Identification and Characterization of Two Thauera Aromatica Strain T1 Genes Induced

Identification and Characterization of Two Thauera aromatica Strain T1 Genes Induced

by p-Cresol

A dissertation presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Doctor of Philosophy

Mohor Chatterjee

August 2012

This dissertation titled

Identification and Characterization of Two Thauera aromatica Strain T1 Genes Induced

by p-Cresol

MOHOR CHATTERJEE

has been approved for

the Program of Molecular and Cellular Biology

and the College of Arts and Sciences by

Peter W. Coschigano

Associate Professor of Biomedical Sciences

Howard Dewald

Interim Dean, College of Arts and Sciences 3

ABSTRACT

CHATTERJEE, MOHOR, Ph.D., August 2012, Molecular and Cellular Biology

Identification and Characterization of Two Thauera aromatica Strain T1 Genes Induced by p-Cresol (109 pp)

Director of Dissertation: Peter W. Coschigano

p-Cresol is a toxic aromatic compound found in the environment and is a constituent of many disinfectants and preservatives. It may act as a tumor promoter and the US Environmental Protection Agency has listed it as a possible human carcinogen.

Thauera aromatica strain T1 is a facultative anaerobic, denitrifying, Gram-negative bacterium that is able to degrade many aromatic compounds including toluene and p- cresol.

A proteomics approach was used to identify proteins from T. aromatica strain T1 that have differential expression when cells are induced by p-cresol in comparison to benzoate, a common downstream metabolic intermediate in the degradation of many aromatic compounds. Sequences of peptides from proteins selectively up-regulated by p- cresol in comparison to benzoate were obtained by MS analysis and compared against databases of known proteins from other microorganisms. The sequenced peptides from one of the isolated proteins induced by p-cresol matched a hypothetical protein from a different T. aromatica strain and another matched a hypothetical protein from Azoarcus sp. strain EbN1. Using PCR with degenerate oligonucleotides, the gene fragments corresponding to these proteins were obtained from the T1 genome. Expression analysis also showed differential up- regulation at the RNA level for both these genes when 4 compared to cells induced by benzoate. Using the genome sequence of T. aromatica strain 3CB2, the full-length genes corresponding to these proteins have been cloned from the T. aromatica strain T1 genome. The genes are named pipA and pipB (for p-cresol induced protein) and were determined to reside in a cluster within the T. aromatica strain

T1 genome. Bioinformatic analyses of the corresponding gene and protein sequences of pipA and pipB show that these proteins are conserved in many bacterial species involved in aromatic compound biodegradation. PipA is predicted to be an outer membrane transport protein and PipB shows significant homology to a chaperone involved in sorting of lipoproteins in the outer membrane of bacteria. We hypothesize that these proteins may be components of bacterial nanopods that are involved in the uptake of a range of aromatic metabolites from the environment by the aromatic compound degrading bacterial species in the soil and the process may be energy-dependent.

Approved: ______

Peter W. Coschigano

Associate Professor of Biomedical Sciences

Dedicated to my family and for their love, support and good wishes

ACKNOWLEDGMENTS

I am thankful to many people for their unending love, support and faith in me during the pursuit of my degree. This journey would not have been possible without them.

First and foremost, I would like to thank my advisor Dr. Peter W. Coschigano for the many ways in which he has helped me to carve my future in this field. He is an amazing human being apart from being an amazing scientist. I express my sincere gratitude to him for letting me work with him and for supporting me in every way even during difficult times. I am honored to be a part of his research team and could not have finished this work without his guidance at each and every step.

I am extremely thankful to Dr. Chester R. Cooper and Julie M. Chandler of

Youngstown State University for their help with proteomics and Dr. Bongkeun Song of the University of North Carolina at Wilmington for kindly providing the sequence of

Thauera aromatica strain 3CB2 that helped my research immensely. My special thanks go out to the entire Murphy lab, especially Dr. Erin Murphy, William Broach and Andy

Kouse. I am thankful to them for allowing me use their machines and reagents during my research and also for providing an enjoyable atmosphere for work. I have shared lot of good times with the Murphy lab, both in the university and away, especially at conferences we attended together. I also thank Dr. Karen Coschigano and her lab for helping me with the Real Time PCR experiment.

Next, I am thankful to all my committee members, Dr. Calvin James, Dr. Xiao

Zhuo Chen and Dr. Stefan Gleissberg for their guidance during this journey. Each of 7 them has provided me with valuable insights in my work and I truly believe the dissertation would have been incomplete without their inputs. I am extremely lucky to have such a committee of people to look after me.

I am also thankful to Amr Elzawily of the Coschigano lab who was my colleague and a dear friend for his help during the initial days of my research. I wish him all the best in the future. The lab was always an enjoyable place to work with him around.

My additional thanks go to Dr. Donald Holzschu, Dr. Joan Cunningham and Dr.

Lorie Lapierre with whom I have done TA for more than four years. I consider myself lucky to have learnt the values of teaching from them. I had looked forward to each and every class with them and I know the students of Ohio University are lucky to have them as their instructors.

I extend my gratitude to my professors in the Molecular and Cellular Biology

Program for their influence in my education and the shaping of my future. I am grateful to Dr. Robert Colvin for being a mentor throughout my stay in this program. I also thank

Molecular and Cellular Biology program and Graduate Student Senate for providing financial support to me during my Ph.D. I must also thank my professor Dr. Anjan K.

Dasgupta of University of Calcutta who inspired me to embark upon the journey of Ph.D.

Special thanks must be extended to my friends both inside and outside the department without whom this journey would have been very difficult. I express my gratitude to my friends Archan, Setu, Andy, Bill, Jian, Yan, Nilesh, Aditya, Aditi and

Debarati for the good times spent in Ohio University. I am also thankful to my present and former roommates Gayatri, Sulalita, Koyel, Anupama, Sreerupa and Somali for being 8 such good friends. They have all made Athens a home outside of home and I cherish every good moment spent with them.

Lastly, this section is incomplete without extending thanks to my family. My parents Mr. Achintya Kumar Chatterjee and Mrs. Mondira Chatterjee have been a source of perennial strength to me throughout my life. Words cannot express my gratitude towards them. They are the reason for whatever I am today. I also express my thanks to my fiancée Dr. Partha Nandi for providing me impetus to complete my research. He has been a source of strength and I look forward to spending my life with him.

I am indebted to each and every people mentioned above and I wish them all best of luck.

