sign in sign up
<<
Home , P21, PC3

Cancer and Prostatic Diseases (2005) 8, 321–326 & 2005 Nature Publishing Group All rights reserved 1365-7852/05 $30.00 www.nature.com/pcan p21WAF1/CIP1 is inactivated in metastatic prostatic cancer cell lines by promoter methylation

SRJ Bott1*, M Arya1, RS Kirby1 & M Williamson1 1Prostate Cancer Research Centre, Institute of Urology, University College London, London, UK

Introduction: p21WAF1/CIP1 may act as a tumour suppressor gene (TSG) and loss of the p21WAF1/CIP1 gene has been reported in several solid tumours. The aim of this study was to see whether p21WAF1/CIP1 was expressed in metastatic cell lines and to determine if there was methylation of the p21WAF1/CIP1 promoter. Method: PC3, LNCaP and DU145 metastatic prostate cancer cell lines, 1542NP normal prostate, and RD rhabdomyosarcoma cell lines were cultured in the demethylating agent 5-Aza-2 deoxycytidine (5-Aza-CdR). p21WAF1/CIP1 mRNA expression was analysed by RT-PCR. DNA from untreated cell lines was modified with sodium bisulphite and promoter sequencing was performed. Results: p21WAF1/CIP1 was expressed at low or undetectable levels in metastatic prostate cancer cell lines but expression was reactivated by treatment with 5-Aza-CdR. Sequence analysis of the promoter region revealed several sites of methylation at the 50 end of a CpG island in the PC3, LNCaP and DU145 cell line DNA but not in the normal prostate control DNA. Most notably the Sis-inducible element (SEI)-1—a STAT1-binding site, was methylated. Conclusions: In this study, we show that p21WAF1/CIP1 expression in metastatic prostate cancer cell lines is enhanced as a result of demethylation of the DNA. Furthermore, several cytosine residues in the promoter region are methylated, including critical binding sites. The inhibition of the STAT1-signalling pathway by methylation of the promoter may inactivate the p21WAF1/CIP1 TSG in prostate cancer. Prostate Cancer and Prostatic Diseases (2005) 8, 321–326. doi:10.1038/sj.pcan.4500822; published online 8 November 2005

