bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

1 Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

2 Pasteurella multocida type B:2 from fowl cholera

3 Otun Saha1*, M. Rafiul Islam1*, M. Shaminur Rahman1*, M. Nazmul Hoque1,2, M. Anwar

4 Hossain1,3, Munawar Sultana1

5 1Department of Microbiology, University of Dhaka, Dhaka-1000, Bangladesh

6 2Department of Gynecology, Obstetrics and Reproductive Health, Bangabandhu Sheikh Mujibur

7 Rahman Agricultural University, Gazipur-1706, Bangladesh

8 3Present address: Jashore University of Science and Technology, Jashore-7408, Bangladesh

9

10 *Equal contribution

11

12

13 Correspondence to:

14 Munawar Sultana, Department of Microbiology, University of Dhaka, Dhaka-1000, Bangladesh

15 Email: [email protected]

16

17

18 Running title: Pasteurella multocida type B:2 causing fowl cholera

19

20

21 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

22 ABSTRACT

23 Pasteurella multocida is the etiologic agent of fowl cholera (FC), a highly contagious and

24 severe disease in poultry with higher mortality and morbidity. Twenty-two P. multocida strains

25 isolated from the FC outbreaks were subjected to phenotypic and genotypic characterization. The

26 isolates were grouped into two distinct RAPD biotypes harboring a range of pathogenic genes;

27 exbB, ompH, ptfA, nanB, sodC, and hgbA. Among these strains, 90.90% and 36.37% were

28 multidrug-resistant and strong biofilm formers, respectively. Whole genome sequencing of the

29 two representative RAPD isolates confirmed as P. multocida type B:L2:ST122 harboring a

30 number of virulence factors, and antimicrobial resistance genes. Pan-genome analysis revealed

31 90 unique genes in these genomes associated with versatile metabolic functions, pathogenicity,

32 virulence, and antimicrobial resistance. This study for the first time reports the association of P.

33 multocida genotype B:L2:ST122 in the pathogenesis of FC, and provides a genetic context for

34 future researches on P. multocida strains.

35 36 Keywords: Fowl cholera, multidrug-resistance, biofilm former, Pasteurella multocida, genotype

37 B:2, pan-genome, unique genes, host-adaptation

38

39 1. Introduction

40 Poultry raring is one of the important sources of income in Bangladesh, including both

41 commercial broiler, and layer farming. This subsector of livestock has been noted as the largest

42 primary source of eggs, and meat since last decade, and contributes ~3.0% to the GDP of

43 Bangladesh [1]. However, this industry faces a number of constraints including limited feed

44 resource, and frequent outbreaks of infectious diseases. Emerging infectious diseases with

45 zoonotic potentials are appearing at an alarming rate, and pose a growing threat to global

46 biodiversity [2, 3]. With this backdrop, there are rising apprehensions among health care bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

47 providers, veterinarians, policymakers, and the general public about human acquisition of

48 zoonotic infections from nearby encounters with domesticated pets, wild animals, and/or avian

49 species like commercial poultry [4-6].

50 Pasteurella multocida is identified as a major bacterial etiologic agent for many

51 infectious diseases in a wide spectrum of domestic and wild animals such as poultry and wild

52 birds, pigs, cattle and buffaloes, rabbits, small ruminants, cats, dogs and other mammals [4, 7-9].

53 P. multocida is a zoonotic Gram negative, and opportunistic bacterium [10], and causes FC or

54 pasteurellosis, an economically important disease to the poultry industry [8, 11]. Among the

55 bacterial diseases, FC is a major threat to the poultry industry causing 25-35% mortality [12].

56 Different strains of P. multocida are associated with clinical manifestations of FC ranging from

57 depression, anorexia, lameness, swollen wattles, mucoid discharge from the mouth, ruffled

58 feathers, diarrhea, increased respiratory rate, and per acute or sudden asymptomatic death [12,

59 13]. The disease can range from acute septicemia to chronic and localized infections, and the

60 morbidity and mortality may be up to 100%. The route of infection is oral or nasal

61 with transmission via nasal exudate, faces, contaminated soil, equipment, and people [14].

62 Currently, the strains of P. multocida are divided into 5 serotypes such as A (hyaD-

63 hyaC), B (bcbD), D (dcbF), E (ecbJ), and F (fcbD based on capsular typing [7, 8]. Among these

64 serotypes, capsular serogroups A and F cause the majority of FC, whereas serogroups B and E

65 are predominantly associated with hemorrhagic septicemia (HS) in cattle and wild ruminants [4,

66 15]. In addition to capsular serogroups, P. multocida strains are currently classified into 16

67 Heddleston lipopolysaccharide (LPS) serovars [16, 17]. Different serotypes of the P. multocida

68 exhibit varying degrees of virulence in different host [7, 8]. Various strains of P. multocida

69 harbor a wide arsenal virulence factors-associated genes (VFGs), and of them, genes involved in bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

70 the capsule formation, LPS, fimbriae and adhesins, toxins, iron regulation and acquisition

71 proteins, sialic acid metabolism, hyaluronidase, and outer membrane proteins (OMPs) are the

72 key components of regulating the pathogenesis [4, 7, 18, 19]. Though not well studied, many of

73 these VFGs might play a substantial role in the pathogenesis of FC, and survival in the complex

74 host environment [7, 18, 19]. Previous reports showed that there is a clear correlation between

75 certain VFGs, and capsular types or biovars [20, 21]. Therefore, identification of prevalent VFGs

76 is important to predict the pathogenic nature of the bacterium, and select potential vaccine

77 candidates.

78 Till to date, there is lack of effective coverage in multi-serotype vaccines, and thus,

79 antibiotics remain as the most commonly employed treatment strategies for prevention and

80 control of FC despite their increased correlation to drug resistance, and food safety risks due to

81 residual effects [4, 8, 22]. Furthermore, the infrequent, and unnecessary overuse of antibiotics in

82 the poultry farms, livestock, fisheries, and agriculture is believed to have augmented the

83 emergence of MDR pathogenic bacterial species like P. multocida posing a serious threat to

84 public health and livestock [4].

85 Bio-molecular techniques such as polymerase chain reaction (PCR), ribotyping, random

86 amplification of polymorphic DNA (RAPD)-PCR, multilocus sequence type (MLST), and 16S

87 rRNA gene sequencing analysis enabled the studies of molecular epidemiology, and genetic

88 diversity of P. multocida [18, 23-25]. In addition to these molecular techniques, whole-genome

89 sequencing (WGS) is an affordable, convenient, and rapid technique for outbreak investigations,

90 diagnostics, and epidemiological surveillance [26, 27]. The state of the art WGS technology

91 might enable us to study the underlying genetic mechanisms associated with pathogenicity,

92 virulence fitness, and host adaptability of P. multocida in multiple hosts [4, 28, 29]. However, bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

93 there is limited information on the molecular epidemiology of P. multocida circulating in the

94 global poultry industry with particular reference to Bangladesh. Therefore, in this study, we’ve

95 employed different bio-molecular techniques along with the WGS of two representative MDR,

96 and SBF P. multocida isolates to investigate the phenotypic and genotypic diversity, and

97 underlying genetic contents such as VFGs, antimicrobial resistance genes (ARGs), and metabolic

98 functional potentials to be associated with the pathogenesis of FC in laying hens in Bangladesh.

99 Moreover, herein this study, we first time report the phenotypic and genotypic traits, and

100 associated genetic factors of highly pathogenic strains of P. multocida type B:2 causing FC in

101 chickens of Bangladesh.

102

103 2. Methods

104 2.1. Sample collection, bacterial strain isolation, and genomic DNA extraction

105 We collected fifty-seven samples (n=57) of suspected FC including 36 suspected live

106 birds, and 21 dead laying hens from six commercial layer farms located in Narsingdi (23.9193°

107 N, 90.7176° E), Narayangonj (3.6238° N, 90.5000° E), and Manikgonj (23.8617° N, 90.0003° E)

108 districts of Bangladesh during August 2017 to November 2017. Diseased birds were diagnosed

109 with FC by observing clinical signs and symptoms including sudden death, swollen wattle and

110 combs, lameness, respiratory rales, and diarrhea by practicing veterinarians. The birds were then

111 dissected, and internal organs (liver) from each bird were collected as the experimental samples.

112 The samples were finally processed, kept in the nutrient enriched media, and transported to the

113 laboratory (at 4°C). The samples were plated on Luria-Bertani broth (LB) (Oxoid, Thermo Fisher

114 Scientific, UK). A small amount of inoculum from LB was streaked onto Blood agar based

115 (BAB) (Oxoid, Thermo Fisher Scientific, UK) supplemented with 5% sheep blood, and bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

116 incubated for 24 h at 37 °C for selective growth. Colonies revealing the characteristic of the P.

117 multocida on the BAB agar (3–5 colonies from each sample) were further inoculated into

118 MacConkey (MC) agar. The MC agar positive colonies were further subjected to biochemical

119 tests according to Kim et al. (2019) [7]. A total of 78 bacterial isolates were retrieved from the

120 selective culture and biochemical tests, and of them 22 isolates were confirmed as P. multocida

121 by kmt1 gene-specific PCR following previously published protocols [30]. Genomic DNA of P.

122 multocida was extracted from overnight culture by the boiled DNA extraction method [31]. The

123 quality and quantity of the extracted DNA was measured using a NanoDrop ND-2000

124 spectrophotometer (Thermo Scientific, Waltham, USA). The extracted DNA was kept at -80 °C

125 [32].

126 2.2. Molecular typing and detection of pathogenic genes

127 Random amplification of polymorphic DNA (RAPD)-PCR was performed with the

128 extracted DNA to investigate the biotype diversity among the isolates [33, 34]. The RAPD-PCR

129 was performed by using (5´-GCGATCCCCA-3´) primer following the previously optimized

130 protocol for E. coli [31]. Using previously published pathogenic gene-specific primers (Table 1)

131 for PCR assays, we surveyed 10 pathogenic genes in the isolated strains of P. multocida [7, 19].

