PDE4) Subtypes in Human Primary CD4+ T Cells: Predominant Role of PDE4D This Information Is Current As of September 26, 2021

Differential Expression and Function of Phosphodiesterase 4 (PDE4) Subtypes in Human Primary CD4+ T Cells: Predominant Role of PDE4D This information is current as of September 26, 2021. Daniel Peter, S. L. Catherine Jin, Marco Conti, Armin Hatzelmann and Christof Zitt J Immunol 2007; 178:4820-4831; ; doi: 10.4049/jimmunol.178.8.4820 http://www.jimmunol.org/content/178/8/4820 Downloaded from

References This article cites 53 articles, 24 of which you can access for free at:

http://www.jimmunol.org/content/178/8/4820.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Differential Expression and Function of Phosphodiesterase 4 :PDE4) Subtypes in Human Primary CD4؉ T Cells) Predominant Role of PDE4D1

Daniel Peter,* S. L. Catherine Jin,† Marco Conti,† Armin Hatzelmann,* and Christof Zitt2*

Type 4 phosphodiesterases (PDE4) are critical regulators in TCR signaling by attenuating the negative constraint of cAMP. In this study, we show that anti-CD3/CD28 stimulation of human primary CD4؉ T cells increases the expression of the PDE4 subtypes PDE4A, PDE4B, and PDE4D in a speciﬁc and time-dependent manner. PDE4A and PDE4D mRNAs as well as enzyme activities were up-regulated within 5 days, PDE4B showed a transient up-regulation with highest levels after 24 h. The induction was shown to be independent of different stimulation conditions and was similar in naive and memory T cell subpopulations. To elucidate the functional impact of individual PDE4 subtypes on T cell function, we used PDE4 subtype-speciﬁc short-interfering RNAs Downloaded from (siRNAs). Knockdown of either PDE4B or PDE4D inhibited IL-2 release 24 h after stimulation (time point of maximal IL-2 concentrations) to an extent similar to that observed with the panPDE4 inhibitor RP73401 (piclamilast). Substantial amounts of IFN-␥ or IL-5 were measured only at later time points. siRNA targeting PDE4D showed a predominant inhibitory effect on these cytokines measured after 72 h. However, the inhibition of all cytokines was most effective when PDE4 siRNAs were applied in combination. Although the effect of PDE4 inhibition on T cell proliferation is small, the PDE4D-targeting siRNA alone was as

effective as the panPDE4 inhibitor, whereas PDE4A or PDE4B siRNAs had hardly an effect. In summary, individual PDE4 http://www.jimmunol.org/ subtypes have overall nonredundant, but complementary, time-dependent roles in propagating various T cell functions and PDE4D is the form likely playing a predominant role. The Journal of Immunology, 2007, 178: 4820–4831.

he CD4ϩ Th cell plays a key role as a regulator of the mediated signaling must involve effective local cAMP hydrolyzing immune system. The major task of CD4ϩ T lymphocytes capacities. Cyclic nucleotide hydrolyzing phosphodiesterases T in initiating the adaptive immune response is the recog- (PDEs), which comprise a large superfamily of 11 families termed nition of Ags and the subsequent release of cytokines as mediators PDE1–PDE11 (13, 14), play a fundamental role in regulating T of immunity and inflammation (1, 2). However, various negative cell signaling. Several cAMP-hydrolizing PDEs have been found ϩ regulators of immunoreceptor signaling ensure that CD4 T cells in T cells and T cell lines, namely PDE1, PDE3, PDE4, PDE7, by guest on September 26, 2021 either maintain the quiescent state of unstimulated, mature T cells and PDE8, with PDE4 being the predominant family (15–18). The or limit and terminate the activating signal, and therefore restore PDE4 family comprehends four genes coding the subtypes the dormant state of T cells (3, 4). The second messenger cAMP PDE4A, PDE4B, PDE4C, and PDE4D. By the complex arrange- has been recognized as an important mediator of such inhibitory ment of transcriptional units and multiple promoters, Ͼ20 PDE4 signaling mechanisms by activation of the cAMP-protein kinase A isoforms (splice variants) have been described with unique N-ter- (PKA),3 with PKA functioning as a gatekeeper of tonic inhibition minal properties, enabling complex regulation mechanisms and in- in T cells (5–10). tracellular compartmentalization. Based on sequence similarities, Paradoxically, stimulation of the TCR initially elevates intra- all four PDE4 subtypes show a related structural organization with cellular cAMP levels (11, 12). As a consequence, to abolish the a highly conserved catalytic domain in the C-terminal region and inhibitory tone of cAMP and for T cell activation to occur, AgR- the so-called “upstream-conserved regions” in the N-terminal por- tion of the protein. Splice variants from all PDE4 subtypes are categorized in either PDE4 long or short forms depending on the *Department of Biochemistry, Altana Pharma, Konstanz, Germany; and †Division of Reproductive Biology, Department of Obstetrics and Gynecology, Stanford Univer- length of the N-terminal part with the existence of either two or sity School of Medicine, Stanford, CA 94305 just one upstream-conserved region, respectively (19, 20). Received for publication September 25, 2006. Accepted for publication January Over the past years, the development of PDE4 inhibitors as anti- 29, 2007. inflammatory and immunomodulatory drugs has been a major fo- The costs of publication of this article were defrayed in part by the payment of page cus of pharmaceutical research for the treatment of asthma and charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. other chronic inflammatory diseases (21, 22). By increasing intra- 1 D.P. is a member of the research training group Graduiertenkolleg 702 and was cellular cAMP levels, PDE4 inhibitors have been shown to broadly supported by the Deutsche Forschungsgemeinschaft. Work done in the laboratory of target inflammatory and immunocompetent cells and are also ca- M.C. was supported by National Institutes of Health HD205788 and HL67674. pable to inhibit T cell functions like cytokine release and prolif- 2 Address correspondence and reprint requests to Dr. Christof Zitt, Department of eration (23, 24). Current PDE4 inhibitors do not discriminate be- Biochemistry (RPR/B2), Altana Pharma, 78467 Konstanz, Germany. E-mail address: [email protected] tween distinct PDE4 subtypes. However, evidence derived from 3 Abbreviations used in this paper: PKA, protein kinase A; PDE, phosphodiesterase; PDE4 knockout mice demonstrates that PDE4 subtypes are non- PDE4, type 4 PDE; siRNA, small-interfering RNA; NF, nucleofection; Ct, cycle redundant, indicating that distinct PDE4 subtypes have distinct threshold; 7-AAD, 7-aminoactinomycin D; MGB, minor groove binder. functional roles in inflammatory and immunocompetent cells, such Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 as macrophages, smooth muscle cells, and neutrophils (25–28). www.jimmunol.org The Journal of Immunology 4821

In T cells, the impact of PDE4 subtypes on T cell function is still tailed elsewhere (33). Mouse monoclonal anti-␤-actin Abs were purchased unclear. PDE4B2 has been found to be associated with the CD3␧ from Sigma-Aldrich. siRNAs were from Dharmacon (Lafayette): chain of the human TCR complex (29) and overexpression of PDE4A_si (D-007647-04, GUAACAGCCUGAACAACUC), PDE4B_si (D-007648-04, GAAAGAGACCUCCUAAAGA), PDE4D_si (D-004757- PDE4B2 in Jurkat cells localizes to the immunological synapse 06, GAACUUGCCUUGAUGUACA), PDE4D_si-2 (D-004757-05, GAAA upon activation, correlating with an increase in IL-2 production UCAAGUGUCAGAGUU). As control, nontargeting NEG_si (more than (30). In a recent study, Tasken and coworkers (31) reported that four mismatches to every known human gene, D-001210-01) was used. TCR and CD28 stimulation in human peripheral T cells recruits Isolation and cytometrical analysis of primary CD4ϩ T cells PDE4A4, PDE4B2, PDE4D1, and PDE4D2 in complex with ␤-ar- Research conducted for this study with human material has been approved restin to lipid rafts, pointing to a potential role of individual PDE4 ϩ by the local ethics committee. For the isolation of human peripheral CD4 isoforms in opposing the TCR-induced production of cAMP. How- T cells by negative selection, 250 ml of blood from normal, healthy donors ever, the precise expression pattern of PDE4 subtypes and their were taken by antecubital venipuncture, 0.3% (w/v) citrate-treated, and functional consequences for T cell responses remain speculative. diluted 1.6-fold with PBS before centrifugation at room temperature for 10 In the present study, we investigated the expression profiles of min at 220 ϫ g. The lower phase was layered on a Percoll gradient (density 1.077 g/ml) and subject for centrifugation for 25 min at 800 ϫ g. The PDE4 subtypes in anti-CD3/CD28-stimulated human primary ϩ interphase containing the PBMC was washed twice in PBS containing 2 CD4 T cells. To ascertain the functional role of PDE4 subtypes mM EDTA and was then resuspended on ice in PBS, 0.5% (v/v) heat- in these cells, we applied a small-interfering RNA (siRNA)-me- inactivated FCS, 2 mM EDTA and prepared for magnetical separation diated, PDE4 subtype-specific knockdown strategy. We reveal that using the autoMACS system (Miltenyi Biotec), as described by the manufacturer (CD4ϩ T Cell Isolation kit II, Program Deplete; Miltenyi Biotec). the subtypes PDE4A, PDE4B, PDE4C, and PDE4D exhibit dis- ϩ ϩ ϩ For the isolation of naive (CD45RA ) and memory (CD45RO ) T cells, tinct expression levels in CD4 T cells and that upon anti-CD3/ CD4ϩ T cells of one donor were separated into two parts, and each part was Downloaded from CD28 stimulation the subtypes are differently regulated, with labeled with anti-CD45RA or anti-CD45RO microbeads (Miltenyi Biotec), PDE4 short forms accounting for an up-regulation in a time-de- respectively, for magnetic separation. pendent manner. We demonstrate that a siRNA-based electropo- For flow cytometrical analysis (Coulter Epics XL-MCL; Beckman Coulter), 2–5 ϫ 105 cells in 100 ␮l of staining buffer (PBS, 2% (v/v) ration technique is a reliable tool to generate PDE4 subtype-spe- ϩ heat-inactivated FCS) were labeled with Abs directed against surface cific mRNA and protein knockdown in human primary CD4 T markers CD4 and CD25 (Immunotech). Surface marker-specific Abs were

cells. Finally, we provide evidence that PDE4 subtypes have an used in combination with their respective isotype controls. The dye 7-ami- http://www.jimmunol.org/ overall nonredundant, but complementary role in propagating var- noactinomycin D (7-AAD) was used to check for viability (Immunotech). ious T cell functions upon TCR stimulation, such as cytokine re- Transfection and stimulation of CD4ϩ T cells lease (IL-2, IFN-␥, IL-5) and proliferation. We suggest that Transfection of human peripheral, freshly isolated CD4ϩ T cells (5 ϫ 106 PDE4B and PDE4D might be involved in regulating “short-term” cells/transfection) was conducted using the nucleofector kit for unstimu- TCR signals, such as IL-2 release, and that PDE4D plays a pre- lated human T cells according to the instructions of the manufacturer dominant role in propagating “long-term” TCR signals, such as (nucleofector device I, program U-14; Amaxa) (34). At standard condi- IFN-␥ release, IL-5 release, and proliferation. tions, ﬁnal siRNA concentrations were 1.5 ␮M in a total volume of 100 ␮l. Immediately after nucleofection (NF), cells were recovered with 2.5 ml of