TABLE OF CONTENTS

Abstract ...... 3

Dedication ...... 5

Acknowledgement ...... 6

Table of Contents ...... 9

List of Tables ...... 12

List of Figures ...... 13

List of Abbreviations ...... 16

Chapter 1 Introduction ...... 17

1.1 Biodegradation of Aromatic Compounds in the Environment ...... 17

1.2 p-Cresol as an Aromatic Compound ...... 18

1.3 Biochemistry of Cresol Degradation ...... 19

1.3.1 Aerobic Mode of p-Cresol Degradation ...... 20

1.3.2 Anaerobic Mode of p-Cresol Degradation ...... 21

1.4 Benzoate as a Key Intermediate in Anaerobic Degradation ...... 25

1.5 Benzoate Degradation by Anaerobic Bacteria ...... 27

1.6 Previous Work done with Thauera aromatica Strain T1...... 32

1.7 Transporter Genes in Anaerobic Biodegradation ...... 35

1.8 Anaerobic Monocyclic Aromatic Compound Degradation ...... 36

1.8.1 Phenol ...... 36

1.8.2 Xylenes ...... 38

1.8.3 Hydroxybenzoate ...... 39 10

1.8.4 Benzene ...... 39

1.8.5 Ethylbenzene ...... 40

1.8.6 Halogenated Aromatic Compounds ...... 40

1.9 Objective of this Research ...... 41

Chapter 2 Materials and Methods ...... 43

2.1 Chemicals, Reagents and Media ...... 43

2.2 Bacterial Growth ...... 43

2.3 Protein Extraction ...... 44

2.4 Protein Quantification ...... 44

2.5 Two Dimensional Gel-Electrophoresis (2DGE) ...... 45

2.6 Image Analysis...... 46

2.7 Protein Isolation and Preparation for Mass Spectrometry ...... 46

2.8 Mass Spectrometry...... 48

2.9 DNA Manipulations ...... 49

2.10 Primer Design ...... 50

2.11 Cloning of pipA and pipB Genes ...... 50

2.12 RNA Manipulations ...... 51

2.13 Expression Analysis ...... 52

2.14 Real Time PCR ...... 52

2.15 Cloning of Full-Length pipA and pipB Genes ...... 53

2.16 Sequencing of pipA and pipB Genes ...... 55

2.17 In-Silico Analysis...... 55 11

2.17.1 Physiological Details of PipA and PipB Protein Sequences ...... 55

2.17.2 Localization Details of PipA and PipB Protein Sequences ...... 56

Chapter 3 Results ...... 63

3.1 Proteomics...... 63

3.2 Cloning of pipA and pipB Gene Fragments ...... 64

3.3 Expression Analysis ...... 68

3.4 Full-Length Gene Sequence Analysis ...... 69

3.5 In Silico Analysis ...... 76

3.5.1 Protparam Analysis ...... 79

3.5.2 Motif Scan ...... 80

3.5.3 PSORTb Analysis ...... 80

3.5.4 SignalP 4.0 ...... 81

3.5.5 TMPred Analysis ...... 82

3.5.6 Phyre2 ...... 84

Chapter 4 Discussion ...... 87

Chapter 5 Future Perspectives ...... 95

Bibliography ...... 97

LIST OF TABLES

Table 1: The Oligomeric Sequences Designed for the Degenerate PCR of pipA Gene ....57

Table 2: The Oligomeric Sequences Designed for the Degenerate PCR of pipB Gene ....58

Table 3: List of Different Primers used in Cloning and Expression Analysis of pipA and pipB Gene Fragments from the T1 Genome ...... 59

Table 4: List of Flanking Primers Based on T. aromatica Strain 3CB2 Sequence to Clone pipA and pipB Full-Length Genes from the T1 Genome ...... 60

Table 5: Bacterial Constructs Used in the Study ...... 61

Table 6: List of Sequencing Primers Used ...... 62

Table 7 Protparam Analysis of PipA and PipB Proteins ...... 80

LIST OF FIGURES

Figure 1: Role of Bacteria in Biodegradation at Different Groundwater Levels ...... 18

Figure 2: Protocatechuate is a Common Intermediate in the Aerobic Degradation of

Aromatic Compounds ...... 21

Figure 3: Initial Steps in Anaerobic Biodegradation of p-Cresol Under Denitrifying

Conditions ...... 22

Figure 4: Initial reactions of Anaerobic p-Cresol Metabolism via Fumarate Addition .....24

Figure 5: Key Intermediates in Degradation of Aromatic Compounds by Aerobic and

Anaerobic mode ...... 26

Figure 6: Conversion of Diverse Anaerobic Pathways to Benzoate as a Key

Intermediate ...... 27

Figure 7: Benzoate Degradation in Thauera and Rhodopsudomonas sp ...... 30

Figure 8: Toluene Degrading tutE tutFDGH Gene Cluster in Strain T1 ...... 35

Figure 9: Representative 2DGE Images of Proteins Produced by T. aromatica Strain T1

Grown in Benzoate and p-Cresol Supplemented media ...... 64

Figure 10: The 564 Amino Acid Sequence of the Hypothetical T. aromatica (Ta) Protein

Identified by 2DGE as Differentially Expressed in p-Cresol Induced Cells Compared to the Translated Peptide Sequences of the Cloned Fragment from Strain T1 ...... 66

Figure 11: The 454 Amino Acid Sequence of the Hypothetical Azoarcus sp. EbN1 (Az)

Protein Identified by 2DGE as Differentially Expressed in p-Cresol Induced Cells

Compared to the Translated Peptide Sequences of the Cloned Fragment from Strain

T1 ...... 67 14

Figure 12: Expression Analysis of pipA by RT-PCR Shows Differential Up-regulation for p-Cresol Treated Cells in Comparison to Benzoate Treated Cells ...... 68

Figure 13: Real Time PCR Comparison of p-Cresol and Benzoate Treated Bacterial

Cells ...... 69

Figure 14: Sequencing of Full-Length pipA and pipB Clones from T. aromatica Strain T1

Genome with Primers Based on Related T. aromatica Strain 3CB2 Sequence ...... 72

Figure 15: Full pipAB Gene Sequence ...... 73

Figure 16: The Translated Protein Sequence from pipA DNA Sequence Compared to the

564 Amino Acid Sequence of the Conserved T. aromatica (thauera) Protein Identified by

2DGE ...... 75

Figure 17: The Translated Protein Sequence from pipB DNA Sequence Compared to the

454 Amino Acid Sequence of the Conserved Hypothetical Azoarcus sp. EbN1 (Az)

Protein Identified by 2DGE ...... 76

Figure 18: DUF 1329 and DUF 1302 Domains found in PipB and PipA Translated

Protein Sequences from T1 Genome ...... 77

Figure 19: BlastX of PipA Translated Sequence Against the Available Protein Sequences in the Database Shows Presence of a Number of Hypothetical Proteins Similar to PipA in a Range of Bacterial Species ...... 78

Figure 20: BlastX of PipB Translated Sequence against the Available Protein Sequences in the Database also shows Presence of a Number of Hypothetical Proteins Similar to

PipB in a Range of Bacterial Species ...... 79 15

Figure 21: Protein Sequence of PipB Showed Presence of a Signal Peptide at Residue

A25-V26 that Targets PipB Protein Outside the Cytoplasmic Membrane ...... 82

Figure 22: TMPred Analysis of PipB Showing Presence of One Transmembrane Helix that is Marked with a Star ...... 83