132 Briefly, each PCR reaction contained 2 L DNA template (300 ng/L), 10 L PCR master mix

133 2X (Go Taq Colorless Master Mix) and 1L (100 pmol/L) of each primer (Table 1) in each

134 tube. The PCR amplifications were conducted in thermocycler, and the cycling conditions were

135 identical for all the samples as follows: 94 °C for 5 min; 35 cycles of 1min at 94 °C, 1 min at 50-

136 60 °C, and 1 min at 72 °C; and 72 °C for 7 min. PCR amplicons were visualized on 1.5% agarose

137 gel prepared in 1× TAE buffer. After gel electrophoresis, the images were captured using Image

138 ChemiDoc™ Imaging System (Bio-Rad, USA) [7]. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

139 2.3. Antimicrobial susceptibility testing

140 The antimicrobial susceptibility testing of various P. multocida pathotypes was carried

141 out using Kirby-Bauer disc diffusion method on Mueller-Hinton agar according to the guidelines

142 of the Clinical and Laboratory Standards Institute; CLSI [35], and European Committee on

143 Antimicrobial Susceptibility Testing; EUCAST [36]. Antibiotics were selected for susceptibility

144 testing corresponding to a panel of antimicrobial agents of interest to the poultry industry and

145 public health in Bangladesh. The kmt1 gene positive pathogenic isolates (n=22) were selected

146 for antimicrobial susceptibility to 17 antibiotic discs comprising ampicillin (AMP) (10 mg),

147 oxacillin (OXA) (10mg), doxycycline (DOX) (30 mg), streptomycin (STR) (10 mg),

148 nitrofurantoin (F) (300 mg), levofloxacin (LEV) (3rdgeneration) (5 mg), aztreonam (ATM) (30

149 mg), cefoxitin (Fox) (30 mg), gentamycin (CN) (10 mg), nalidixic acid (NA) (1st generation) (30

150 mg), trimethoprim (Tm) (5 mg), tetracycline (TE) (30 mg), ciprofloxacin (CIP) (2nd generation)

151 (5 mg), chloramphenicol (C) (30 mg), sulfonamide (S3) (250µg) , colistin sulfate (CS) (10mg),

152 and cefepime (FEP) (30 mg). Finally, the findings were recorded as susceptible, intermediate and

153 resistant according to the CLSI and EUCAST breakpoints.

154 2.4. Biofilms formation (BF) assay

155 The BF ability of the P. multocida pathotypes was tested in 24-well polystyrene plates

156 (Corning, Costar) as previously described [37]. Briefly, all isolated (n=22) P. multocida strains

157 were grown in LB medium for 24h at 37°C with shaking, and a 1:1000 dilution was prepared

158 in LB. Twenty-five microliters were placed in each well containing 1.5ml of culture medium.

159 The plates were incubated for 48h at 37°C in static condition. Planktonic cells were removed,

160 and wells containing biofilms were rinsed three times with distilled water, and the remaining

161 adherent bacteria were stained with 2ml/well of crystal violet (0.7% [wt/vol] solution; Sigma- bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

162 Aldrich) for 12min. Excess stain was removed by washing with distilled water. Crystal violet

163 (CV) was extracted by acetic acid (33% [vol/vol]), and the plates were incubated at room

164 temperature to release the dye into the solution. Then, two samples of 100µl from each well

165 were transferred to a 96-well flat-bottom plate, and the amount of dye was determined at

166 600nm using a microplate reader. As quantified in crystal violet assay, the bacterial strains

167 were divided into four groups based upon optical density (OD) at 600 nm of the bacterial

168 biofilm: non-biofilm former (NBF), weak biofilm former (WBF), moderate biofilm former

169 (MBF) and strong biofilm former (SBF) [37].

170 2.5. Ribosomal gene (16S rRNA) sequencing and phylogenetic analysis

171 Two P. multocida isolates; PM4 and PM7, representative of each genotype and/or

172 biotype, were selected for ribosomal gene (16S rRNA) sequencing using universal primers

173 (Table 1) followed by sequencing at First Base Laboratories SdnBhd (Malaysia) using Applied

174 Biosystems highest capacity-based genetic analyzer (ABI PRISM® 377 DNA Sequencer)

175 platforms with the BigDye® Terminator v3.1 cycle sequencing kit chemistry [38]. Initial quality

176 controls of the generated raw sequences were performed using SeqMan software, and were

177 aligned with relevant reference sequences retrieved from NCBI database using Molecular

178 Evolutionary Genetics Analysis (MEGA) version 7.0 for bigger datasets [39]. We employed the

179 Kimura-Nei method to compute the evolutionary distances, and neighbor-joining method to

180 construct a phylogenetic tree [40]. The percentage of replicate trees in which the associated taxa

181 clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The

182 evolutionary distances were computed using the Kimura 2-parameter method and in the units of

183 the number of base substitutions per site [41].

184 2.6. Whole genome sequencing and assembly bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

185 Two RAPD representative P. multocida pathotypes (PM4 and PM7) were selected for

186 whole-genome sequencing (WGS). Genomic DNA libraries containing 300∼500 bp fragments

187 were constructed using Nextera XT DNA Library Preparation Kit (Illumina Inc., San Diego,

188 USA). The WGS was performed using 100 bp paired-end sequencing protocol under Illumina

189 platform using HiSeq4000 sequencer (Macrogen, lnc. Seoul, Republic of Korea) with an average

190 ∼456-fold genome coverage per sample. The generated FASTQ files were evaluated for quality

191 using FastQC v0.11 [42]. Adapter sequences, and low-quality ends per read were trimmed by

192 using Trimmomatic v0.39 [43] with set criteria of sliding window size 4; a minimum average

193 quality score of 20; minimum read length of 50 bp. High quality reads were de novo assembled

194 to generate contigs using an open source platform, SPAdes (Species Prediction and Diversity

195 Estimation) v3.13 [44] with a range of k-mer between 21 to 121, and contigs less than 500 bp

196 were filtered. The draft contigs were mapped, reordered, and scaffolded according to a NCBI

197 reference complete sequence of P. multocida strain Razi_Pm0001 (accession number:

198 NZ_CP017961.1) by RaGOO v1.1 [45]. Completeness of the scaffold was checked using

199 CheckM [46]. Scaffolded contigs were searched for the bacterium at strain level by BLAST, and

200 the k-mer algorithm in the KmerFinder 3.1 tool [47]. The WGS-based phylogenetic tree was

201 constructed using the online pipeline Reference Sequence Alignment Based Phylogeny Builder

202 (REALPHY) [48], and visualized on iTor v5 [49]. The Plasmid Finder v2.1, and Integron_Finder

203 v1.5 tools were used for the detection of plasmid sequence contamination [50, 51]. Prophage

204 sequences within the genome assemblies were identified by the PHAge Search Tool Enhanced

205 Release (PHASTER) web server [52].

206 2.7. Genome annotation and genomic organization mapping bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

207 The scaffolded genomes of the P. multocida PM4 and PM7 strains were annotated by multiple

208 annotation schemes to improve accuracy. We used the NCBI Prokaryotic Genome Annotation

209 Pipeline (PGAPv4.11) with best-placed reference protein set, and GeneMarkS-2+ annotation

210 methods [53], Rapid Prokaryotic Genome Annotation (Prokka) (e = 0.000001) [54], and Rapid

211 Annotation using Subsystem Technology (RAST) (e = 0.000001) [55]. Annotated genes by each

212 tool were then cross-checked. To remove the tRNA and mRNA from the genomes, we used

213 tRNAscan-SE v2.0 [56], and Aragorn v1.2.38 [57] tools. The graphical map of the circular

214 genome was generated using the CGView Server

215 (http://stothard.afns.ualberta.ca/cgview_server/) [58]. Circular BLAST of annotated genome

216 comparison was performed using an in-house instance of BLAST Ring Image Generator (BRIG)

217 v0.95 [59]. The pan-genome and core-genome were analyzed using the Bacterial Pan Genome

218 Analysis (BPGA) pipeline [60].

219 2.8. Genome sequence analysis

220 The trimmed fastq files and assembled genomes of PM4 and PM7 were aligned with P.

221 multocida capsular serotypes (hyaD-hyaC, bcbD, dcbF, ecbJ, fcbD) [7]; LPS genotypes (LPS

222 outer core structure genes) [17] genes using Burrows-Wheeler Aligner (BWA) [61], and the

223 output was extracted using Resistome Analyzer integrated into AmrPlusPlus v2.0 pipeline [62].

224 MLST genotypes of the P. multocida strains were assigned by performing blast of their scaffolds

225 against the P. multocida MLST Databases (https://pubmlst.org/pmultocida). In this study,

226 RIRDC MLST, a scheme of multi-locus sequence typing based on seven housekeeping genes

227 (adk, est, pmi, zwf, mdh, gdh, and pgi) of P. multocida in the Bacterial Isolate Genome Sequence

228 Database (BIGSdb) [63] was used to determine the MLST genotypes of the isolates (PM4 and

229 PM7). bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

230 2.9. Virulence factors (VFGs), antimicrobial resistance (ARGs) and metabolic functions

231 profiling

232 The trimmed fastq files, and assembled genomes of PM4 and PM7 were further aligned

233 with P. multocida outer membrane and porin proteins (oma87, ompH, plpB, psl), adesins (ptfA,

234 fimA, hsf-1, hsf-2, pfhA, tadD); neuraminidases (nanB, nanH), iron acquisition related factors

235 (exbD, tonB, fur, tbpA, hgbA, hgbB); superoxide dismutases (sodA, sodC); dermonecrotoxin

236 (toxA); and hyaluronidase (pmHAS) pathogenic genes using BWA [61], and the resulting output

237 was using Resistome Analyzer integrated into AmrPlusPlus v2.0 pipeline [62]. We mapped the

238 annotated genomes against the ResFinder Database [64], Comprehensive Antibiotic Resistance

239 Database (CARD) [65], MEGARes [62, 66] databases to search for ARGs, and the gene fraction

240 value ≥ 95 was considered ARGs to our strains. Assembled genomes were also blasted against

241 Virulence Factor database (VFDB) [67] for putative VFGs identification. We predicted the

242 metabolic functional potentials of the two genomes through the KEGG (Kyoto Encyclopedia of

243 Genes and Genomes) Automatic Annotation Server (KAAS) [68] database.

244

245 3. Results and Discussion

246 3.1. Intra-outbreak diversity of P. multocida in FC

247 The present study focused on the phenotypic and genotypic characterization of

248 pathogenic P. multocida associated with fowl cholera in commercial layer birds. We obtained 78

249 P. multocida isolates from 57 samples originating from different layer farms of the Narsingdi,

250 Narayangonj and Manikgonj districts of Bangladesh. The isolates produced small glistening

251 dewdrop like colonies on blood agar plates after incubation at 37 °C for 18 h, and appeared as

252 Gram-negative cocco-bacilli with Gram’s staining. Other characteristics cultural properties bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

253 included no growth on MacConkey agar, and bacteria remained non-motile and non-hemolytic

254 on blood agar. Of the retrieved isolates (n = 78), the species and type-specific PCR using

255 kmt1 gene confirmed 22 isolates as P. multocida from the samples of Narsingdi district (Table 2,

256 Fig. S1), which was further confirmed through biochemical and molecular characterization [7,

257 30]. Since the isolates from two other district, Narayangonj and Manikgonj lacked kmt1 gene,

258 these might include different bacterial species, which require further investigations. The

259 kmt1 gene positive 22 isolates of P. multocida were catalase and oxidase positive, and urease

260 negative. Furthermore, there was no reaction with citrate, methyl red, and Voges-Proskauer

261 (Table 2). These isolates fermented glucose, mannose and sucrose, and none utilized lactose.

