DOCSLIB.ORG

P21 Gene Is Inactivated in Metastatic Prostatic Cancer Cell Lines by Promoter Methylation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
P21 Gene Is Inactivated in Metastatic Prostatic Cancer Cell Lines by Promoter Methylation Prostate Cancer and Prostatic Diseases (2005) 8, 321–326 & 2005 Nature Publishing Group All rights reserved 1365-7852/05 $30.00 www.nature.com/pcan p21WAF1/CIP1 gene is inactivated in metastatic prostatic cancer cell lines by promoter methylation SRJ Bott1*, M Arya1, RS Kirby1 & M Williamson1 1Prostate Cancer Research Centre, Institute of Urology, University College London, London, UK Introduction: p21WAF1/CIP1 may act as a tumour suppressor gene (TSG) and loss of the p21WAF1/CIP1 gene has been reported in several solid tumours. The aim of this study was to see whether p21WAF1/CIP1 was expressed in metastatic prostate cancer cell lines and to determine if there was methylation of the p21WAF1/CIP1 promoter. Method: PC3, LNCaP and DU145 metastatic prostate cancer cell lines, 1542NP normal prostate, and RD rhabdomyosarcoma cell lines were cultured in the demethylating agent 5-Aza-2 deoxycytidine (5-Aza-CdR). p21WAF1/CIP1 mRNA expression was analysed by RT-PCR. DNA from untreated cell lines was modified with sodium bisulphite and promoter sequencing was performed. Results: p21WAF1/CIP1 was expressed at low or undetectable levels in metastatic prostate cancer cell lines but expression was reactivated by treatment with 5-Aza-CdR. Sequence analysis of the promoter region revealed several sites of methylation at the 50 end of a CpG island in the PC3, LNCaP and DU145 cell line DNA but not in the normal prostate control DNA. Most notably the Sis-inducible element (SEI)-1—a STAT1-binding site, was methylated. Conclusions: In this study, we show that p21WAF1/CIP1 expression in metastatic prostate cancer cell lines is enhanced as a result of demethylation of the DNA. Furthermore, several cytosine residues in the promoter region are methylated, including critical binding sites. The inhibition of the STAT1-signalling pathway by methylation of the promoter may inactivate the p21WAF1/CIP1 TSG in prostate cancer. Prostate Cancer and Prostatic Diseases (2005) 8, 321–326. doi:10.1038/sj.pcan.4500822; published online 8 November 2005 Keywords: p21WAF1/CIP1; methylation; prostate cancer; STAT1; metastases Introduction independent manner.6 p21WAF1/CIP1 also inhibits DNA replication directly, by binding to the proliferating Progression through the G1/S checkpoint of the cell cycle nuclear antigen (PCNA), a subunit of DNA polymerase is regulated by a family of cyclin-dependent kinases d.9,10 In addition to its associations with CDKs and (CDKs), whose activity is in turn controlled by CDK PCNA, p21WAF1/CIP1 participates in specific protein-to- WAF1/CIP1 WAF1/CIP1 inhibitors (CDKIs), including p21 . p21 protein interactions, acting both on other cell cycle was identified simultaneously as a mediator of p53- regulators and as a modulator of apoptosis.11 induced growth arrest (wild-type p53-activated fragment Malignancy is characterised by the inability of cells to 1 2 1) and as a regulator of CDK (CDK-interacting protein). respond correctly to growth arrest signals. The various 3 4–6 7 Factors including TGF-b, IFN-a, IFN-b, IFN-g, IL-6 roles of p21WAF1/CIP1 and other CDKIs as inhibitors of 8 WAF1/CIP1 and EGF, have been shown to upregulate p21 the cell cycle and as a modulators of apoptosis and via the JAK-STAT and other pathways, in a p53- differentiation implies a tumour suppressor function.12,13 Decreased levels of CDKIs, or increased cyclin-CDK *Correspondence: SRJ Bott, 7 Rostrevor Road, Wimbledon, London levels, may lead to inappropriate cell division. Alterna- SW19 7AP, UK. E-mail: [email protected] tively, decreased levels of CDKIs may limit the cellular Received 27 February 2005; revised 30 June 2005; accepted 30 June 2005; published online 8 November 2005 response to DNA damage. p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 322 Lack of p21WAF1/CIP1 gene expression has been related the enzyme