Materials and Methods prewarmed complemented medium (RPMI 1640 medium, 10% (v/v) heat- by guest on September 26, 2021 inactivated FCS, 1% (v/v) L-glutamine, 100 U/ml penicillin, and 0.1 mg/ml Reagents, inhibitors, primer/probe sets, Abs, and siRNA streptomycin), transferred to 6-well plates (Corning Costar), and incubated Percoll, Sepharose A, and G, 5,8-[3H]cAMP, and [3H]thymidine were ob- in a humidified incubator at 37°C/5% CO2. For control experiments, ϭ tained from Amersham Biosciences (GE Healthcare). 4-(2-Aminoethyl)- nucleofection was performed without siRNA ( NF control) or with non- ϭ benzenesulfonyl fluoride and complete mini protease inhibitor (EDTA- targeting siRNA ( NEG_si). After 24 h of culturing, transfected cells free) were from Roche. Medium and solutions used for culturing of CD4ϩ were checked for viability by flow cytometry and diluted to a concentration ϫ 6 T cells were purchased from Invitrogen Life Technologies. All other chemicals of 1 10 cells/ml. To test the nucleofection efficiency, different concen- not specifically mentioned were of analytical grade and were obtained from trations of FITC-labeled nontargeting siRNA (BLOCK-iT Fluorescent Oligo, Sequitur; Invitrogen Life Technologies) were transfected. Sigma-Aldrich. The PDE4 inhibitor RP73401 (piclamilast, WO9212961) was ϩ synthesized at the chemical facilities of Altana Pharma. The PDE4 inhibitor For functional analysis, CD4 T cells were stimulated via the CD3 rolipram was purchased from Sigma-Aldrich. chain of the TCR and the costimulatory molecule CD28, similar to a pro- Forward/reverse primer and probe sets and TaqMan universal PCR mas- tocol described elsewhere (24). To coat 96-well microtiter plates (Microtest ter mix for quantitative PCR were purchased from Applied Biosystems. tissue culture plate, Falcon; BD Biosciences) with anti-CD3 mAbs, the ␮ The designed primer and probe sets were as follows: 18S rRNA plates were incubated for 2.5 h at 37°C/5% CO2 with 50 lofa6or60 ␮ ␮ (X03205) forward, CGGCTACCACATCCAAGGAA, reverse, GCT g/ml solution of anti-CD3 in PBS, corresponding to 0.3 or 3 g anti- ϫ 5 GGAATTACCGCGGCT, probe VIC-TGCTGGCACCAGACTTGCCC CD3/well, respectively. A total of 2 10 cells in a total volume of 200 ␮ TC; PDE4A (NM_006202) forward, GTGGCTCCGGATGAGTTCTC, l was used per well. For costimulation, soluble anti-CD28 mAb in a ␮ reverse, GGGCTGCTGTGGCTTACAG, probe FAM-CCGGGAGGAA volume of 10 l was added to each well to obtain final concentrations of ϳ ϳ ␮ TTCGTGGT-minor groove binder (MGB); PDE4B (NM_002600) 0.3 or 3 g of anti-CD28/ml, respectively. forward, AGCAGCACAAAGACGCTTTGT, reverse, TCAGTCTCTC Optionally, the PDE4 inhibitor RP73401 (piclamilast) was included at a ␮ CCAGGGAATCTC, probe FAM-TGATTGATCCAGAAAAC-MGB; final concentration of 1 M. Stock solutions of RP73401 in DMSO were PDE4C (NM_000923) forward, ACTCTGGAGGAGGCAGAGGAA, diluted 1/1000 (v/v) to result in a final DMSO concentration of 0.1% (v/v) reverse, AGGCAACTCCAAGGCCTCTT, probe FAM-AAGAGACAG in the assay. Cells were incubated at 37°C/5% CO2, for several time pe- CTTTAGCC-MGB; PDE4D (NM_006203) forward, GGCAGGGTCA riods, as indicated. Every condition was performed at least in duplicates. AACTGAGAAATT, reverse TGACTGCCACTGTCCTTTTCC, probe RNA isolation, cDNA synthesis, and quantitative PCR FAM-TAGAGGAAGATGGTGAGTCAG-MGB. The PDE4 subtype primer/probe sets have been designed to bind at the 3Ј end of the open A total of 0.1–1 ϫ 107 CD4ϩ T cells were washed in PBS, lysed with 350 reading frame of each subtype, at positions where individual splice variants ␮l of RNA lyses tissue buffer containing 1% 2-ME, and homogenized with of one subtype are identical. QIAshredder spin columns (Qiagen). Total RNA was isolated using For the stimulation of human primary CD4ϩ T cells, anti-CD3 mAb RNeasy mini columns according to the instructions of the manufacturer (Orthoclone OKT-3; Janssen-Cilag) and anti-CD28 mAb (clone CD28.2; (Qiagen). RNA concentration was determined by spectrophotometric analysis Immunotech) were used. The rabbit polyclonal Abs AC55 (anti-PDE4A) using a SpectraMax 190 (Molecular Devices) or a NanoDrop ND-1000. The and K118 (anti-PDE4B) as well as the murine mAb m3S1 (anti-PDE4D), average yield was determined to be ϳ0.8 ␮g of total RNA per 1 ϫ 106 un- all applied for immunoprecipitations, were used as described (32). Purified stimulated human primary CD4ϩ T cells. Reverse transcription was performed mouse myeloma IgG1 as isotype control was purchased from Zymed (In- with 0.5–1 ␮g of RNA using AMV reverse transcriptase (Roche). vitrogen Life Technologies). For immunoblotting experiments, rabbit poly- Quantitative PCR were performed on an ABI Prism 7900 HT sequence clonal Abs raised against PDE4A, PDE4B, and PDE4D were used as de- detection system (Applied Biosystems). Primer and probe sets have been 4822 ROLE OF PDE4s IN HUMAN CD4ϩ T CELLS tested for specificity and were optimized to have similar maximal ampli- blood donors and the comparable narrow linear range of the ELISA stan- fication efficiencies (95 Ϯ 3%, data not shown) in duplex reactions (i.e., dard curve, appropriate dilution factors have been determined before the combined detection of 18S rRNA and a target gene). Standard quantitative analysis. Dilutions were performed in the buffers equipped in the assay kits. PCR were performed in a total volume of 25 ␮l in triplicates, each con- All cytokines were determined from the pool fraction in duplicate in ac- taining 10 ng of cDNA as template, 50 nM of primer and probe detecting cordance with the manufacturer’s instructions (Immunotech). 18S rRNA, and 900 nM/200 nM primer/probe detecting the target gene in The incorporation of [3H]thymidine was taken as a parameter to deter- 1ϫ TaqMan universal PCR master mix (Applied Biosystems). The thermal mine CD4ϩ T cell proliferation. After 48 h of stimulation, 10 ␮lof cycler protocol consisted of a 2-min period at 50°C (uracil removal for [3H]thymidine (0.2 ␮Ci/well) were added to the cells in duplicates for a PCR carryover protection), a 10-min period at 95°C (denaturation of native period of 18 h until cell transfer and radioactivity measurement, as detailed DNA), and of 40 cycles of 15 s at 95°C (denaturation of PCR product) and elsewhere (24). 1 min at 60°C (annealing/extension). As controls for DNA contamination, total RNA and water were taken as templates. For control experiments, Data analysis and software plasmids were used containing conserved C-terminal parts of the subtypes Averages are presented as mean Ϯ SD. For statistical analysis, ANOVA PDE4A, PDE4B, PDE4C, and PDE4D. Quantification of PCR experiments ⌬⌬ (ANOVA, GraphPad Prism 4.0; GraphPad Software) was used. Densito- was based on the comparative cycle threshold (Ct) method as described metric analysis of immunoblots was performed with the Advanced Image elsewhere (35) using either unstimulated cells or nucleofection control Data Analyzer (AIDA 3.22; Raytest). The primer and probe sets for quan- cells as calibrator. titative PCR analysis were designed using Primer Express 2.0 (Applied Immunoprecipitation and PDE activity measurement Biosystems). Cells were washed in PBS and resuspended in lysis buffer (50 mM Tris- Results HCl (pH 7.4), 10 mM sodium fluoride, 1 mM EDTA, 0.2 mM EGTA, 10 Primary CD4ϩ T cells isolated from human whole blood by neg- mM sodium pyrophosphate, 250 mM sodium chloride, 5% glycerol, 1 mM 4-[2-aminoethyl]-benzenesulfonyl fluoride, 1 tablet/10 ml complete pro- ative selection using magnetic bead cell separation were used in all Downloaded from ϩ tease inhibitor, 1 mM sodium orthovanadate, 1% Nonidet P-40 (Calbio- experiments. With this approach, we obtained CD4 cells of 94– chem), and 15 mM 2-ME). After sonication, the lysate was centrifuged at 99% purity as measured by flow cytometry analysis (data not ϫ 4°C for 20 min at 16,000 g. The protein concentration in the supernatant shown). To mimic the physiological conditions of T cell activa- was determined using Bio-Rad protein assay dye reagent concentrate according to the instructions of the manufacturer (Bio-Rad). Immunoprecipi- tion, we stimulated the cells via the TCR (by plate-bound anti-CD3 tation and subsequent activity assays for the determination of both total Abs) and the CD28 coreceptor (by soluble anti-CD28 Abs).