262 However, fermentation of inositol grouped these P. multocida isolates into two biotypes (Table

263 2). Out of 22 P. multocida isolates, 14 (63.64%) isolates fermented inositol, and denoted as

264 biotype 1 (Table 2). Conversely, 8 (36.36%) isolates remained unable to ferment inositol, and

265 thus denoted as biotype 2 (Table 2). These results indicated that P. multocida isolates might

266 possess diverse metabolic potentials despite being identified from the same outbreak of FC as

267 also reported earlier [22]. Moreover, the RAPD assay also confirmed two pathotypes of P.

268 multocida among these 22 strains (Table 2, Fig. S2). In this study, the RAPD profiling indicated

269 less genetic heterogeneity among the studied P. multocida strains corroborating the findings of

270 Hotchkiss et al. [69]. There we found a positive correlation between biotypes and RAPD profiles

271 since all of the 14 isolates of biotype 1 showed the RAPD pattern 1 while the rest of the 8

272 isolates belonged to biotype 2 showed RAPD pattern 2 (Table 2). Moreover, pathogenic gene-

273 specific primer-based PCR revealed different pathogenic genes among the identified strains

274 (Table 2). Three pathogenic genes nanB, sodC, and hgbA were found in all of the tested isolates,

275 and 22.73% (5/22) isolates harbored six pathogenic genes (exbB, ompH, ptfA, nanB, sodC, and bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

276 hgbA) out of the 10 VFGs tested (Table 2). The present results therefore show that these VFGs

277 are highly prevalent in FC associated P. multocida isolates indicating their high pathogenic

278 potentials. Although the molecular basis of the pathogenicity and host specificity of P. multocida

279 is not well understood, several studies have reported that a number of VFGs are correlated with

280 the pathogenic mechanisms of FC [7, 14, 22] . However, corroborating the previous observations

281 by Omaleki et al. [29], the biochemical and molecular findings of the current study reflect the

282 phenotypic and genotypic diversity of the P. multocida isolates originated from the same

283 outbreak of FC.

284 3.2. Antimicrobial resistance in FC-associated P. multocida strains

285 Antibiotic susceptibility of the recovered P. multocida strains (n=22) was tested against

286 17 different antibiotics of varied classes through disc diffusion assay. The prevalent strains

287 detected were resistant to ampicillin (90.91%), tetracycline (90.91%), and nalidixic acid

288 (63.64%) according to the EUCAST breakpoints (Fig. 1). In this study, 68.18% P. multocida

289 strains found to be resistant against each of the three antibiotics, oxacillin, cefoxitin and

290 trimethoprim. Remarkably, we observed that 91.91% isolates were multidrug-resistant, being

291 resistant against ≥5 antibiotics tested (Fig. 1). Treatment for infections with P. multocida either

292 in livestock or in poultry with FC or pasteurellosis commonly includes broad-spectrum

293 antimicrobials. The findings of our antimicrobial resistance (AMR) study, like the findings of

294 Jabeen et al. [25] in Malaysia, Kehrenberg et al. [70] in France, Yoshimura et al. [71] in Japan,

295 and Tang et al. [72] in China indicated that ampicillin, tetracycline, and nalidixic acid were the

296 most resistant antibiotics. Therefore, preventive and therapeutic effects on birds suffering from

297 FC with P. multocida strains should no longer be expected from these antibiotics. However, all

298 of the tested isolates were sensitive to colistin, suggesting that this antibiotic could effectively be bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

299 used for treatment of FC or other infections with P. multocida. The results documented that P.

300 multocida has developed resistance to commonly used antibiotics in poultry. Frequent and

301 excessive use of antibiotics in the livestock of Bangladesh might have a role in AMR

302 development against multiple antibiotics in the clinical infections caused by P. multocida [73,

303 74].

304 3.3. Biofilm formation infers higher antibiotic resistance (ABR) in P. multocida

305 Among the mechanisms of bacterial virulence, biofilm is recognized as an intricate factor

306 in many bacterial infections, and one of the reasons for treatment failure with antibiotics [74-76].

307 However, in contrast to other microorganisms, only few studies have examined the of biofilm

308 formation (BF) properties of the P. multocida [75]. Moreover, studies comparing the

309 pathogenicity of P. multocida strains as a function of their biofilm production capacity are also

310 rare in avian species. The P. multocida strains isolated from FC formed biofilms on polystyrene

311 plates, as shown in Fig. 2. In this study, the average OD of the negative control was 0.028±0.002,

312 and the cutoff OD value was set as 0.045. The isolates which have OD value ≤0.045 were

313 considered as NBF. In this study, 81.82% (18/22) of the P. multocida strains were biofilm-

314 formers with significance differences (P = 0.039) in their BF categories, and we denoted them as

315 strong biofilm former (SBF, 36.36%), moderate biofilm former (MBF, 27.27%), and weak

316 biofilm former (WBF, 18.18%). In our present study, 18.18% of study strains did not produce

317 biofilms, and thus, designated as the non-biofilm formers (NBF) (Fig. 2a) In addition, the SBF

318 isolates showed higher AMR properties (41.18-64.71%) compared to the MBF (14.50-34.65%),

319 and WBF (5.88-29.91%) strains against the tested antibiotics. Moreover, 35.29 - 41.18% of the

320 NBF strains also showed AMR phenomena against these antibiotics (Fig. 1). Furthermore,

321 scanning acoustic microscopy (SAM) of the two representative P. multocida strains (Isolate: bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

322 PM4 and PM7), as representative of SBF strains demonstrated densely colonization, and

323 exopolysaccharides covering the bacterial cells, validating the high biofilm potential of these two

324 MDR strains (Fig. 2b, c). Results from antibiogram, and BF assays indicate that BF ability of the

325 P. multocida may enhance antibiotic resistance and pathogenic fitness of P. multocida to survive

326 under unfavorable complex conditions within host and environmental niches [76]. Moreover, the

327 biofilms may also promote the bacterium to resist host immune defense mechanisms [74].

328 Therefore, BF of P. multocida needs to be studied in-depth, which might be an alternative to

329 combat the threat of drug-resistant pathogenic P. multocida [77].

330 3.4. Genomic features of two P. multocida strains

331 Two strains of P. multocida, initially identified through ribosomal gene (16S rRNA)

332 sequencing, biotyping, and RAPD grouping with MDR and SBF phenomena were undergone to

333 WGS. The 16S rRNA gene-based phylogenetic analysis revealed that these two P. multocida

334 strains had 99.9% identity to Razi_Pm0001 (GenBank accession number: NZ_CP017961.1), and

335 clustered with previously identified P. multocida strains in the 16S rRNA phylogeny (Fig. S3).

336 Previous investigations have also shown that P. multocida associated with FC represented

337 multiple clones [4, 78]. We found 34 and 37 contigs in PM4 and PM7 strains of P. multocida,

338 and the average genome length of these two strains were 2,408,286 bp and 2,408,436 bp,

339 respectively (Table 3). The average GC content of each genome was 40.4% (Table 3), which was

340 consistent with that of a complete P. multocida chromosome [8, 16]. The genome completeness

341 of both strains (PM4 and PM7) was 99.55% with genome coverage 458 X and 455.0X for PM4

342 and PM7, respectively (Table 3). The statistics of the assembly and annotation from NCBI

343 Prokaryotic Genome Annotation Pipeline, Rapid Prokaryotic Genome Annotation (Prokka) [54],

344 and Rapid Annotation using Subsystem Technology (RAST) [55] are summarized in Table 4. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

345 According to NCBI annotation pipeline, PM4 and PM7 genomes contained 2260 and 2261

346 coding sequences (CDS) sequentially where 2217 and 2221 were protein-coding genes (Table 4).

347 Moreover, the number of RNA genes was 58, including 50 transfer RNAs (tRNAs) and 4 rRNAs

348 for each of the genome (Table 4). However, PHASTER database predicted three intact

349 prophages in the genomes of PM4 and PM7 compared with the two intact and one incomplete

350 prophage within the reference strain Razi_Pm0001 (Fig. 4). Noteworthy, despite the difference

351 in biotype and RAPD profiles (Table 2, Fig. S2), both of the strains studied here showed similar

352 genomic features (Table 3). However, PM7 strain harbored two unique genes, and of them, one

353 encoding tonB-dependent hemoglobin/transferrin/lactoferrin family outer membrane receptor

354 facilitating the use of transferrin, lactoferrin, and hemoglobin as sources of iron in different

355 niches within the host [79]. Another unique protein of PM7 was a hypothetical protein of

356 unknown function. Strikingly, endoU domain-containing protein, and inositol-1-

357 monophosphatase genes, involved in inositol metabolism found in both PM4 and PM7 originated

358 P. multocia strain, with 100 % aa sequence identity. However, the diversity of inositol

359 fermentation by PM4 (inositol -) and PM7 (inositol +) possibly related to expression of the gene,

360 likely the genes were not expressed properly in PM4, which needs further investigations. These

361 findings indicate all biotypic and RAPD clustering of P. multocida does not necessarily directly

362 related to genotypic clusters rather expression of genes plays a determining role in phenotypic

363 classification [80, 81].

