (2007). Saccharomyces cerevisiae Sae2- and Tel1-dependent single- strand DNA formation at DNA break promotes microhomology-mediated end joining. Genetics, 176(4), 2003-2014. doi:10.1534/genetics.107.076539 Lengsfeld, B. M., Rattray, A. J., Bhaskara, V., Ghirlando, R., & Paull, T. T. (2007). Sae2 is an endonuclease that processes hairpin DNA cooperatively with the Mre11/Rad50/Xrs2 complex. Mol.Cell., 28(4), 638-651. Lescale, C., Lenden Hasse, H., Blackford, A. N., Balmus, G., Bianchi, J. J., Yu, W., . . . Deriano, L. (2016). Specific Roles of XRCC4 Paralogs PAXX and XLF during V(D)J Recombination. Cell Rep. doi:10.1016/j.celrep.2016.08.069 143 Li, G., Alt, F. W., Cheng, H. L., Brush, J. W., Goff, P. H., Murphy, M. M., . . . Zha, S. (2008). Lymphocyte-Specific Compensation for XLF/Cernunnos End-Joining Functions in V(D)J Recombination. Mol.Cell., 31, 631-640. Li, X., & Tyler, J. K. (2016). Nucleosome disassembly during human non-homologous end joining followed by concerted HIRA- and CAF-1-dependent reassembly. Elife, 5. doi:10.7554/eLife.15129 Li, Y., Gao, X., & Wang, J. Y. (2011). Comparison of two POLQ mutants reveals that a polymerase-inactive POLQ retains significant function in tolerance to etoposide and gamma-irradiation in mouse B cells. Genes Cells, 16(9), 973-983. doi:10.1111/j.1365- 2443.2011.01550.x Lieber, M. R. (2010). The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annu Rev Biochem, 79, 181-211. doi:10.1146/annurev.biochem.052308.093131 Lieber, M. R., Hesse, J. E., Lewis, S., Bosma, G. C., Rosenberg, N., Mizuuchi, K., . . . Gellert, M. (1988). The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination. Cell, 55(1), 7-16. Retrieved from PM:3167977 Limbo, O., Chahwan, C., Yamada, Y., de Bruin, R. A., Wittenberg, C., & Russell, P. (2007). Ctp1 is a cell-cycle-regulated protein that functions with Mre11 complex to control double-strand break repair by homologous recombination. Mol Cell, 28(1), 134-146. doi:S1097-2765(07)00621-1 [pii] 10.1016/j.molcel.2007.09.009 Lin, W., Sampathi, S., Dai, H., Liu, C., Zhou, M., Hu, J., . . . Shen, B. (2013). Mammalian DNA2 helicase/nuclease cleaves G-quadruplex DNA and is required for telomere integrity. EMBO J, 32(10), 1425-1439. doi:10.1038/emboj.2013.88 Liu, F., & Lee, W. H. (2006). CtIP activates its own and cyclin D1 promoters via the E2F/RB pathway during G1/S progression. Mol Cell Biol, 26(8), 3124-3134. doi:26/8/3124 [pii] 10.1128/MCB.26.8.3124-3134.2006 Liu, W., Zhou, M., Li, Z., Li, H., Polaczek, P., Dai, H., . . . Shen, B. (2016). A Selective Small Molecule DNA2 Inhibitor for Sensitization of Human Cancer Cells to Chemotherapy. EBioMedicine, 6, 73-86. doi:10.1016/j.ebiom.2016.02.043 Liu, X., Jiang, W., Dubois, R. L., Yamamoto, K., Wolner, Z., & Zha, S. (2012). Overlapping functions between XLF repair protein and 53BP1 DNA damage response factor in end joining and lymphocyte development. Proc Natl Acad Sci U S A, 109(10), 3903-3908. doi:1120160109 [pii] 10.1073/pnas.1120160109 Liu, X., Liu, T., Shang, Y., Dai, P., Zhang, W., Lee, B. J., . . . Meng, F. L. (2020). ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells. Cell Res, 30(9), 732-744. doi:10.1038/s41422-020-0328-3 144 Liu, X., Shao, Z., Jiang, W., Lee, B. J., & Zha, S. (2017). PAXX promotes KU accumulation at DNA breaks and is essential for end-joining in XLF-deficient mice. Nat Commun, 8, 13816. doi:10.1038/ncomms13816 Liu, X., Wang, X. S., Lee, B. J., Wu-Baer, F. K., Lin, X., Shao, Z., . . . Zha, S. (2019). CtIP is essential for early B cell proliferation and development in mice. J Exp Med, 216(7), 1648-1663. doi:10.1084/jem.20181139 Liu, Y., Beard, W. A., Shock, D. D., Prasad, R., Hou, E. W., & Wilson, S. H. (2005). DNA polymerase beta and flap endonuclease 1 enzymatic specificities sustain DNA synthesis for long patch base excision repair. J Biol Chem, 280(5), 3665-3674. doi:10.1074/jbc.M412922200 Liu, Y., Zhang, L., & Desiderio, S. (2009). Temporal and spatial regulation of V(D)J recombination: interactions of extrinsic factors with the RAG complex. Adv Exp Med Biol, 650, 157-165. Retrieved from http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation &list_uids=19731809 Lobachev, K. S., Gordenin, D. A., & Resnick, M. A. (2002). The Mre11 complex is required