PDE activity and PDE4 inhibitor-insensitive PDE activity (in the presence http://www.jimmunol.org/ of 10 ␮M rolipram) were conducted in accordance with a method described PDE4 subtypes have distinct mRNA expression patterns in ϩ earlier (28). Alternatively, cells were resuspended in homogenization CD4 T cells and are differentially up-regulated upon buffer (20 mM Tris-HCl (pH 7.6), 140 mM sodium chloride, 3.8 mM anti-CD3/CD28 stimulation potassium chloride, 1 mM EGTA, 1 mM magnesium chloride, 0.5 mM 4-[2-aminoethyl]-benzenesulfonyl fluoride, 10 ␮M leupeptin, 2 mM ben- For quantitative RT-PCR experiments, we designed primer/probe zamidine, 10 ␮M pepstatin A, 5 ␮M trypsin inhibitor, 1 mM 2-ME). After sets specific for each of the four PDE4 subtypes. To monitor the sonication, the lysate was centrifuged at 4°C for 20 min at 1000 ϫ g. Total amount of template in different reactions, we used 18S rRNA as PDE and PDE4 inhibitor-insensitive PDE activity (in the presence of 1 ␮M piclamilast) were assayed as described previously (24). Briefly, 5–20 ␮gof internal standard, which we had shown not to be differentially protein were diluted in 20 mM Tris-HCl (pH 7.8) to a final volume of 150 expressed upon T cell stimulation (data not shown). In validation ␮l, either including 0.1% DMSO or PDE4 inhibitor. After preincubation at experiments, we tested the primer/probe sets for the PDE4 sub- by guest on September 26, 2021 37°C for 5 min, assay mixture (final 20 mM Tris-HCl (pH 7.8), 5 mM types in combination with the primer/probe set detecting 18S rRNA magnesium chloride, 0.5 ␮M cAMP, 100 ␮M EGTA, and ϳ30,000 cpm/ 3 (duplex PCR). Because all PDE4 subtype primer/probe sets assay [ H]cAMP) was added and the samples were incubated at a final Ϯ volume of 200 ␮l at 37°C for 20 min. The reaction was stopped with 0.2 showed similar maximal efficiencies in standardized PCR (95 N HCl (4°C) on ice. Following incubation at 37°C for 15 min with 25 ␮g 3%, data not shown), we concluded that PDE4 expression patterns of 5Ј-nucleotidase (Crotalus atrox snake venom; Sigma-Aldrich), the as- could also be directly compared. In unstimulated CD4ϩ cells, we says were loaded on Poly-Prep chromatography columns (Bio-Rad) filled detected mRNA expression of the PDE4 subtypes PDE4A, with 1 ml of QAE Sephadex A-25 (Sigma-Aldrich). [3H]Adenosine was eluted with 2 ml of 30 mM ammonium formiate (pH 6.0), mixed with 3 ml PDE4B, and PDE4D. Although the PDE4C primer/probe set is of scintillation fluid (Lumasafe Plus; Lumac), and measured for total ra- functional in control experiments, we never detected expression of ϩ dioactivity in a scintillation counter (Beckman Coulter). Results were cor- PDE4C in CD4 cells, regardless of whether the cells were stim- rected for blank values (measured in the presence of denatured protein) and ulated or not. The highest mRNA expression level was found for the PDE4 activity was calculated as the difference of total PDE activity and PDE4D (ϳ12-fold higher than PDE4A) followed by PDE4B (ϳ8- PDE4 inhibitor-insensitive PDE activity. In all PDE assays, the amount of cAMP hydrolyzed was below 25% of the original substrate concentration. fold higher than PDE4A) and PDE4A (set to 1 as reference) (Fig. 1A). We then investigated whether the PDE4 subtypes are differ- Detection of PDE4 subtypes by immunoblotting entially expressed upon stimulation. Therefore, cells were stimu- Cells were washed in PBS and resuspended in lysis buffer (150 mM sodium lated with anti-CD3/CD28 for different periods of time. For each chloride, 5 mM EDTA, 50 mM Tris-HCl (pH 7.4), 0.1% sodium azide, gene, the expression in unstimulated cells (time point 0 h) was 0.5% Triton X-100, 0.5 mM 4-[2-aminoethyl]-benzenesulfonyl fluoride, 10 ␮ ␮ ␮ used as reference point. Upon stimulation, PDE4A mRNA was M leupeptin, 2 mM benzamidine, 10 M pepstatin A, 5 M trypsin ϳ inhibitor) at ϳ1.5 ϫ 107 cells per 100 ␮l of lysis buffer. Protein determi- steadily up-regulated and had a 15-fold higher expression after nation, SDS-PAGE, and immunodetection of PDE4 subtypes were per- 120 h (Fig. 1B). PDE4B mRNA was up-regulated ϳ2-fold within formed as detailed elsewhere (33). Modifications were the use of 50 ␮gof the first 16 h, returned to basal level after 48 h, and further de- protein per lane, the transfer to nitrocellulose membranes, a semidry blot- creased at later times, indicating a transient up-regulation of this ting technique (Bio-Rad), and the immunodetection with ECL advance Western blotting detection reagent (Amersham Biosciences). Detection of subtype (Fig. 1C). PDE4D mRNA expression slightly decreased ␤-actin was used as loading control. within the first 24 h after stimulation, but was then steadily up- regulated and reached a ϳ4-fold higher expression after 120 h, Functional analysis of CD4ϩ T cells indicating a long-term up-regulation of this subtype (Fig. 1D). As parameter for T cell function after anti-CD3/CD28-induced stimulation, To obtain an overall picture of the PDE4 subtype expression cytokine concentrations of IL-2, IFN-␥, and IL-5 in the culture medium after T cell stimulation, we combined the different expression lev- were measured. Supernatants were removed after 24 or 72 h, pooled, and stored at Ϫ80°C until specific commercially available enzyme-linked im- els (Fig. 1A) with the time courses of each individual subtype (Fig. munosorbent assays (IL-2, IFN-␥, and IL-5 assay kits; Immunotech) were 1, B–D), using the expression level of PDE4A mRNA in unstimu- performed. Due to the high variability of cytokine levels from different lated cells as reference for all other data points (Fig. 2A). Due to The Journal of Immunology 4823 Downloaded from FIGURE 1. PDE4A, PDE4B, and PDE4D mRNA expression in untreated and anti-CD3/CD28 stimulated human primary CD4ϩ T lymphocytes. Cells were separated from whole blood as described in Materials and Methods and were subject for total RNA isolation and cDNA transcription. FIGURE 2. Time-dependent mRNA expression profiles of PDE4 sub- Quantitative PCR was performed using ribosomal 18S rRNA as internal types in CD4ϩ T cells by different anti-CD3/CD28 stimulation. The quan- standard (detected after 10–13 cycles) and specific primer/probe sets for titative mRNA expression levels of PDE4A, PDE4B, and PDE4D in un- ⌬ PDE4A, PDE4B, PDE4C, and PDE4D. By comparing Ct values, the treated cells (shown in Fig. 1A) were combined with the respective time http://www.jimmunol.org/ expression level of individual PDE4 subtypes was reported relative to courses (shown in Fig. 1, B–D). All data were expressed relative to the ⌬ ϳ PDE4A, which was detected after 27–30 cycles ( Ct 17) (A). After stim- PDE4A expression level in untreated cells (t ϭ 0 h). Thereby, the complete ulation with 3 ␮g anti-CD3/well and 3 ␮g anti-CD28/ml, time-dependent quantitative mRNA expression pattern of the PDE4 subtypes was obtained mRNA expression for PDE4A (B), PDE4B (C), and PDE4D (D) was mea- for cells stimulated with 3 ␮g anti-CD3/well and 3 ␮g anti-CD28/ml (A). sured relative to untreated conditions (t ϭ 0 h). PDE4C transcripts were not The same sets of experiments were performed with cells stimulated with detected after 40 cycles. Results are expressed as mean Ϯ SD of four 0.3 ␮g of anti-CD3/well and 0.3 ␮g of anti-CD28/ml (B), with 3 ␮gof p Ͻ 0.01; anti-CD3/well alone (C), and with 0.3 ␮g anti-CD3/well alone (D). Results ,ءء ;p Ͻ 0.05 ,ء :donors. Significance of differences is indicated B–D, compared with untreated cells (t ϭ 0 h). in A are expressed as mean Ϯ SD of four donors. Results in B–D are the average of two donors. the considerably high PDE4B mRNA levels in untreated CD4ϩ T by guest on September 26, 2021 cells, the ϳ2-fold up-regulation after 16 h stimulation lead to the ϩ predominant expression of this subtype at 16 and 24 h. From 48 h whether different subpopulations of CD4 cells may regulate the onward, the induction of PDE4D and the decrease of PDE4B re- PDE4 subtype expression specifically. Therefore, we studied the ϩ sulted in PDE4D being the predominant subtype. PDE4A mRNA expression patterns separately in naive CD4 T cells characterized ϩ displayed the lowest expression level up to 48 h after stimulation. by the surface marker CD45RA and in memory CD4 T cells Due to the steady up-regulation of this subtype and the down- expressing the marker CD45RO (36). Due to the isolation strategy ϩ ϩ regulation of PDE4B at later time points, the expression level of (see Material and Methods), we obtained CD45RA CD4 T cells ϩ ϩ PDE4A exceeded that of PDE4B at 120 h but still did not reach the (Ͼ95% pure) and CD45RO CD4 T cells (Ͼ98% pure), whereas high expression level of PDE4D. cells coexpressing CD4, CD45RA, and CD45RO were sorted out. In unstimulated naive CD4ϩ T cells, we found slightly lower lev- The induction of PDE4 subtypes upon stimulation is independent els of PDE4A, PDE4B, and PDE4D transcripts compared with of the anti-CD3-CD28 ratio unstimulated memory CD4ϩ T cells (Fig. 3, A–C). After anti-CD3/ ϩ To examine whether the distinct regulation of individual PDE4 CD28 stimulation, memory CD4 T cells showed a slightly faster mRNA levels is dependent on the anti-CD3:anti-CD28 ratio and up-regulation of PDE4A (Fig. 3A) and PDE4D (Fig. 3C), as well subsequently on the costimulatory anti-CD28 stimulus, we acti- as a more pronounced transient up-regulation of PDE4B (Fig. 3B) ϩ vated CD4ϩ T cells with 0.3 ␮g of anti-CD3/well in combination compared with naive CD4 T cells. However, these differences in with 0.3 ␮g of anti-CD28/ml (Fig. 2B), with 3 ␮g of anti-CD3/well the regulation of individual PDE4 subtypes between naive and ϩ alone (Fig. 2C), or with 0.3 ␮g of anti-CD3/well alone (Fig. 2D). memory CD4 T cells were not statistically significant. Because All conditions resulted in similar time-dependent expression pat- the expression profiles of PDE4 subtypes both in naive and mem- ϩ terns as were found for the strong stimulation with 3 ␮g of anti- ory CD4 T cells were found to be very similar, all following ϩ CD3/well plus 3 ␮g of anti-CD28/ml shown in Fig. 2A, hereby experiments were performed with CD4 cells that were not further confirming the long-term induction of PDE4A and PDE4D and the separated. transient up-regulation of PDE4B. For all additional experiments related to PDE4 subtype expression, either on mRNA, enzyme PDE4 subtype activity resembles mRNA expression pattern activity, or protein level, we used this latter stimulation condition. Changes in mRNA levels do not necessarily result in changes of the respective protein levels. Therefore, we investigated whether the in- PDE4 subtypes are similarly regulated both in naive and ϩ duction of PDE4 subtypes observed in quantitative PCR experiments memory CD4 T cells translates in an increase in PDE4 enzyme activity. Upon stimulation, Because CD4ϩ T cells isolated from human whole blood still rep- total cAMP-hydrolizing PDE activity (mean Ϯ SD ϭ 37 Ϯ 16 pmol/ resent a rather heterogeneous population of cells, we investigated min/mg in resting cells) was augmented in a time-dependent manner 4824 ROLE OF PDE4s IN HUMAN CD4ϩ T CELLS

