LETTERS trophoresis (PFGE) analysis demon- recently to Chile (8), where it has comparison with Asian and North strated these to be a unique clone dis- caused hundreds of infections, result- American pandemic isolates. J Clin Microbiol. 2004;42:4672–8. tinct from Asian and American clini- ing in the first V. parahaemolyticus 6. Okuda J, Ishibashi M, Hayakawa E, cal strains (5). pandemic in history (9). We report the Nishino T, Takeda Y, Mukhopadhyay AK, In July 2004, a V. parahaemolyti- first evidence that it has been intro- et al. Emergence of a unique O3:K6 clone cus outbreak of 80 illnesses occurred duced to Europe. The emergence of of Vibrio parahaemolyticus in Calcutta, India, and isolation of strains from the same in A Coruña, Spain. All the case- this virulent serotype in Europe is a clonal group from Southeast Asian travelers patients attended weddings in the public health concern and emphasizes arriving in Japan. J Clin Microbiol. same restaurant. V. parahaemolyticus the need to include V. parahaemolyti- 1997;35:3150–5. was isolated from stool samples of 3 cus in microbiologic surveillance and 7. Daniels NA, Ray B, Easton A, Marano N, Kahn E, McShan AL II, et al. Emergence of patients. The outbreak isolates were reexamine control programs for shell- a new Vibrio parahaemolyticus serotype in characterized by serotyping, poly- fish-harvesting areas and ready-to-eat raw oysters: a prevention quandary. JAMA. merase chain reaction (PCR) for seafood. 2000;284:1541–5. species-specific genes (Vp-toxR and 8. González-Escalona N, Cachicas V, Jaime Martinez-Urtaza,* Acevedo C, Rioseco ML, Juan A. Vergara tlh), virulence-related genes (tdh and JA, et al. Vibrio parahaemolyticus diar- trh), and group specific (GS)-PCR (a Lourdes Simental,* rhea, Chile, 1998 and 2004. Emerg Infect PCR method to detect the pandemic David Velasco,† Angelo DePaola,‡ Dis. 2005;11:129–31. clone). Two isolates belonged to the Masanori Ishibashi,§ 9. Matsumoto C, Okuda J, Ishibashi M, Yoshitsugu Nakaguchi,¶ Iwanaga M, Garg P, Rammamurthy T, et al. serotype O3:K6, while the remaining Pandemic spread of an O3:K6 clone of isolate was O3:K untypeable. All 3 Mitsuaki Nishibuchi,¶ Vibrio parahaemolyticus and emergence of isolates had the toxR, tlh, and tdh Dolores Carrera-Flores,# related strains evidenced by arbitrarily genes, lacked the trh gene, and were Carmen Rey-Alvarez,# primed PCR and toxRS sequence analyses. positive for the GS-PCR assay to and Anxela Pousa# J Clin Microbiol. 2000;38:578–85. detect pandemic strains. These results *Universidad de Santiago de Compostela, Address for correspondence: Jaime Martinez- unequivocally linked the outbreak iso- Santiago de Compostela, Spain; †Complexo Hospitalario Universitario Juan Urtaza, Instituto de Acuicultura, Universidad de lates to the O3:K6 pandemic clone of Canalejo, A Coruña, Spain; ‡US Food and Santiago de Compostela, Campus Universitario V. parahaemolyticus. To confirm the Drug Administration, Dauphin Island, Sur, 15782 Santiago de Compostela, Spain; fax: relationship with the pandemic clone, Alabama, USA; §Osaka Prefectural 34-981-547-165; email: [email protected] the outbreak isolates were additionally Institute of Public Health, Osaka, Japan; subjected to DNA fingerprinting ¶Kyoto University, Kyoto, Japan; and #Consellería de Sanidade, Santiago de analyses. PFGE and arbitrarily primed Compostela, Spain PCR analyses showed that these iso- lates exhibited a pattern indistinguish- References able from those of pandemic strains from Asia. The epidemiologic investi- 1. Mead PS, Slutsker L, Dietz V, McCaig LF, Bresee JS, Shapiro C, et al. Food-related ill- Q Fever and gation associated with the outbreak ness and death in the United States. Emerg identified the boiled crab eaten in the Infect Dis. 1999;5:607–25. the US Military restaurant as the most probable source 2. Joseph SW, Colwell RR, Kaper JB. Vibrio of the infection. Live crabs were parahaemolyticus and related halophilic To the Editor: Q fever is a imported to Spain from the United vibrios. Crit Rev Microbiol. 