Keywords: p21WAF1/CIP1; methylation; prostate cancer; STAT1; metastases

Introduction independent manner.6 p21WAF1/CIP1 also inhibits DNA replication directly, by binding to the proliferating Progression through the G1/S checkpoint of the nuclear antigen (PCNA), a subunit of DNA polymerase is regulated by a family of -dependent kinases d.9,10 In addition to its associations with CDKs and (CDKs), whose activity is in turn controlled by CDK PCNA, p21WAF1/CIP1 participates in specific -to- WAF1/CIP1 WAF1/CIP1 inhibitors (CDKIs), including p21 . p21 protein interactions, acting both on other cell cycle was identified simultaneously as a mediator of - regulators and as a modulator of .11 induced growth arrest (wild-type p53-activated fragment Malignancy is characterised by the inability of cells to 1 2 1) and as a regulator of CDK (CDK-interacting protein). respond correctly to growth arrest signals. The various 3 4–6 7 Factors including TGF-b, IFN-a, IFN-b, IFN-g, IL-6 roles of p21WAF1/CIP1 and other CDKIs as inhibitors of 8 WAF1/CIP1 and EGF, have been shown to upregulate p21 the cell cycle and as a modulators of apoptosis and via the JAK-STAT and other pathways, in a p53- differentiation implies a tumour suppressor function.12,13 Decreased levels of CDKIs, or increased cyclin-CDK *Correspondence: SRJ Bott, 7 Rostrevor Road, Wimbledon, London levels, may lead to inappropriate . Alterna- SW19 7AP, UK. E-mail: [email protected] tively, decreased levels of CDKIs may limit the cellular Received 27 February 2005; revised 30 June 2005; accepted 30 June 2005; published online 8 November 2005 response to DNA damage. p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 322 Lack of p21WAF1/CIP1 has been related the enzyme DNA methyltransferase and thus prevents to poor prognosis in several solid cancers including DNA methylation during replication. Following treat- pancreatic,14 gastric,15 bladder16 and non-small-cell lung ment for 24 h the test and control media was replaced cancers.17 Immunohistochemical studies have shown with standard growth medium (RPMI-1640, FCS, G). reduced p21WAF1/CIP1 protein expression in prostate After 5 days the cells were harvested, snap frozen and cancer can be used to predict poor survival outcome.18,19 stored at À801C. was performed in triplicate. Although decreased p21WAF1/CIP1 expression is often RNA from cell lines was extracted using RNeasys detected in cancer cells, the mechanism of inactivation is mini kits (QIAGENs), according to the manufacturer’s not known, mutations and allelic loss of p21WAF1/CIP1 are instructions. In all, 1 mg total cellular RNA was reverse rarely found.6,20 In acute lymphoblastic leukaemia poor transcribed using oligodT primers and SuperScript II prognosis is associated with transcriptional silencing of reverse transcriptase (RT) (QIAGENs). the p21WAF1/CIP1 gene, in this instance decreased expres- cDNA was amplified using intragenic primers at p21 sion occurs by methylation of the CpG islands in the (Table 1), spanning a region À990 to À67 relative to the promoter region.21 transcription start site and to the glyceraldehyde DNA methylation involves the addition of a methyl phosphate dehydrogenase gene (GAPDH). Reactions group to the carbon-5 position of cytosine residues, and were performed in a Perkin Elmer-Gene Amp 2400 occurs almost exclusively at cytosine residues that are thermal cycler (Perkin Elmer Ltd, UK), at 941C for 150 s, immediately followed by guanine (CpG dinucleotides). then 34 cycles at 941C for 45 s, 601C for 45 s and 721C for Isolated CpG dinucleotides are relatively rare and are 45 s, followed by an extension step at 721C for 5 min. The nearly always methylated. In contrast, small stretches PCR products were electrophoresed through a 1.5% of DNA rich in CpG dinucleotides, the CpG islands, are agarose gel, DNA extraction was performed using the usually free of methylation. These CpG islands are DNeasy Tissue kits according to the manufacturer’s frequently found in the promoter region of human protocol. The CgGenomet DNA modification (Inter- and methylation within the islands has been associated gen) was used to treat 1 mg of DNA extracted from PC3, with transcriptional inactivation of the corresponding LNCaP, DU145, RD, 1542NP cell lines with sodium gene. Alteration in DNA methylation in the promoter bisulphite (modified DNA). Sodium bisulphite deami- region of tumour suppressor genes (TSGs) may be nates cytosine, removing the NH2 group from carbon-4 pivotal to the development of cancer.22 The aim of this and converting cytosine to uracil, unless the cytosine study was to examine p21WAF1/CIP1 expression in meta- is methylated in the carbon-5 position. During PCR static prostate cancer cell lines and to assess the amplification uracil binds adenine and adenine binds methylation status of the promoter region. thymine. Consequently, following bisulphite modifica- tion an unmethylated cytosine will sequence as thymine and a methylated cytosine will sequence as cytosine. Primers were designed to yield product containing the Materials and methods CpG islands of the promoter region, as methylation at these sites may be associated with transcriptional Cell culture and treatment inactivation. CpG sites were not included in the primer sequence as this repeating sequence would reduce the Human metastatic prostate cancer cell lines PC3, LNCaP, specificity of primer annealing. As CpG sites were not DU145 and 1542 NP a normal prostate epithelial cell line, included in the sequence, primers were designed for were obtained from the originators, RD a rhabdomyo- DNA in which all cytosine were converted to uracil by sarcoma cell line was obtained from ATCC. LNCaP cells modification with sodium bisulphite, these were termed have a slower replication rate than the other cells lines. In modification primers (M). Primers were also designed all, 500 000 PC3, DU145, 1542NP, RD cells and 106 cell at the same sites for untreated DNA, named unmodified LNCaP cell were plated in T80 flasks containing RPMI- (U) primers, these were used as a control. Sense and 1640 (Gibco BRL), 10% foetal calf serum (FCS) and 1% of antisense primers for the modified (M1 and M2) and WAF1/CIP1 L-glutamine (G). After 16 h, 500 nM of the demethylating unmodified (U1) promoter region of p21 inclu- agent 5-Aza-2 deoxycytidine (5-Aza-CdR) (Sigma Che- ding the Sis-inducible element (SIE)-1 STAT-binding site mical Co: A 3656 C8H12N4O4)in15ml of phosphate buffer at À692, are shown in Table 2. Sense and antisense solution (PBS) was added to the test flasks and 15 ml PBS primers were used as the PCR products had long was added to the control flasks. 5-Aza-CdR sequesters sequences. The PCR protocol was 951C for 150 s, then