for repair of hairpin-capped double-strand breaks and prevention of chromosome rearrangements. Cell, 108(2), 183-193. doi:10.1016/s0092-8674(02)00614-1 Lou, Z., Minter-Dykhouse, K., Franco, S., Gostissa, M., Rivera, M. A., Celeste, A., . . . Chen, J. (2006). MDC1 maintains genomic stability by participating in the amplification of ATM- dependent DNA damage signals. Mol.Cell, 21(2), 187-200. Retrieved from PM:16427009 Lumsden, J. M., McCarty, T., Petiniot, L. K., Shen, R., Barlow, C., Wynn, T. A., . . . Hodes, R. J. (2004). Immunoglobulin class switch recombination is impaired in Atm-deficient mice. J.Exp.Med., 200(9), 1111-1121. Retrieved from PM:15504820 Ma, J. L., Kim, E. M., Haber, J. E., & Lee, S. E. (2003). Yeast Mre11 and Rad1 proteins define a Ku-independent mechanism to repair double-strand breaks lacking overlapping end sequences. Mol Cell Biol, 23(23), 8820-8828. doi:10.1128/mcb.23.23.8820-8828.2003 Ma, Y., Lu, H., Tippin, B., Goodman, M. F., Shimazaki, N., Koiwai, O., . . . Lieber, M. R. (2004). A biochemically defined system for mammalian nonhomologous DNA end joining. Mol Cell, 16(5), 701-713. doi:10.1016/j.molcel.2004.11.017 Ma, Y., Pannicke, U., Schwarz, K., & Lieber, M. R. (2002). Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell, 108(6), 781-794. Retrieved from PM:11955432 Makharashvili, N., & Paull, T. T. (2015). CtIP: A DNA damage response protein at the intersection of DNA metabolism. DNA Repair, 32, 75-81. doi:10.1016/j.dnarep.2015.04.016 Makharashvili, N., Tubbs, A. T., Yang, S. H., Wang, H., Barton, O., Zhou, Y., . . . Paull, T. T. (2014). Catalytic and noncatalytic roles of the CtIP endonuclease in double-strand break end resection. Mol Cell, 54(6), 1022-1033. doi:10.1016/j.molcel.2014.04.011 145 Manis, J. P., Dudley, D., Kaylor, L., & Alt, F. W. (2002). IgH class switch recombination to IgG1 in DNA-PKcs-deficient B cells. Immunity., 16(4), 607-617. Retrieved from PM:11970883 Manis, J. P., Morales, J. C., Xia, Z., Kutok, J. L., Alt, F. W., & Carpenter, P. B. (2004). 53BP1 links DNA damage-response pathways to immunoglobulin heavy chain class-switch recombination. Nat Immunol, 5(5), 481-487. doi:10.1038/ni1067 ni1067 [pii] Martin, N. T., Nakamura, K., Davies, R., Nahas, S. A., Brown, C., Tunuguntla, R., . . . Hu, H. (2013). ATM-dependent MiR-335 targets CtIP and modulates the DNA damage response. PLoS Genet, 9(5), e1003505. doi:10.1371/journal.pgen.1003505 Masani, S., Han, L., Meek, K., & Yu, K. (2016). Redundant function of DNA ligase 1 and 3 in alternative end-joining during immunoglobulin class switch recombination. Proc Natl Acad Sci U S A, 113(5), 1261-1266. doi:10.1073/pnas.1521630113 Mateos-Gomez, P. A., Gong, F., Nair, N., Miller, K. M., Lazzerini-Denchi, E., & Sfeir, A. (2015). Mammalian polymerase theta promotes alternative NHEJ and suppresses recombination. Nature, 518(7538), 254-257. doi:10.1038/nature14157 Matthews, A. G., Kuo, A. J., Ramon-Maiques, S., Han, S., Champagne, K. S., Ivanov, D., . . . Oettinger, M. A. (2007). RAG2 PHD finger couples histone H3 lysine 4 trimethylation with V(D)J recombination. Nature, 450(7172), 1106-1110. doi:10.1038/nature06431 Matthews, A. J., Zheng, S., DiMenna, L. J., & Chaudhuri, J. (2014). Regulation of immunoglobulin class-switch recombination: choreography of noncoding transcription, targeted DNA deamination, and long-range DNA repair. Adv Immunol, 122, 1-57. doi:10.1016/B978-0-12-800267-4.00001-8 McKee, A. H., & Kleckner, N. (1997). A general method for identifying recessive diploid-specific mutations in Saccharomyces cerevisiae, its application to the isolation of mutants blocked at intermediate stages of meiotic prophase and characterization of a new gene SAE2. Genetics, 146(3), 797-816. Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/9215888 McVey, M., & Lee, S. E. (2008). MMEJ repair of double-strand breaks (director's cut): deleted sequences and alternative endings. Trends Genet., 24(11), 529-538. Meek, K., Dang, V., & Lees-Miller, S. P. (2008). DNA-PK: the means to justify the ends? Adv Immunol, 99, 33-58. doi:S0065-2776(08)00602-0 [pii] 10.1016/S0065-2776(08)00602-0 Menolfi, D., Jiang, W., Lee, B. J., Moiseeva, T., Shao, Z., Estes, V., . . . Zha, S. (2018). Kinase- dead ATR differs from ATR loss by limiting the dynamic exchange of ATR and RPA. Nat Commun, 9(1), 5351. doi:10.1038/s41467-018-07798-3 Methot, S. P., & Di Noia, J. M. (2017). Molecular Mechanisms of Somatic Hypermutation and Class Switch Recombination. Adv Immunol, 133, 37-87. doi:10.1016/bs.ai.2016.11.002 Mimitou, E. P., & Symington, L. S. (2008). Sae2, Exo1 and Sgs1 collaborate in DNA double- strand break processing. Nature, 455(7214), 770-774. doi:nature07312 [pii] 146 10.1038/nature07312 Mimitou, E. P., & Symington, L. S. (2009). DNA end resection: many nucleases make light work. DNA Repair (Amst), 8(9), 983-995. doi:10.1016/j.dnarep.2009.04.017 Mimitou, E. P., & Symington, L. S. (2010). Ku prevents Exo1 and Sgs1-dependent resection of DNA ends in the absence of a functional MRX complex or Sae2. EMBO J, 29(19), 3358- 3369. doi:emboj2010193 [pii] 10.1038/emboj.2010.193 Mimitou, E. P., Yamada, S., & Keeney, S. (2017). A global view of meiotic double-strand break end resection. Science, 355(6320), 40-45. doi:10.1126/science.aak9704 Moreau, S., Ferguson, J. R., & Symington, L. S. (1999). The nuclease activity of Mre11 is required for meiosis but not for mating type switching, end joining, or telomere maintenance. Mol Cell Biol, 19(1), 556-566. doi:10.1128/mcb.19.1.556 Moshous, D., Callebaut, I., de Chasseval, R., Corneo, B., Cavazzana-Calvo, M., le Deist, F., . . . de Villartay, J. P. (2001). Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency. Cell, 105(2), 177-186. Retrieved from PM:11336668 Murina, O., von Aesch, C., Karakus, U., Ferretti, L. P., Bolck, H. A., Hanggi, K., & Sartori, A. A. (2014). FANCD2 and CtIP cooperate to repair DNA interstrand crosslinks. Cell Rep, 7(4), 1030-1038. doi:10.1016/j.celrep.2014.03.069 Nacht, M., Strasser, A., Chan, Y. R., Harris, A. W., Schlissel, M., Bronson, R. T., & Jacks, T. (1996). Mutations in the p53 and SCID genes cooperate in tumorigenesis. Genes Dev., 10(16), 2055-2066. Retrieved from PM:8769648 Nakamura, K., Kogame, T., Oshiumi, H., Shinohara, A., Sumitomo, Y., Agama, K., . . . Taniguchi, Y. (2010). Collaborative action of Brca1 and CtIP in elimination of covalent modifications from double-strand breaks to facilitate subsequent break repair. PLoS Genet, 6(1), e1000828. doi:10.1371/journal.pgen.1000828 Nowell, P. C., & Hungerford, D. A. (1960). Chromosome studies on normal and leukemic human leukocytes. J Natl Cancer Inst, 25, 85-109. Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/14427847 Nussenzweig, A., Chen, C., da, C. S. V., Sanchez, M., Sokol, K., Nussenzweig, M. C., & Li, G. C. (1996). Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature, 382(6591), 551-555. Retrieved from PM:8700231 Nussenzweig, A., & Nussenzweig, M. C. (2010). Origin of chromosomal translocations in lymphoid cancer. Cell, 141(1), 27-38. doi:S0092-8674(10)00289-8 [pii] 10.1016/j.cell.2010.03.016 Oh, J., & Symington, L. S. (2018). Role of the Mre11 Complex in Preserving Genome Integrity. Genes (Basel), 9(12). doi:10.3390/genes9120589 147 Oksenych, V., Alt, F. W., Kumar, V., Schwer, B., Wesemann, D. R., Hansen, E., . . . Guo, C. (2012). Functional redundancy between repair factor XLF and damage response mediator 53BP1 in V(D)J recombination and DNA repair. Proc Natl Acad Sci U S A, 109(7), 2455-2460. doi:1121458109 [pii] 10.1073/pnas.1121458109 Olivieri, M., Cho, T., Alvarez-Quilon, A., Li, K., Schellenberg, M. J., Zimmermann, M., . . . Durocher, D. (2020). A Genetic Map of the Response to DNA Damage in Human Cells. Cell, 182(2), 481-496 e421. doi:10.1016/j.cell.2020.05.040 Pan-Hammarstrom, Q., Lahdesmaki, A., Zhao, Y., Du, L., Zhao, Z., Wen, S., . . . Hammarstrom, L. (2006). Disparate roles of ATR and ATM in immunoglobulin class switch recombination and somatic hypermutation. J.Exp.Med., 203(1), 99-110. Retrieved from PM:16390936 Panchakshari, R. A., Zhang, X., Kumar, V., Du, Z., Wei, P. C., Kao, J., . . . Alt, F. W. (2018). DNA double-strand break response factors influence end-joining features of IgH class switch and general translocation junctions. Proc Natl Acad Sci U S A, 115(4), 762-767. doi:10.1073/pnas.1719988115 Pannicke, U., Ma, Y., Hopfner, K. P., Niewolik, D., Lieber, M. R., & Schwarz, K. (2004). Functional and biochemical dissection of the structure-specific nuclease ARTEMIS. EMBO J, 23(9), 1987-1997. doi:10.1038/sj.emboj.7600206 7600206 [pii] Pannunzio, N. R., Watanabe, G., & Lieber, M. R. (2018). Nonhomologous DNA end-joining for repair of DNA double-strand breaks. J Biol Chem, 293(27), 10512-10523. doi:10.1074/jbc.TM117.000374 Pelanda, R., Schwers, S., Sonoda, E., Torres, R. M., Nemazee, D., & Rajewsky, K. (1997). Receptor editing in a transgenic mouse model: site, efficiency, and role in B cell tolerance and antibody diversification. Immunity, 7(6), 765-775. