Prostate Cancer and Prostatic Diseases (2005) 8, 321–326 & 2005 Nature Publishing Group All rights reserved 1365-7852/05 $30.00 www.nature.com/pcan p21WAF1/CIP1 gene is inactivated in metastatic prostatic cancer cell lines by promoter methylation SRJ Bott1*, M Arya1, RS Kirby1 & M Williamson1 1Prostate Cancer Research Centre, Institute of Urology, University College London, London, UK Introduction: p21WAF1/CIP1 may act as a tumour suppressor gene (TSG) and loss of the p21WAF1/CIP1 gene has been reported in several solid tumours. The aim of this study was to see whether p21WAF1/CIP1 was expressed in metastatic prostate cancer cell lines and to determine if there was methylation of the p21WAF1/CIP1 promoter. Method: PC3, LNCaP and DU145 metastatic prostate cancer cell lines, 1542NP normal prostate, and RD rhabdomyosarcoma cell lines were cultured in the demethylating agent 5-Aza-2 deoxycytidine (5-Aza-CdR). p21WAF1/CIP1 mRNA expression was analysed by RT-PCR. DNA from untreated cell lines was modified with sodium bisulphite and promoter sequencing was performed. Results: p21WAF1/CIP1 was expressed at low or undetectable levels in metastatic prostate cancer cell lines but expression was reactivated by treatment with 5-Aza-CdR. Sequence analysis of the promoter region revealed several sites of methylation at the 50 end of a CpG island in the PC3, LNCaP and DU145 cell line DNA but not in the normal prostate control DNA. Most notably the Sis-inducible element (SEI)-1—a STAT1-binding site, was methylated. Conclusions: In this study, we show that p21WAF1/CIP1 expression in metastatic prostate cancer cell lines is enhanced as a result of demethylation of the DNA. Furthermore, several cytosine residues in the promoter region are methylated, including critical binding sites. The inhibition of the STAT1-signalling pathway by methylation of the promoter may inactivate the p21WAF1/CIP1 TSG in prostate cancer. Prostate Cancer and Prostatic Diseases (2005) 8, 321–326. doi:10.1038/sj.pcan.4500822; published online 8 November 2005 Keywords: p21WAF1/CIP1; methylation; prostate cancer; STAT1; metastases Introduction independent manner.6 p21WAF1/CIP1 also inhibits DNA replication directly, by binding to the proliferating Progression through the G1/S checkpoint of the cell cycle nuclear antigen (PCNA), a subunit of DNA polymerase is regulated by a family of cyclin-dependent kinases d.9,10 In addition to its associations with CDKs and (CDKs), whose activity is in turn controlled by CDK PCNA, p21WAF1/CIP1 participates in specific protein-to- WAF1/CIP1 WAF1/CIP1 inhibitors (CDKIs), including p21 . p21 protein interactions, acting both on other cell cycle was identified simultaneously as a mediator of p53- regulators and as a modulator of apoptosis.11 induced growth arrest (wild-type p53-activated fragment Malignancy is characterised by the inability of cells to 1 2 1) and as a regulator of CDK (CDK-interacting protein). respond correctly to growth arrest signals. The various 3 4–6 7 Factors including TGF-b, IFN-a, IFN-b, IFN-g, IL-6 roles of p21WAF1/CIP1 and other CDKIs as inhibitors of 8 WAF1/CIP1 and EGF, have been shown to upregulate p21 the cell cycle and as a modulators of apoptosis and via the JAK-STAT and other pathways, in a p53- differentiation implies a tumour suppressor function.12,13 Decreased levels of CDKIs, or increased cyclin-CDK *Correspondence: SRJ Bott, 7 Rostrevor Road, Wimbledon, London levels, may lead to inappropriate cell division. Alterna- SW19 7AP, UK. E-mail: [email protected] tively, decreased levels of CDKIs may limit the cellular Received 27 February 2005; revised 30 June 2005; accepted 30 June 2005; published online 8 November 2005 response to DNA damage. p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 322 Lack of p21WAF1/CIP1 gene expression has been related the enzyme DNA methyltransferase and thus prevents to poor prognosis in several solid cancers including DNA methylation during replication. Following treat- pancreatic,14 gastric,15 bladder16 and non-small-cell lung ment for 24 h the test and control media was replaced cancers.17 Immunohistochemical studies have shown with standard growth medium (RPMI-1640, FCS, G). reduced p21WAF1/CIP1 protein expression in prostate After 5 days the cells were harvested, snap frozen and cancer can be used to predict poor survival outcome.18,19 stored at À801C. Cell culture was performed in triplicate. Although decreased p21WAF1/CIP1 expression is often RNA from cell lines was extracted using RNeasys detected in cancer cells, the mechanism of inactivation is mini kits (QIAGENs), according to the manufacturer’s not known, mutations and allelic loss of p21WAF1/CIP1 are instructions. In all, 1 mg total cellular RNA was reverse rarely found.6,20 In acute lymphoblastic leukaemia poor transcribed using oligodT primers and SuperScript II prognosis is associated with transcriptional silencing of reverse transcriptase (RT) (QIAGENs). the p21WAF1/CIP1 