Table 1 Intragenic primers in p21 WAF1/CIP1 used to amplify cDNA Primer Sequence Annealing temperature Product size (bp)

P21 sense tgaccctgaagtgagcacagcc 601C 834 p21 antisense gccgagagaaaacagtccaggc

Prostate Cancer and Prostatic Diseases p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 323 by 36 cycles at 951C for 45 s, 60–621C for 30 s and 721C low level, following 5-Aza-CdR treatment gene expres- for 45 s, followed by an extension step at 721C for 5 min sion increased (Figure 1a). 1542NP cells expressed and was performed in a Perkin Elmer-Gene Amp p21WAF1/CIP1 before and after treatment with 5-Aza- 2400 thermal cycler (Perkin Elmer Ltd, UK). CdR. The GAPDH control confirmed equivalent quan- PCR product was electrophoresed on a 1.5% agarose tities of cDNA in the treated and untreated pairs gel and extracted using a QIAquick Gel Extraction Kits (Figure 1b). Figure 2 demonstrates treatment with (QIAGEN). The PCR products were sequenced directly 5-Aza-CdR has a profound effect on the rate of cell using both sense and antisense primers by cycle division. The rate of cell turnover was 1.9 Â in PC3, 1.8 Â sequencing (Amplitaq DNA polymerase ABI) and were in LNCaP, 1.3 Â in DU145 and 21 Â in RD greater in the analysed using a on the ABI PRISMs 377 DNA untreated cells. Sequencer.

5 120 5-Aza-CdR PBS 100 Results 80 60 RT-PCR was performed on cDNA derived in triplicate 40 from RNA of the 5-Aza-CdR-treated and -untreated cell 20 lines. In all three prostate cancer cell lines p21WAF1/CIP1

Number of cells 10 0 expression was either low or undetectable in the PC3 LNCaP DU145 RD NP untreated cell lines. In contrast the prostate cancer cell Cell line lines LNCaP and DU145 expressed high levels of WAF1/CIP1 Figure 2 The number of cells harvested after treatment with 5-Aza-CdR p21 following 5-Aza-CdR treatment (Figure or PBS (control). 1a). Expression of p21WAF1/CIP1 was also increased in PC3 cells following treatment. 5-Aza-CdR treatment there- fore results in the re-expression of p21WAF1/CIP1 gene in the three prostate cancer cell lines. The p21WAF1/CIP1 gene in RD has previously been shown to be inactivated by promoter methylation23 and was included as a positive control for methylation-sensitive expression. In the untreated RD cell line p21WAF1/CIP1 was expressed at a

Table 2 Modified and unmodified p21 WAF1/CIP1 primers Primer Primer sequence Annealing temperature p21 M1-sense TTTGTTGTATGATTTGAGTTAG 601C p21 M1-antisense TAATCCCTCACTAAATCACCTC Figure 3 The p21WAF1/CIP1 promoter region in modified PC3 cells. The cytosine residue is conserved at position À896 (a), À856 (b) and at the p21 M2-sense GTTTTGTTGGGGTGTTAGGTG 601C SIE-1-binding site at À692 (c), the latter shown here using the antisense p21 M2-antisense CACACCTCAACTAACACAACT primer. p21 U1-sense ATCATTCTGGCCTCAAGATGC 621C p21 U1-antisense CGGCTCCACAAGGAACTGAC

Primers 1 and 2 denote different sites in the promoter region in cell, M ¼ primers for modified DNA, U ¼ primers for unmodified DNA.