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9430222 Peterson, S. E., Li, Y., Wu-Baer, F., Chait, B. T., Baer, R., Yan, H., . . . Gautier, J. (2012). Activation of DSB Processing Requires Phosphorylation of CtIP by ATR. Mol Cell. doi:S1097-2765(12)00977-X [pii] 10.1016/j.molcel.2012.11.020 Petroni, M., Sardina, F., Infante, P., Bartolazzi, A., Locatelli, E., Fabretti, F., . . . Giannini, G. (2018). MRE11 inhibition highlights a replication stress-dependent vulnerability of MYCN-driven tumors. Cell Death Dis, 9(9), 895. doi:10.1038/s41419-018-0924-z Polato, F., Callen, E., Wong, N., Faryabi, R., Bunting, S., Chen, H. T., . . . Nussenzweig, A. (2014). CtIP-mediated resection is essential for viability and can operate independently of BRCA1. J Exp Med, 211(6), 1027-1036. doi:10.1084/jem.20131939 148 Post, S. M., Quintas-Cardama, A., Terzian, T., Smith, C., Eischen, C. M., & Lozano, G. (2010). p53-dependent senescence delays Emu-myc-induced B-cell lymphomagenesis. Oncogene, 29(9), 1260-1269. doi:10.1038/onc.2009.423 Price, B. D., & D'Andrea, A. D. (2013). Chromatin remodeling at DNA double-strand breaks. Cell, 152(6), 1344-1354. doi:10.1016/j.cell.2013.02.011 Ramon-Maiques, S., Kuo, A. J., Carney, D., Matthews, A. G., Oettinger, M. A., Gozani, O., & Yang, W. (2007). The plant homeodomain finger of RAG2 recognizes histone H3 methylated at both lysine-4 and arginine-2. Proc Natl Acad Sci U S A, 104(48), 18993- 18998. doi:10.1073/pnas.0709170104 Reczek, C. R., Shakya, R., Miteva, Y., Szabolcs, M., Ludwig, T., & Baer, R. (2016). The DNA resection protein CtIP promotes mammary tumorigenesis. Oncotarget, 7(22), 32172- 32183. doi:10.18632/oncotarget.8605 Reczek, C. R., Szabolcs, M., Stark, J. M., Ludwig, T., & Baer, R. (2013). The interaction between CtIP and BRCA1 is not essential for resection-mediated DNA repair or tumor suppression. J Cell Biol, 201(5), 693-707. doi:10.1083/jcb.201302145 Reina-San-Martin, B., Chen, H. T., Nussenzweig, A., & Nussenzweig, M. C. (2004). ATM is required for efficient recombination between immunoglobulin switch regions. J.Exp.Med., 200(9), 1103-1110. Retrieved from PM:15520243 Reina-San-Martin, B., Difilippantonio, S., Hanitsch, L., Masilamani, R. F., Nussenzweig, A., & Nussenzweig, M. C. (2003). H2AX is required for recombination between immunoglobulin switch regions but not for intra-switch region recombination or somatic hypermutation. J.Exp.Med., 197(12), 1767-1778. Retrieved from PM:12810694 Riballo, E., Kuhne, M., Rief, N., Doherty, A., Smith, G. C., Recio, M. J., . . . Lobrich, M. (2004). A pathway of double-strand break rejoining dependent upon ATM, Artemis, and proteins locating to gamma-H2AX foci. Mol.Cell., 16(5), 715-724. Rickert, R. C., Roes, J., & Rajewsky, K. (1997). B lymphocyte-specific, Cre-mediated mutagenesis in mice. Nucleic Acids Res, 25(6), 1317-1318. doi:gka214 [pii] Roch, B., Abramowski, V., Chaumeil, J., & de Villartay, J. P. (2019). Cernunnos/Xlf Deficiency Results in Suboptimal V(D)J Recombination and Impaired Lymphoid Development in Mice. Front Immunol, 10, 443. doi:10.3389/fimmu.2019.00443 Roerink, S. F., van Schendel, R., & Tijsterman, M. (2014). Polymerase theta-mediated end joining of replication-associated DNA breaks in C. elegans. Genome Res, 24(6), 954- 962. doi:10.1101/gr.170431.113 Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., & Bonner, W. M. (1998). DNA double- stranded breaks induce histone H2AX phosphorylation on serine 139. J.Biol.Chem., 273(10), 5858-5868. Retrieved from PM:9488723 Rooney, S., Sekiguchi, J., Whitlow, S., Eckersdorff, M., Manis, J. P., Lee, C., . . . Alt, F. W. (2004a). Artemis and p53 cooperate to suppress oncogenic N-myc amplification in progenitor B cells. Proc.Natl.Acad.Sci.U.S.A, 101(8), 2410-2415. Retrieved from PM:14983023 