364 3.5. Genotypic and phylotypic analysis implicates novel P. multocida type B:L2:ST122 365 associated with FC 366 Characterization of the complete genome sequences is an important step in further

367 investigation of the genomic structure, and comparative pathogenomic characteristics of the

368 bacteria. The genome-based phylogenetic tree revealed that P. multocida PM4 and PM7 strains bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

369 clustered in the same branch with the serotype B strains Razi_Pm0001 and NCTC10323 of

370 NCBI of the reference genomes (Fig. 5). The presence of bcbD gene in the genomes of PM4 and

371 PM7 determines the capsular serotype B for both isolates PM4 and PM7. The genes bcbD is

372 associated with capsular biosynthesis of P. multocida specific to serogroup B [7, 11]. On the

373 other hand, rest of the P. multocida isolates of the present study showed a higher degree of

374 similarity in RAPD pattern with that of either PM4 or PM7 (Fig. S2) suggesting that these

375 isolates likely to be of the same genotype. These findings are in line with Hotchkiss et al. [69]

376 who reported that closely related P. multocida isolates show similar RAPD pattern Moreover,

377 lipopolysaccharide (LPS) outer core structural genes gatD, nctA, hptF and hptE found in both the

378 isolates indicating LPS genotype L2 as also reported in several earlier studies [7, 17].

379 Furthermore, based on seven housekeeping genes (adk, est, pmi, zwf, mdh, gdh, and pgi) of P.

380 multocida in the Bacterial Isolate Genome Sequence Database (BIGSdb), RIRDC MLST type

381 assigned both the PM4 and PM7 isolates into ST122 which is widely documented to be

382 associated with bovine hemorrhagic septicemia (Table 3, Fig. 4). Notably, P. multocida from

383 genotype B:L2:ST122 is predominant in bovine [4], and no previous reports show the association

384 of this genotype FC in commercial poultry like laying birds. Moreover, the majority of the avian

385 pasteurellosis outbreaks are caused by P. multocida from types A and D [4, 17]. However, cross-

386 species transmission of diseases is frequently reported by different serotypes of P. multocida i.e.

387 serogroups A and D. These serotypes are globally distributed, and found to cause diseases in a

388 wide range of domestic animals (e.g. from fowl to calves, pigs, sheep, goats, and rabbits) [15, 17,

389 22]. Conversely, P. multocida serogroups B and E have been found predominantly in tropic areas

390 where they induce hemorrhagic septicemia in cattle and wild ruminants [15, 17, 22]. Moreover,

391 phylogenetically close relatedness of the two isolates of our present study with that of the bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

392 previously reported bovine originated P. multocida type B:L2:ST122. Therefore it is assumed

393 that association of type B:L2:ST122 P. multocida with FC might have occurred through host

394 adaptation, and spill-over transmission of the strains from bovine into chicken. Mixed cultivation

395 system of cattle, goat, sheep, and poultry together in the rural areas of Bangladesh as well as

396 poor hygienic practices in the farms further strengthen the possibility of cross-species

397 transmission directly or via the working personnel of the farms [82]. In support with the previous

398 reports, our results indicate that relationship between capsular type, genotype, biotype, host

399 origin, and disease manifestation of P. multocida is not clear cut, rather strains from the same

400 capsule, LPS and MLST types can cause similar or different diseases with varied symptoms in

401 multiple hosts despite their geographic origins or phylogenetic relationships [4, 16, 80].

402 However, further comprehensive studies focusing multi-host adaptation evolution are needed to

403 understand the pathogenesis, mode of transmission, and host adaptability of different serotypes

404 of P. multocida.

405 3.6. Genome-wide virulence factors-associated genes (VFGs) supporting the pathogenesis of the 406 FC 407 The genomic features such as coverage, identity and product of different VFGs identified

408 in the complete genomes of the two study strains are in Table 5. In this study, we found different

409 VFGs encoding for outer membrane and porin proteins (oma87, ompH, plpB, psl), adhesins

410 (ptfA, fimA), neuraminidases (nanH), iron acquisition related factors (exbB, exbD, tonB, fur,

411 tbpA, hgbA), and superoxide dismutases (sodA, sodC) in the assembled genome of both PM4

412 and PM7 isolates (Fig. 4). This result is in agreement with the PCR-based virulence profile of the

413 P. multocida strains studied (Table 1, Fig. 4). Potential VFGs were identified based on a

414 homology search against the Virulence Factor Database (VFDB), which identified 14 genes

415 (Table 5) in the PM4 and PM7 genomes, and their pathogenic functions including UDP-3-O-[3- bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

416 hydroxymyristoyl] N-acetylglucosamine deacetylase, ADP-L-glycero-D-manno-heptose-6-

417 epimerase, UDP-glucose 4-epimerase, D-glycero-beta-D-manno-heptose 1-phosphate

418 adenylyltransferase with 100% query coverage (Table 5). These gene-products are involved in

419 many biosynthetic pathways including secretion system and its effectors, several phospholipases,

420 the elastase and protease IV enzymes, production of phenazines, the exotoxin-A, quorum sensing

421 systems, and synthesis and uptake of the pyochelin siderophore that might have an important role

422 in survival and pathogenesis of P. multocida strains avian species [4, 17]. Previous studies

423 reported similar pathogenic gene profiles in P. multocida associated with diseases among

424 different hosts including chicken, bovine, porcine and rabbit [4, 11, 16]. Therefore, together

425 these findings indicate neither VFGs nor genotypes can be correlated with host specificity for P.

426 multocida [4, 16]. The high frequency of VFGs analyzed was also observed in other studies with

427 strains from both avian and animal hosts [4, 11, 16, 17]. The synchronous distribution of certain

428 VFGs, regardless of host species or P. multocida serotype, may suggest the selection of factors

429 that present cross-protection as candidates for vaccine development.

430 3.7. Antimicrobial resistance genes (ARGs) from complete genomes

431 Comprehensive search for ARGs in the complete genomes of P. multocida PM4 and PM7

432 genomes through the antimicrobial resistance databases such as CARD, ResFinder, and

433 MEGARes explored an array of ARGs (Fig. 4, Table 6). Both PM4 and PM7 genomes seem to

434 be well equipped with a similar load of drug resistance genes conferring resistance to

435 aminoglycoside [aph(3')-Ia, aph(3'')-Ib, aph(6)-Id], sulfonamides (sul2), tetracyclines (tetA,

436 tetD), phenicol (catII), trimethroprim (dfr), β-lactam (TEM-1). The ARGs were categorized into

437 efflux pump conferring antibiotic resistance, antibiotic inactivation enzyme, and antibiotic target

438 in susceptible species (Table 6). The presence of ARGs in the whole genome of PM4 and PM7 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

439 corroborated with the resistance pattern observed in antibiotic susceptibility test (Fig. 1, Table 6).

440 In parallel with most Gram-negative bacteria such as Pseudomonas, Vibrio, Stenotrophomonas

441 and Serratia, tetracycline resistant P. multocida frequently possesses genes tetD and tetA

442 implicating resistance to tetracycline through efflux of tetracycline or for a protein that prevent

443 tetracycline binding to the bacterial ribosome [25, 83]. Both the strains were resistant to most of

444 the antibiotics tested such as tetracycline, ampicillin, nalidixic acid, oxacillin, cefoxitin and

445 trimethoprim according to EUCAST breakpoints. Although, both the strains, PM4 and PM7

446 harbored dihydropteroate synthase type-2 (sul2), however, the PM4 strain showed complete

447 resistance to the antibiotic sulfonamide, while PM7 exhibited an inhibition zone of 27 mm (Fig.

448 1). In contrast to our results, Jabeen et al. [25] pmrE conferring resistance to polymyxins such as

449 colistin in avian P. multocida. Conversely, all of our isolates including PM4 and PM7 were

450 sensitive to colistin corroborating with the absence of pmrE gene in their genomes. Remarkably,

451 we did not find any plasmid and integrin representing sequences in the complete genomes of

452 PM4 or PM7 indicating the chromosomal origin of the ARGs [4]. Overall, the abundance of

453 ARGs might be correlated with

454 3.8. Metabolic pathways reconstruction

455 Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis classified the genes

456 of PM4, PM7 and reference strain (Razi_Pm001) into 34 categories, and 356 subsystems (Fig.

457 6). In these genome, 37% genes were located in the generated subsystems, and the rest were out

458 of the subsystem list. While RASTtk [84] annotation built metabolic pathways of PM4, PM7 and

459 the reference strain related to cellular process, metabolism, environmental information

460 processing, genetic information processing, and pathogenesis (Fig. 6a). Of these subsystems,

461 “amino acids and derivatives” was the largest functional pathway accounting for 190 genes in bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

462 PM4 and PM7, while the reference strain harbored 199 genes. Similarly, metabolic functional

463 pathways related to “protein metabolism” revealed 175 genes in PM4 and PM7 genomes, and

464 197in the reference strain. The genome of PM4 harbored 134 genes coding for metabolism of

465 “carbohydrates” whereas 142 and 141 genes were respectively found in the genomes of PM7 and

466 reference strain. In addition, 116 genes associated with “cofactors, vitamins, prosthetic groups,

467 pigments” metabolism were identified in the study genomes (PM4 and PM7) while the reference

468 strain had 120 genes to be related to this metabolic functional pathway (Fig. 6a). The isolates

469 possess several genes associated with adaptation supporting pathways that might help the

470 bacteria being accommodated to pathogenesis in multiple hosts. These pathways include flagellar

471 biosynthesis, motility, quorum sensing, biofilm formation, biosynthesis of vitamin, co-factors,

472 folate, xenobiotics metabolism and so on (Fig. 6b). Diverse metabolic pathways of the bacterial

473 strains reflect their pathogenic fitness, and robust to cause multiple diseases in different hosts

474 [76].

475 3.9. Pan-genome analysis of P. multocida

476 Genome diversity, genome dynamics, species evolution, pathogenesis, and other features

477 of microorganisms have been evaluated by applying pan-genome analysis [85]. The pan genome

478 includes genes present in all strains (core genome), and genes present only in two or more strains

479 of a species (variable or accessory genome). Genes present only in a single strain are called

480 unique genes. To better understand the phylogenetic relationship and bacterial evolution, we

481 performed a pan-genome analysis of seven publicly available whole-genome sequences of P.