Figure 1 Agarose gel showing RT-PCR of 5-Aza-CdR treated ( þ ) and Figure 4 Positive and negative controls: (a) Preservation of the cytosine untreated (À) cell line DNA: (a) p21WAF1/CIP1 (b) GAPDH. residue in RD at –896 and (b) conversion to thymine in 1542NP.

Prostate Cancer and Prostatic Diseases p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al

324 WAF1/CIP1 Table 3 Results of p21 promoter sequencing after sodium bisulphite DNA modification DNA Site 50-30

À896 À856 À692 À471 À377 À278 - À78

PC3 M M M ND ND ND LNCaP M M M M M U DU145 M M M M M U RD M M M ND ND ND 1542NP U U ND ND ND ND Binding site cap SIE-1 cap

M ¼ methylated; U ¼ unmethylated; M/U ¼ partial methylation; ND ¼ not determined.

These findings suggest the p21WAF1/CIP1 gene is p16INK4a is mutated in advanced and metastatic prostate inactivated by methylation in prostate cancer. To provide cancer.32 The pivotal role of CDKIs and in particular further evidence that inactivation of p21 in the prostate p21WAF1/CIP1 in control of the cell cycle and as a cancer cell lines was due to methylation in the promoter, modulator of apoptosis and differentiation implies cell line DNA was modified by sodium bisulphite a tumour suppressor function.12,13 The aim of this study treatment and sequenced. In all three prostate cancer was to assess the expression of p21WAF1/CIP1 in metastatic cell lines (PC3, LNCaP, DU145) cytosine was conserved prostatic cell lines and to determine if the low levels following sodium bisulphite treatment at positions of expression observed result from methylation of the À896, À856 and À692 in the p21 promoter, confirming p21 promoter. methylation at these sites (Figure 3). In the RD cell line, a p21WAF1/CIP1 gene expression was low or undetectable positive control, cytosine was also conserved at the same in the metastatic prostate cancer cell lines and the RD positions (À896, À856 and À692) (Figure 4a), indicating control, but was highly expressed in the normal prostate that these sites are methylated, in agreement with epithelial cell line (1542NP). Following treatment with previous studies.23 In contrast, DNA from the normal the demethylating agent, 5-Aza-CdR, p21WAF1/CIP1 was prostate epithelial cell line, 1542NP, used as a negative re-expressed in the prostate cancer cell lines. This control, was not methylated at the positions À896 and suggests p21WAF1/CIP1 expression is inactivated by DNA À856. This suggests that methylation at these sites is methylation in the prostate cancer cell lines. Low levels cancer specific and not an artefact due to cell culture of expression were observed in PC3-, LNCaP- and RD- (Table 3). untreated cells, presumably because either methylation is In all samples, the cytosine residues that were not part incomplete or because methylation does not completely of a CG site were converted to thymine by sodium inhibit gene expression. bisulphite modification, confirming successful modifica- SIE-1 sites (TTCNNNGAA) are found at the À692, tion. À2557 and À4232 (SIE-1, SIE-2 and SIE-3, respectively), Cytosine methylation was also seen at two other sites in the p21WAF1/CIP1 promoter. STAT1, a cytoplasmic (À471 and À377) in LNCaP and DU145. The sequence for protein which binds to SIE sites,33 is an essential PC3 DNA at these sites could not be reliably interpreted. component of the IFN-g pathway.5 There is a CpG island in the p21WAF1/CIP1 gene Activation of STAT1 in response to IFN-g results in promoter downstream of the sites discussed. The follow- upregulation of the p21WAF1/CIP1 gene and inhibition ing sites were sequenced in LNCaP and DU145 cell line of cell growth.4,5 Methylation at the SIE-1-binding DNA after modification and were not methylated: À278, site (À692) inhibits binding of STAT1 and decreases À259, À251, À245, À206, À192, À172, À152, À149, À123, p21WAF1/CIP1 gene expression.23 The SIE site at À692 was À114, À108, À104, À101, À99, À91, À87 and À78. methylated in all three prostate cancer cell lines. Inhibition of STAT binding by methylation may be the mechanism by which the p21WAF1/CIP1 gene is silenced in Discussion prostate cancer cell lines. CG sites at À896 and À856 were methylated in all Seven CDKIs have been identified and have been three prostate cancer cell lines but not in the normal subclassified into two classes on the basis of their prostate epithelial cell line, suggesting that methylation structure and their CDK target. 24 The first class, the at these sites is cancer specific. The CG site at À896 is INK4 , inhibit CDK4 and CDK6 and include not a recognised -binding site.34 A p15INK4b, p16INK4a, p18 and p19.25–27 The second class myeloid zinc-finger protein MZF1 does bind seven base of CDKIs are the Cip/Kip family, which includes pairs downstream at À889.34 MZF-1 is a transcription p21WAF1/CIP1, p27Kip1 and p571,2,28 and they regulate factor of the Kruppel family of zinc-finger proteins.35 In the -, E- and A-dependent kinases.24 Altered in vitro transient transfection experiments, MZF-1 can expression of CDKIs has been associated with prostate alter transcription in haemopoietic and nonhaemopoietic cancer. p27KIP1 is frequently lost in advanced prostate cells.36,37 It is feasible that methylation close to the MZF- cancer,29 and is associated with higher grade disease.30,31 1-binding site alters the structure of the binding domain