Figure 23: TMPred Analysis of PipA Showing Presence of Three Transmembrane

Helices that are Marked with a Star ...... 84

Figure 24: Phyre2 Software Analysis Predicts PipA Protein to be a Family of Outer

Membrane Transport Protein ...... 85

Figure 25: Phyre2 Software Analysis Predicts PipB Protein to belong to a Family of

Outer Membrane Lipoprotein-Sorting Protein...... 86

Figure 26. Lol System in Prokaryotes...... 91

Figure 27. Diagrammatic Representation of the Roles of PipA and PipB Proteins in p-

Cresol uptake ...... 94

LIST OF ABBREVIATIONS

2DGE 2-Dimensional Gel Electrophoresis

BSA Bovine Serum Albumin

BLAST Basic Local Alignment Search Tool

CHAPS 3-[(3-cholamidopropyl) Dimethylammonio]-1-Propanesulfonate

CoA Coenzyme A

DNA Deoxyribonucleic Acid

DTT Dithiothreitol

DUF Domain of Unknown Function

EPA Environmental Protection Agency

LOL Localization of Lipoproteins

LC-MS/MS Liquid Chromatography Tandem Mass Spectrometry m-cresol meta-Cresol

MS Mass Spectrometry o-cresol ortho-Cresol

OMV Outer Membrane Vesicle

PCR Polymerase Chain Reaction p-cresol para-Cresol

RD Reductive Dehalogenases rRNA Ribosomal Ribonucleic Acid

SDS Sodium Dodecyl Sulfate

T. aromatica Thauera aromatica 17

Chapter 1: Introduction

1.1 Biodegradation of aromatic compounds in the environment

About 25%of the earth’s biomass is composed of compounds that are aromatic in nature having a benzene ring as a structural component. Much of these aromatic compounds are synthesized and released into nature by green plants that assemble them to form lignin, a polymer that is stabilized by ether and other linkages (1 , 2). The industrial revolution has led to human activities adding many new aromatic chemicals to the environment. Although the input of these new compounds is less in total amount than that of plant materials, their novel structures pose major challenges to the microorganisms that are the major recyclers of natural products in the environment.

Under such circumstances, bacteria can adapt themselves to the surrounding environment to degrade these toxic compounds (3). This has prompted studies of aromatic compound degradation by microbes (1-4).

Initially most studies in biodegradation were focused towards microbes that can degrade aromatic compounds in an aerobic manner. Studies involving the role of anaerobic bacteria in biodegradation were delayed by the inability to grow these microbes in the lab and perform genetic manipulations (5, 6). Gradually, it became increasingly clear that after the oxygen source is exhausted, it is the anaerobic bacteria that play a crucial role in the breakdown of toxic compounds into non-toxic substances. A perfect example of this is the groundwater where due to low availability of oxygen, mostly anaerobic bacteria take up the biodegradative role (Figure 1). Thus, many of these aromatic materials that are released into the environment by humans or by the 18 degradation of plant material go into anaerobic sediments where the anaerobic bacteria act upon it to convert them into non-toxic materials (6-8).

Figure 1. Role of bacteria in biodegradation at different groundwater levels (1)

1.2 p- Cresol as an aromatic compound

p-Cresol (4 -methylphenol) is chemically defined as methyl-substituted phenol with a hydroxyl group at the para-position. It is a clear to slightly amber semi solid with a phenolic odor and is soluble in both water and alcohol. It is usually obtained from coal tar or petroleum as by-products in the fractional distillation and in coal gasification. It is also 19 formed as a by-product during the combustion of wood and can be released to the atmosphere by automobile exhaust. These are the major source of p-cresol contamination in wastewaters (9). The only evidence of p-cresol being generated biologically is from tyrosine via the decarboxylation of p-hydroxyphenylacetate by Clostridium species (10).

Primary use of p-cresol is for sterilization as a disinfectant, deodorizer and pesticide.

It is also used as an external antiseptic, gastric sedative and deodorant. It is useful as raw materials for various chemical products like fragrances, herbicides, pigments, lubricating oils, adhesives and photographic chemicals. These have led to extensive use of p-cresol in industry, thus increasing the chance for its accumulation in the environment (11).

p-Cresol is known as a toxic compound because studies have shown that it may act as a tumor promoter and the EPA has listed it as a possible human carcinogen. Cases of multifocal transitional cell carcinoma of the skin following chronic occupational exposure to p-cresol are reported (U.S. EPA, 2008). Also, dermal contact with p-cresol can result in irritation and burning of skin and ingestion of p-cresol can result in kidney problems, mouth and throat burns, abdominal pain, vomiting, and effects on the blood and nervous system.

1.3 Biochemistry of cresol degradation

Though all three cresol isomers can be degraded anaerobically by denitrifying, sulfate-reducing or methanogenic bacteria, the degradation pathways are quite different.

Also, though biochemical studies have predicted the possible pathways, the genes involved in o-cresol and m-cresol biodegradation have not yet been identified. 20

In a denitrifying bacterium related to the Thauera sp., o-cresol is carboxylated in the para position to 3-methyl-4-hydroxybenzoate which is then activated to the CoA- thioester that is dehydroxylated to 3-methylbenzoyl-CoA. From that point, benzoyl-CoA reductase has been found to catalyse ring reduction. Also, it is reported that mixed cultures of nitrate-reducing bacteria degraded o-cresol along with toluene (5, 7).

m-Cresol degradation in sulfate reducing and methanogenic bacteria is by carboxylation to 2-methyl-4-hydroxybenzoate. Methanogenic mixed cultures were found to convert m-cresol to 4-hydroxybenzoate and methane. These observations prompted speculations that a demethylation reaction of 2-methyl-4-hydroxybenzoate to 4- hydroxybenzoate may be a possible further step in m-cresol-degradation (5,7). An alternative pathway of m-cresol degradation is methyl oxidation to 3-hydroxybenzoate, which is thioesterified with coenzyme A and dehydroxylated to benzoyl CoA (5, 7).

For p-cresol, however, there has been evidence of both aerobic and anaerobic mode of biodegradation.

1.3.1 Aerobic mode of p-cresol degradation

Aerobic biodegradation of p-cresol by Pseudomonas bacteria occurs by way of the protocatechuate metabolic pathway (Figure 2). p-Cresol-methylhydroxylase (PCMH) is the first enzyme in the protocatechuate pathway and is responsible for the degradation of p-cresol. PCMH catalyzes the oxidation of p-cresol to p-hydroxybenzyl alcohol and then to p-hydroxybenzaldehyde. p-Hydroxybenzaldehyde dehydrogenase further oxidizes the aldehyde to p-hydroxybenzoate (Figure 2) (12)

Figure 2. Protocatechuate is a common intermediate in the aerobic degradation of aromatic compounds. Ring cleavage proceeds from this common intermediate.