1982;10: zoonotic disease caused by the rick- 77–124. ettsialike organism Coxiella burnetii. Kingdom, processed under unhealthy 3. Opinion of the Scientific Committee on conditions, and stored at room temper- Veterinary Measures relating to Public The disease has a worldwide distribu- ature for several hours before they Health on Vibrio vulnificus and Vibrio tion and can infect many different were eaten. All the seafood eaten at the parahaemolyticus. European Commission. species, although cattle, sheep, and 2001. goats are the primary reservoirs (1). weddings was harvested in Europe, 4. Lozano-Leon A, Torres J, Osorio CR, and no imported food was eaten or Martinez-Urtaza J. Identification of tdh- Transmission to humans usually handled in the restaurant. positive Vibrio parahaemolyticus from an occurs by inhaling dust or aerosols Pandemic O3:K6 clone of V. para- outbreak associated with raw oyster con- from infected animals, and approxi- sumption in Spain. FEMS Microbiol Lett. mately half of infected persons mani- haemolyticus appeared in Asia around 2003;226:281–4. 1996 (6). Since its emergence, it has 5. Martinez-Urtaza J, Lozano-Leon A, fest clinical symptoms. In acute Q accounted for most V. parahaemolyti- DePaola A, Ishibashi M, Shimada K, fever infection, the 3 main sets of cus infections in Asia. It spread to the Nishibuchi M, et al. Characterization of symptoms are flulike syndrome, pathogenic Vibrio parahaemolyticus iso- pneumonia, and hepatitis (2,3). United States in 1998 (7) and more lates from clinical sources in Spain and

1320 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 11, No. 8, August 2005 LETTERS

Q fever has military relevance not occurred in Iraq from March 1 to reported contact with domestic ani- only in its potential use as a bioterror- August 20, 2003. A pneumonia case mals, including dogs, cats, sheep, ism agent, but also because of the risk was defined as occurring in a patient goats, and camels. Two of the patients for natural infection in deployed mili- with a chest radiograph suggesting reported tick bites within 30 days tary personnel. Thousands of cases of pneumonia and >1 of the following before becoming ill, and 1 reported Q fever have been seen in military symptoms: fever, cough, or shortness drinking raw sheep’s milk. The 5 personnel since the disease was first of breath. The Defense Medical other patients who became ill with reported in the 1930s (4). Since the Surveillance System (DMSS) was pneumonia also first sought care most common mode of transmission queried to determine how many while in northern Iraq. Predeployment is airborne, personnel do not need to patients had both predeployment and sera from these 3 patients were also have direct contact with infected ani- postdeployment serum samples avail- tested for C. burnetii by IFA, and all mals to be exposed. able for Q fever testing. The Army samples were negative for both IgG C. burnetii was first recognized as Medical Surveillance Activity, which and IgM. an infectious disease threat to US mil- operates DMSS, also maintains the Extremely limited information is itary troops serving in Iraq in 2003 Department of Defense Serum available on Q fever disease preva- during a pneumonia outbreak investi- Repository and stores serum from lence in Iraq, either in animals or gation. Nineteen cases of severe pneu- service members after mandatory humans. Iraq is primarily an agricul- monia, including 2 deaths, occurred HIV testing and deployment process- tural country, and nomadic herding from March 1 to August 20 (5). A case ing (6). Predeployment sera must be takes place countrywide, except in the was defined as occurring in a patient collected within the year before northernmost regions and along the with bilateral alveolar infiltrates that deployment. eastern border, where adequate land is required intubation and mechanical Twenty-two soldiers had prede- available for grazing livestock. The