DNA methyltransferase and thus prevents to poor prognosis in several solid cancers including DNA methylation during replication. Following treat- pancreatic,14 gastric,15 bladder16 and non-small-cell lung ment for 24 h the test and control media was replaced cancers.17 Immunohistochemical studies have shown with standard growth medium (RPMI-1640, FCS, G). reduced p21WAF1/CIP1 protein expression in prostate After 5 days the cells were harvested, snap frozen and cancer can be used to predict poor survival outcome.18,19 stored at À801C. Cell culture was performed in triplicate. Although decreased p21WAF1/CIP1 expression is often RNA from cell lines was extracted using RNeasys detected in cancer cells, the mechanism of inactivation is mini kits (QIAGENs), according to the manufacturer’s not known, mutations and allelic loss of p21WAF1/CIP1 are instructions. In all, 1 mg total cellular RNA was reverse rarely found.6,20 In acute lymphoblastic leukaemia poor transcribed using oligodT primers and SuperScript II prognosis is associated with transcriptional silencing of reverse transcriptase (RT) (QIAGENs). the p21WAF1/CIP1 gene, in this instance decreased expres- cDNA was amplified using intragenic primers at p21 sion occurs by methylation of the CpG islands in the (Table 1), spanning a region À990 to À67 relative to the promoter region.21 transcription start site and to the glyceraldehyde DNA methylation involves the addition of a methyl phosphate dehydrogenase gene (GAPDH). Reactions group to the carbon-5 position of cytosine residues, and were performed in a Perkin Elmer-Gene Amp 2400 occurs almost exclusively at cytosine residues that are thermal cycler (Perkin Elmer Ltd, UK), at 941C for 150 s, immediately followed by guanine (CpG dinucleotides). then 34 cycles at 941C for 45 s, 601C for 45 s and 721C for Isolated CpG dinucleotides are relatively rare and are 45 s, followed by an extension step at 721C for 5 min. The nearly always methylated. In contrast, small stretches PCR products were electrophoresed through a 1.5% of DNA rich in CpG dinucleotides, the CpG islands, are agarose gel, DNA extraction was performed using the usually free of methylation. These CpG islands are DNeasy Tissue kits according to the manufacturer’s frequently found in the promoter region of human genes protocol. The CgGenomet DNA modification kit (Inter- and methylation within the islands has been associated gen) was used to treat 1 mg of DNA extracted from PC3, with transcriptional inactivation of the corresponding LNCaP, DU145, RD, 1542NP cell lines with sodium gene. Alteration in DNA methylation in the promoter bisulphite (modified DNA). Sodium bisulphite deami- region of tumour suppressor genes (TSGs) may be nates cytosine, removing the NH2 group from carbon-4 pivotal to the development of cancer.22 The aim of this and converting cytosine to uracil, unless the cytosine study was to examine p21WAF1/CIP1 expression in meta- is methylated in the carbon-5 position. During PCR static prostate cancer cell lines and to assess the amplification uracil binds adenine and adenine binds methylation status of the promoter region. thymine. Consequently, following bisulphite modifica- tion an unmethylated cytosine will sequence as thymine and a methylated cytosine will sequence as cytosine. Primers were designed to yield product containing the Materials and methods CpG islands of the promoter region, as methylation at these sites may be associated with transcriptional Cell culture and treatment inactivation. CpG sites were not included in the primer sequence as this repeating sequence would reduce the Human metastatic prostate cancer cell lines PC3, LNCaP, specificity of primer annealing. As CpG sites were not DU145 and 1542 NP a normal prostate epithelial cell line, included in the sequence, primers were designed for were obtained from the originators, RD a rhabdomyo- DNA in which all cytosine were converted to uracil by sarcoma cell line was obtained from ATCC. LNCaP cells modification with sodium bisulphite, these were termed have a slower replication rate than