creased 24 h after stimulation and recovered to baseline levels during the time period studied. To ascertain which PDE4 subtypes contribute to this up-regulation, an immunoprecipitation strategy was applied with Abs specific for PDE4A, PDE4B, and PDE4D. After precipitation, the samples were assayed for PDE4 cAMP hydrolyzing activity. In unstimulated CD4ϩ T cells (time point0hinFig. 4B), the highest activity was measured in samples precipitated with the PDE4D- specific Ab. Whereas PDE4B activity was somewhat lower than PDE4D activity, PDE4A contributed least to the total PDE4 activity. However, after anti-CD3/CD28 stimulation, PDE4A activity was greatly induced starting at 72 h and reached a 4-fold higher activity at the end of the time period examined (Fig. 4B). PDE4B activity was transiently up-regulated, peaking with a 3.4-fold higher activity at 24 h followed by a decrease. After 120 h, PDE4B activity was similar to the level observed in untreated cells. At this FIGURE 3. mRNA expression profiles of PDE4 subtypes in CD45RAϩ ϩ ϩ time point, PDE4A activity exceeded the PDE4B activity. Com- (naive) and CD45RO (memory) human primary CD4 T lymphocytes. pared with untreated cells, PDE4D activity remained relatively CD4ϩ cells were further purified by negative selection using either anti- constant during the first 48 h after stimulation, and increased at 72 Downloaded from CD45RA or anti-CD45RO microbeads. Cells were stimulated with 3 ␮gof and 120 h after stimulation totaling in a 1.5-fold up-regulation. anti-CD3/well and 3 ␮g of anti-CD28/ml for different periods of time. Subsequent experiments were performed as outlined in the legend of Fig. Taken together, the pattern of PDE4 subtype-specific enzyme ac- 1. Expression profiles of PDE4A (A), PDE4B (B), and PDE4D (C) from tivities qualitatively closely resembled the mRNA expression both T cell subpopulations are shown. Results are expressed relative to profile. untreated conditions in naive T cells (t ϭ 0 h), as mean Ϯ SD of four The up-regulation of short PDE4 splice variants may account donors. Differences between naive and memory cells were statistically not http://www.jimmunol.org/ significant. for the induction of PDE4 activity To elucidate which splice variants are expressed in untreated CD4ϩ T cells and may account for the measured changes in (Fig. 4A), resulting in a significantly higher activity 72 and 120 h after mRNA levels and protein activities after stimulation, we used Abs stimulation. This increase was mainly due to an increase in PDE4 recognizing the conserved C termini of the PDE4 subtypes to per- activity, whereas PDE4-independent enzyme activity initially de- form immunoblotting experiments (Fig. 5, A and B). In unstimulated T cells, a polyclonal Ab directed against PDE4A detected immunoreactivity at ϳ130 kDa and with a very low density below 100 kDa, which can be attributed to long (PDE4A4, PDE4A10, by guest on September 26, 2021 and/or PDE4A11) and short (PDE4A1) PDE4A forms, respectively. Contrary to our mRNA and enzyme activity measurements, the intensity of the immunodetected signals did not show a long- term increase after stimulation with anti-CD3/CD28. A polyclonal Ab directed against PDE4B gave rise to two predominant bands. One band migrated slightly above 100 kDa and might be attributed to PDE4B long forms (PDE4B1 and/or PDE4B3). The high immunoreactivity in unstimulated cells decreased after stimulation during the examined time period (0–120 h). The other band, mi- grating at ϳ75 kDa (might be attributed to PDE4B2) was also present in unstimulated cells, but was strongly induced, peaking 24–48 h after stimulation. At later time points, a reduction of this band was observed. Considering the transient induction of the subtype PDE4B measured by PCR and activity assays, the immunodetected down-regulation of long PDE4B splice variants is com- pensated by a pronounced up-regulation of the short splice variant FIGURE 4. cAMP hydrolyzing phosphodiesterase activity in untreated and may result in a net up-regulation between 24 and 48 h after and anti-CD3/CD28 stimulated human primary CD4ϩ T lymphocytes. stimulation. A polyclonal Ab directed against PDE4D detected Cells were stimulated with 3 ␮g of anti-CD3/well and 3 ␮g of anti- several bands of different molecular weights. One set of bands was CD28/ml for different periods of time. A, Total cAMP-PDE hydrolyzing in the range of ϳ60–75 kDa and likely corresponds to the short activity and PDE4 inhibitor-insensitive PDE activity (ϭ PDE4 indepen- forms PDE4D6 (ϳ59 kDa), PDE4D2 (ϳ68 kDa), and PDE4D1 dent) in T cell lysates were measured as detailed in Materials and Methods. (ϳ72 kDa). These short forms were up-regulated in a time-depen- PDE4 activity was determined by subtracting the PDE4 independent ac- dent manner, with the middle band, assumingly PDE4D2, showing Ϯ tivity from the total activity. Data are expressed as mean SD of three to the most pronounced up-regulation. The other set of bands was ,p Ͻ 0.001 (compared with untreated cells ,ءءء ;p Ͻ 0.05 ,ء .five donors above ϳ85 kDa and may be the long splice variants of PDE4D t ϭ 0 h). B, Cell lysates were immunoprecipitated with Abs recognizing PDE4A (AC55), PDE4B (K118), and PDE4D (m3S1) (32). The PDE ac- (PDE4D3, PDE4D4, PDE4D5, PDE4D7, PDE4D8, PDE4D9). tivity recovered in the immunoprecipitation pellet was measured as de- These bands showed low immunoreactivities that were not, or only tailed in Materials and Methods. Shown is one representative experiment slightly, changed after stimulation. The unchanged immunodetec- of three. For the experiment, CD4ϩ cells of three donors were indepen- tion of ␤-actin as loading control confirmed that the observed reg- dently stimulated, but pooled for lysis and immunoprecipitation. ulation of PDE4 subtypes was not due to different amounts of The Journal of Immunology 4825

FIGURE 5. Detection and quantification of PDE4 splice variants in untreated and anti-CD3/ CD28-stimulated human primary CD4ϩ T lymphocytes by immunoblotting and densitometric analysis. Cells were stimulated with 3 ␮g of anti- CD3/well and 3 ␮g of anti-CD28/ml for different periods of time. Cells were lysed and 50 ␮gof protein of the 1000 ϫ g supernatant were separated by SDS-PAGE. A, Immunoblots detecting PDE4A, PDE4B, and PDE4D splice variants. Im- munodetection was performed using rabbit polyclonal Abs recognizing PDE4A, PDE4B, or PDE4D (33). ␤-Actin was used as loading control. Shown is one representative of two experiments with cells from three donors that have been inde- pendently stimulated, but pooled for lysis and immunoblotting.B, Densitometric analysis of PDE4 long and short forms and ␤-actin, each expressed relative to untreated conditions. PDE4A short forms were not analyzed quantitatively due to the Downloaded from very faint immunodetected signal. Shown are mean values of two independent experiments, each with cells from three donors that have been inde- pendently stimulated, but pooled for lysis and immunoblotting. http://www.jimmunol.org/ protein loaded onto the gel. For quantification, densitometric anal- tion of siRNA had no additional effects on any of the parameters ysis of PDE4 long and short forms and of ␤-actin was performed investigated (see last column in Table I). and expressed relative to untreated cells (Fig. 5B). As indicated The transfection efficiency was tested with FITC-labeled non- above, both PDE4B and PDE4D short forms are up-regulated, targeting siRNA and resulted in ϳ94% FITC-positive cells (Fig. whereas PDE4B and PDE4D long forms are down-regulated or 6A). From sets of siRNAs specific for each PDE4 subtype, we unaffected, respectively. selected those individual siRNAs that were most effective in down- regulating the respective mRNA (data not shown). Different