1.3.2 Anaerobic mode of p-cresol degradation

Anaerobic degradation of p–cresol has been demonstrated under methanogenic conditions and with pure cultures of nitrate-reducing, iron-reducing, and sulfate-reducing bacteria (11-16). p-Cresol is completely metabolized under denitrifying, sulfidogenic, and methanogenic conditions, with the formation of nitrogen gas, loss of sulfate, or formation of methane and carbon dioxide, respectively (13-15). Results suggest that the initial pathway of p-cresol degradation is the same under denitrifying and methanogenic conditions and proceeds via oxidation of the methyl substituent to p- hydroxybenzaldehyde and p-hydroxybenzoate (13) . It has been well established that denitrifying bacteria can metabolize p-cresol, cognate to its degradation by aerobic bacteria through a sequence of oxidation reactions leading to p-hydroxybenzoate, with water as the oxygen source (12, 14). 22

The denitrifying bacterial isolate PC-07 has been studied for its ability to metabolize p-cresol under nitrate-reducing conditions. The methyl substituent of the substrate is oxidized anaerobically through a series of dehydrogenation and hydration reactions to yield p-hydroxybenzoate (Figure 3). A p-cresol methylhydroxylase mediates the oxidation of p-cresol to p-hydroxybenzaldehyde, which is further oxidized to p- hydroxybenzoate by an NAD+-dependent dehydrogenase (17). The protein appears to be a multifunctional flavocytochrome, which first oxidizes p-cresol to p-hydroxybenzyl alcohol and subsequently to p-hydroxybenzaldehyde (Figure 3) (16)

Figure 3. Initial steps in anaerobic biodegradation of p-cresol under denitrifying conditions.

Other denitrifying bacterial species such as Azoarcus sp. EBN1 have been reported to degrade p-cresol in an identical manner to aerobic metabolism. The pch gene cluster in this species is known to be organized in an operon and members of this gene cluster have sequence similarity to the p-cresol methylhydroxylase enzyme subunits (17). However, 23 since p-cresol can also act as an inducer of genes involved in the degradation of other compounds like toluene, it is also thought that the same gene cluster may have overlapping roles in biodegradation (18).

The anaerobic bacterium Desulfobacterium cetonicum oxidizes p-cresol completely to

CO2 with sulfate as the electron acceptor. During growth, p-hydroxybenzylsuccinate accumulates in the medium. This indicates that the methyl group of p-cresol is activated by addition to fumarate, analogous to anaerobic toluene, m-xylene, and m-cresol degradation (19, 20). p-Hydroxybenzylsuccinate is degraded further to p- hydroxybenzoyl-coenzyme A (CoA), most likely via β-oxidation (20). Subsequently, p- hydroxybenzoyl-CoA is reductively dehydroxylated to benzoyl-CoA (Figure 4). There was no evidence that p-cresol is degraded by p-cresol methylhydroxylase in this strain.

Figure 4. Initial reactions of anaerobic p-cresol metabolism via fumarate addition.

The compounds p-hydroxyphenylitaconyl-CoA and p-hydroxybenzoylsuccinyl-CoA are hypothesized.

In Geobacter metallireducens, a strict anaerobic bacterium, p-cresol degradation occurs by methyl-hydroxylation but there the enzyme activity was found to be associated with the membrane instead of being cytosolic. The genes responsible for this activity also showed interaction with the pcm gene cluster encoding a membranous bacterial cytochrome-bc1 complex and is also shown to regulate p-hydroxybenzylalcohol. It is believed that a noncatalytic subunit of the enzyme that is absent in other bacteria mediates electron transfer to decide a more energetically favorable pathway for this bacterium (11). 25

1.4 Benzoate as a key intermediate in anaerobic biodegradation

The different pathways by which anaerobic bacteria degrades various aromatic compounds is dependent on the stability of the aromatic ring and the energy requirement of the bacterial species (5, 6, 21). Therefore, there is a possibility that the different pathways followed by different bacteria could be highly diversified. However, bacteria often degrade energetically stable compounds such as aromatics by a different mechanism. Different aromatic substrates are usually acted upon by peripheral enzymes that convert them to a central intermediate, followed by the ring cleavage from that central intermediate (6). This is true for both aerobic and anaerobic mode of degradation

(Figures 5 and 6). Many anaerobic bacteria, thus, use their substrates and convert them to benzoate from which the ring-cleavage occurs rapidly to an energetically favored reaction gradient. Under aerobic conditions, some of these central compounds are catechol and protocatechuate, however, for anaerobic biodegradation, most of the evidence received until now shows that benzoyl-CoA is the preferred compound as a central intermediate for biodegradation of most aromatic compounds (6, 7).

Figure 5. Key intermediates in degradation of aromatic compounds by aerobic and anaerobic mode. (6).

Figure 6. Conversion of diverse anaerobic pathways to benzoate as a key intermediate (22).

1.5 Benzoate degradation by anaerobic bacteria

The key mode of degradation of aromatic compounds is the breakdown of substrates like toluene and p-cresol into a few aromatic intermediates, and the most important of them is benzoate (5, 7). Benzoate is further reduced to acetyl-CoA and CO2 and the end of metabolism which feeds into the cell’s energy sources (5). The benzoate degradation pathway is relatively well-studied considering its importance in the entire breakdown process. The two model organisms used for this purpose are a α-subgroup phototrophic proteobacterium Rhodopseudomonas palustris and the denitrifying bacteria Thauera 28 aromatica that belong to the β-subgroup of proteobacteria (22-24). Both use slightly different mechanisms in degradation of benzoate which are now identified as the main anaerobic benzoate degradation pathways (22-24).

Initially in the degradation process, the various aromatic substrates feed into the benzoyl-CoA by a common theme (Figure 6). The aromatic compounds that are destined to enter the benzoyl-CoA degradation pathway either carry a carboxyl group to begin with or they must be carboxylated to form an aromatic acid in one of the initial metabolic steps by a benzoyl-CoA ligase coupled to ATP hydrolysis (5). All of the intermediates of the reductive benzoate degradation pathway are CoA thioesters, and intermediates in the channeling pathways that lead to benzoyl-CoA formation are themselves frequently thioesterified at a carboxyl group with coenzyme A, as the thioester group lowers the redox potential difference of the first electron transfer (5). Following this, the reduction of benzoyl-CoA is catalyzed by the iron-sulfur protein benzoyl-CoA reductase. The enzyme from T. aromatica catalyzes a two-electron reduction and requires 2 ATP which are hydrolyzed to ADP and inorganic phosphate with the formation of the product cyclohex-1,5-diene-1-carboxy-CoA, the electron donor being ferredoxin which contains two 4Fe/4S centers (2 2). In R. palustris, the enzyme reduces the diene intermediate further to cyclohex-1-ene-1-carboxyl-CoA. On the other hand, cyclohex-1, 5-diene-1- carboxy-CoA, the product of the ring reduction reaction in T. aromatica, is hydrated by a specific dienoyl-CoA hydratase to give 6-hydroxycylohex-1-ene-1-carboxy-CoA, followed by NAD-dependent oxidation of the 6-hydroxy group to the 6-oxo group by a specific L-hydroxyacyl-CoA dehydrogenase. 6-Oxocyclohex-1-ene-1-carboxy-CoA is 29 converted to 3-hydroxypimelyl-CoA (2 2). In R. palustris the sequence of reactions that occurs following ring reduction includes a specific enoyl-CoA hydratase that converts cyclohex-1-ene-1-carboxy-CoA to the 2-hydroxy compound, followed by oxidation with an NAD-dependent alcohol dehydrogenase to yield the 2-oxo compound. The L-oxoacyl-

CoA compound is then cleaved by a hydrolyzing enzyme to produce pimelyl-CoA which is subsequently oxidized via 3-hydroxypimelyl-CoA, similar to T. aromatica (22, 24).