482 multocida strains with our isolates (Fig. 7, Table S1). The evolution of the pan and core genome

483 is presented in Fig. 7a. In addition, each new genome sequence of P. multocida, the number of

484 gene families in the pan-genome increased from 2,131 to 2,838, and that of gene families in the bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

485 core genome decreased from 1,876 to 1,734 (Fig. 7a, b). The core genome accounted for an

486 average 61.1% of the pan genome. The gene families of the pan genome represent the housing

487 capacity of the genetic determinants and those of the core genome are usually related to bacterial

488 replication, translation, and maintenance of cellular homeostasis [85]. In our study, the unique

489 genes of each P. multocida strain exhibited a wide distribution, ranging from 17 (0.6%) to 100

490 (3.5%). We found 90 unique genes in our isolates (Table S2). These unique genes are found

491 under relaxed mutation pressure, and might have an association with the pathogenicity, virulence

492 and antimicrobial resistance [86], which might have facilitated the strains PM4 and PM7, though

493 being type B:2, to cause FC in layer birds. These types of genes enable the bacteria to transfer

494 benefits to themselves through the horizontal gene transfer, thereby enhancing symbiosis and

495 adaptation of the bacteria to the host, and subsequent onset of pathogenic episodes [87].

496 However, these potential unique virulence genes need further investigation to prove their

497 association with pathogenicity in FC. The phylogeny based on the pan genome demonstrated that

498 PM4 and PM7 are closer to strain Razi_Pm001 forming a clade with other strains C48-1, and

499 HN06 (Fig. 7c). In contrast, the tree based on the core genome showed that additional to

500 Razi_Pm001 the strain ATCC 2095 belonged to the same clade with our isolates PM4 and PM7

501 (Fig. 7d). These findings suggest the diverse genetic evolution of the pan and core genomes in

502 different P. multocida strains [85].

503 Conclusions

504 This study reports the characterization of 22 P. multocida isolates from the FC outbreaks

505 in commercial layer farms of Bangladesh. Biochemical and molecular typing grouped the

506 isolates into two major biotypes, and RAPD profiles. The in vitro investigation showed that

507 majority of the P. multocida isolates were multi-drug resistant, and strong biofilm formers. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

508 However, all of the study isolates were sensitive to colistin, suggesting this antibiotic to be

509 effective for treatment of infections in poultry with P. multocida. The complete genome analyses

510 of two selected isolates (PM4 and PM7) revealed that the isolates belonged to P. multocida

511 genotype B:L2:ST122, which type is commonly found in bovine infections, and not ever

512 reported to cause FC in laying chicken. Furthermore, the comprehensive analysis of the complete

513 genome sequence of P. multocida strain PM4 and PM7 has provided valuable insights on the

514 genomic structure with detection and identification of key important genes namely VFGs, ARGs,

515 and genes related to diverse metabolic functions. The pan-genome analysis revealed 90 unique

516 genes involved in versatile metabolic pathways, pathogenicity, virulence and antimicrobial

517 resistance implicating survival fitness and host adaptation advantages among the isolates causing

518 FC. However, further comprehensive genetic and phenotypic study covering multiple hosts

519 required to reveal the genes associated with disease-specificity and host-adaptability of P.

520 multocida. Furthermore, a clear phylogenomic relatedness for P. multocida can be established

521 based on the complete genome analysis. The insightful findings of this study has opened up an

522 avenue for further research on elucidating the mechanisms behind the molecular pathogenesis of

523 P. multocida associated FC in avian hosts with subsequent development of effective preventive

524 and therapeutic strategies.

525

526

527

528

529

530 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

531

532

533

534

535

536

537

538

539

540

541

542

543

544

545

546 Data availability

547 Complete genome sequences of PM4 and PM7 are available in the NCBI GenBank

548 database under the accession numbers CP052764 (BioSample: SAMN14639261) and CP052765

549 (BioSample: SAMN14639262), respectively in the BioProject: PRJNA626386.

550 Acknowledgments

551 This work was supported by the grant from Bangladesh Academy of Science – United

552 States Department of Agriculture (BAS – USDA) (Grant no: BAS -USDA PALS DU LSc -34). bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

553 We would also like to acknowledge Bangabandhu Science & Technology Fellowship Trust for

554 supporting Otun Saha with a PhD fellowship.

555 Conflict of interest

556 The authors declare no conflict of interest regarding this work.

557 Ethical approval

558 The authors confirm the strict adherence to the ethical policies of the journal, as noted on

559 the journal’s author guidelines page. Ethical approval was granted from the Animal

560 Experimentation Ethical Review Committee (AEERC), Faculty of Biological Sciences,

561 University of Dhaka under the Reference No. 71/Biol.Scs./2018-2019.

562 Author’s contributions

563 O.S. carried out the studies (sampling, laboratory experiments, molecular and data

564 analysis). O.S, M.S.R and M.R.I. performed the analyses, and drafted the initial manuscript. M.

565 N. H critically reviewed and interpreted the results, and edited the entire manuscript. M.A.H. and

566 M.S. developed the hypothesis, supervised the work, and critically review the final manuscript.

567 Finally, all authors read and approved the final manuscript.

568 569 References 570

571 [1] S.N. Panna, K.N.H. Nazir, M.B. Rahman, S. Ahamed, M.G. Saroare, S. Chakma, T. Kamal, 572 U.H. Majumder, Isolation and molecular detection of Pasteurella multocida Type A from 573 naturally infected chickens, and their histopathological evaluation in artificially infected 574 chickens in Bangladesh, Journal of Advanced Veterinary and Animal Research, 2 (2015) 338- 575 345. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

576 [2] T. Allen, K.A. Murray, C. Zambrana-Torrelio, S.S. Morse, C. Rondinini, M. Di Marco, N. 577 Breit, K.J. Olival, P. Daszak, Global hotspots and correlates of emerging zoonotic diseases, 578 Nature communications, 8 (2017) 1-10.

579 [3] S.J. Cutler, A.R. Fooks, W.H. Van der Poel, Public health threat of new, reemerging, and 580 neglected zoonoses in the industrialized world, Emerging infectious diseases, 16 (2010) 1.

581 [4] Z. Peng, W. Liang, F. Wang, Z. Xu, Z. Xie, Z. Lian, L. Hua, R. Zhou, H. Chen, B. Wu, 582 Genetic and phylogenetic characteristics of Pasteurella multocida isolates from different host 583 species, Frontiers in microbiology, 9 (2018) 1408.

584 [5] B.A. Wilson, M. Ho, Pasteurella multocida: from zoonosis to cellular microbiology, Clinical 585 microbiology reviews, 26 (2013) 631-655.

586 [6] S.S. Morse, J.A. Mazet, M. Woolhouse, C.R. Parrish, D. Carroll, W.B. Karesh, C. Zambrana- 587 Torrelio, W.I. Lipkin, P. Daszak, Prediction and prevention of the next pandemic zoonosis, The 588 Lancet, 380 (2012) 1956-1965.

589 [7] J. Kim, J.W. Kim, S.-I. Oh, B. So, W.-I. Kim, H.-Y. Kim, Characterisation of Pasteurella 590 multocida isolates from pigs with pneumonia in Korea, BMC veterinary research, 15 (2019) 119.

591 [8] Q. Liu, Y. Hu, P. Li, Q. Kong, Identification of Fur in Pasteurella multocida and the potential 592 of its mutant as an attenuated live vaccine, Frontiers in veterinary science, 6 (2019) 5.

593 [9] K.F. Kubatzky, Pasteurella multocida and immune cells, in: Pasteurella multocida, Springer, 594 2012, pp. 53-72.

595 [10] I.W. Wilkie, M. Harper, J.D. Boyce, B. Adler, Pasteurella multocida: diseases and 596 pathogenesis, in: Pasteurella multocida, Springer, 2012, pp. 1-22.

597 [11] T. Furian, K. Borges, R. Pilatti, C. Almeida, V. do Nascimento, C. Salle, H.d.S. Moraes, 598 Identification of the capsule type of Pasteurella multocida isolates from cases of fowl cholera by 599 multiplex PCR and comparison with phenotypic methods, Brazilian Journal of Poultry Science, 600 16 (2014) 31-36. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

601 [12] 12. Sander JE, Fowl Cholera. MSD Veterinary Mannual, Merck & Co., Inc., 602 Kenilworth, NJ, USA (2019).

603 [13] S. Ievy, M.F.R. Khan, M.A. Islam, M.B. Rahman, Isolation and identification of Pasteurella 604 multocida from chicken for the preparation of oil adjuvanted vaccine, Microbes and Health, 2 605 (2013) 1-4.

606 [14] R. Singh, B. Remington, P. Blackall, C. Turni, Epidemiology of fowl cholera in free range 607 broilers, Avian diseases, 58 (2014) 124-128.

608 [15] Z. Jaglic, Z. Kucerova, K. Nedbalcova, I. Pavlik, P. Alexa, M. Bartos, Characterisation and 609 comparison of Pasteurella multocida isolated from different species in the Czech Republic: 610 capsular PCR typing, ribotyping and dermonecrotoxin production, VETERINARNI 611 MEDICINA-PRAHA-, 50 (2005) 345.

612 [16] P. Cao, D. Guo, J. Liu, Q. Jiang, Z. Xu, L. Qu, Genome-wide analyses reveal genes subject 613 to positive selection in Pasteurella multocida, Frontiers in microbiology, 8 (2017) 961.

614 [17] M. Harper, M. John, C. Turni, M. Edmunds, F.S. Michael, B. Adler, P.J. Blackall, A.D. 615 Cox, J.D. Boyce, Development of a rapid multiplex PCR assay to genotype Pasteurella 616 multocida strains by use of the lipopolysaccharide outer core biosynthesis locus, Journal of 617 Clinical Microbiology, 53 (2015) 477-485.

618 [18] Z. Li, F. Cheng, S. Lan, J. Guo, W. Liu, X. Li, Z. Luo, M. Zhang, J. Wu, Y. Shi, 619 Investigation of genetic diversity and epidemiological characteristics of Pasteurella multocida 620 isolates from poultry in southwest China by population structure, multi-locus sequence typing 621 and virulence-associated gene profile analysis, Journal of Veterinary Medical Science, (2018) 622 18-0049.

623 [19] H.S. Aski, M. Tabatabaei, Occurrence of virulence-associated genes in Pasteurella 624 multocida isolates obtained from different hosts, Microbial pathogenesis, 96 (2016) 52-57.