Validation of siRNA-mediated PDE4 subtype mRNA and activity by guest on September 26, 2021 ϩ siRNA concentrations were tested to determine the optimal con- knockdown in CD4 T cells centration needed for mRNA knockdown (Fig. 6B). In unstimu- ϩ In the following set of experiments, we addressed the question lated CD4 cells, individual siRNAs directed against PDE4A, whether the specific expression patterns of PDE4 subtypes corre- PDE4B, and PDE4D concentration dependently induced specific lates with a respective relevance for different T cell functions. mRNA knockdowns of each respective PDE4 subtype 24 h after Because PDE4 inhibitors so far available are rather nonselective transfection compared with nucleofection controls (NF control, for PDE4 subtypes, we used a siRNA-based approach to selec- cells transfected without siRNA) (Fig. 6B). Maximal mRNA tively knockdown the different PDE4 subtypes. Although we used knockdown was achieved with 1.5 ␮M siRNA. Notably, the a comparatively high stimulation condition (3 ␮g of anti-CD3/well knockdown efficacy for every individual siRNA was within the and 3 ␮g of anti-CD28/ml) for all PDE4 expression and activity same range of ϳ59–65%. The siRNAs target sequences that are studies to detect maximal effects in the regulation of PDE4 sub- highly conserved between the different PDE4 subtypes. Although types (Figs. 1–5), we used a weaker stimulation condition (0.3 ␮g of anti-CD3/well and 0.3 ␮g of anti-CD28/ml) for all functional studies and therefore also for all siRNA validation experiments. a This weaker stimulation was chosen because we had observed that Table I. Validation of the NF procedure full stimulation decreases the efficacy of PDE4 inhibitors (data not shown) and might thus also decrease functional effects of PDE4 Functional Effect of Additional Effect of Parameter Nucleofection siRNA subtype-specific siRNAs. To transfect human primary CD4ϩ T cells with siRNAs, we used the Amaxa NF technique (34). In a Loss of cells 37 Ϯ 10% No effect series of extensive control experiments, we tested this siRNA- Mortality of 5 Ϯ 3% increased No effect based strategy for unspecific, cytotoxic effects. The nucleofection recovered cells Expression of CD4 No effect No effect procedure alone (without siRNA) produced a considerable loss of and CD25 cells (37 Ϯ 10%), but had only a minor effect (5 Ϯ 3%) on cell Cytokine release 45 Ϯ 7% decreased No effect (NEG_si) mortality of recovered cells, as measured by 7-AAD staining 24 Proliferation No effect No effect (NEG_si) and 48 h after nucleofection (Table I). The release of cytokines a CD4ϩ T cells were treated by the NF procedure without the addition of siRNA was also affected by the nucleofection procedure, compared with (column: “effect of nucleofection”) or with the addition of siRNA (column: “addi- untreated cells (45 Ϯ 7%). In contrast, the expression of surface tional effect of siRNA”). The loss of cells due to the transfection procedure was determined by counting the recovered cells 24 h after nucleofection. Twenty-four to markers, such as CD4 and CD25 measured by flow cytometry, as 48 h after nucleofection, 7-AAD was used to determine the mortality of recovered well as cell proliferation was not changed by the nucleofection cells. Additionally, cells were stained with Abs recognizing CD4 and CD25 and the expression of these surface markers were measured by flow cytometry. Cytokine procedure. Although the nucleofection procedure alone had sub- release and the proliferation rate were determined as detailed in Materials and Meth- stantial effects on some of the measured parameters, the applica- ods. NEG_si, Nontargeting control siRNA. Data are expressed as mean Ϯ SD. 4826 ROLE OF PDE4s IN HUMAN CD4ϩ T CELLS Downloaded from

FIGURE 6. Validation of siRNA-mediated knockdown of PDE4 subtypes in human primary CD4ϩ T lymphocytes. A, Transfection efficiency, tested by using 2 ␮M FITC-labeled siRNA. Uptake of siRNA was measured by flow cytometry. B, Concentration-dependent siRNA-mediated mRNA knockdown in unstimulated CD4ϩ T cells 24 h after nucleofection. Data are shown relative to each nucleofection (NF) control, as one representative of two experiments. C, Time-dependent siRNA-mediated mRNA knockdown after stimulation with 0.3 ␮g of anti-CD3/well and 0.3 ␮g of anti-CD28/ml. Results are expressed http://www.jimmunol.org/ relative to the respective NF control as the mean Ϯ SD of three to six donors. Significant differences between NF control and siRNA-transfected cells are p Ͻ 0.001; compared with NF control of each time point). D, PDE activity knockdown, induced by PDE4 ,ءءء ;p Ͻ 0.01 ,ءء ;p Ͻ 0.05 ,ء) indicated subtype-specific siRNAs, in CD4ϩ T cells 24 and 72 h after anti-CD3/CD28 stimulation. Results are expressed as cAMP-PDE activity in percent of the p Ͻ ,ءءء ;p Ͻ 0.01 ,ءء) NF control, as mean Ϯ SD of three donors. Significant differences between NF control and siRNA-transfected cells are indicated 0.001; compared with NF control). each siRNA is capable to efficiently down-regulate the correspond- overall PDE4 activity, it is expected that PDE4A siRNA will have ing mRNA, none of the used siRNAs did affect the highly homol- the smallest effect on PDE4 activity whereas PDE4B and PDE4D by guest on September 26, 2021 ogous mRNAs of the other PDE4 subtypes. Additionally, nontar- siRNAs will have larger effects even when the individual subtypes geting siRNA used as a negative control had no effect on the are diminished to the same extend. Indeed, the collective effects of expression of PDE4A, PDE4B, and PDE4D mRNA (data not all individual PDE4 siRNAs sum up to ϳ90% both after 24 and shown). 72 h, indicating a pronounced efficacy of the siRNAs to down- To test whether the PDE4 subtype-specific siRNAs were also regulate their respective subtype. Taken together, the strategy to effective after stimulation, transfected cells were left unstimulated selectively knockdown individual PDE4 subtypes in primary for 24 h to allow siRNA-mediated mRNA depletion before the CD4ϩ T cells was well tolerated, specific, and efficient. Because addition of the anti-CD3/CD28 stimulus. Subsequently, the mRNA enzymatic activity was effectively reduced 72 h after stimulation knockdown effects were determined at 24, 48, and 72 h after stim- but mRNA levels started to recover at the same time, we consid- ulation and were compared with the NF controls (Fig. 6C) taken at ered the siRNA approach to be suitable for the application on the respective time point. Significant mRNA knockdowns were functional T cell assays in a time period of up to 72 h. achieved up to 72 h after stimulation with all applied siRNAs, although the siRNA-mediated knockdown effects started to dimin- Anti-CD3 and anti-CD28 stimulation induces the release of ish. To ascertain that the mRNA knockdown translates into a de- cytokines, which can be suppressed by PDE4 inhibition crease in protein level, we performed cAMP-PDE activity assays To determine how human primary CD4ϩ T cells functionally re- with lysates from siRNA-transfected CD4ϩ T cells (Fig. 6D). Ly- spond to anti-CD3/CD28 stimulation, we measured IL-2, IFN-␥, sates from T cells treated only with the nucleofection procedure and IL-5 secretion at different times in supernatants of stimulated (NF control) were used as reference. Twenty-four hours after stim- cells (Fig. 7A). In untreated cells (time point 0 h), IL-2, IFN-␥,as ulation, a marginal reduction of total cAMP-PDE activity and well as IL-5 levels were below the detection limit. After stimula- PDE4 activity (mean Ϯ SD ϭ 10 Ϯ 13%, NS) was achieved with tion, IL-2 was strongly induced with maximal levels 24 h after siRNA directed against PDE4A. siRNAs directed against PDE4B stimulation, but returned to basal levels within 5 days. Compared and PDE4D significantly reduced total cAMP-PDE activity and with IL-2 secretion, IFN-␥ and IL-5 levels were substantially in- PDE4 activity (PDE4B-siRNA: 28 Ϯ 5%, PDE4D-siRNA: 51 Ϯ duced at later time points, but were from 24 h onward steadily 11%). To evaluate whether the knockdown effects on PDE4 ac- up-regulated and were maximal at the end of the examined time tivity were maintained for a longer time period, we repeated the period (134 h). PDE activity measurements at 72 h. At this latter time point, the To investigate how T cell functions are affected by PDE4 inhi- reduction of PDE4 enzyme activity by the different siRNAs were bition, we treated CD4ϩ cells with the very potent panPDE4 in- similar to the 24-h time point (PDE4A-siRNA: 18 Ϯ 9%, PDE4B- hibitor RP73401 (piclamilast), which does not discriminate be- siRNA: 27 Ϯ 14%, PDE4D-siRNA: 46 Ϯ 7%). Considering that tween distinct PDE4 subtypes (24), and stimulated the cells for the the individual PDE4 subtypes contribute quite differently to the indicated time periods (Fig. 7B). To compare the effects of The Journal of Immunology 4827

and proliferation rate of these cells to 100%. A total of 1 ␮M RP73401 (a maximum concentration that guarantees PDE4 selectivity, data not shown) signiﬁcantly inhibited anti-CD3/CD28 induced IL-2 release (ϳ39 Ϯ 12% inhibition, 24 h after stimulation), IFN-␥ release (ϳ52 Ϯ 11% inhibition, 72 h after stimulation), and IL-5 release (ϳ43 Ϯ 13% inhibition, 72 h after stimulation) (Fig. 7B). Under these conditions, proliferation was also signiﬁcantly inhibited, but to a lesser extent (ϳ13 Ϯ 4% inhibition, 66 h after stimulation).

Individual PDE4 subtypes have different functional signiﬁcance in human primary CD4ϩ T cells To ascertain which individual PDE4 subtype(s) mediate the inhibitory effect of a panPDE4 inhibitor, PDE4 subtype-speciﬁc siRNAs were nucleofected into CD4ϩ T cells. After a 24-h resting period, transfected cells were stimulated with anti-CD3/CD28. A total of 1.5 ␮M nontargeting siRNA was used as control for statis- FIGURE 7. Time course of functional T cell parameters after anti-CD3/ tical analysis (NEG_si in Fig. 8). The functional impact of indi- Downloaded from CD28 stimulation and suppression of T cell functions by complete PDE4 inhibition. A, Time-dependent cytokine secretion of CD4ϩ T cells (IL-2, vidual siRNAs on cytokine release and on cell proliferation is re- IFN- ␥, IL-5) after stimulation with 0.3 ␮g of anti-CD3/well and 0.3 ␮gof ported as a percentage of the RP73401 effect, which can be anti-CD28/ml. Supernatants were collected and cytokine concentrations assumed to represent the maximal effect and was set therefore to were determined by ELISA. Results are expressed as mean Ϯ SD of four 100%. Comparable to Fig. 7B, cells treated with the nucleofection donors. B, Suppression of CD4ϩ T cell functions by the panPDE4 inhibitor procedure alone were used to determine these maximal effects.

RP73401 (piclamilast). Cells treated with the nucleofection procedure Twenty-four hours after stimulation, siRNA targeting PDE4A http://www.jimmunol.org/ alone (NF control) were incubated for the indicated period of time after showed no significant inhibitory effect on IL-2 synthesis, however, anti-CD3/CD28 stimulation either in the presence of 0.1% DMSO or addi- knockdown of either PDE4B or PDE4D significantly suppressed ␮ Ϯ tionally in the presence of 1 M RP73401. Data are shown as mean SD (%) anti-CD3/CD28 induced IL-2 release to an extent close to that ;p Ͻ 0.01 ,ءء :of four to six donors. Significance of differences is indicated observed with RP73401 (Fig. 8A). Because substantial amounts of .(p Ͻ 0.001; compared with NF control (ϩ0.1% DMSO ,ءءء IFN-␥ and IL-5 were only measured at later time points, the functional impact of PDE4 subtype-specific siRNAs on these latter RP73401 with the effects of PDE4 subtype-specific siRNAs, we cytokines was measured 72 h after stimulation. siRNA targeting used cells treated with the nucleofection procedure for the PDE4A had no significant inhibitory effect on IFN-␥ release. RP73401 experiments, but did not apply siRNA. To adjust the siRNA targeting PDE4B had a slightly higher inhibitory effect, by guest on September 26, 2021 control conditions for DMSO concentrations, we treated trans- however, siRNA targeting PDE4D showed the most pronounced fected cells with 0.1% DMSO and set the measured cytokine level inhibitory effect on IFN-␥ synthesis similar to RP73401 (Fig. 8B).