the other cells lines. In modification primers (M). Primers were also designed all, 500 000 PC3, DU145, 1542NP, RD cells and 106 cell at the same sites for untreated DNA, named unmodified LNCaP cell were plated in T80 flasks containing RPMI- (U) primers, these were used as a control. Sense and 1640 (Gibco BRL), 10% foetal calf serum (FCS) and 1% of antisense primers for the modified (M1 and M2) and WAF1/CIP1 L-glutamine (G). After 16 h, 500 nM of the demethylating unmodified (U1) promoter region of p21 inclu- agent 5-Aza-2 deoxycytidine (5-Aza-CdR) (Sigma Che- ding the Sis-inducible element (SIE)-1 STAT-binding site mical Co: A 3656 C8H12N4O4)in15ml of phosphate buffer at À692, are shown in Table 2. Sense and antisense solution (PBS) was added to the test flasks and 15 ml PBS primers were used as the PCR products had long was added to the control flasks. 5-Aza-CdR sequesters sequences. The PCR protocol was 951C for 150 s, then Table 1 Intragenic primers in p21 WAF1/CIP1 used to amplify cDNA Primer Sequence Annealing temperature Product size (bp) P21 sense tgaccctgaagtgagcacagcc 601C 834 p21 antisense gccgagagaaaacagtccaggc Prostate Cancer and Prostatic Diseases p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 323 by 36 cycles at 951C for 45 s, 60–621C for 30 s and 721C low level, following 5-Aza-CdR treatment gene expres- for 45 s, followed by an extension step at 721C for 5 min sion increased (Figure 1a). 1542NP cells expressed and was performed in a Perkin Elmer-Gene Amp p21WAF1/CIP1 before and after treatment with 5-Aza- 2400 thermal cycler (Perkin Elmer Ltd, UK). CdR. The GAPDH control confirmed equivalent quan- PCR product was electrophoresed on a 1.5% agarose tities of cDNA in the treated and untreated pairs gel and extracted using a QIAquick Gel Extraction Kits (Figure 1b). Figure 2 demonstrates treatment with (QIAGEN). The PCR products were sequenced directly 5-Aza-CdR has a profound effect on the rate of cell using both sense and antisense primers by cycle division.
Load more

Recommended publications
  • FOXA2 Is a Sensitive and Specific Marker for Small Cell Neuroendocrine Carcinoma of the Prostate Jung Wook Park1, John K Lee2,3, Owen N Witte1,4,5 and Jiaoti Huang6
    Modern Pathology (2017) 30, 1262–1272 1262 © 2017 USCAP, Inc All rights reserved 0893-3952/17 $32.00 FOXA2 is a sensitive and specific marker for small cell neuroendocrine carcinoma of the prostate Jung Wook Park1, John K Lee2,3, Owen N Witte1,4,5 and Jiaoti Huang6 1Department of Microbiology, Immunology and Molecular Genetics, David Geffen School of Medicine, University of California—Los Angeles, Los Angeles, CA, USA; 2Division of Hematology and Oncology, Department of Medicine, David Geffen School of Medicine, University of California—Los Angeles, Los Angeles, CA, USA; 3Molecular Biology Institute, David Geffen School of Medicine, University of California— Los Angeles, Los Angeles, CA, USA; 4Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, University of California—Los Angeles, Los Angeles, CA, USA; 5Department of Molecular and Medical Pharmacology, David Geffen School of Medicine, University of California—Los Angeles, Los Angeles, CA, USA and 6Department of Pathology, Duke University School of Medicine, Durham, NC, USA The median survival of patients with small cell neuroendocrine carcinoma is significantly shorter than that of patients with classic acinar-type adenocarcinoma. Small cell neuroendocrine carcinoma is traditionally diagnosed based on histologic features because expression of current immunohistochemical markers is inconsistent. This is a challenging diagnosis even for expert pathologists and particularly so for pathologists who do not specialize in prostate cancer. New biomarkers to aid in the diagnosis of small cell neuroendocrine carcinoma are therefore urgently needed. We discovered that FOXA2, a pioneer transcription factor, is frequently and specifically expressed in small cell neuroendocrine carcinoma compared with prostate adenocarcinoma from published mRNA-sequencing data of a wide range of human prostate cancers.