625 [20] N. García, J. Fernández-Garayzábal, J. Goyache, L. Domínguez, A. Vela, Associations 626 between biovar and virulence factor genes in Pasteurella multocida isolates from pigs in Spain, 627 Veterinary Record, (2011). bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

628 [21] A. Bethe, L.H. Wieler, H.-J. Selbitz, C. Ewers, Genetic diversity of porcine Pasteurella 629 multocida strains from the respiratory tract of healthy and diseased swine, Veterinary 630 microbiology, 139 (2009) 97-105.

631 [22] B. Sellyei, Á. Thuma, D. Volokhov, Z. Varga, Comparative analysis of Pasteurella 632 multocida isolates from acute and chronic fowl cholera cases in Hungary during the period 2005 633 through 2010, Avian diseases, 61 (2017) 457-465.

634 [23] K. Mühldorfer, S. Schwarz, J. Fickel, G. Wibbelt, S. Speck, Genetic diversity of Pasteurella 635 species isolated from European vespertilionid bats, Veterinary microbiology, 149 (2011) 163- 636 171.

637 [24] A. García-Alvarez, A.I. Vela, E. San Martín, F. Chaves, J.F. Fernández-Garayzábal, D. 638 Lucas, D. Cid, Characterization of Pasteurella multocida associated with ovine pneumonia using 639 multi-locus sequence typing (MLST) and virulence-associated gene profile analysis and 640 comparison with porcine isolates, Veterinary microbiology, 204 (2017) 180-187.

641 [25] S. Jabeen, H.Y. Yap, F.F.J. Abdullah, Z. Zakaria, N.M. Isa, Y.C. Tan, Y.S. Joo, D.A. 642 Satharasinghe, A.R. Omar, Complete Genome Sequence Analysis and Characterization of 643 Selected Iron Regulation Genes of Pasteurella Multocida Serotype A Strain PMTB2. 1, Genes, 644 10 (2019) 81.

645 [26] C.D. Carrillo, A. Koziol, N. Vary, B.W. Blais, Applications of genomics in regulatory food 646 safety testing in Canada, in: New Insight into Brucella Infection and Foodborne Diseases, 647 IntechOpen, 2019.

648 [27] R. Edirmanasinghe, R. Finley, E.J. Parmley, B.P. Avery, C. Carson, S. Bekal, G. Golding, 649 M.R. Mulvey, A whole-genome sequencing approach to study cefoxitin-resistant Salmonella 650 enterica serovar Heidelberg isolates from various sources, Antimicrobial agents and 651 chemotherapy, 61 (2017).

652 [28] A.L. Cooper, A.J. Low, A.G. Koziol, M.C. Thomas, D. Leclair, S. Tamber, A. Wong, B.W. 653 Blais, C.D. Carrillo, Systematic Evaluation of Whole Genome Sequence-Based Predictions of 654 Salmonella Serotype and Antimicrobial Resistance, Frontiers in Microbiology, 11 (2020) 549. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

655 [29] L. Omaleki, P.J. Blackall, T. Cuddihy, S.A. Beatson, B.M. Forde, C. Turni, Using genomics 656 to understand inter-and intra-outbreak diversity of Pasteurella multocida isolates associated with 657 fowl cholera in meat chickens, Microbial Genomics, 6 (2020).

658 [30] K.M. Townsend, J.D. Boyce, J.Y. Chung, A.J. Frost, B. Adler, Genetic organization of 659 Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system, 660 Journal of Clinical Microbiology, 39 (2001) 924-929.

661 [31] O. Saha, M.N. Hoque, O.K. Islam, M. Rahaman, M. Sultana, M.A. Hossain, Multidrug- 662 Resistant Avian Pathogenic Escherichia coli Strains and Association of Their Virulence Genes in 663 Bangladesh, Microorganisms, 8 (2020) 1135.

664 [32] S. Momtaz, O. Saha, M.K. Usha, M. Sultana, M.A. Hossain, Occurrence of pathogenic and 665 multidrug resistant Salmonella spp. in poultry slaughter-house in Bangladesh, Bioresearch 666 Communications-(BRC), 4 (2018) 506-515.

667 [33] H. Shirzad-Aski, M. Tabatabaei, Molecular characterization of Pasteurella multocida 668 isolates obtained from poultry, ruminant, cats and dogs using RAPD and REP-PCR analysis, 669 Molecular Biology Research Communications, 5 (2016) 123.

670 [34] A. Sultana, O. Saha, A. Rahman Sid, A. Saha, S. Hussain, T. Islam, Molecular Detection of 671 Multidrug Resistance Pathogenic Bacteria from Protective Materials Used By Healthcare 672 Workers (HCW); Bangladesh Scenario, JApSc, 18 (2018) 48-55.

673 [35] T.C. Abbey, E. Deak, What's New from the CLSI Subcommittee on Antimicrobial 674 Susceptibility Testing M100, Clinical Microbiology Newsletter, 41 (2019) 203-209.

675 [36] 36. EUCAST. Clinical Breakpoints (2020). 676 https://www.eucast.org/clinical_breakpoints/

677 [37] M.N. Hoque, A. Istiaq, R.A. Clement, K.M. Gibson, O. Saha, O.K. Islam, R.A. Abir, M. 678 Sultana, A. Siddiki, K.A. Crandall, Insights Into the Resistome of Bovine Clinical Mastitis 679 Microbiome, a Key Factor in Disease Complication, Frontiers in Microbiology, 11 (2020) 860. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

680 [38] M. Masomian, R.N.Z.R.A. Rahman, A.B. Salleh, M. Basri, Analysis of comparative 681 sequence and genomic data to verify phylogenetic relationship and explore a new subfamily of 682 bacterial lipases, PloS one, 11 (2016) e0149851.

683 [39] S. Kumar, G. Stecher, K. Tamura, MEGA7: molecular evolutionary genetics analysis 684 version 7.0 for bigger datasets, Molecular biology and evolution, 33 (2016) 1870-1874.

685 [40] N. Saitou, M. Nei, The neighbor-joining method: a new method for reconstructing 686 phylogenetic trees, Molecular biology and evolution, 4 (1987) 406-425.

687 [41] M.A. Rahman, A.S. Arefin, O. Saha, M.M. Rahaman, Isolation and Identification of 688 Pesticides Degrading Bacteria from Farmland Soil, Bangladesh Journal of Microbiology, 35 689 (2018) 90-94.

690 [42] S. Andrews, FastQC: a quality control tool for high throughput sequence data, in, Babraham 691 Bioinformatics, Babraham Institute, Cambridge, United Kingdom, 2010.

692 [43] A.M. Bolger, M. Lohse, B. Usadel, Trimmomatic: a flexible trimmer for Illumina sequence 693 data, Bioinformatics, 30 (2014) 2114-2120.

694 [44] A. Bankevich, S. Nurk, D. Antipov, A.A. Gurevich, M. Dvorkin, A.S. Kulikov, V.M. Lesin, 695 S.I. Nikolenko, S. Pham, A.D. Prjibelski, SPAdes: a new genome assembly algorithm and its 696 applications to single-cell sequencing, Journal of computational biology, 19 (2012) 455-477.

697 [45] M. Alonge, S. Soyk, S. Ramakrishnan, X. Wang, S. Goodwin, F.J. Sedlazeck, Z.B. 698 Lippman, M.C. Schatz, RaGOO: fast and accurate reference-guided scaffolding of draft 699 genomes, Genome biology, 20 (2019) 1-17.

700 [46] D.H. Parks, M. Imelfort, C.T. Skennerton, P. Hugenholtz, G.W. Tyson, CheckM: assessing 701 the quality of microbial genomes recovered from isolates, single cells, and metagenomes, 702 Genome research, 25 (2015) 1043-1055.

703 [47] H. Hasman, D. Saputra, T. Sicheritz-Pontén, O. Lund, C.A. Svendsen, N. Frimodt-Møller, 704 F.M. Aarestrup, Rapid whole-genome sequencing for detection and characterization of bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

705 microorganisms directly from clinical samples, Journal of clinical microbiology, 52 (2014) 139- 706 146.

707 [48] F. Bertels, O.K. Silander, M. Pachkov, P.B. Rainey, E. van Nimwegen, Automated 708 reconstruction of whole-genome phylogenies from short-sequence reads, Molecular biology and 709 evolution, 31 (2014) 1077-1088.

710 [49] I. Letunic, P. Bork, Interactive Tree Of Life (iTOL) v4: recent updates and new 711 developments, Nucleic acids research, 47 (2019) W256-W259.

712 [50] J. Cury, T. Jové, M. Touchon, B. Néron, E.P. Rocha, Identification and analysis of integrons 713 and cassette arrays in bacterial genomes, Nucleic acids research, 44 (2016) 4539-4550.

714 [51] P.T. Clausen, F.M. Aarestrup, O. Lund, Rapid and precise alignment of raw reads against 715 redundant databases with KMA, BMC bioinformatics, 19 (2018) 1-8.

716 [52] D. Arndt, J.R. Grant, A. Marcu, T. Sajed, A. Pon, Y. Liang, D.S. Wishart, PHASTER: a 717 better, faster version of the PHAST phage search tool, Nucleic acids research, 44 (2016) W16- 718 W21.

719 [53] T. Tatusova, M. DiCuccio, A. Badretdin, V. Chetvernin, E.P. Nawrocki, L. Zaslavsky, A. 720 Lomsadze, K.D. Pruitt, M. Borodovsky, J. Ostell, NCBI prokaryotic genome annotation pipeline, 721 Nucleic acids research, 44 (2016) 6614-6624.

722 [54] T. Seemann, Prokka: rapid prokaryotic genome annotation, Bioinformatics, 30 (2014) 2068- 723 2069.

724 [55] R.K. Aziz, D. Bartels, A.A. Best, M. DeJongh, T. Disz, R.A. Edwards, K. Formsma, S. 725 Gerdes, E.M. Glass, M. Kubal, The RAST Server: rapid annotations using subsystems 726 technology, BMC genomics, 9 (2008) 1-15.

727 [56] T.M. Lowe, P.P. Chan, tRNAscan-SE On-line: integrating search and context for analysis of 728 transfer RNA genes, Nucleic acids research, 44 (2016) W54-W57. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

729 [57] D. Laslett, B. Canback, ARAGORN, a program to detect tRNA genes and tmRNA genes in 730 nucleotide sequences, Nucleic acids research, 32 (2004) 11-16.