149 Rooney, S., Sekiguchi, J., Whitlow, S., Eckersdorff, M., Manis, J. P., Lee, C., . . . Alt, F. W. (2004b). Artemis and p53 cooperate to suppress oncogenic N-myc amplification in progenitor B cells. Proc Natl Acad Sci U S A, 101(8), 2410-2415. doi:10.1073/pnas.0308757101 Rooney, S., Sekiguchi, J., Zhu, C., Cheng, H. L., Manis, J., Whitlow, S., . . . Alt, F. W. (2002). Leaky Scid phenotype associated with defective V(D)J coding end processing in Artemis-deficient mice. Mol.Cell, 10(6), 1379-1390. Retrieved from PM:12504013 Rybanska, I., Ishaq, O., Chou, J., Prakash, M., Bakhsheshian, J., Huso, D. L., & Franco, S. (2013). PARP1 and DNA-PKcs synergize to suppress p53 mutation and telomere fusions during T-lineage lymphomagenesis. Oncogene, 32(14), 1761-1771. doi:10.1038/onc.2012.199 Saldivar, J. C., Cortez, D., & Cimprich, K. A. (2017). The essential kinase ATR: ensuring faithful duplication of a challenging genome. Nat Rev Mol Cell Biol, 18(10), 622-636. doi:10.1038/nrm.2017.67 Sartori, A. A., Lukas, C., Coates, J., Mistrik, M., Fu, S., Bartek, J., . . . Jackson, S. P. (2007). Human CtIP promotes DNA end resection. Nature., 450(7169), 509-514. Savic, V., Yin, B., Maas, N. L., Bredemeyer, A. L., Carpenter, A. C., Helmink, B. A., . . . Bassing, C. H. (2009). Formation of dynamic gamma-H2AX domains along broken DNA strands is distinctly regulated by ATM and MDC1 and dependent upon H2AX densities in chromatin. Mol Cell, 34(3), 298-310. doi:S1097-2765(09)00241-X [pii] 10.1016/j.molcel.2009.04.012 Schaeper, U., Subramanian, T., Lim, L., Boyd, J. M., & Chinnadurai, G. (1998). Interaction between a cellular protein that binds to the C-terminal region of adenovirus E1A (CtBP) and a novel cellular protein is disrupted by E1A through a conserved PLDLS motif. J Biol Chem, 273(15), 8549-8552. Retrieved from http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation &list_uids=9535825 Schar, P., Herrmann, G., Daly, G., & Lindahl, T. (1997). A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52-independent repair of DNA double-strand breaks. Genes Dev, 11(15), 1912-1924. doi:10.1101/gad.11.15.1912 Schatz, D. G. (2004). Antigen receptor genes and the evolution of a recombinase. Semin.Immunol., 16(4), 245-256. Schatz, D. G., & Swanson, P. C. (2011). V(D)J recombination: mechanisms of initiation. Annu Rev Genet, 45, 167-202. doi:10.1146/annurev-genet-110410-132552 Sfeir, A., & Symington, L. S. (2015). Microhomology-Mediated End Joining: A Back-up Survival Mechanism or Dedicated Pathway? Trends Biochem Sci, 40(11), 701-714. doi:10.1016/j.tibs.2015.08.006 Shanbhag, N. M., Rafalska-Metcalf, I. U., Balane-Bolivar, C., Janicki, S. M., & Greenberg, R. A. (2010). ATM-dependent chromatin changes silence transcription in cis to DNA double- strand breaks. Cell, 141(6), 970-981. doi:10.1016/j.cell.2010.04.038 150 Shim, E. Y., Chung, W. H., Nicolette, M. L., Zhang, Y., Davis, M., Zhu, Z., . . . Lee, S. E. (2010). Saccharomyces cerevisiae Mre11/Rad50/Xrs2 and Ku proteins regulate association of Exo1 and Dna2 with DNA breaks. EMBO J, 29(19), 3370-3380. doi:10.1038/emboj.2010.219 Shiotani, B., & Zou, L. (2009). Single-stranded DNA orchestrates an ATM-to-ATR switch at DNA breaks. Mol Cell, 33(5), 547-558. doi:S1097-2765(09)00068-9 [pii] 10.1016/j.molcel.2009.01.024 Shoshani, O., Brunner, S. F., Yaeger, R., Ly, P., Nechemia-Arbely, Y., Kim, D. H., . . . Cleveland, D. W. (2020). Chromothripsis drives the evolution of gene amplification in cancer. Nature. doi:10.1038/s41586-020-03064-z Simsek, D., Brunet, E., Wong, S. Y., Katyal, S., Gao, Y., McKinnon, P. J., . . . Jasin, M. (2011). DNA ligase III promotes alternative nonhomologous end-joining during chromosomal translocation formation. PLoS Genet, 7(6), e1002080. doi:10.1371/journal.pgen.1002080 Simsek, D., Furda, A., Gao, Y., Artus, J., Brunet, E., Hadjantonakis, A. K., . . . Jasin, M. (2011). Crucial role for DNA ligase III in mitochondria but not in Xrcc1-dependent repair. Nature, 471(7337), 245-248. doi:nature09794 [pii] 10.1038/nature09794 Srinivasan, G., Williamson, E. A., Kong, K., Jaiswal, A. S., Huang, G., Kim, H. S., . . . Hromas, R. (2019). MiR223-3p promotes synthetic lethality in BRCA1-deficient cancers. Proc Natl Acad Sci U S A, 116(35), 17438-17443. doi:10.1073/pnas.1903150116 