β-oxidation of 3-hydroxypimelyl-CoA first yields glutaryl-CoA and one molecule of acetyl-CoA. The intermediate glutaryl-CoA is then oxidized to glutaconyl-CoA and decarboxylated to crotonyl-CoA by the soluble flavoenzyme glutaryl-CoA dehydrogenase. Crotonyl-CoA is oxidized to two molecules of acetyl-CoA. Hence, the final products of benzoyl-CoA metabolism are 3 acetyl-CoA, 1 CO2 and 6 reducing equivalents, regaining the reducing equivalents used in ring reduction. Acetyl-CoA is oxidized to CO2 (24). The products are used by the cell as building blocks for growth

(Figure 7). A good overview of the benzoate metabolism pathway with the respective genes and enzymes involved in the two bacterial species in depicted in Figure 7. 30

Figure 7. Benzoate degradation in Thauera and Rhodopseudomonas sp. (22)

Much genetic study has also been done on these 2 species to further illustrate that these two bacteria use slightly different mechanisms for benzoate degradation. For most of the T. aromatica genes, functionality was assigned based on comparison of their 31 deduced amino acid sequences with the purified proteins involved. In R. palustris, the gene products with the exception of benzoyl-CoA reductase were expressed in E. coli and shown to have the enzyme activity. The benzoyl-CoA reductase genes, badDEFG, were identified based on the phenotypes of two mutants that were unable to grow on benzoate, but grew on proposed benzoate pathway intermediates. It was also deduced that sequences of the BadDEFG proteins have a high degree of sequence identity to the

BcrCBAD subunits of the T. aromatica benzoyl-CoA reductase, the overall amino acid sequence identity being 70%. Once benzoyl-CoA is reduced and the two pathways diverge, the next step in T. aromatica is a hydration and in R. palustris is a second 2- electron reduction (F igure 7). Differences in these ring-cleavage substrates are reflected by differences in genes (22, 25, 26). The R. palustris and T. aromatica ring-cleavage genes are very different in size. The T. aromatica oah gene is 40% longer than the R. palustris badI gene, and the deduced amino acid sequences of BadI and Oah share only

30% identity (24, 26). Other genes involved that encode enoyl-CoA hydratases and alcohol dehydrogenases are specific to either the R. palustris or the T. aromatica pathways. The dch and badK genes each encode enoyl-CoA hydratases, but the two encoded enzymes catalyze different reactions specific to either the T. aromatica for Dch or R. palustris for BadK (27). Consistent with this, these two genes share just 25/33% amino acid identity/similarity and are no more similar to each other than they are to other enoyl-CoA hydratases from mammalian and bacterial sources. Similarly Had from T. aromatica and BadH from R. palustris each catalyzes NAD-dependent dehydrogenation reactions, but again with different substrates. In accordance with these differences, the 32

Had sequence indicates membership in the family of long-chain zinc-containing alcohol dehydrogenases, whereas BadH is a short chain alcohol dehydrogenase. The two proteins show no significant amino acid sequence similarity (27).

Thus it is seen that these two different bacterial species metabolize benzoate in obviously different ways which may be primarily due to their different energy sources.

Benzoate degradation is reported in strain T1 but the proteins involved are not known yet.

It is expected to carry out the same reactions as in Thauera aromatica due to sequence similarity of the genes involved (28).

1.6 Previous work with Thauera aromatica strain T1.

Thauera aromatica strain T1 is a Gram-negative, peritrichously flagellated bacterium with high GC content (~67%). It is classified under the beta subclass of proteobacteria and was isolated by P. J. Evans on the basis of its capacity for using toluene as the sole carbon source under denitrifying conditions. It has been reported that T. aromatica strain

T1 can also grow on p-cresol under denitrifying conditions (28).

Toluene can act as a sole carbon source for a number of bacterial species including

Thauera aromatica strain T1, Thauera aromatica strain K172 and Azoarcus sp. The biochemistry of toluene metabolism in these bacteria is well-characterized (29-32). The initial step of toluene degradation consists of the addition of fumarate to the methyl group of toluene, yielding benzylsuccinate, catalyzed by a glycine-free radical of the enzyme benzylsuccinate synthase (29). A large subunit of 97 kDa and two very small subunits

(8.5 and 6.5 kDa) make up the enzyme benzylsuccinate synthase in a α2β2γ2 complex (29).

The enzyme bound radical abstracts a hydrogen atom from the methyl group of toluene 33 which is then attacked by the incoming fumarate. This process forms a benzylsuccinyl radical, which then abstracts the hydrogen atom from the enzyme to form benzylsuccinate (29, 32). The formation of the active enzyme in the radical form requires activation by another enzyme (b enzylsuccinate synthase activating enzyme), which uses

S-adenosylmethionine and an electron donor as co-substrates (29). A chaperone-like protein may be required for the assembly/disassembly of the enzyme (33).

Benzylsuccinate is converted to benzoyl-CoA by beta-oxidation, which is initiated by

CoA transfer from succinyl-CoA by a specific CoA transferase, forming 2- benzylsuccinyl-CoA. The reaction cycle is complete when succinate is oxidized to fumarate. Thus, the overall pathway consists of a six-electron oxidation of the methyl group of toluene to the carbonyl group of benzoyl-CoA (5). The reduced electron carriers are re-oxidized in the course of the anaerobic respiration. Once benzoyl-CoA is formed, it enters the well-studied benzoyl-CoA degradation pathway to form acetyl-CoA and CO2 that forms the building blocks of the cell (5, 7).

A genetic approach has been taken with T. aromatica strain T1 for studies of toluene metabolism. Mutants were isolated which have deficiencies in toluene degradation (32).

A cosmid library was created and a number of genes involved in toluene metabolism including those that code for the TutB and TutC regulatory proteins (32) and those that code for the TutE, TutF, TutD, TutG, and TutH metabolic proteins (31)were cloned. It has been shown that the glycine at position 828 of the TutD protein is essential for enzyme function (30). It was also demonstrated that the cysteine at position 492 of the

TutD protein is essential for function of the protein. These results were also consistent 34 with the hypothesis that the benzylsuccinate synthase enzyme is composed of the TutF,

TutD, and TutG proteins organized in a α2β2γ2 complex (30-32) . Construction and characterization of chromosomal deletions of the tutD, tutF and tutG genes gave significant insight into the role of these genes in anaerobic toluene degradation.