ventilation. This investigation ployment and postdeployment sera most common livestock in Iraq are involved extensive serologic testing available; samples were tested for cattle, sheep, and goats (7). Although for possible infectious causes of pneu- phase I and phase II antibody to Q herds of infected animals may exist in monia, including C. burnetii. Of 19 fever by using IFA. Results showed 5 any region of Iraq, larger concentra- patients with severe pneumonia tested additional soldiers in whom pneumo- tions of livestock may exist in north- for C. burnetii, 3 had positive anti- nia was diagnosed while serving in ern areas, where land is suitable for body titers by immunofluorescence Iraq and who seroconverted to C. bur- ruminants to graze. This concentra- assay (IFA). No other infectious cause netii before postdeployment serum tion could lead to a higher risk for was confirmed for the remaining draws (Table). All predeployment transmission to humans because the cases of pneumonia. Although C. bur- antibody titers for both immunoglob- chance of contact with infected ani- netii was not determined to be the ulin (Ig) G and IgM were negative in mals would be greater. cause of the pneumonia outbreak, the these 5 soldiers, with an IFA titer of These data indicate the potential finding of 3 patients with positive 1:16 as a cutoff. importance of C. burnetii as an infec- antibody titers launched an effort to The initial 3 Q fever patients ascer- tious disease threat to US military ascertain other cases of Q fever tained through the pneumonia out- troops in Iraq. Healthcare providers among military personnel who served break investigation were extensively should include Q fever in their differ- in Iraq during that time. interviewed for possible exposures. ential diagnosis of community- Approximately 62 cases of pneu- All 3 patients first experienced symp- acquired pneumonia and consider monia, both severe and nonsevere, toms while in northern Iraq and adding doxycycline to a combined antimicrobial drug regimen to pre- sumptively treat severe pneumonia. Future studies to be completed include case ascertainment to locate US troops who were infected with Q fever while in Iraq and in whom pneu- monia or other clinical manifestations of illness may have developed.

Research was conducted in compli- ance with the Animal Welfare Act and

Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 11, No. 8, August 2005 1321 LETTERS other federal statutes and regulations relat- Anaplasma were collected from 50 dogs and 20 ing to animals and experiments involving horses that showed tick infestation animals and adheres to principles stated in phagocytophilum, and symptoms consistent with tick- the Guide for the Care and Use of Sardinia, Italy borne disease, such as fever, anorexia, Laboratory Animals, NRC Publication, jaundice (only in horses), anemia, 1996 edition. To the Editor: Anaplasma phago- myalgia, and reluctance to move. cytophilum (formerly Ehrlichia Genomic DNA was extracted from phagocytophila), a tick-transmitted the buffy coat obtained by centrifuga- Alicia D. Anderson,* pathogen that infects several animal Bonnie Smoak,* Eric Shuping,† tion of 2 to 4 mL of blood, as previ- species, including humans (involved ously described (6). Furthermore, Christopher Ockenhouse,* as accidental “dead-end” hosts), is the and Bruno Petruccelli‡ DNA was extracted from 50 causative agent of human granulocyt- Rhipicephalus sanguineus ticks *Walter Reed Army Institute of Research, ic anaplasmosis (HGA). It is a Silver Spring, Maryland, USA; †Ireland removed from 30 dogs. Primers pathogen of veterinary importance Army Community Hospital, Fort Knox, EphplgroEL(569)F (ATGGTATGCA- Kentucky, USA; and ‡US Army Center for responsible for tickborne fever of GTTTGATCGC), EphplgroEL (1193) Health Promotion and Preventive ruminants and for granulocytic R (TCTACTCTGTCTTTGCGTTC), Medicine, Aberdeen Proving Ground, anaplasmosis of horses and dogs Maryland, USA and