FIGURE 8. Suppression of CD4ϩ T cell functions by PDE4 subtype-specific siRNAs. A total of 1.5 ␮M nontargeting siRNA (NEG_si) or PDE4 subtype-specific siRNAs were nucleofected into human primary CD4ϩ T cells. Cells were left in culture for 24 h and were then stimulated with 0.3 ␮g of anti-CD3/well and 0.3 ␮g of anti-CD28/ml. The siRNA-mediated suppression of IL-2 secretion after 24h(A), IFN-␥ secretion after 72 h (B), IL-5 secretion after 72 h (C), and proliferation ([3H]thymidine incorporation) after 66 h (D) is depicted in percent of the RP73401 effect. This maximally expected effect was determined using cells treated with the nucleofection procedure alone. NEG_si, nontargeting control siRNA; PDE4_all_si, combined application of PDE4A_si, PDE4B_si, and PDE4D_si. Re- sults are expressed as mean Ϯ SD of four to six donors. Significance of differences is indicated: -p Ͻ 0.001; com ,ءءء ;p Ͻ 0.01 ,ءء ;p Ͻ 0.05 ,ء pared with 1.5 ␮M NEG_si. 4828 ROLE OF PDE4s IN HUMAN CD4ϩ T CELLS

Likewise, IL-5 synthesis was not significantly affected by the ap- trast, one study (42) reported that anti-CD3/CD28 stimulation in- plication of siRNAs targeting PDE4A and PDE4B, but was sig- creased PDE4 activity 30 min after stimulation, but did not elevate nificantly inhibited by knockdown of PDE4D, to an extent close to de novo PDE4 protein or mRNA expression. Contrary to our that obtained with RP73401 (Fig. 8C). Remarkably, the combined study, a mixed CD4ϩ and CD8ϩ T cell population, shorter stim- application of siRNAs targeting PDE4A, PDE4B, and PDE4D ulation periods, and a semiquantitative PCR strategy were used in (PDE4_all_si in Fig. 8), produced the most pronounced inhibitory the latter study. effect on cytokine release. The relatively weak inhibitory effect of Human primary CD4ϩ T cells are a heterogeneous group of RP73401 on T cell proliferation (compare Fig. 7B) was mimicked different subpopulations, among them naive and memory T cells, by PDE4D knockdown, whereas siRNA targeting PDE4A and which are distinguished by their surface markers CD45RA and PDE4B were hardly effective (Fig. 8D). Furthermore, the addition CD45RO, respectively (36). These two subpopulations can be sep- of the latter two siRNAs to PDE4D siRNA did not further increase arated rather easily and in sufficient numbers. Considering the gen- the inhibitory effect on T cell proliferation. erally lower activation threshold dedicated to memory effector T cells (43), we asked whether PDE4 subtypes are differentially reg- Discussion ulated in these two subpopulations. Although we found a margin- The aim of our study was to clarify the time-dependent expression ally higher PDE4 subtype expression and a slightly faster and more profile of the four PDE4 subtypes in CD4ϩ T cells and to elucidate pronounced induction of individual PDE4 subtypes in memory which PDE4 subtype(s) is/are of importance for T cell cytokine CD4ϩ T cells, these differences were statistically not significant production and proliferation. Because PDE4 inhibitors are tested in between naive and memory T cells. Our findings indicate that na- ϩ clinical trials and may provide future therapeutic options in dis- ive and memory CD4 T cells express the same set of PDE4 Downloaded from eases as asthma, chronic obstructive pulmonary disease, inflam- subtypes, and that these PDE4 subtypes are similarly regulated matory bowel disease, and others (22, 37), we wished to closely after anti-CD3/CD28 stimulation. Furthermore, the time-depen- mimic the physiological conditions relevant to human in our ex- dent expression patterns of PDE4 subtypes in CD4ϩ cells were not periments. Consequently, although cell lines such as the Jurkat T found to be influenced by the strength of the anti-CD3 stimulus or cell line are functionally more stable and are easier to handle (e.g., the costimulatory anti-CD28 signal. ϩ to transfect), we preferred human primary CD4 T cells for our Although the primary goal of our study was to analyze the dif- http://www.jimmunol.org/ studies, even though this approach is more time consuming, tech- ferent PDE4 subtypes, we assessed whether the observed subtype nically complex, and had a higher variability due to donor-depen- expression patterns can be attributed to some splice variants. We dent differences. detected proteins of different lengths in immunoblotting experi- By using quantitative PCR and PDE activity assays combined ments, indicating that multiple splice variants are expressed for with an immunoprecipitation protocol, we demonstrate that each individual subtype. In unstimulated T cells, the Ab directed PDE4A, PDE4B, and PDE4D are expressed in untreated CD4ϩ T against PDE4A detected two bands (although the shorter variant cells, whereas PDE4C was not detected. The highest mRNA ex- resulted in a very faint signal), probably corresponding to short and pression level as well as PDE4 activity was found for PDE4D, long forms of PDE4A. However, after stimulation, no long-term followed by PDE4B and PDE4A, the latter having substantially increase of the amount of protein was observed. by guest on September 26, 2021 lower expression level. These findings are only partly in accor- The different immunoblot experiments we performed with the dance with earlier studies based on semiquantitative PCR experi- PDE4A Ab (different from the one suitable for immunoprecipita- ments. Whereas Landells et al. (38) found high PDE4D mRNA tion) showed a somewhat higher variability compared with the expression in CD4ϩ T cells, Gantner et al. (39) found PDE4B experiments performed with PDE4B or PDE4D Abs. This may be expression levels above PDE4A, but could not detect substantial a result of the lower expression level of PDE4A. In fact, we were amount of PDE4D. Upon anti-CD3/CD28 stimulation, we show a not able to detect a PDE4A signal from T cell extracts using an- time-dependent up-regulation of PDE4A, PDE4B, and PDE4D other commercially available PDE4A Ab (FabGennix; Frisco) or mRNA expression and PDE4 activities. Whereas PDE4A and using the Ab suitable for immunoprecipitation (data not shown). PDE4D were up-regulated within 5 days with the highest expres- Additionally, we performed an experiment in which we immuno- sion levels at 120 h (the latest time point measured), PDE4B only precipitated PDE4A with the idea to increase the amount of showed a transient up-regulation with highest levels 16–24 h after PDE4A in the sample followed by immunoblot analysis (using the stimulation. In general, the time-dependent expression profiles immunoblot Ab). However, because both Abs are derived from found for mRNA levels closely resembled the PDE4 activity pro- rabbits it was not possible to detect a PDE4A signal above the high files measured by PDE4 subtype-specific immunoprecipitations. A background produced by the Ab used for immunoprecipitation. time delay between changes of mRNA levels and enzyme activi- Therefore, due to the low expression level and to limited experi- ties was observed as expected because protein synthesis is subse- mental tools we could not resolve this discrepancy. However, one quent to mRNA transcription. However, some differences were explanation might be that the Ab used for the immunoblot exper- observed in the extent of mRNA and activity up-regulation. iments may not have detected all expressed PDE4A splice vari- Whereas PDE4A showed an ϳ15-fold induction and PDE4D an ants. For the PDE4B and PDE4D subtypes, the mRNA and enzyme ϳ4-fold induction on mRNA level, PDE4 activities increased only activity data as well as the immunoblot data were in good agreement. 4- and 1.5-fold, respectively. On the contrary, up-regulation of If one considers the two prominent bands (slightly above 100 kDa and PDE4B activity was more pronounced than PDE4B mRNA up- at ϳ75 kDa) displayed by the PDE4B Ab, an increase in the overall regulation (3.4- vs 2-fold). Whereas results by quantitative PCR PDE4B protein amount 24 h after stimulation is comprehensible. A directly reflect the number of mRNA molecules in the cell, PDE reduction is obvious at later time points. For PDE4D a clear induc- activity is not only influenced by the amount of the enzyme but tion is found for the proteins 60–75 kDa in size. Most remarkably, also by other parameters such as phosphorylation and protein-pro- the different splice variants detected for PDE4B and PDE4D are tein interactions. Therefore, changes on the mRNA level may not not regulated uniformly. Especially, the immunoblot of PDE4B quantitatively reflect the changes in enzymatic activity. The induc- displays a time-dependent reduction of PDE4B long form(s) par- tion of PDE4 subtypes upon stimulation of T cells in our own alleled by a pronounced transient up-regulation of the PDE4B experiments is in agreement with other studies (40, 41). In con- short form. The immunoblot of PDE4D shows PDE4D long forms The Journal of Immunology 4829