Starnes, L. M., Su, D., Pikkupeura, L. M., Weinert, B. T., Santos, M. A., Mund, A., . . . Daniel, J. A. (2016). A PTIP-PA1 subcomplex promotes transcription for IgH class switching independently from the associated MLL3/MLL4 methyltransferase complex. Genes Dev, 30(2), 149-163. doi:10.1101/gad.268797.115 Stewart, G. S., Wang, B., Bignell, C. R., Taylor, A. M., & Elledge, S. J. (2003). MDC1 is a mediator of the mammalian DNA damage checkpoint. Nature., 421(6926), 961-966. Stucki, M., Clapperton, J. A., Mohammad, D., Yaffe, M. B., Smerdon, S. J., & Jackson, S. P. (2005). MDC1 directly binds phosphorylated histone H2AX to regulate cellular responses to DNA double-strand breaks. Cell, 123(7), 1213-1226. Retrieved from PM:16377563 Syed, A., & Tainer, J. A. (2018). The MRE11-RAD50-NBS1 Complex Conducts the Orchestration of Damage Signaling and Outcomes to Stress in DNA Replication and Repair. Annu Rev Biochem, 87, 263-294. doi:10.1146/annurev-biochem-062917-012415 Symington, L. S., & Gautier, J. (2011). Double-strand break end resection and repair pathway choice. Annu Rev Genet, 45, 247-271. doi:10.1146/annurev-genet-110410-132435 Symington, L. S., Rothstein, R., & Lisby, M. (2014). Mechanisms and regulation of mitotic recombination in Saccharomyces cerevisiae. Genetics, 198(3), 795-835. doi:10.1534/genetics.114.166140 Taccioli, G. E., Amatucci, A. G., Beamish, H. J., Gell, D., Xiang, X. H., Torres Arzayus, M. I., . . . Herrera, V. L. (1998). Targeted disruption of the catalytic subunit of the DNA-PK gene in 151 mice confers severe combined immunodeficiency and radiosensitivity. Immunity., 9(3), 355-366. Retrieved from PM:9768755 Tanaka, H., & Watanabe, T. (2020). Mechanisms Underlying Recurrent Genomic Amplification in Human Cancers. Trends Cancer, 6(6), 462-477. doi:10.1016/j.trecan.2020.02.019 Tebbs, R. S., Flannery, M. L., Meneses, J. J., Hartmann, A., Tucker, J. D., Thompson, L. H., . . . Pedersen, R. A. (1999). Requirement for the Xrcc1 DNA base excision repair gene during early mouse development. Dev Biol, 208(2), 513-529. doi:10.1006/dbio.1999.9232 Teng, G., & Schatz, D. G. (2015). Regulation and Evolution of the RAG Recombinase. Adv Immunol, 128, 1-39. doi:10.1016/bs.ai.2015.07.002 Teo, S. H., & Jackson, S. P. (1997). Identification of Saccharomyces cerevisiae DNA ligase IV: involvement in DNA double-strand break repair. EMBO J, 16(15), 4788-4795. doi:10.1093/emboj/16.15.4788 Tonegawa, S. (1983). Somatic generation of antibody diversity. Nature, 302(5909), 575-581. doi:10.1038/302575a0 Tong, P., & Wesemann, D. R. (2015). Molecular Mechanisms of IgE Class Switch Recombination. Curr Top Microbiol Immunol, 388, 21-37. doi:10.1007/978-3-319-13725- 4_2 Trujillo, K. M., & Sung, P. (2001). DNA structure-specific nuclease activities in the Saccharomyces cerevisiae Rad50*Mre11 complex. J Biol Chem, 276(38), 35458-35464. doi:10.1074/jbc.M105482200 Vanasse, G. J., Halbrook, J., Thomas, S., Burgess, A., Hoekstra, M. F., Disteche, C. M., & Willerford, D. M. (1999). Genetic pathway to recurrent chromosome translocations in murine lymphoma involves V(D)J recombinase. J.Clin.Invest, 103(12), 1669-1675. Retrieved from PM:10377173 Villarreal, D. D., Lee, K., Deem, A., Shim, E. Y., Malkova, A., & Lee, S. E. (2012). Microhomology directs diverse DNA break repair pathways and chromosomal translocations. PLoS Genet, 8(11), e1003026. doi:10.1371/journal.pgen.1003026 Wang, H., Li, Y., Truong, L. N., Shi, L. Z., Hwang, P. Y., He, J., . . . Wu, X. (2014). CtIP maintains stability at common fragile sites and inverted repeats by end resection- independent endonuclease activity. Mol Cell, 54(6), 1012-1021. doi:10.1016/j.molcel.2014.04.012 Wang, H., Perrault, A. R., Takeda, Y., Qin, W., & Iliakis, G. (2003). Biochemical evidence for Ku-independent backup pathways of NHEJ. Nucleic Acids Res, 31(18), 5377-5388. Retrieved from http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation &list_uids=12954774 Wang, H., Rosidi, B., Perrault, R., Wang, M., Zhang, L., Windhofer, F., & Iliakis, G. (2005). DNA ligase III as a candidate component of backup pathways of nonhomologous end joining. Cancer Res, 65(10), 4020-4030. doi:10.1158/0008-5472.CAN-04-3055 152 Wang, H., Shao, Z., Shi, L. Z., Hwang, P. Y., Truong, L. N., Berns, M. W., . . . Wu, X. (2012). CtIP