gene, in this instance decreased expres- cDNA was amplified using intragenic primers at p21 sion occurs by methylation of the CpG islands in the (Table 1), spanning a region À990 to À67 relative to the promoter region.21 transcription start site and to the glyceraldehyde DNA methylation involves the addition of a methyl phosphate dehydrogenase gene (GAPDH). Reactions group to the carbon-5 position of cytosine residues, and were performed in a Perkin Elmer-Gene Amp 2400 occurs almost exclusively at cytosine residues that are thermal cycler (Perkin Elmer Ltd, UK), at 941C for 150 s, immediately followed by guanine (CpG dinucleotides). then 34 cycles at 941C for 45 s, 601C for 45 s and 721C for Isolated CpG dinucleotides are relatively rare and are 45 s, followed by an extension step at 721C for 5 min. The nearly always methylated. In contrast, small stretches PCR products were electrophoresed through a 1.5% of DNA rich in CpG dinucleotides, the CpG islands, are agarose gel, DNA extraction was performed using the usually free of methylation. These CpG islands are DNeasy Tissue kits according to the manufacturer’s frequently found in the promoter region of human genes protocol. The CgGenomet DNA modification kit (Inter- and methylation within the islands has been associated gen) was used to treat 1 mg of DNA extracted from PC3, with transcriptional inactivation of the corresponding LNCaP, DU145, RD, 1542NP cell lines with sodium gene. Alteration in DNA methylation in the promoter bisulphite (modified DNA). Sodium bisulphite deami- region of tumour suppressor genes (TSGs) may be nates cytosine, removing the NH2 group from carbon-4 pivotal to the development of cancer.22 The aim of this and converting cytosine to uracil, unless the cytosine study was to examine p21WAF1/CIP1 expression in meta- is methylated in the carbon-5 position. During PCR static prostate cancer cell lines and to assess the amplification uracil binds adenine and adenine binds methylation status of the promoter region. thymine. Consequently, following bisulphite modifica- tion an unmethylated cytosine will sequence as thymine and a methylated cytosine will sequence as cytosine. Primers were designed to yield product containing the Materials and methods CpG islands of the promoter region, as methylation at these sites may be associated with transcriptional Cell culture and treatment inactivation. CpG sites were not included in the primer sequence as this repeating sequence would reduce the Human metastatic prostate cancer cell lines PC3, LNCaP, specificity of primer annealing. As CpG sites were not DU145 and 1542 NP a normal prostate epithelial cell line, included in the sequence, primers were designed for were obtained from the originators, RD a rhabdomyo- DNA in which all cytosine were converted to uracil by sarcoma cell line was obtained from ATCC. LNCaP cells modification with sodium bisulphite, these were termed have a slower replication rate than the other cells lines. In modification primers (M). Primers were also designed all, 500 000 PC3, DU145, 1542NP, RD cells and 106 cell at the same sites for untreated DNA, named unmodified LNCaP cell were plated in T80 flasks containing RPMI- (U) primers, these were used as a control. Sense and 1640 (Gibco BRL), 10% foetal calf serum (FCS) and 1% of antisense primers for the modified (M1 and M2) and WAF1/CIP1 L-glutamine (G). After 16 h, 500 nM of the demethylating unmodified (U1) promoter region of p21 inclu- agent 5-Aza-2 deoxycytidine (5-Aza-CdR) (Sigma Che- ding the Sis-inducible element (SIE)-1 STAT-binding site mical Co: A 3656 C8H12N4O4)in15ml of phosphate buffer at À692, are shown in Table 2. Sense and antisense solution (PBS) was added to the test flasks and 15 ml PBS primers were used as the PCR products had long was added to the control flasks. 5-Aza-CdR sequesters sequences. The PCR protocol was 951C for 150 s, then Table 1 Intragenic primers in p21 WAF1/CIP1 used to amplify cDNA Primer Sequence Annealing temperature Product size (bp) P21 sense tgaccctgaagtgagcacagcc 601C 834 p21 antisense gccgagagaaaacagtccaggc Prostate Cancer and Prostatic Diseases p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 323 by 36 cycles at 951C for 45 s, 60–621C for 30 s and 721C low level, following 5-Aza-CdR treatment gene expres- for 45 s, followed by an extension step at 721C for 5 min sion increased (Figure 1a). 1542NP cells expressed and was performed in a Perkin Elmer-Gene Amp p21WAF1/CIP1 before and after treatment with 5-Aza- 2400 thermal cycler (Perkin Elmer Ltd, UK). CdR. The GAPDH control confirmed equivalent quan- PCR product was electrophoresed on a 1.5% agarose tities of cDNA in the treated and untreated pairs gel and extracted using a QIAquick Gel Extraction Kits (Figure 1b). Figure 2 demonstrates treatment with (QIAGEN). The PCR products were sequenced directly 5-Aza-CdR has a profound effect on the rate of cell using both sense and antisense primers by cycle division.