above 85 kDa in size, which are rather unaffected after stimulation. siRNA was similarly efficient and specific in down-regulating the The detected proteins of 60–75 kDa in size may represent PDE4D PDE4D mRNA in unstimulated T cells while leaving the other short forms, which are clearly up-regulated after stimulation. subtypes unaffected and it was also capable to keep mRNA levels Taken together, the immunoblots supplement the PCR and enzyme lowered after T cell stimulation (data not shown). Most notewor- activity results. In addition, the data highlight that multiple splice thy, both PDE4D-siRNAs were almost equally effective in reduc- variants further increase the complexity in the regulation of PDE4 ing IL-2 secretion 24 h after stimulation (data not shown). Con- ϩ subtypes in CD4 T cells. sidering our extensive validation of the siRNAs performed with By evaluating our comprehensive expression data, one can im- primary T cells and the experiments using a second PDE4D ply that the different expression levels of the PDE4 subtypes in siRNA, the observed functional effects are most likely due to the ϩ untreated CD4 T cells and their different induction upon stimu- specific down-regulation of the respective PDE4 subtypes rather lation may have distinct effects on the regulation of T cell func- than due to unspecific off-target effects. tions. For example, the high expression and activity level of The crucial role of PDE4 in T cell signaling and function is PDE4D at all examined time points (0–120 h) may provide a con- well-known (23, 24). In our study, we used the secretion of IL-2, stitutive high cAMP hydrolyzing capacity. PDE4B might be in- IFN-␥, and IL-5 and proliferation as functional readout parame- volved in regulating early T cell activation, because PDE4B ters. The maximum inhibition of these parameters by complete mRNA and activity showed a substantial but only transient up- suppression of PDE4 activity was determined by the panPDE4 regulation. Remarkably, PDE4A, but not PDE4B or PDE4D had inhibitor RP73401 (piclamilast). We could demonstrate that the most pronounced x-fold up-regulation of both mRNA and ac- siRNA-mediated knockdown of both PDE4B and PDE4D resulted tivity. This induction of PDE4A was most pronounced 120 h after in significant suppression of anti-CD3/CD28-induced IL-2 release; Downloaded from stimulation and may thus be involved in undefined long-term pro- the effect of PDE4A siRNA was not statistically significant. These cesses which are beyond the scope of our examined time window. ϩ data indicate that for IL-2 synthesis PDE4B and PDE4D may have To study the impact of distinct PDE4 subtypes on CD4 T cell a partially overlapping function. For IFN-␥ and IL-5, PDE4D- functions and due to the lack of subtype-specific small molecule ϩ siRNA had a predominant effect. However, the inhibition of both inhibitors, we transfected CD4 T cells with individual siRNAs cytokines was most effective when PDE4 subtype-specific siRNAs directed against PDE4A, PDE4B, and PDE4D. Human primary were applied in combination, pointing to complementary functions http://www.jimmunol.org/ CD4ϩ T lymphocytes are difficult to transfect and various common of PDE4 subtypes. The weak inhibition of proliferation by sup- transfection methods such as cationic lipids fail to transfect the pression of PDE4 enzyme activity under the conditions applied cells efficiently. We used an electroporation-based transfection could be fully mimicked by PDE4D siRNA. In summary, our find- method (nucleofection) optimized for the transfection of human T ings indicate that the regulation and function of individual PDE4 cells (34). Nevertheless, the transfection procedure alone caused a subtypes might be a complex interplay leading to largely nonre- considerable loss of cells, which is a common event associated dundant, complementary, and time-dependent roles. Our results with electroporation. In our experiments, the procedure also seem to be in discrepancy to a study of Manning et al. (47), who caused a substantial decrease in the release of cytokines if com-

claimed that suppression of T cell proliferation with “PDE4 sub- by guest on September 26, 2021 pared with untreated cells. However, cells recovered after nucleo- type-selective inhibitors” correlated with the inhibition of PDE4A fection had a good viability and proliferation of the cells after and PDE4B. This contradiction might be explained by the low stimulation was not affected. Taking the unavoidable effects of the selectivity of the inhibitors used in that study and/or by different procedure into account, it was important to demonstrate that the additional application of siRNAs had no additional effect on cell stimulation conditions. In the Manning study, mononuclear cells parameters (besides expected effects linked to PDE4 knockdown). from allergic donors were stimulated by Ag. In our own study, we Ϯ Whereas siRNA concentrations in the range from 100 nM to 4 ␮M have evaluated the impact of stimulation conditions (anti-CD3 have been used (44–46), we determined 1.5 ␮M siRNA as the costimulation with anti-CD28 in different strengths) and found no optimal concentration for maximal knockdown of PDE4 subtypes differences with respect to regulation of PDE4 subtypes. For our in our validation experiments. We could not achieve complete functional studies, we used a “medium” costimulation protocol by ␮ ␮ knockdown of the target PDE4 subtypes, however, the mRNA and applying 0.3 g of anti-CD3/well and 0.3 g of anti-CD28/ml. We protein knockdown was substantial and all siRNAs had the same cannot exclude the possibility that—in contrast to the mRNA ex- efficacy in down-regulating the respective mRNA in unstimulated pression profiles—the impact of various PDE4 subtypes/splice CD4ϩ T cells. After stimulation, the applied siRNAs not only had variants may depend on the stimulation condition used. It may also be that for different stimulation conditions small (undefined) sub- to reduce a stable basal mRNA level but also had to counteract the ϩ induction of the respective mRNAs, probably resulting in more populations of CD4 T cells may respond differently which cannot variable knockdown effects under stimulatory conditions. be resolved by our protocol. These possibilities will be investi- Additionally, we also addressed the specificity of the siRNAs in gated in future studies. our validation experiments. The siRNAs target sequences that are In support of our findings, complementary, but nonredundant highly conserved between the PDE4 subtypes. Therefore, each roles of PDE4 subtypes have already been described in mice de- siRNA targeting a specific subtype can be considered as a “high ficient in PDE4B and PDE4D, in which neutrophil recruitment to homology control” for the other subtypes. With this respect it is the inflamed lung is impaired (27). In contrast, ablation of PDE4B important to note that each individual siRNA specifically down- alone impacts LPS signaling and decreases TNF-␣ production in regulates its respective mRNA and does not affect the other highly monocytes, dendritic cells, and macrophages (25, 28). So far, the homologous subtypes. In our functional studies, PDE4A and relevance of PDE4 subtypes for T cell function has not been ex- PDE4B siRNAs show only limited effects on most of the param- tensively described neither in mice nor in humans. However, in eters studied arguing also against general unspecific effects of human primary T cells and T cell lines, two reports localize these siRNAs. The most prominent and consistent effects on all PDE4B2 at the TCR and the immunological synapse (29, 30). A functional parameters were observed for PDE4D siRNA. We per- recent study reported that TCR and CD28 stimulation in human formed a limited set of experiments with a second siRNA peripheral T cells recruits PDE4A4, PDE4B2, PDE4D1, and (PDE4D_si-2) targeting a different sequence of PDE4D. This PDE4D2 in complex with ␤-arrestin to lipid rafts, pointing to a 4830 ROLE OF PDE4s IN HUMAN CD4ϩ T CELLS potential role of PDE4 in counteracting C-terminal Src kinase me- 14. Bender, A. T., and J. A. Beavo. 2006. Cyclic nucleotide phosphodiesterases: diated inhibition of Lck (31). Interestingly, we have found in our molecular regulation to clinical use. Pharmacol. Rev. 58: 488–520. 15. Schudt, C., H. Tenor, and A. Hatzelmann. 1995. PDE isoenzymes as targets for immunoblot analyses that especially the short forms of PDE4B and anti-asthma drugs. Eur. Resp. J. 8: 1179–1183. PDE4D are responsible for or contribute to the time-dependent 16. Giembycz, M. A., C. J. Corrigan, J. Seybold, R. Newton, and P. J. Barnes. 1996. ϩ Identification of cyclic AMP phosphodiesterases 3, 4, and 7 in human CD4ϩ and up-regulation of these subtypes in CD4 T cells. Additionally, ϩ CD8 T-lymphocytes: role in regulating proliferation and the biosynthesis of Tasken and coworkers (31) confirmed in human primary T cells interleukin-2. Br. J. Pharmacol. 118: 1945–1958. that PKA-dependent phosphorylation increases PDE4 activity, a 17. Li, L., C. Yee, and J. A. Beavo. 1999. CD3- and CD28-dependent induction of mechanism that was already described in several cell systems (42, PDE7 required for T cell activation. Science 283: 848–851. 18. Glavas, N. A., C. Ostenson, J. B. Schaefer, V. Vasta, and J. A. Beavo. 2001. T 48–51). The well-characterized interactions of PDE4 isoforms cell activation up-regulates cyclic nucleotide phosphodiesterases 8A1 and 7A3. with A-kinase anchoring proteins were also found in T cell lines, Proc. Natl. Acad. Sci. USA 98: 6319–6324. 19. Houslay, M. D., and D. R. Adams. 2003. PDE4 cAMP phosphodiesterases: mod- enabling a local feedback regulation as control for cAMP concen- ular enzymes that orchestrate signalling cross-talk, desensitization and compart- tration (52). mentalization. Biochem. J. 370: 1–18. The combination of several mechanisms, including the up-reg- 20. Conti, M., W. Richter, C. Mehats, G. Livera, J. Y. Park, and C. Jin. 2003. Cyclic AMP-specific PDE4 phosphodiesterases as critical components of cyclic AMP ulation of the amount of different PDE4 subtypes, the regulation of signaling. J. Biol. Chem. 278: 5493–5496. PDE4 activity by e.g., phosphorylation, and the intracellular tar- 21. Torphy, T. J. 1998. Phosphodiesterase isozymes: molecular targets for novel geting of distinct PDE4 splice variants to specific microdomains antiasthma agents. Am. J. Respir. Crit. Care Med. 157: 351–370. 22. Lipworth, B. J. 2005. Phosphodiesterase-4 inhibitors for asthma and chronic ob- may be involved in the subtle and complex regulation necessary structive pulmonary disease. Lancet 365: 167–175. for opposing the inhibitory tonus of cAMP in inflammatory cells. 23. Souness, J. E., D. Aldous, and C. Sargent. 2000. Immunosuppressive and anti- ϩ Our study indicates that in CD4 T cells this regulation is not inflammatory effects of cyclic AMP phosphodiesterase (PDE) type 4 inhibitors. Downloaded from Immunopharmacology 47: 127–162. mediated by one subtype alone, but that distinct subtypes are time- 24. Hatzelmann, A., and C. Schudt. 2001. Anti-inflammatory and immunomodula- dependently involved with PDE4D probably playing a predomi- tory potential of the novel PDE4 inhibitor roflumilast in vitro. J. Pharmacol. Exp. nant role, supporting the concept of PDE4 compartmentalization, Ther. 297: 267–279. 25. Jin, S. L., and M. Conti. 2002. Induction of the cyclic nucleotide phosphodies- both temporally and spatially (20, 53). Detailed information about terase PDE4B is essential for LPS-activated TNF-␣ responses. Proc. Natl. Acad. functionally relevant subtypes in inflammatory cells will help to Sci. USA 99: 7628–7633. 26. Mehats, C., S. L. Jin, J. Wahlstrom, E. Law, D. T. Umetsu, and M. Conti. 2003. define the rational basis for the development of subtype-selective http://www.jimmunol.org/ PDE4D plays a critical role in the control of airway smooth muscle contraction. PDE4 inhibitors for the treatment of inflammatory diseases. FASEB J. 17: 1831–1841. 27. Ariga, M., B. Neitzert, S. Nakae, G. Mottin, C. Bertrand, M. P. Pruniaux, Acknowledgments S. L. Jin, and M. Conti. 2004. Nonredundant function of phosphodiesterases 4D and 4B in neutrophil recruitment to the site of inflammation. J. Immunol. 173: We thank Barbara Burgbacher, Bettina Eidmann, and Sandra Hamm for 7531–7538. excellent technical help and Jonathan Gilbert for valuable information. We 28. Jin, S. L., L. Lan, M. Zoudilova, and M. Conti. 2005. Specific role of phospho- are indebted to Drs. Hermann Tenor, Hans-Peter Hofmann, and Oliver diesterase 4B in lipopolysaccharide-induced signaling in mouse macrophages. Steinbach for fruitful discussions and helpful advice. J. Immunol. 175: 1523–1531. 29. Baroja, M. L., L. B. Cieslinski, T. J. Torphy, R. L. Wange, and J. Madrenas. 1999. Specific CD3⑀ association of a phosphodiesterase 4B isoform determines