protein dimerization is critical for its recruitment to chromosomal DNA double- stranded breaks. J Biol Chem, 287(25), 21471-21480. doi:10.1074/jbc.M112.355354 Wang, H., Shi, L. Z., Wong, C. C., Han, X., Hwang, P. Y., Truong, L. N., . . . Wu, X. (2013). The interaction of CtIP and Nbs1 connects CDK and ATM to regulate HR-mediated double- strand break repair. PLoS Genet, 9(2), e1003277. doi:10.1371/journal.pgen.1003277 Wang, Q., Gu, L., Adey, A., Radlwimmer, B., Wang, W., Hovestadt, V., . . . Weichenhan, D. (2013). Tagmentation-based whole-genome bisulfite sequencing. Nat Protoc, 8(10), 2022-2032. doi:10.1038/nprot.2013.118 Wang, W., Daley, J. M., Kwon, Y., Krasner, D. S., & Sung, P. (2017). Plasticity of the Mre11- Rad50-Xrs2-Sae2 nuclease ensemble in the processing of DNA-bound obstacles. Genes Dev, 31(23-24), 2331-2336. doi:10.1101/gad.307900.117 Wang, X. S., Lee, B. J., & Zha, S. (2020). The recent advances in non-homologous end-joining through the lens of lymphocyte development. DNA Repair (Amst), 94, 102874. doi:10.1016/j.dnarep.2020.102874 Wang, X. S., Zhao, J., Wu-Baer, F., Shao, Z., Lee, B. J., Cupo, O. M., . . . Zha, S. (2020). CtIP- mediated DNA resection is dispensable for IgH class switch recombination by alternative end-joining. Proc Natl Acad Sci U S A, 117(41), 25700-25711. doi:10.1073/pnas.2010972117 Wang, Z. Q., Auer, B., Stingl, L., Berghammer, H., Haidacher, D., Schweiger, M., & Wagner, E. F. (1995). Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev, 9(5), 509-520. doi:10.1101/gad.9.5.509 Wesemann, D. R., Magee, J. M., Boboila, C., Calado, D. P., Gallagher, M. P., Portuguese, A. J., . . . Alt, F. W. (2011). Immature B cells preferentially switch to IgE with increased direct Smu to Sepsilon recombination. J Exp Med, 208(13), 2733-2746. doi:jem.20111155 [pii] 10.1084/jem.20111155 Wiest, N. E., Houghtaling, S., Sanchez, J. C., Tomkinson, A. E., & Osley, M. A. (2017). The SWI/SNF ATP-dependent nucleosome remodeler promotes resection initiation at a DNA double-strand break in yeast. Nucleic Acids Res, 45(10), 5887-5900. doi:10.1093/nar/gkx221 Williams, R. S., Dodson, G. E., Limbo, O., Yamada, Y., Williams, J. S., Guenther, G., . . . Tainer, J. A. (2009). Nbs1 flexibly tethers Ctp1 and Mre11-Rad50 to coordinate DNA double- strand break processing and repair. Cell, 139(1), 87-99. doi:10.1016/j.cell.2009.07.033 Wilson, T. E., Grawunder, U., & Lieber, M. R. (1997). Yeast DNA ligase IV mediates non- homologous DNA end joining. Nature, 388(6641), 495-498. doi:10.1038/41365 Wong, A. K., Ormonde, P. A., Pero, R., Chen, Y., Lian, L., Salada, G., . . . Bartel, P. L. (1998). Characterization of a carboxy-terminal BRCA1 interacting protein. Oncogene, 17(18), 2279-2285. doi:10.1038/sj.onc.1202150 153 Wood, C., & Tonegawa, S. (1983). Diversity and joining segments of mouse immunoglobulin heavy chain genes are closely linked and in the same orientation: implications for the joining mechanism. Proc Natl Acad Sci U S A, 80(10), 3030-3034. doi:10.1073/pnas.80.10.3030 Xu, G., Chapman, J. R., Brandsma, I., Yuan, J., Mistrik, M., Bouwman, P., . . . Rottenberg, S. (2015). REV7 counteracts DNA double-strand break resection and affects PARP inhibition. Nature, 521(7553), 541-544. doi:10.1038/nature14328 Yamamoto, K., Wang, Y., Jiang, W., Liu, X., Dubois, R. L., Lin, C. S., . . . Zha, S. (2012). Kinase-dead ATM protein causes genomic instability and early embryonic lethality in mice. J Cell Biol, 198(3), 305-313. Retrieved from http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation &list_uids=22869596 Yan, C. T., Boboila, C., Souza, E. K., Franco, S., Hickernell, T. R., Murphy, M., . . . Alt, F. W. (2007a). IgH class switching and translocations use a robust non-classical end-joining pathway. Nature., 449(7161), 478-482. Yan, C. T., Boboila, C., Souza, E. K., Franco, S., Hickernell, T. R., Murphy, M., . . . Alt, F. W. (2007b). IgH class switching and translocations use a robust non-classical end-joining pathway. Nature, 449(7161), 478-482. doi:10.1038/nature06020 Yu, A. M., & McVey, M. (2010). Synthesis-dependent microhomology-mediated end joining accounts for multiple types of repair junctions. Nucleic Acids Res, 38(17), 5706-5717. doi:10.1093/nar/gkq379 