    [Show full text]
  • CDK-Independent and PCNA-Dependent Functions of P21 in DNA Replication
    G C A T T A C G G C A T genes Review CDK-Independent and PCNA-Dependent Functions of p21 in DNA Replication Sabrina Florencia Mansilla , María Belén De La Vega y, Nicolás Luis Calzetta y, Sebastián Omar Siri y and Vanesa Gottifredi * Cell Cycle and Genomic Stability Laboratory, Fundación Instituto Leloir, IIBBA-CONICET, Av. Patricias Argentinas 435, Buenos Aires 1405, Argentina; [email protected] (S.F.M.); [email protected] (M.B.D.L.V.); [email protected] (N.L.C.); [email protected] (S.O.S.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 9 April 2020; Accepted: 15 May 2020; Published: 28 May 2020 Abstract: p21Waf/CIP1 is a small unstructured protein that binds and inactivates cyclin-dependent kinases (CDKs). To this end, p21 levels increase following the activation of the p53 tumor suppressor. CDK inhibition by p21 triggers cell-cycle arrest in the G1 and G2 phases of the cell cycle. In the absence of exogenous insults causing replication stress, only residual p21 levels are prevalent that are insufficient to inhibit CDKs. However, research from different laboratories has demonstrated that these residual p21 levels in the S phase control DNA replication speed and origin firing to preserve genomic stability. Such an S-phase function of p21 depends fully on its ability to displace partners from chromatin-bound proliferating cell nuclear antigen (PCNA). Vice versa, PCNA also regulates p21 by preventing its upregulation in the S phase, even in the context of robust p21 induction by γ irradiation.
    [Show full text]
  • Cadherin-11 Promotes the Metastasis of Prostate Cancer Cells to Bone
    Cadherin-11 Promotes the Metastasis of Prostate Cancer Cells to Bone Khoi Chu,2 Chien-Jui Cheng,6 Xiangcang Ye,1 Yu-Chen Lee,1 Amado J.Zurita, 2 Dung-Tsa Chen,7 Li-Yuan Yu-Lee,5 Sui Zhang,4 Edward T.Yeh, 4 Mickey C-T.Hu, 3 Christopher J.Logothetis, 2 and Sue-Hwa Lin1,2 Departments of 1Molecular Pathology, 2Genitourinary Medical Oncology, 3Molecular and Cellular Oncology, and 4Cardiology, The University of Texas M. D. Anderson Cancer Center; 5Department of Medicine, Baylor College of Medicine, Houston, Texas; 6Department of Pathology, Taipei Medical University and Hospital, Taipei, Taiwan; and 7Biostatistics Division, Moffitt Cancer Center and Research Institute, University of South Florida, Tampa, Florida Abstract Introduction Bone is the most common site of metastases from Prostate cancer is the most common cancer among men. prostate cancer.The mechanism by which prostate The mortality from this disease results mostly from the cancer cells metastasize to bone is not fully understood, metastasis of tumor cells to secondary sites, particularly bone. but interactions between prostate cancer cells and bone Prostate cancer metastasizes to the bone with high frequency, cells are thought to initiate the colonization of metastatic causing significant morbidity and mortality (1). Jacobs (2) cells at that site.Here, we show that cadherin-11 reported that 80% of men with prostate cancer had bone (also known as osteoblast-cadherin) was highly metastases at autopsy. A more recent rapid autopsy study also expressed in prostate cancer cell line derived from bone reported that f80% of patients who die from prostate cancer metastases and had strong homophilic binding to have metastases in bone (3), further confirming the prevalence recombinant cadherin-11 in vitro.Down-regulation of of bone metastasis in prostate cancer.