731 [58] J.R. Grant, P. Stothard, The CGView Server: a comparative genomics tool for circular 732 genomes, Nucleic acids research, 36 (2008) W181-W184.

733 [59] N.-F. Alikhan, N.K. Petty, N.L.B. Zakour, S.A. Beatson, BLAST Ring Image Generator 734 (BRIG): simple prokaryote genome comparisons, BMC genomics, 12 (2011) 402.

735 [60] N.M. Chaudhari, V.K. Gupta, C. Dutta, BPGA-an ultra-fast pan-genome analysis pipeline, 736 Scientific reports, 6 (2016) 1-10.

737 [61] H. Li, Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM, 738 arXiv preprint arXiv:1303.3997, (2013).

739 [62] E. Doster, S.M. Lakin, C.J. Dean, C. Wolfe, J.G. Young, C. Boucher, K.E. Belk, N.R. 740 Noyes, P.S. Morley, MEGARes 2.0: a database for classification of antimicrobial drug, biocide 741 and metal resistance determinants in metagenomic sequence data, Nucleic acids research, 48 742 (2020) D561-D569.

743 [63] K.A. Jolley, M.-S. Chan, M.C. Maiden, mlstdbNet–distributed multi-locus sequence typing 744 (MLST) databases, BMC bioinformatics, 5 (2004) 1-8.

745 [64] E. Zankari, H. Hasman, S. Cosentino, M. Vestergaard, S. Rasmussen, O. Lund, F.M. 746 Aarestrup, M.V. Larsen, Identification of acquired antimicrobial resistance genes, Journal of 747 antimicrobial chemotherapy, 67 (2012) 2640-2644.

748 [65] B. Jia, A.R. Raphenya, B. Alcock, N. Waglechner, P. Guo, K.K. Tsang, B.A. Lago, B.M. 749 Dave, S. Pereira, A.N. Sharma, CARD 2017: expansion and model-centric curation of the 750 comprehensive antibiotic resistance database, Nucleic acids research, (2016) gkw1004.

751 [66] S.M. Lakin, C. Dean, N.R. Noyes, A. Dettenwanger, A.S. Ross, E. Doster, P. Rovira, Z. 752 Abdo, K.L. Jones, J. Ruiz, MEGARes: an antimicrobial resistance database for high throughput 753 sequencing, Nucleic acids research, 45 (2017) D574-D580. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

754 [67] L. Chen, J. Yang, J. Yu, Z. Yao, L. Sun, Y. Shen, Q. Jin, VFDB: a reference database for 755 bacterial virulence factors, Nucleic acids research, 33 (2005) D325-D328.

756 [68] M. Kanehisa, M. Furumichi, M. Tanabe, Y. Sato, K. Morishima, KEGG: new perspectives 757 on genomes, pathways, diseases and drugs, Nucleic acids research, 45 (2017) D353-D361.

758 [69] E. Hotchkiss, J. Hodgson, E. Schmitt-Van De Leemput, M. Dagleish, R. Zadoks, Molecular 759 epidemiology of Pasteurella multocida in dairy and beef calves, Veterinary microbiology, 151 760 (2011) 329-335.

761 [70] C. Kehrenberg, G. Schulze-Tanzil, J.-L. Martel, E. Chaslus-Dancla, S. Schwarz, 762 Antimicrobial resistance in Pasteurella and Mannheimia: epidemiology and genetic basis, 763 Veterinary research, 32 (2001) 323-339.

764 [71] H. Yoshimura, M. Ishimaru, Y. Endoh, A. Kojima, Antimicrobial susceptibility of 765 Pasteurella multocida isolated from cattle and pigs, Journal of Veterinary Medicine, Series B, 48 766 (2001) 555-560.

767 [72] X. Tang, Z. Zhao, J. Hu, B. Wu, X. Cai, Q. He, H. Chen, Isolation, antimicrobial resistance, 768 and virulence genes of Pasteurella multocida strains from swine in China, Journal of clinical 769 microbiology, 47 (2009) 951-958.

770 [73] A. Al Masud, E.K. Rousham, M.A. Islam, M.-U. Alam, M. Rahman, A. Al Mamun, S. 771 Sarker, M. Asaduzzaman, L. Unicomb, Drivers of antibiotic use in poultry production in 772 Bangladesh: dependencies and dynamics of a patron-client relationship, Frontiers in Veterinary 773 Science, 7 (2020).

774 [74] I. Ahmed, M.B. Rabbi, S. Sultana, Antibiotic resistance in Bangladesh: A systematic 775 review, International Journal of Infectious Diseases, 80 (2019) 54-61.

776 [75] B.D.d. Emery, T.Q. Furian, R.M. Pilatti, G.Z. Chitolina, K.A. Borges, C.T. Salle, H.L. 777 Moraes, Evaluation of the biofilm formation capacity of Pasteurella multocida strains isolated 778 from cases of fowl cholera and swine lungs and its relationship with pathogenicity, Pesquisa 779 Veterinária Brasileira, 37 (2017) 1041-1048. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

780 [76] M.N. Hoque, A. Istiaq, R.A. Clement, M. Sultana, K.A. Crandall, A.Z. Siddiki, M.A. 781 Hossain, Metagenomic deep sequencing reveals association of microbiome signature with 782 functional biases in bovine mastitis, Scientific reports, 9 (2019) 1-14.

783 [77] C. Vuotto, G. Donelli, Novel treatment strategies for biofilm-based infections, Drugs, 784 (2019) 1-21.

785 [78] S. Dey, V. Singh, A. Kumar, B. Sharma, S. Srivastava, N. Singh, Comparative sequence 786 analysis of 16S rRNA gene of Pasteurella multocida serogroup B isolates from different animal 787 species, Research in veterinary science, 83 (2007) 1-4.

788 [79] T. Jatuponwiphat, P. Chumnanpuen, S. Othman, E. Teerasak, W. Vongsangnak, Iron- 789 associated protein interaction networks reveal the key functional modules related to survival and 790 virulence of Pasteurella multocida, Microbial pathogenesis, 127 (2019) 257-266.

791 [80] F. Dziva, H. Christensen, L. Van Leengoed, K. Mohan, J. Olsen, Differentiation of 792 Pasteurella multocida isolates from cases of atrophic rhinitis in pigs from Zimbabwe by RAPD 793 and ribotyping, Veterinary microbiology, 102 (2004) 117-122.

794 [81] P.C. Thiaville, K.L. Bourdage, A.C. Wright, M. Farrell-Evans, C.W. Garvan, P.A. Gulig, 795 Genotype is correlated with but does not predict virulence of Vibrio vulnificus biotype 1 in 796 subcutaneously inoculated, iron dextran-treated mice, Infection and immunity, 79 (2011) 1194- 797 1207.

798 [82] N. Teufel, A. Markemann, B. Kaufmann, A. Valle-Zárate, J. Otte, Livestock production 799 systems in South Asia and the Greater Mekong sub-region, A quantitative description of 800 livestock production in Bangladesh, Cambodia, India, Lao PDR, Nepal, Pakistan, Sri Lanka, 801 Thailand, and Viet Nam, (2010).

802 [83] R.C. Founou, L.L. Founou, M. Allam, A. Ismail, S.Y. Essack, Whole genome sequencing of 803 extended spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae isolated from 804 hospitalized patients in KwaZulu-Natal, South Africa, Scientific reports, 9 (2019) 1-11.

805 [84] T. Brettin, J.J. Davis, T. Disz, R.A. Edwards, S. Gerdes, G.J. Olsen, R. Olson, R. Overbeek, 806 B. Parrello, G.D. Pusch, RASTtk: a modular and extensible implementation of the RAST bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

807 algorithm for building custom annotation pipelines and annotating batches of genomes, Scientific 808 reports, 5 (2015) 8365.

809 [85] J.-N. Lin, C.-H. Lai, C.-H. Yang, Y.-H. Huang, H.-H. Lin, Genomic features, comparative 810 genomics, and antimicrobial susceptibility patterns of Elizabethkingia bruuniana, Scientific 811 reports, 9 (2019) 1-9.

812 [86] L. Carlos Guimaraes, L. Benevides de Jesus, M. Vinicius Canario Viana, A. Silva, R. 813 Thiago Juca Ramos, S. de Castro Soares, V. Azevedo, Inside the pan-genome-methods and 814 software overview, Current genomics, 16 (2015) 245-252.

815 [87] D. Zhu, J. He, Z. Yang, M. Wang, R. Jia, S. Chen, M. Liu, X. Zhao, Q. Yang, Y. Wu, 816 Comparative analysis reveals the Genomic Islands in Pasteurella multocida population genetics: 817 on Symbiosis and adaptability, BMC genomics, 20 (2019) 1-11.

818 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

Pasteurella multocida type B:2 from fowl cholera

Table 1. Primers for genotyping and pathogenic gene (VFGs) characterization in P. multocida

strains.

Target Product Gene product Description Primer sequence (Forward/Reverse) (5’-3’) gene size Identification of ATCCGCTATTTACCCAGTGG P. multocida kmt1 all P. 460 specific GCTGTAAACGAACTCGCCAC multocida isolates 16S P16Sf AGAGTTTGATYMTGGC 16S rRNA 1500 rRNA P16Sr GYTACCTTGTTACGACTT Outer Outer membrane ATGAAAAAACTTTTAATTGCGAGC omp87 membrane and protein 87 988 porin proteins TGACTTGCGCAGTTGCATAAC Dermonecrotic toxin TCTTAGATGAGCGACAAGG toxA Toxin 846 GAATGCCACACCTCTATAG Autotransporter TTGAGTCGGCTGTAGAGTTCG Hsf-1 Adhesins adhesion 664 ACTCTTTAGCAGTGGGGACAACCTC TGTGGAATTCAGCATTTTAGTGTGTC Fimbriae ptfA Adhesins 488 TCATGAATTCTTATGCGCAAAATCCT GCTGG Filamentous AGCTGATCAAGTGGTGAAC pfhA Adhesins haemagglutinin 275 TGGTACATTGGTGAATGCTG Hyaluronidase TCAATGTTTGCGATAGTCCGTTAG pmHAS Hyaluronidase 430 TGGCGAATGATCGGTGATAGA Neuraminidases GTCCTATAAAGTGACGCCGA nanB Neuraminidases 554 ACAGCAAAGGAAGACTGTCC TGGCGGATAGTCATCAAG

Iron acquisition Haemoglobin hgbA 419 related factor binding protein CCAAAGAACCACTACCCA

TTGGCTTGTGATTGAACGC Iron acquisition Iron regulated and exbB TGCAGGAATGGCGACTAA A 283 related factor acquisition factors

AGTTAGTAGCGGGGTTGGCA Superoxide Superoxide TGGTGCTGGGTGATCATCATG sodC 235 dismutases dismutases

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

Pasteurella multocida type B:2 from fowl cholera

Table 2. The bio-molecular features, and VFGs profile of the P. multocida isolates (n=22).