EphgroEL(1142)R (TTGAGTA- (1,2). HGA was first described in the CAGCAACACCACCGGAA) were References United States in 1994 (2) and is designed and used in combination to emerging in Europe (3). Although 1. McQuiston JH, Childs JE. Q fever in generate a heminested polymerase only 2 human cases have been report- chain reaction (PCR) for the selective humans and animals in the United States. ed in Italy (4), serologic and molecu- Vector Borne Zoonotic Dis. 2002;2: amplification of 573 bp of the groEL 179–91. lar findings have shown A. phagocy- gene of A. phagocytophilum. The final 2. Maurin M, Raoult D. Q fever. Clin tophilum infections in dogs and µ Microbiol Rev. 1999;12:518–53. 50 L PCR volume of the first PCR Ixodes ricinus ticks (5). Incidence, round contained 5 µL of the DNA 3. Stoker MGP, Marmion BP. The spread of Q prevalence, and public impact of fever from animals to man: the natural his- extraction, primers EphplgroEL tory of a rickettsial disease. Bull World HGA and horse granulocytic anaplas- (569)F and EphplgroEL(1193)R, and Health Organ. 1955;13:781–806. mosis are, therefore, unknown for this 4. Spicer AJ. Military significance of Q fever: HotMaster Taq DNA polymerase geographic area. From 1992 to 1996, (5u/µL, Eppendorf) according to the a review. J R Soc Med. 1978;71:762–7. an average rate of 13.4 cases/year/ 5. Severe acute pneumonitis among deployed manufacturer’s basic protocol U.S. military personnel—southwest Asia, 100,000 inhabitants of tick bite–relat- (Eppendorf AG, Hamburg, Germany). March–August, 2003. MMWR Morb ed fever of unknown etiology has Mortal Wkly Rep. 2003;52:857. Heminested PCR was performed by been reported on the island of using 5 µL of each of the first PCR 6. Rubertone MV, Brundage JF. The Defense Sardinia, Italy, which is considerably Medical Surveillance System and the products and primer EphgroEL Department of Defense serum repository: higher than the corresponding nation- (1142)R. To confirm the PCR diagno- glimpses of the future of public health sur- al average value of 2.1 cases/year/ veillance. Am J Public Health. sis, amplicons were digested with the 100,000 inhabitants. Moreover, 117 HindIII restriction endonuclease (pre- 2002;92:1900–4. cases of tick bite–related fever, whose 7. Bishay FK. Towards sustainable agricultur- dicted digestion pattern: 3 fragments al development in Iraq: the transition from etiology remains obscure, have been of 525 bp, 21 bp, and 27 bp). relief, rehabilitation, and reconstruction to reported from 1995 to 2002 in the development [monograph on the Internet]. Anaplasma phagocytophilum DNA central west coast area of the island. was obtained from strain NCH-1 and Rome: Food and Agriculture Organization Local newspapers occasionally report of the United Nations. 2003 [cited 2005 Jun used as positive control in PCR reac- 2]. Available from http://www.fao.org/doc- deaths as a result of tick bites, tions. Sequences were obtained by uments/show_cdr.asp?url_file=/DOCREP/ although no HGA-associated deaths 006/Y9870E/Y9870E00.HTM cloning the PCR products into the have been documented in Europe. pCR2.1-TOPO vector (Invitrogen This study investigated A. phago- S.R.L., Milan, Italy) and using the Address for correspondence: Alicia D. cytophilum in Sardinia. From 2002 to Anderson, Walter Reed Army Institute of ABI PRISM Big Dye Terminator 2004, veterinarians based on the cen- Cycle Sequencing Ready Reaction Research, Preventive Medicine Division, 503 tral west coast of the island were Robert Grant Ave, Silver Spring, MD 20910, Kit (Applied Biosystems, Foster City, instructed to collect EDTA blood sam- CA, USA), according to the protocols USA; fax: 301-319-9104; email: alicia.ander- ples when a suspected case of tick [email protected] supplied by the manufacturers. bite–related fever was found at their Sequences (AY848751, AY848747) clinics. A total of 70 blood samples were aligned to the corresponding

1322 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 11, No. 8, August 2005