    [Show full text]
  • P14ARF Inhibits Human Glioblastoma–Induced Angiogenesis by Upregulating the Expression of TIMP3
    P14ARF inhibits human glioblastoma–induced angiogenesis by upregulating the expression of TIMP3 Abdessamad Zerrouqi, … , Daniel J. Brat, Erwin G. Van Meir J Clin Invest. 2012;122(4):1283-1295. https://doi.org/10.1172/JCI38596. Research Article Oncology Malignant gliomas are the most common and the most lethal primary brain tumors in adults. Among malignant gliomas, 60%–80% show loss of P14ARF tumor suppressor activity due to somatic alterations of the INK4A/ARF genetic locus. The tumor suppressor activity of P14ARF is in part a result of its ability to prevent the degradation of P53 by binding to and sequestering HDM2. However, the subsequent finding of P14ARF loss in conjunction with TP53 gene loss in some tumors suggests the protein may have other P53-independent tumor suppressor functions. Here, we report what we believe to be a novel tumor suppressor function for P14ARF as an inhibitor of tumor-induced angiogenesis. We found that P14ARF mediates antiangiogenic effects by upregulating expression of tissue inhibitor of metalloproteinase–3 (TIMP3) in a P53-independent fashion. Mechanistically, this regulation occurred at the gene transcription level and was controlled by HDM2-SP1 interplay, where P14ARF relieved a dominant negative interaction of HDM2 with SP1. P14ARF-induced expression of TIMP3 inhibited endothelial cell migration and vessel formation in response to angiogenic stimuli produced by cancer cells. The discovery of this angiogenesis regulatory pathway may provide new insights into P53-independent P14ARF tumor-suppressive mechanisms that have implications for the development of novel therapies directed at tumors and other diseases characterized by vascular pathology. Find the latest version: https://jci.me/38596/pdf Research article P14ARF inhibits human glioblastoma–induced angiogenesis by upregulating the expression of TIMP3 Abdessamad Zerrouqi,1 Beata Pyrzynska,1,2 Maria Febbraio,3 Daniel J.
    [Show full text]
  • Prostate News
    Prostate Cancer and Prostatic Diseases (2008) 11, 108–111 & 2008 Nature Publishing Group All rights reserved 1365-7852/08 $30.00 www.nature.com/pcan RESEARCH HIGHLIGHTS Prostate News Prostate Cancer and Prostatic Diseases (2008) 11, 108–111; doi:10.1038/pcan.2008.24 Changing biopsy patterns affect Clinical trial recommendations screening predictive value In 1999, the Prostate-Specific Antigen Working Group A large body of literature establishes the contribution of offered consensus recommendations for the conduct prostate-specific antigen (PSA) screening to the improve- of clinical trials. Their focus was on the development ment of prostate cancer detection. However, much of the of trials for patients with progressive disease who had data derived from the early and mid 1990s, and since undergone castration specifically with regard to the use then prostate biopsy practice patterns have changed of PSA level. A year later, the New Guidelines to significantly. Early on the predictive power of PSA Evaluate the Response to Treatment in Solid Tumors screening depended on the high prevalence of the criteria were introduced from a broader and interna- disease, the higher prevalence of high-grade disease tional group of researchers. Their focus was on standar- and the low likelihood of prostate cancer diagnosis in dizing the criteria used in clinical trials to assess tumor men with low PSA titers. Biopsy factors that affect the response for all solid tumors, whether arising in the changes in value of PSA screening include the increased prostate or elsewhere. However, if trial outcomes were number of biopsy cores obtained routinely and changes based solely on either of these two sets of criteria, none of in how pathologists interpret biopsy samples.