Isolates Biotype kmt1 Pathogenic genes PM1 1 + exbB, omp87, hgbA PM2 1 + exbB, omp87, ptfA PM4 2 + exbB, omp87, ptfA, nanB, sodC, hgbA PM5 1 + omp87, ptfA, nanB, sodC, hgbA PM7 1 + exbB, omp87, ptfA, nanB, sodC, hgbA PM10 2 + exbB, sodC, hgbA PM11 1 + exbB, omp87, ptfA, nanB PM12 2 + nanB, sodC, hgbA PM13 1 + nanB, sodC, hgbA PM14 1 + exbB, omp87, ptfA, nanB, sodC PM15 2 + exbB, omp87, ptfA, nanB, sodC, hgbA PM19 2 + exbB, omp87, ptfA, nanB, sodC, hgbA PM21 2 + exbB, omp87, ptfA, nanB, sodC, hgbA PM22 1 + nanB, sodC, hgbA PM26 1 + nanB, sodC, hgbA PM30 1 + nanB, sodC, hgbA PM31 2 + exbB, omp87, ptfA, nanB, sodC, hgbA PM34 1 + nanB, sodC, hgbA PM36 1 + exbB, omp87, sodC, hgbA PM39 2 + nanB, sodC, hgbA PM43 1 + nanB, sodC, hgbA PM44 1 + nanB, sodC, hgbA

‘+’ = presence; Biotype: 1(Glucose+, Inositol+, Lactose -, Mannitol +, Mannose +, Sucrose +, Dulcitol -, Xylose +, Indole production +, MR-VP -, Urease -, H2S production -, Citrate utilization -, Catalase +, Oxidase +), Biotype: 2 (Glucose+, Inositol-, Lactose -, Mannitol +, Mannose +, Sucrose +, Dulcitol -, Xylose +, Indole production +, MR-VP -, Urease -, H2S production -, Citrate utilization -, Catalase +, Oxidase +) represent two different RAPD patterns.

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

Pasteurella multocida type B:2 from fowl cholera

Table 3. Summary of genome assembly and genotypic characteristics of whole genome sequenced PM4 and PM7 strains of P. multocida.

Str Host Clinic Capsu LPS MLST No. of No. of GC Coverage Size (bp) Comple ain origin al lar genot genotype Contigs Contigs (%) teness syndro genoty ypes after me pes scafolding PM chicken Fowl B L2 ST122 34 1 40.4 458 X 2,408,286 99.55 4 cholera PM chicken Fowl B L2 ST122 37 1 40.4 455X 2,408,436 99.55 7 cholera

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

Pasteurella multocida type B:2 from fowl cholera

Table 4. Assembly and annotation statistics of the PM4 and PM7 strains of P. multocida.

Features PM4 PM7 NCBI Prokaryotic Genome Annotation Pipeline (PGAP) (GeneMarkS-2+) Genes (total) 2,318 2,319 CDSs (total) 2,260 2,261 Genes (coding) 2,217 2,221 Genes (RNA) 58 58 Complete rRNAs (5S, 16S, 23S) 2, 1, 1 2, 1, 1 tRNAs 50 50 ncRNAs 4 4 Pseudo Genes (total) 43 40 RASTtk v2.0 Number of Coding Sequences (CDS) 2,323 2,332 Gene in Subsystem Non-Hypothetical 814 817 Hypothetical 39 39 Gene not in Non-Hypothetical 992 993 Subsystem Hypothetical 478 483 Number of RNAs 56 56 Prokka v1.12 Number of genes predicted 2,313 2,313 Number of protein coding genes 2,258 2,258 Number of genes with non-hypothetical function 1,684 1,682 Number of genes with EC-number 890 890 Number of genes with Seed Subsystem Ontology 745 745 tRNAscan-SE v. 2.0 Total tRNAs 52 52 ARAGORN v1.2.38 Total tRNA genes 50 50 Total tmRNA 1 1

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

Pasteurella multocida type B:2 from fowl cholera

Table 5. Genome-wide distribution of VFGs, and their features in PM4, PM7 and Razi_Pm0001 strains.

Gene Query Query Product Coverage identity (%) (%) lpxC 100 91 UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase rfaD 100 90 ADP-L-glycero-D-manno-heptose-6-epimerase galE 100 86 UDP-glucose 4-epimerase rfaE 100 85 D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase/ D-glycero-beta-D-manno-heptose-7-phosphate kinase yhxB/manB 98 88 Phosphoglucosamine mutase wecA 98 83 Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase msbA 98 80 Lipid A export permease/ATP-binding protein MsbA orfM 97 83 Nucleoside 5-triphosphatase RdgB (dHAPTP, dITP, XTP-specific) galU 96 87 UTP--glucose-1-phosphate uridylyltransferase lpxB 96 81 Lipid-A-disaccharide synthase kdsA 94 92 2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase gmhA/lpcA 94 91 D-sedoheptulose 7-phosphate isomerase rfaF 91 83 ADP-heptose--lipooligosaccharide heptosyltransferase II msbB 80 80 Lipid A biosynthesis myristoyltransferase

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

Pasteurella multocida type B:2 from fowl cholera

Table 6. Antimicrobial resistance genes (ARGs) in the genomes of PM4 and PM7 strain.

Gene Product Resistance mechanism aph(3'')-Ib Aminoglycoside 3''-phosphotransferase sul2 Dihydropteroate synthase type-2, Sulfonamide resistance protein catII Chloramphenicol O-acetyltransferase Antibiotic inactivation TEM-1 Class A beta-lactamase enzyme aph(3')-Ia Aminoglycoside 3'-phosphotransferase aph(6)-Id Aminoglycoside 6-phosphotransferase tetD Right origin-binding protein tetA Tetracycline resistance, MFS efflux pump Efflux pump contributing resistance tetR Tetracycline resistance regulatory protein TetR TUFAB EF-Tu inhibition protein folA, dfr Dihydrofolate reductase Antibiotic target in susceptible species rho Transcription termination factor Rho

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Genome-wide diversity and differentiation of two novel multidrug-resistant populations of

Pasteurella multocida type B:2 from fowl cholera

Fig. 1. Antimicrobial resistance profile of the tested 22 P. multocida strains. Antibiotic susceptibility to 17 antibiotics of varied classes was determined by disk diffusion assays. The strains were categorized as resistant or susceptible based on the breakpoints defined by the European Committee on Antimicrobial Susceptibility Testing (EUCAST, 2020). Numeric inside the gray boxes represent zone of inhibition (in mm unit) for the antibiotics that have no standard breakpoints currently available. Biofilm producing abilities are shown in the right column based on their adherence potential on 24-well polystyrene plates. The superscript asterisks (*) in two isolates (PM4 and PM7) indicate that they were selected for WGS.

Fig. 2 Biofilm formation (BF) ability of the P. multocida isolates. (a) Mean optical density (OD) of the 22 isolates measured at 600 nm after 48 h growth at 37 °C. The horizontal line represents the threshold below which indicates non-biofilm producers. Biofilms of two strong biofilm-producing isolates, (b) PM4 and (c) PM7 were further observed under scanning acoustic microscopy (SAM). The SAM micrographs demonstrated the colonizing bacterial cells after 48 h incubation, and revealed how the bacteria tend to grow in clumps (micro-colonies), and the exopolysaccharide that is covering the bacteria. Error bars represent standard deviation.

Fig. 3. Circular representation of the genome of of P. multocida (a) PM4 and (b) PM7 strains. The PM4 and PM7 genomes, and their coding regions with homologies, the tRNA and rRNA operons, and the overall G-C content are presented. The outer two circles demonstrate the coding sequence (CDS), tRNA, and rRNA. The third circle shows the GC content (black). The fourth circle represents the GC skew curve (positive GC skew, green; negative GC skew, violet). The figures were generated by using CGView Server (http://stothard.afns.ualberta.ca/cgview_server/).

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

Fig. 4. Distribution of virulence factors-associated genes (VFGs), antibiotic resistance genes (ARGs), and prophage related sequence features. Genomes of P. multocida strains Razi_Pm0001 and NCTC10323 found to be more closely related to P. multocida PM4 and PM7 strains. Capsular serotype determining gene (black), LPS genotyping genes (teal), VFGs (red), ARGs (purple), and prophage (orange) are presented with their respective genomic positions.

Fig. 5. Complete genome-based phylogenetic analysis of P. multocida strains. The phylogenetic tree was constructed using the Reference Sequence Alignment Based Phylogeny Builder (REALPHY).

Fig. 6. Metabolic pathway reconstruction and subsystem distribution. (a) Comparative gene distribution to different metabolic pathways of PM4, PM7, and the closely related Razi_Pm0001 genomes as predicted by Rapid Annotation System Technology (RAST) Server. (b) The genes classified into 34 categories, and 356 subsystems. The pie chart and count of the subsystem features in the right panel demonstrate the percentage distribution and category of the subsystems found in all the three strains PM4, PM7, and Razi_Pm0001, predicted using KEGG pathway analysis.

Fig. 7. Pan-genome analysis of seven P. multocida strains in the repertoire of GenBank. (a) Pan-genome and core genome plot shows the progression of the pan (orange line) and core (purple line) genomes as more genomes are added for analysis. The parameter 'b' = 0.17 indicates the pan genome is still open but may be closed soon. The pan genome is still open, as the new additional genome significantly increases the total repertoire of genes. Extrapolation of the curve indicates that the gene families in pan genome increased from 2,131 to 2,838, and those in core genome decreased from 1,876 to 1,734. (b) Flower plot shows the numbers of core genes (inner circle), accessory genes (middle circle), and unique genes (outer circle). (c) Phylogenetic tree based on the pan genome. (d) Phylogenetic tree based on the core genome.

bioRxiv preprint doi: https://doi.org/10.1101/2020.08.24.262618; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.