Prostate Cancer and Prostatic Diseases p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 325 affecting transcription. Another Kruppel-like transcrip- tion of the p21 promoter may inactivate the p21WAF1/CIP1 tion factor, KLF6, is mutated in prostate cancer.38 TSG in prostate cancer. Upregulation of wild-type KLF6 increases expression of the p21WAF1/CIP1 gene five-fold and significantly reduces cell proliferation. Unlike the wild-type mutant KLF6 does Acknowledgements not upregulate p21WAF1/CIP1 gene, suggesting KLF6 is a Simon Bott is kindly sponsored by a BUF/AstraZeneca TSG in prostate cancer. KLF6 interacts with DNA scholarship. through a GC box promoter element, not in the regions examined in this study.38 The work by Narla et al38 on KLF6 does, however, confirm a role for Krupel-like factors in the development and progression of prostate References cancer. 1 el Deiry WS et al. WAF1, a potential mediator of p53 tumor WAF1/CIP1 Site À856 of the p21 gene promoter was suppression. Cell 1993; 75: 817–825. methylated in all three cancer cell lines and is a 2 Harper JW et al. The p21 Cdk-interacting protein Cip1 is a potent transcription factor-binding site.34 The transcription inhibitor of G1 cyclin-dependent kinases. Cell 1993; 75: 805–816. factor ‘cap’ binds to sequence TCACTCGT and triggers 3 Datto MB et al. Transforming beta induces the 39 cyclin-dependent kinase inhibitor p21 through a p53-indepen- transcription initiation. The CG at À377 was methy- dent mechanism. Proc Natl Acad Sci USA 1995; 92: 5545–5549. lated in LNCaP and DU145 cancer cells and is also a cap- 4 Chin YE et al. Activation of the STAT signaling pathway can binding site,39 in this instance binding to TCAGCGGT. cause expression of 1 and apoptosis. Mol Cell Biol 1997; Little is known about cap in normal or malignant cells. 17: 5328–5337. 5 Xu X, Fu XY, Plate J, Chong AS. IFN-gamma induces cell growth The 18 CpG sites downstream of the area studied inhibition by Fas-mediated apoptosis: requirement of STAT1 were unmethylated in two cell lines; this implies the protein for up-regulation of Fas and FasL expression. Cancer Res p21WAF1/CIP1 promoter is not inactivated by methylation 1998; 58: 2832–2837. at these sites. p21WAF1/CIP1 is one of many cell cycle 6 Gartel AL, Tyner AL. Transcriptional regulation of the regulators and fits into the complex pathways of cell p21((WAF1/CIP1)) gene. Exp Cell Res 1999; 246: 280–289. 7 Bellido T, O’Brien CA, Roberson PK, Manolagas SC. Transcrip- cycle control. It may be inactivated in several ways tional activation of the p21(WAF1,CIP1,SDI1) gene by inter- during tumourogenesis and methylation of upstream leukin-6 type cytokines. A prerequisite for their pro- transcription factors may account for the reactivation of differentiating and anti-apoptotic effects on human osteoblastic p21WAF1/CIP1 gene following treatment with 5-Aza-CdR. cells. J Biol Chem 1998; 273: 21137–21144. However, sequencing experiments confirmed several 8 Chin YE et al. Cell growth arrest and induction of cyclin- WAF1/CIP1 dependent kinase inhibitor p21 WAF1/CIP1 mediated by sites on the p21 promoter were methylated and STAT1. Science 1996; 272: 719–722. this suggests inactivation by methylation maybe the 9LiRet al. Differential effects by the p21 CDK inhibitor on PCNA- mechanism of p21WAF1/CIP1 inactivation in the cell lines dependent DNA replication and repair. Nature 1994; 371: examined. 