    [Show full text]
  • Transcriptional Regulation of the P16 Tumor Suppressor Gene
    ANTICANCER RESEARCH 35: 4397-4402 (2015) Review Transcriptional Regulation of the p16 Tumor Suppressor Gene YOJIRO KOTAKE, MADOKA NAEMURA, CHIHIRO MURASAKI, YASUTOSHI INOUE and HARUNA OKAMOTO Department of Biological and Environmental Chemistry, Faculty of Humanity-Oriented Science and Engineering, Kinki University, Fukuoka, Japan Abstract. The p16 tumor suppressor gene encodes a specifically bind to and inhibit the activity of cyclin-CDK specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 complexes, thus preventing G1-to-S progression (4, 5). and is found altered in a wide range of human cancers. p16 Among these CKIs, p16 plays a pivotal role in the regulation plays a pivotal role in tumor suppressor networks through of cellular senescence through inhibition of CDK4/6 activity inducing cellular senescence that acts as a barrier to (6, 7). Cellular senescence acts as a barrier to oncogenic cellular transformation by oncogenic signals. p16 protein is transformation induced by oncogenic signals, such as relatively stable and its expression is primary regulated by activating RAS mutations, and is achieved by accumulation transcriptional control. Polycomb group (PcG) proteins of p16 (Figure 1) (8-10). The loss of p16 function is, associate with the p16 locus in a long non-coding RNA, therefore, thought to lead to carcinogenesis. Indeed, many ANRIL-dependent manner, leading to repression of p16 studies have shown that the p16 gene is frequently mutated transcription. YB1, a transcription factor, also represses the or silenced in various human cancers (11-14). p16 transcription through direct association with its Although many studies have led to a deeper understanding promoter region.
    [Show full text]
  • Clusterin-Mediated Apoptosis Is Regulated by Adenomatous Polyposis Coli and Is P21 Dependent but P53 Independent
    [CANCER RESEARCH 64, 7412–7419, October 15, 2004] Clusterin-Mediated Apoptosis Is Regulated by Adenomatous Polyposis Coli and Is p21 Dependent but p53 Independent Tingan Chen,1 Joel Turner,1 Susan McCarthy,1 Maurizio Scaltriti,2 Saverio Bettuzzi,2 and Timothy J. Yeatman1 1Department of Interdisciplinary Oncology, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida; and 2Dipartimento di Medicina Sperimentale, Sezione di Biochimica, Biochimica Clinica e Biochimica dell’Esercizio Fisico, Parma, Italy ABSTRACT ptosis (15). Additional data suggest that a secreted form of clusterin acts as a molecular chaperone, scavenging denatured proteins outside Clusterin is a widely expressed glycoprotein that has been paradoxi- cells following specific stress-induced injury such as heat shock. cally observed to have both pro- and antiapoptotic functions. Recent Other data, show that overexpression of a specific nuclear form of reports suggest this apparent dichotomy of function may be related to two different isoforms, one secreted and cytoplasmic, the other nuclear. To clusterin acts as a prodeath signal (16). Furthermore, studies of human clarify the functional role of clusterin in regulating apoptosis, we exam- colon cancer suggest a conversion from the nuclear form of clusterin ined its expression in human colon cancer tissues and in human colon to the cytoplasmic form, which may promote tumor progression (17). cancer cell lines. We additionally explored its expression and activity using Recently, a link between the accumulation of the nuclear form of models of adenomatous polyposis coli (APC)- and chemotherapy-induced clusterin and anoikis induction in prostate epithelial cells was shown apoptosis. Clusterin RNA and protein levels were decreased in colon (18).
    [Show full text]
  • Complete Deletion of Apc Results in Severe Polyposis in Mice
    Oncogene (2010) 29, 1857–1864 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc SHORT COMMUNICATION Complete deletion of Apc results in severe polyposis in mice AF Cheung1, AM Carter1, KK Kostova1, JF Woodruff1, D Crowley1,2, RT Bronson3, KM Haigis4 and T Jacks1,2 1Koch Institute and Department of Biology, MIT, Cambridge, MA, USA; 2Howard Hughes Medical Institute, MIT, Cambridge, MA, USA; 3Department of Pathology, Tufts University School of Medicine and Veterinary Medicine, Boston, MA, USA and 4Masschusetts General Hospital Cancer Center, Harvard Medical School Department of Pathology, Charlestown, MA, USA The adenomatous polyposis coli (APC) gene product is region of APC termed the mutation cluster region and mutated in the vast majority of human colorectal cancers. result in retained expression of an N-terminal fragment APC negatively regulates the WNT pathway by aiding in of the APC protein (Kinzler and Vogelstein, 1996). the degradation of b-catenin, which is the transcription Genotype–phenotype correlations involving germline factor activated downstream of WNT signaling. APC APC mutations suggest that different lengths and levels mutations result in b-catenin stabilization and constitutive of APC expression can influence the number of polyps WNT pathway activation, leading to aberrant cellular in the gut, the distribution of polyps and extra-colonic proliferation. APC mutations associated with colorectal manifestations of the disease (Soravia et al., 1998; cancer commonly fall in a region of the gene termed the Nieuwenhuis and Vasen, 2007). Specifically, patients mutation cluster region and result in expression of an that present clinically with attenuated FAP have N-terminal fragment of the APC protein.