Individual chromosomal deletions of these genes have shown that each mutant strain was unable to metabolize toluene, and hence it was concluded that the tutF, tutD and tutG genes are each essential for toluene metabolism and may function as an oligomeric complex (30). This complex is suggested to code for benzylsuccinate synthase which catalyzes the formation of benzylsuccinate from toluene and fumarate(30). Further, it has been shown that toluene may slightly induce the tutE tutFDGH gene cluster, while benzylsuccinate (or an immediate metabolite of benzylsuccinate) is required for the full induction of these genes (29). Additionally, site-directed mutagenesis experiments performed on tutE, tutF, tutG, and tutH identified amino acid residues that when changed failed to result in a functional protein. These include cysteines at amino acids 72 and 79 of TutE and 29 of TutG, cysteine alanine at amino acids 9 and 10 of TutF and amino acids 52 to 54 (part of the putative ATP binding domain) of the TutH protein (33). It has been determined that the tutE tutFDGH gene cluster consists of two operons (Figure 8) whose expression is induced when cells are grown on toluene. The major transcriptional start sites are located 177 bp upstream of the tutE translational start and 76 bp upstream of the tutF translational start. The tutE gene product is predicted to function as an activating enzyme of benzylsuccinate synthase, forming a free radical on the glycine residue at position 828 of the tutD gene product. The tutH gene has been identified 35 immediately downstream of tutG and is transcribed from the same start site as tutFDGH

(31) The tutH gene product has a putative ATP binding domain and is known to be similar to a class of chaperone-like ATPases. It is suggested that TutH may play important role in the assembly/disassembly of the benzylsuccinate synthase complex.

Previous work has also demonstrated that tutH is essential for toluene metabolism and strains carrying mutations in the putative ATP binding domain fail to metabolize toluene

(33).

Figure 8. Toluene degrading tutE tutFDGH gene cluster in strain T1. The tutF, tutD and tutG genes code for benzylsuccinate synthase, which catalyzes the formation of benzylsuccinate from toluene and fumarate. The tutE gene product functions as the activating enzyme of benzylsuccinate synthase. The tutH gene product may play a role in complex formation. Transcriptional start sites are identified in the figure.

1.7 Transporter genes in anaerobic biodegradation

One of the important questions of aromatic metabolism is how the substrates are taken up by the bacteria in order to metabolize them. There are two theories in place that describes the process as either passive diffusion or active transport (34). It has been shown that many of the catabolic gene clusters contain different bacterial outer 36 membrane proteins. It is likely that these proteins are required for the uptake of the hydrophobic aromatic substrates into the cell as the bacterial outer membrane is composed of hydrophilic lipopolysaccharides (34). E.coli has a superfamily of proteins known as the FadL proteins that are outer membrane proteins that can help in the uptake of hydrophobic substrates like fatty acids (35-37). Similar proteins also exist in aromatic compound degrading bacteria like the TodX protein of Pseudomonas putida that helps in uptake of toluene (38, 39). Structural analysis has revealed the presence of a hydrophobic pocket inside these proteins through which the substrate can pass from outside of the cell to the periplasmic space (34). PcaK is another protein in Pseudomonas putida that is known to act as a transporter as well as a chemoreceptor for 4-hydroxybenzoate and protocatechuate (40). It is also known that two transport systems of opposite functions exist in bacteria, one that helps uptake of substrates and another which acts like an efflux pump to pump out excess substrate. It is expected that these pathways are complementary to each other (34).

1.8 Anaerobic mode of monocyclic aromatic compound biodegradation

Other monocyclic aromatic compound degradation pathways are summarized below that highlights the diversified nature of anaerobic biodegradation in the environment.

1.8.1 Phenol

Phenol is degradable by many anaerobic bacteria and mainly has been studied with the denitrifying T.aromatica strain that can grow with phenol as substrate. The pathway is initiated by an unusual carboxylation reaction of the aromatic ring (7). Phenol carboxylation occurs in para position to the hydroxyl group to yield 4-hydroxybenzoate 37 and proceeds in a two-step process (5). The first step results in formation of the intermediate phenylphosphate from phenol by the enzyme phenylphosphate synthase with ATP as the phosphate donor (48). This enzyme consists of three proteins with adjacent genes on the phenol operon. Protein 1 (ORF1, 70 kDa) contains a conserved histidine residue that interacts with the substrate phenol and transfers the phosphoryl group from the phosphorylated protein 1 to the substrate (48). Phosphorylation of phenol requires protein 1, ATP, and another protein 2 (ORF2, 40kDa) that catalyzes the phosphorylation of protein 1. Protein 2 transfers a pyrophosphate group from ATP to the conserved histidine of protein 1 and release the γ-phosphate. The overall reaction is stimulated several folds by another protein 3 (ORF3, 24 kDa) which may have a regulatory function due to similarity to AMP binding proteins (7, 41, 42).

The second step in phenol carboxylation is the carboxylation of phenyl phosphate catalysed by phenylphosphate-carboxylase. This enzyme activity is dependent on the presence of K+ and Mn2+ that catalyses the exchange of the carboxyl group of 4- hydroxybenzoate with free CO2 (5). An enzyme bound phenolate anion would be (43) produced by dephosphorylation of phenylphosphate. This would induce a suitable nucleophilic site at the para position for attacking a CO2 molecule. Phenylphosphate- carboxylase consists of four proteins whose genes are located adjacent to each other on the operon (5). Three of the subunits (αβγ, 54, 53, and 10 kDa) can catalyze the exchange reaction but the net phenylphosphate carboxylation is restored when the18-kDa (δ) subunit is added. This 18-kDa phosphatase subunit alone also catalyzes a very slow hydrolysis of phenylphosphate. The 54 and 53-kDa subunits show similarity to UbiD, 3- 38 octaprenyl-4-hydroxybenzoate-carboxy-lyase, which catalyzes the decarboxylation of a

4-hydroxybenzoate derivative in ubiquinone (ubi) biosynthesis. The 18-kDa subunit belongs to a hydratase/phosphatase protein family. The 10 kDa subunit is unique. The function of the remaining seven genes of the phenol gene cluster, two genes related to ubiD and ubiX , is still unknown (43). 4-hydroxybenzoate is then converted to its CoA thioester by a specific CoA ligase. This is essential for phenol metabolism as the following enzyme in the pathway, benzoyl-CoA reductase, does not accept the para- hydroxylated compound as a substrate but can reduce the ortho and meta-isomers of monohydroxylated benzoyl-CoA analogues. This enzyme from T. aromatica has a molecular mass of 270 kDa and contains Fe-S cluster, FAD and a molybdopterin- cytosine dinucleotide cofactor. The structure of 4-hydroxybenzoyl-CoA reductase confirmed that the enzyme belongs to the xanthine oxidase family of molybdenum enzymes. Following the conversion into the CoA thioester, benzoyl-CoA reductase takes over and degrades it by the well-known benzoate degradation pathway, as demonstrated in Thauera aromatica (7, 43, 44).