534–537. Further studies are required to examine whether these 10 Chen J, Jackson PK, Kirschner MW, Dutta A. Separate domains of p21 involved in the inhibition of Cdk kinase and PCNA. findings are present in human prostate samples. Results Nature 1995; 374: 386–388. from several preclinical studies have demonstrated that 11 Dotto GP. p21(WAF1/Cip1): more than a break to the cell cycle? decitabine (5-Aza-CdR) effectively demethylated and Biochim Biophys Acta 2000; 1471: M43–M56. reactivated different TSGs in cell lines from breast 12 Hirama T, Koeffler HP. Role of the cyclin-dependent kinase inhibitors in the development of cancer. Blood 1995; 86: cancer, mesothelioma, lung, gastric, colorectal cancer 841–854. and haematological malignancies. The role of decitabine 13 Toyoshima H, Hunter T. p27, a novel inhibitor of G1 cyclin- in prostate cancer is under evaluation (NCI-T95-0070). Cdk protein kinase activity, is related to p21. Cell 1994; 78: Reactivation of TSGs including p21WAF1/CIP1 by demethy- 67–74. lation may play a role in prostate cancer therapy in the 14 DiGiuseppe JA et al. p53-independent expression of the cyclin- dependent kinase inhibitor p21 in pancreatic carcinoma. Am J future. Pathol 1995; 147: 884–888. 15 Noda H et al. Growth pattern and expressions of cell cycle regulator proteins p53 and p21WAF1/CIP1 in early gastric Conclusions carcinoma. Cancer 2001; 92: 1828–1835. 16 Shariat SF et al. p53, p21, pRB, and expression predict WAF1/CIP1 The p21 gene product has a number of roles clinical outcome in cystectomy with bladder cancer. J Clin Oncol involving cell cycle control and apoptosis. With this in 2004; 22: 1014–1024. mind it is unsurprising that this gene has been impli- 17 Shoji T et al. Clinical significance of p21 expression in non-small- 20 cated as a TSG in a variety of solid and haematological cell lung cancer. J Clin Oncol 2002; : 3865–3871. WAF1/CIP1 18 Cheng L et al. The cell cycle inhibitors p21WAF1 and p27KIP1 malignancies. This study demonstrates p21 is are associated with survival in patients treated by salvage poorly expressed in metastatic prostate cancer cell lines prostatectomy after radiation therapy. Clin Cancer Res 2000; 6: and sequestration of the DNA methyltransferase enzyme 1896–1899. results in re-expression. Furthermore, several cytosine 19 Matsushima H et al. Immunohistochemical study of p21WAF1 and p53 proteins in prostatic cancer and their prognostic residues in the promoter region are methylated, in significance. Hum Pathol 1998; 29: 778–783. particular the site of STAT1 and cap binding. The 20 Shiohara M et al. Absence of WAF1 mutations in a variety of inhibition of the STAT1-signalling pathway by methyla- human malignancies. Blood 1994; 84: 3781–3784.