    [Show full text]
  • Nanocarrier for Prostate Cancer Orielyz Flores1, 2, Santimukul Santra1, Charalambos Kaittanis3, Rania Bassiouni2, Amr S Khaled4, Annette R
    Theranostics 2017, Vol. 7, Issue 9 2477 Ivyspring International Publisher Theranostics 2017; 7(9): 2477-2494. doi: 10.7150/thno.18879 Research Paper PSMA-Targeted Theranostic Nanocarrier for Prostate Cancer Orielyz Flores1, 2, Santimukul Santra1, Charalambos Kaittanis3, Rania Bassiouni2, Amr S Khaled4, Annette R. Khaled2, Jan Grimm3 and J Manuel Perez5 1. Nanoscience Technology Center and Chemistry Department, University of Central Florida, Orlando FL, 32827; 2. Burnett School of Biomedical Science, College of Medicine, University of Central Florida, Orlando FL, 32827; 3. Molecular Pharmacology Program and Department of Radiology, Memorial Sloan Kettering Cancer Center, New York, NY, 10065; 4. Orlando VA Medical Center, Orlando, FL 32827; 5. Biomedical Imaging Research Institute, & Samuel Oschin Comprehensive Cancer Institute, Department of Biomedical Sciences and Department of Neurosurgery, Cedar Sinai Medical Center, Los Angeles CA, 90048. Corresponding author: J Manuel Perez, PhD, Professor, Department of Biomedical Sciences & Department of Neurosurgery, Biomedical Imaging Research Institute & Samuel Oschin Comprehensive Cancer Institute, Cedar Sinai Medical Center, 127 S. San Vicente Blvd, Suite A8113, Los Angeles CA, 90048 Email: [email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2016.12.22; Accepted: 2017.04.12; Published: 2017.06.24 Abstract Herein, we report the use of a theranostic nanocarrier (Folate-HBPE(CT20p)) to deliver a therapeutic peptide to prostate cancer tumors that express PSMA (folate hydrolase 1). The therapeutic peptide (CT20p) targets and inhibits the chaperonin-containing TCP-1 (CCT) protein-folding complex, is selectively cytotoxic to cancer cells, and is non-toxic to normal tissue.
    [Show full text]
  • On the Biological Properties of Prostate Cancer Cells by Modulation of Inflammatory and Steroidogenesis Pathway Genes
    International Journal of Molecular Sciences Article The Impact of Ang-(1-9) and Ang-(3-7) on the Biological Properties of Prostate Cancer Cells by Modulation of Inflammatory and Steroidogenesis Pathway Genes Kamila Domi ´nska 1,* , Karolina Kowalska 2 , Kinga Anna Urbanek 2 , Dominika Ewa Habrowska-Górczy ´nska 2 , Tomasz Och˛edalski 1 and Agnieszka Wanda Piastowska Ciesielska 2 1 Department of Comparative Endocrinology, Medical University of Lodz, Zeligowskiego 7/9, 90-752 Lodz, Poland; [email protected] 2 Department of Cell Cultures and Genomic Analysis, Medical University of Lodz, Zeligowskiego 7/9, 90-752 Lodz, Poland; [email protected] (K.K.); [email protected] (K.A.U.); [email protected] (D.E.H.-G.); [email protected] (A.W.P.C.) * Correspondence: [email protected] Received: 12 July 2020; Accepted: 26 August 2020; Published: 28 August 2020 Abstract: The local renin–angiotensin system (RAS) plays an important role in the pathophysiology of the prostate, including cancer development and progression. The Ang-(1-9) and Ang-(3-7) are the less known active peptides of RAS. This study examines the influence of these two peptide hormones on the metabolic activity, proliferation and migration of prostate cancer cells. Significant changes in MTT dye reduction were observed depending on the type of angiotensin and its concentration as well as time of incubation. Ang-(1-9) did not regulate the 2D cell division of either prostate cancer lines however, it reduced the size of LNCaP colonies formed in soft agar, maybe through down-regulation of the HIF1a gene.