1.8.2 Xylenes

All three xylene isomers are degraded via the fumarate addition pathway similar to the toluene degradation pathway (5). m –Xylene is the most readily degraded isomer in mixed cultures. The isomers show variability in degrading capability, specifying site- specific degradation pattern. Homologs corresponding to toluene-fumarate addition metabolites have been detected in cultures incubated with xylenes (7). 4- methylbenzylsuccinate and 4-methylphenylitaconic acid were extracted from an 39 enrichment culture incubated with p –xylene and the expected 2- methylbenzylsuccinate homolog was detected in cultures co-metabolizing o –xylene (5, 7).

1.8.3 Hydroxybenzoate

Hydroxylated benzoates occur as natural components in plants (salicylic acid or gallic acid) and are also produced as intermediates in the degradation of other aromatics. All three isomers of monohydroxylated benzoates are degraded by conversion to benzoyl-

CoA (24). The carboxyl group is first activated to the coenzyme A thioester and then dehydroxylated. This pathway was first proven for 4-hydroxybenzoate which is an intermediate in the anaerobic degradation of phenol or p-cresol by the denitrifying bacterium T. aromatica (24, 45, 46). Preliminary data for 2- and 3-hydroxybenzoate as substrates for denitrifying, aromatic compound degrading bacteria shows that shows the presence of specific, substrate-inducible CoA ligases to feed into the benzoyl-CoA pathway (5).

1.8.4 Benzene

Benzene is regarded as a relatively inert compound to be degraded, but recently pure cultures of Dechloromonas sp. were isolated for their ability to mineralize benzene along with nitrate reduction (42, 47). Three plausible mechanisms are presented as benzene degrading pathways:

A – hydroxylation, producing phenol with subsequent carboxylation to the postulated intermediate para –hydroxybenzoate.

B – methylation, producing toluene followed by fumarate addition to produce benzylsuccinate. 40

C – carboxylation, producing benzoate, but this pathway may represent the sum of several enzymatic steps carried out by a consortium.

The source of the hydroxyl group of the phenol intermediate may be H2O or a hydroxyl- free radical as used by D. aromatica. The methyl group donor in pathway B is also unknown but it may be SAM (53, 54). These three pathways converge to benzoyl-

CoA and are finally oxidized to acetyl-CoA and carbon dioxide (42, 47-49).

1.8.5 Ethylbenzene

Ethylbenzene is reduced mostly by denitrifiers, and two distinct pathways are proposed for its mechanism. One pathway is the fumarate addition reaction like toluene and xylene that produces benzylsuccinate, found in sulfate-reducers (54). The other pathway is the hydroxylation of carbon to form 1-phenylethanol with water donating the oxygen atom of the hydroxyl group. Further dehydrogenation produces acetophenone and finally benzoyl-CoA. The initial enzyme in this pathway is ethylbenzene dehydrogenase

(48, 50) .

1.8.6 Halogenated aromatic compounds

A critical step in the degradation of organohalides is the cleavage of the halogen- carbon bond, and the two main strategies are that the halogen substituent is removed as an initial step in degradation via reductive or hydrolytic mechanisms or dehalogenation occurs after cleavage of the aromatic ring from an aliphatic intermediate. Reductive dehalogenation is generally the initial step in metabolism under methanogenic conditions, which requires a source of reducing equivalents, with the halogenated compound serving as an electron acceptor (6). 41

Reductive dehalogenases (RD’s) are the key enzymes in halorespiring microorganisms (57). Biochemical analysis has revealed that most RD’s are monomeric, corrinoid (a compound with four pyrrole rings) dependent enzymes, and are vitamin B12- dependent (57). All of them until recently isolated from anaerobic microorganisms contain two iron-sulfur (Fe-S) clusters as cofactors in addition to the corrinoid (57).

Molecular analysis of the operons has indicated that the encoded enzymes form a novel class of corrinoid containing reductases which is further confirmed by the characterization of an increasing number of haloaryl and haloalkyl reductive dehalogenases-encoding genes from halorespiring bacteria (57). N-terminal amino acid sequences were obtained from the purified polypeptides and these sequences were used for reverse genetics approaches to clone and characterize the encoding genes. In all cases, the gene encoding the RD-catalytic subunit, designated rdhA for RD is closely linked to a small open reading frame designated as rdhB that codes for a hydrophobic membrane protein (58). rdhB is located upstream of rdhA in all haloaryl-RD-encoding gene clusters, whereas it is located downstream in the case of all clusters coding for haloalkyl-RDs. The function of the rdhB gene products has been predicted to be that of a membrane anchor for the catalytic subunit (51, 52).

1.9 Objective of this research

Anaerobic biodegradation of toxic aromatic compounds by microbes is extremely important for a healthy biosphere. p-Cresol is a toxic aromatic compound and it is known that Thauera aromatica strain T1 can degrade p-cresol. Thus, the aim of this work is to identify genes that are selectively up-regulated in the presence of p-cresol in comparison 42 to benzoate which is the central intermediate of many aromatic compound degradation pathways including p-cresol. The corresponding proteins identified could provide new insight in the physiology of strain T1 and could be significant for bioremediation purposes. 43

Chapter 2: Materials and Methods

2.1 Chemicals, Reagents, and Media

Unless otherwise noted, all chemicals, reagents, and media were obtained from

Amresco, Inc. (Solon, OH), Bio-Rad Inc. (Hercules, CA), Fisher Scientific (Pittsburgh,

PA), or Sigma Chemical Co. (St. Louis, MO). All solutions and media were prepared in distilled-deionized water (ddH2O).

2.2 Bacterial growth

Wild type T. aromatica strain T1 cells were grown for 3 days at 300C, in tubes containing mineral media (28, 29) supplemented with 1mM pyruvic acid under anaerobic conditions. The tubes were placed inside of an anaerobic jar, (Model no PT798, W.R.

Brown company, IL) with a palladium catalyst and the jar was filled with hydrogen from a hydrogen tank (Pallini Industries Inc., Athens, OH). Palladium catalyzed the reaction in which hydrogen reacted with oxygen to generate anaerobic conditions. BBL™ Gaspak ™ indicator (Becton Dickson & Company, MD) was used to confirm the anaerobic conditions in the jar.

Mineral salts medium (50 ml,no vitamins or yeast extract) (29, 30) with pyruvate

(1mM) as the carbon source and KNO3 (10 mM) as nitrate source was used to culture the cells. 0.5 mM benzoate or p-cresol was also included according to experimental conditions. Serum bottles were tightly stoppered with Teflon coated butyl rubber stoppers and aluminum crimp seals. Anaerobic conditions were generated by evacuation and subsequent filling of the bottles with argon from an argon tank (Pallini Industries Inc.,

Athens, OH) three times. 0.5 ml of the cells from the anaerobic culture tubes were used to 44 inoculate the bottles. After growing for 3 days, the cells were re -fed with KNO3, pyruvate and benzoate or p-cresol. On the following day, the cultures were induced for 2 hours with 0.5 mM benzoate or p-cresol and then harvested for DNA, RNA or protein extractions.