Disclosures its selective tyrosine phosphorylation after CD3 ligation. J. Immunol. 162: by guest on September 26, 2021 2016–2023. M. Conti is a consultant for Pfizer and has received a research grant from 30. Arp, J., M. G. Kirchhof, M. L. Baroja, S. H. Nazarian, T. A. Chau, Altana Pharma. C. A. Strathdee, E. H. Ball, and J. Madrenas. 2003. Regulation of T-cell activation by phosphodiesterase 4B2 requires its dynamic redistribution during immu- References nological synapse formation. Mol. Cell. Biol. 23: 8042–8057. 31. Abrahamsen, H., G. Baillie, J. Ngai, T. Vang, K. Nika, A. Ruppelt, T. Mustelin, 1. Larsen, G. L., and P. M. Henson. 1983. Mediators of inflammation. Annu. Rev. M. Zaccolo, M. Houslay, and K. Tasken. 2004. TCR- and CD28-mediated re- Immunol. 1: 335–359. cruitment of phosphodiesterase 4 to lipid rafts potentiates TCR signaling. J. Im- 2. Davis, M. M., and P. J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell munol. 173: 4847–4858. recognition. Nature 334: 395–402. 32. Iona, S., M. Cuomo, T. Bushnik, F. Naro, C. Sette, M. Hess, E. R. Shelton, and 3. Veillette, A., S. Latour, and D. Davidson. 2002. Negative regulation of immu- M. Conti. 1998. Characterization of the rolipram-sensitive, cyclic AMP-specific noreceptor signaling. Annu. Rev. Immunol. 20: 669–707. phosphodiesterases: identification and differential expression of immunologically 4. Liu, J. O. 2005. The yins of T cell activation. Sci. STKE 265: re1. distinct forms in the rat brain. Mol. Pharmacol. 53: 23–32. 5. Kammer, G. M. 1988. The adenylate cyclase-cAMP-protein kinase A pathway 33. Tenor, H., E. Hedbom, H. J. Hauselmann, C. Schudt, and A. Hatzelmann. 2002. and regulation of the immune response. Immunol. Today 9: 222–229. Phosphodiesterase isoenzyme families in human osteoarthritis chondrocytes— 6. Skalhegg, B. S., B. F. Landmark, S. O. Doskeland, V. Hansson, T. Lea, and functional importance of phosphodiesterase 4. Br. J. Pharmacol. 135: 609–618. T. Jahnsen. 1992. Cyclic AMP-dependent protein kinase type I mediates the inhibitory effects of 3Ј,5Ј-cyclic adenosine monophosphate on cell replication in 34. Gresch, O., F. B. Engel, D. Nesic, T. T. Tran, H. M. England, E. S. Hickman, human T lymphocytes. J. Biol. Chem. 267: 15707–15714. I. Korner, L. Gan, S. Chen, and S. Castro-Obregon. 2004. New non-viral method 7. Tamir, A., and N. Isakov. 1994. Cyclic AMP inhibits phosphatidylinositol-cou- for gene transfer into primary cells. Methods 33: 151–163. pled and -uncoupled mitogenic signals in T lymphocytes: evidence that cAMP 35. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression Ϫ⌬⌬ alters PKC-induced transcription regulation of members of the jun and fos family data using real-time quantitative PCR and the 2 ( Ct) method. Methods 25: 402–408. of genes. J. Immunol. 152: 3391–3399. ϩ 8. Selliah, N., M. M. Bartik, S. L. Carlson, W. H. Brooks, and T. L. Roszman. 1995. 36. Bell, E. B., S. M. Sparshott, and C. Bunce. 1998. CD4 T-cell memory, CD45R cAMP accumulation in T-cells inhibits anti-CD3 monoclonal antibody-induced subsets and the persistence of antigen—a unifying concept. Immunol. Today 19: actin polymerization. J. Neuroimmunol. 56: 107–112. 60–64. 9. Torgersen, K. M., T. Vang, H. Abrahamsen, S. Yaqub, and K. Tasken. 2002. 37. Banner, K. H., and M. A. Trevethick. 2004. PDE4 inhibition: a novel approach Molecular mechanisms for protein kinase A-mediated modulation of immune for the treatment of inflammatory bowel disease. Trends Pharmacol. Sci. 25: function. Cell. Signal. 14: 1–9. 430–436. 10. Loza, M. J., S. Foster, S. P. Peters, and R. B. Penn. 2006. ␤-Agonists modulate 38. Landells, L. J., C. M. Szilagy, N. A. Jones, K. H. Banner, J. M. Allen, A. Doherty, T-cell functions via direct actions on type 1 and type 2 cells. Blood 107: B. J. O’Connor, D. Spina, and C. P. Page. 2001. Identification and quantification 2052–2060. of phosphodiesterase 4 subtypes in CD4 and CD8 lymphocytes from healthy and 11. Ledbetter, J. A., M. Parsons, P. J. Martin, J. A. Hansen, P. S. Rabinovitch, and asthmatic subjects. Br. J. Pharmacol. 133: 722–729. C. H. June. 1986. Antibody binding to CD5 (Tp67) and Tp44 T cell surface 39. Gantner, F., H. Tenor, V. Gekeler, C. Schudt, A. Wendel, and A. Hatzelmann. molecules: effects on cyclic nucleotides, cytoplasmic free calcium, and cAMP- 1997. Phosphodiesterase profiles of highly purified human peripheral blood leu- mediated suppression. J. Immunol. 137: 3299–3305. kocyte populations from normal and atopic individuals: a comparative study. 12. Kammer, G. M., C. A. Boehm, S. A. Rudolph, and L. A. Schultz. 1988. Mobility J. Allergy Clin. Immunol. 100: 527–535. of the human T lymphocyte surface molecules CD3, CD4, and CD8: regulation 40. Seybold, J., R. Newton, L. Wright, P. A. Finney, N. Suttorp, P. J. Barnes, by a cAMP-dependent pathway. Proc. Natl. Acad. Sci. USA 85: 792–796. I. M. Adcock, and M. A. Giembycz. 1998. Induction of phosphodiesterases 3B, 13. Lugnier, C. 2006. Cyclic nucleotide phosphodiesterase (PDE) superfamily: a new 4A4, 4D1, 4D2, and 4D3 in Jurkat T-cells and in human peripheral blood T- target for the development of specific therapeutic agents. Pharmacol. Ther. 109: lymphocytes by 8-bromo-cAMP and Gs-coupled receptor agonists: potential role 366–398. in ␤2-adrenoreceptor desensitization. J. Biol. Chem. 273: 20575–20588. The Journal of Immunology 4831

41. Jiang, X., M. Paskind, R. Weltzien, and P. M. Epstein. 1998. Expression and 48. Sette, C., and M. Conti. 1996. Phosphorylation and activation of a cAMP-specific regulation of mRNA for distinct isoforms of cAMP-specific PDE-4 in mitogen- phosphodiesterase by the cAMP-dependent protein kinase: involvement of serine stimulated and leukemic human lymphocytes. Cell Biochem. Biophys. 28: 54 in the enzyme activation. J. Biol. Chem. 271: 16526–16534. 135–160. 49. Ekholm, D., P. Belfrage, V. Manganiello, and E. Degerman. 1997. Protein kinase 42. Kanda, N., and S. Watanabe. 2001. Regulatory roles of adenylate cyclase and A-dependent activation of PDE4 (cAMP-specific cyclic nucleotide phosphodies- cyclic nucleotide phosphodiesterases 1 and 4 in interleukin-13 production by terase) in cultured bovine vascular smooth muscle cells. Biochim. Biophys. Acta activated human T cells. Biochem. Pharmacol. 62: 495–507. 1356: 64–70. 43. Lanzavecchia, A., and F. Sallusto. 2000. Dynamics of T lymphocyte responses: intermediates, effectors, and memory cells. Science 290: 92–97. 50. MacKenzie, S. J., G. S. Baillie, I. McPhee, C. MacKenzie, R. Seamons, 44. Vang, T., H. Abrahamsen, S. Myklebust, J. Enserink, H. Prydz, T. Mustelin, T. McSorley, J. Millen, M. B. Beard, G. Van Heeke, and M. D. Houslay. 2002. M. Amarzguioui, and K. Tasken. 2004. Knockdown of C-terminal Src kinase by Long PDE4 cAMP specific phosphodiesterases are activated by protein kinase siRNA-mediated RNA interference augments T cell receptor signaling in mature A-mediated phosphorylation of a single serine residue in upstream conserved T cells. Eur. J. Immunol. 34: 2191–2199. region 1 (UCR1). Br. J. Pharmacol. 136: 421–433. 45. Methi, T., J. Ngai, M. Mahic, M. Amarzguioui, T. Vang, and K. Tasken. 2005. 51. Laliberte, F., S. Liu, E. Gorseth, B. Bobechko, A. Bartlett, P. Lario, M. J. Gresser, Short-interfering RNA-mediated Lck knockdown results in augmented down- and Z. Huang. 2002. In vitro PKA phosphorylation-mediated human PDE4A4 stream T cell responses. J. Immunol. 175: 7398–7406. activation. FEBS Lett. 512: 205–208. 46. Skapenko, A., J. Leipe, U. Niesner, K. Devriendt, R. Beetz, A. Radbruch, J. R. Kalden, P. E. Lipsky, and H. Schulze-Koops. 2004. GATA-3 in human T 52. Asirvatham, A. L., S. G. Galligan, R. V. Schillace, M. P. Davey, V. Vasta, cell helper type 2 development. J. Exp. Med. 199: 423–428. J. A. Beavo, and D. W. Carr. 2004. A-kinase anchoring proteins interact with 47. Manning, C. D., M. Burman, S. B. Christensen, L. B. Cieslinski, D. M. Essayan, phosphodiesterases in T lymphocyte cell lines. J. Immunol. 173: 4806–4814. M. Grous, T. J. Torphy, and M. S. Barnette. 1999. Suppression of human in- 53. Baillie, G. S., J. D. Scott, and M. D. Houslay. 2005. Compartmentalisation of flammatory cell function by subtype-selective PDE4 inhibitors correlates with phosphodiesterases and protein kinase A: opposites attract. FEBS Lett. 579: inhibition of PDE4A and PDE4B. Br. J. Pharmacol. 128: 1393–1398. 3264–3270. Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021