Prostate Cancer and Prostatic Diseases p21WAF1/CIP1 gene in prostalic cancer SRJ Bott et al 326 21 Roman-Gomez J et al. 50 CpG island hypermethylation is 30 Guo Y, Sklar GN, Borkowski A, Kyprianou N. Loss of the cyclin- associated with transcriptional silencing of the p21(CIP1/ dependent kinase inhibitor p27(Kip1) protein in human prostate WAF1/SDI1) gene and confers poor prognosis in acute cancer correlates with tumor grade. Clin Cancer Res 1997; 3: lymphoblastic leukemia. Blood 2002; 99: 2291–2296. 2269–2274. 22 Strathdee G, Brown R. Aberrant DNA methylation in cancer: 31 Cote RJ et al. Association of p27Kip1 levels with recurrence and potential clinical interventions. Exp Rev Mol Med 2002. http:// survival in patients with stage C prostate carcinoma. J Natl www-ermm.cbcu.cam.ac.uk/02004222 a.pdf. Cancer Inst 1998; 90: 916–920. 23 Chen B et al. Inhibition of the interferon-gamma/signal 32 Jarrard DF et al. Deletional, mutational, and methy- transducers and activators of transcription (STAT) pathway by lation analyses of CDKN2 (p16/MTS1) in primary and meta- hypermethylation at a STAT-binding site in the p21WAF1 static prostate cancer. Genes Cancer 1997; 19: promoter region. Cancer Res 2000; 60: 3290–3298. 90–96. 24 Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regu- 33 Darnell Jr JE. STATs and gene regulation. Science 1997; 277: lators of G1-phase progression. Genes Dev 1999; 13: 1501–1512. 1630–1635. 25 Chan FK et al. Identification of human and mouse p19, a novel 34 TFSEARCH: Searching Transcription Factor Binding Sites (ver 1.3) CDK4 and CDK6 inhibitor with homology to p16ink4. Mol Cell 2004; http://molsun1.cbrc.aist.go.jp/research/db/TFSEARCH. Biol 1995; 15: 2682–2688. html; (Ref Type: Electronic Citation). 26 Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell- 35 Gaboli M et al. Mzf1 controls cell proliferation and tumorigen- cycle control causing specific inhibition of cyclin D/CDK4. esis. Genes Dev 2001; 15: 1625–1630. Nature 1993; 366: 704–707. 36 Morris JF et al. The myeloid zinc finger gene, MZF-1, regulates 27 Hirai H et al. Novel INK4 proteins, p19 and p18, are specific the CD34 promoter in vitro. Blood 1995; 86: 3640–3647. inhibitors of the cyclin D-dependent kinases CDK4 and CDK6. 37 Hromas R et al. Hematopoietic transcriptional regulation by the Mol Cell Biol 1995; 15: 2672–2681. myeloid zinc finger gene, MZF-1. Curr Top Microbiol Immunol 28 Matsuoka S et al. p57KIP2, a structurally distinct member of the 1996; 211: 159–164. p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor 38 Narla G et al. KLF6, a candidate mutated gene. Genes Dev 1995; 9: 650–662. in prostate cancer. Science 2001; 294: 2563–2566. 29 Kibel AS et al. Identification of 12p as a region of frequent 39 Bucher P. Weight matrix descriptions of four eukaryotic RNA deletion in advanced prostate cancer. Cancer Res 1998; 58: polymerase II promoter elements derived from 502 unrelated 5652–5655. promoter sequences. J Mol Biol 1990; 212: 563–578.

Prostate Cancer and Prostatic Diseases