Yu, K., & Lieber, M. R. (2019). Current insights into the mechanism of mammalian immunoglobulin class switch recombination. Crit Rev Biochem Mol Biol, 54(4), 333-351. doi:10.1080/10409238.2019.1659227 Yu, T. Y., Kimble, M. T., & Symington, L. S. (2018). Sae2 antagonizes Rad9 accumulation at DNA double-strand breaks to attenuate checkpoint signaling and facilitate end resection. Proc Natl Acad Sci U S A, 115(51), E11961-E11969. doi:10.1073/pnas.1816539115 Yu, X., & Baer, R. (2000). Nuclear localization and cell cycle-specific expression of CtIP, a protein that associates with the BRCA1 tumor suppressor. J Biol Chem, 275(24), 18541- 18549. doi:10.1074/jbc.M909494199 M909494199 [pii] Yu, X., Fu, S., Lai, M., Baer, R., & Chen, J. (2006). BRCA1 ubiquitinates its phosphorylation- dependent binding partner CtIP. Genes Dev, 20(13), 1721-1726. doi:10.1101/gad.1431006 Yu, X., & Gabriel, A. (2003). Ku-dependent and Ku-independent end-joining pathways lead to chromosomal rearrangements during double-strand break repair in Saccharomyces cerevisiae. Genetics, 163(3), 843-856. Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/12663527 Yu, X., Wu, L. C., Bowcock, A. M., Aronheim, A., & Baer, R. (1998). The C-terminal (BRCT) domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway of 154 transcriptional repression. J Biol Chem, 273(39), 25388-25392. Retrieved from http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation &list_uids=9738006 Zahn, K. E., Averill, A. M., Aller, P., Wood, R. D., & Doublie, S. (2015). Human DNA polymerase theta grasps the primer terminus to mediate DNA repair. Nat Struct Mol Biol, 22(4), 304- 311. doi:10.1038/nsmb.2993 Zakharyevich, K., Ma, Y., Tang, S., Hwang, P. Y., Boiteux, S., & Hunter, N. (2010). Temporally and biochemically distinct activities of Exo1 during meiosis: double-strand break resection and resolution of double Holliday junctions. Mol Cell, 40(6), 1001-1015. doi:10.1016/j.molcel.2010.11.032 Zha, S., Bassing, C. H., Sanda, T., Brush, J. W., Patel, H., Goff, P. H., . . . Alt, F. W. (2010). ATM-deficient thymic lymphoma is associated with aberrant tcrd rearrangement and gene amplification. Journal of Experimental Medicine, 207(7), 1369-1380. doi:Doi 10.1084/Jem.20100285 Zha, S., Guo, C., Boboila, C., Oksenych, V., Cheng, H. L., Zhang, Y., . . . Alt, F. W. (2011). ATM damage response and XLF repair factor are functionally redundant in joining DNA breaks. Nature, 469(7329), 250-254. doi:nature09604 [pii] 10.1038/nature09604 Zha, S., Jiang, W., Fujiwara, Y., Patel, H., Goff, P. H., Brush, J. W., . . . Alt, F. W. (2011). Ataxia telangiectasia-mutated protein and DNA-dependent protein kinase have complementary V(D)J recombination functions. Proc Natl Acad Sci U S A, 108(5), 2028-2033. doi:1019293108 [pii] 10.1073/pnas.1019293108 Zhang, X., Zhang, Y., Ba, Z., Kyritsis, N., Casellas, R., & Alt, F. W. (2019). Fundamental roles of chromatin loop extrusion in antibody class switching. Nature, 575(7782), 385-389. doi:10.1038/s41586-019-1723-0 Zhang, Y., & Jasin, M. (2010). An essential role for CtIP in chromosomal translocation formation through an alternative end-joining pathway. Nat Struct Mol Biol, 18(1), 80-84. doi:nsmb.1940 [pii] 10.1038/nsmb.1940 Zhang, Y., Malone, J. H., Powell, S. K., Periwal, V., Spana, E., Macalpine, D. M., & Oliver, B. (2010). Expression in aneuploid Drosophila S2 cells. PLoS Biol, 8(2), e1000320. doi:10.1371/journal.pbio.1000320 Zhao, F., Kim, W., Kloeber, J. A., & Lou, Z. (2020). DNA end resection and its role in DNA replication and DSB repair choice in mammalian cells. Exp Mol Med, 52(10), 1705-1714. doi:10.1038/s12276-020-00519-1 Zhou, Y., & Paull, T. T. (2015). Direct measurement of single-stranded DNA intermediates in mammalian cells by quantitative polymerase chain reaction. Anal Biochem, 479, 48-50. doi:10.1016/j.ab.2015.03.025 155 Zhu, C., Bogue, M. A., Lim, D. S., Hasty, P., & Roth, D. B. (1996). Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell., 86(3), 379-389. Zhu, C., Mills, K. D., Ferguson, D. O., Lee, C., Manis, J., Fleming, J., . . . Alt, F. W. (2002). Unrepaired DNA breaks in p53-deficient cells lead to oncogenic gene amplification subsequent to translocations. Cell, 109(7), 811-821. Retrieved from PM:12110179 156