    [Show full text]
  • Loss of P21 Disrupts P14arf-Induced G1 Cell Cycle Arrest but Augments P14arf-Induced Apoptosis in Human Carcinoma Cells
    Oncogene (2005) 24, 4114–4128 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc Loss of p21 disrupts p14ARF-induced G1 cell cycle arrest but augments p14ARF-induced apoptosis in human carcinoma cells Philipp G Hemmati1,3, Guillaume Normand1,3, Berlinda Verdoodt1, Clarissa von Haefen1, Anne Hasenja¨ ger1, DilekGu¨ ner1, Jana Wendt1, Bernd Do¨ rken1,2 and Peter T Daniel*,1,2 1Department of Hematology, Oncology and Tumor Immunology, University Medical Center Charite´, Campus Berlin-Buch, Berlin-Buch, Germany; 2Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch, Germany The human INK4a locus encodes two structurally p16INK4a and p14ARF (termed p19ARF in the mouse), latter unrelated tumor suppressor proteins, p16INK4a and p14ARF of which is transcribed in an Alternative Reading Frame (p19ARF in the mouse), which are frequently inactivated in from a separate exon 1b (Duro et al., 1995; Mao et al., human cancer. Both the proapoptotic and cell cycle- 1995; Quelle et al., 1995; Stone et al., 1995). P14ARF is regulatory functions of p14ARF were initially proposed to usually expressed at low levels, but rapid upregulation be strictly dependent on a functional p53/mdm-2 tumor of p14ARF is triggered by various stimuli, that is, suppressor pathway. However, a number of recent reports the expression of cellular or viral oncogenes including have implicated p53-independent mechanisms in the E2F-1, E1A, c-myc, ras, and v-abl (de Stanchina et al., regulation of cell cycle arrest and apoptosis induction by 1998; Palmero et al., 1998; Radfar et al., 1998; Zindy p14ARF. Here, we show that the G1 cell cycle arrest et al., 1998).
    [Show full text]
  • Rapid Signalling by Androgen Receptor in Prostate Cancer Cells
    Oncogene (1999) 18, 6322 ± 6329 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $15.00 http://www.stockton-press.co.uk/onc Rapid signalling by androgen receptor in prostate cancer cells Heike Peterziel1, Sigrun Mink1, Annette Schonert1, Matthias Becker1, Helmut Klocker2 and Andrew CB Cato*,1 1Forschungszentrum Karlsruhe, Institut fuÈr Toxikologie und Genetik, Postfach 3640, D-76021 Karlsruhe, Germany; 2Department of Urology, University of Innsbruck, Anichstrasse 35, A-6020 Innsbruck, Austria Androgens are important growth regulators in prostate interacts with c-Jun to inhibit the DNA binding cancer. Their known mode of action in target cells activity of this factor (Kallio et al., 1995) or with Ets requires binding to a cytoplasmic androgen receptor transcription factors to downregulate their activities followed by a nuclear translocation event and modulation (Schneikert et al., 1996). of the expression of speci®c genes. Here, we report The ability to regulate gene expression positively and another mode of action of this receptor. Treatment of negatively is not speci®c to the AR but is shared by androgen responsive prostate cancer cells with dihydro- other steroid receptors (Beato et al., 1995). In addition, testosterone leads to a rapid and reversible activation of a number of steroid hormones are reported to rapidly mitogen-activated protein kinases MAPKs (also called and reversibly activate important intermediates in extracellular signal-regulated kinases or Erks). Transient signal transduction pathways known to trigger cell transfection assays demonstrated that the androgen proliferation (Migliaccio et al., 1996, 1998; Endoh et receptor-mediated activation of MAP kinase results in al., 1997; Marcinkowska et al., 1997).
    [Show full text]