2.3 Protein extraction

The proteomics part of the experiments were done in Dr. Chester Cooper’s lab at

Youngstown State University. Frozen cell pellets derived from the particular T. aromatica cultures were thawed on ice prior to adding 400 µl Modified Sample Buffer

(MSB; 2M thiourea, 7M urea, 4% w/v CHAPS, 1% w/v DTT) per 100 mg pellet in a 1.5 ml microfuge tube. The cells were then broken using a Microson Ultrasonic Cell

Disruptor (Misonix, Inc., Farmingdale, NY) operating at 40% power for a total of 2.5 min divided into 30s increments. Sample tubes were maintained in an ice bath for at least 30 sec between disruption cycles. The resulting slurry was centrifuged at 21,000 x g for 30 min at 4C. The protein-containing supernatant was transferred to 1.5 ml screw-cap microfuge tube.

2.4 Protein quantification

A modified Bradford Assay was used to determine the concentration of protein in each sample (53). Each reaction tube contained 80 µl water, 10-20 µl 0.1 M HCl, 10 µl

2DE buffer (8.4 M urea, 2.4 M thiourea, 5% CHAPS, 25 mM spermine base, 50 mM

DTT), and 4.0 ml of Bradford dye (0.01% Coomassie Brilliant Blue G-250, 8.5% [v/v] phosphoric acid). A standard curve was established using serial dilutions of bovine serum albumin. Sample concentrations were determined using 1-5 µl of protein extract 45 added to a reaction tube. The absorbencies of all reaction tubes were recorded at 595 nm using a Spectronic GENESYS 20 spectrophotometer (Thermo Fisher Scientific,

Waltham, MA). Sample protein concentrations were calculated from the standard curve created with Microsoft Excel (version 11.3; Microsoft Corp., Seattle, WA).

2.5 Two-dimensional gel electrophoresis (2DGE)

The following procedure was adapted from Chandler et al. (2008) (54).

Electrophoresis in the first dimension employed immobilized pH gradient (IPG) strips

(17cm; pI 5-8; Bio-Rad) that were passively rehydrated with rehydration buffer (8 M urea, 1% CHAPS, 15 mM DTT, 0.2% [v/v] BioLytes, 0.001% bromophenol blue) and

250 μg protein sample equaling a volume of 300 μl. Subsequently, IPG strips were loaded onto a Protean IEF Cell with electrode wicks (both Bio-Rad) for isoelectric focusing at 20C for 60,000 V-hr. The strips were then sequentially washed with equilibration buffers I (6 M urea, 2% sodium dodecyl sulfate [SDS], 0.375 M Tris-HCl pH 8.8, 20% [v/v] glycerol, 130 mM DTT) and II (6 M urea, 2% SDS, 0.375 M Tris-HCl pH 8.8, 20% [v/v] glycerol, 135 mM iodoacetamide) for 10 min each using gentle agitation. For second dimension electrophoresis, the equilibrated IPG strips were rinsed with Tris-Glycine-SDS (TGS) buffer (25 mM Tris base, 192 mM glycine, 0.1% SDS) prior to being loaded onto 12% polyacrylamide gels (20 cm x 20 cm) prepared in electrophoresis buffer (0.375 M Tris [pH 8.8], 0.1% SDS). Gels were solidified by the addition of ammonium persulfate and tetramethylethylenediamine to a final concentration of 0.1% and 0.04% (v/v), respectively. The strips were sealed in place using an agarose overlay (0.5% low melt agarose in TGS buffer with 0.001% bromophenol blue). The 46 gels were loaded into a Protean Plus Dodeca Cell (both Bio-Rad) and a constant 200V was applied. All samples were subjected to electrophoresis until the dye front migrated the entire length of the gel.

2.6 Image analysis

Following electrophoresis in the second dimension, the gels were placed in a fixing solution (40% methanol, 10% acetic acid; v/v) for one hour. This solution was replaced with SYPRO Ruby protein gel stain (Bio-Rad) for 4 - 24 hrs under gentle shaking conditions. Finally, the SYPRO Ruby solution was removed and the gels were rinsed in distilled-deionized water with shaking for 15 min prior to visualization under ultraviolet illumination at 365 nm using a Molecular Imager ChemiDoc XRS system (Bio-Rad).

Digital images were captured using the system’s CCD camera. For storage, the stained gels were placed in 5% (v/v) acetic acid. Digital images of 2DGE gels were generated from these gels. The images were used in conjunction with PDQuest 2-D Analysis

Software version 7.3.1(Bio-Rad) to create one matchset per experimental condition. The master of each matchset resulting from different experimental conditions was then subjected to further analysis using PDQuest.

2.7 Protein isolation and preparation for mass spectrometry

Based upon image analysis results, proteins of interest were isolated for sequencing by mass spectrometry (MS) as described below. Specifically, cell extracts were subjected to 2DGE as described above except IPG strips were loaded with ≥ 400 µg of protein prior to first-dimension separation. After resolving proteins in the second dimension, gels were placed in 500 ml fixing solution (50% ethanol, 10% acetic acid; v/v) for one hour at 47 room temperature. The fixing solution was then replaced with 500 ml of washing solution (50% methanol, 10% acetic acid; v/v) and the gel was incubated overnight at room temperature. The fixed gel was subsequently stained in fresh SYPRO Ruby stain for at least three hours at room temperature, then incubated in water for 15 min with gentle agitation. Finally, the gel was transferred to storage solution (5% [v/v] acetic acid) for one hour or more before visualizing the protein profiles using the ChemiDoc system.

Protein spots of interest were excised directly by hand from illuminated SYPRO

Ruby-stained gels using a sterile Pasteur pipette or a 2500 µl pipette tip. The gel piece was then expelled into a sterile microfuge tube and covered with 5% (v/v) acetic acid.

The samples were then submitted to the Ohio State University Mass Spectrometry and

Proteomics Facility (Columbus, OH; http://www.ccic.ohio-state.edu/MS/proteomics.htm) for sequencing by MS.

The acrylamide-embedded protein samples submitted for MS sequencing were processed by the following procedure. First, samples were digested with sequencing grade trypsin (Promega, Madison, WI) or sequencing grade chymotrypsin (Roche,

Indianapolis, IN) using the Montage In-Gel Digestion Kit (Millipore, Bedford, MA) following the recommended protocols. Briefly, samples were trimmed as close as possible to minimize background polyacrylamide material, then washed for one hour in a methanol/acetic acid solution (50% methanol: 5% acetic acid; v/v). The wash step was repeated once before gel pieces were dehydrated in acetonitrile. Subsequently, the protein/acrylamide samples were rehydrated with in a DTT solution (5 mg/ml in 100 mM ammonium bicarbonate) for 30 minute prior to the addition of iodoacetamide (15 mg/ml 48 in 100 mM ammonium bicarbonate). The samples were incubated in the dark for 30 min before sequential 5 min washes in acetonitrile and 100 mM ammonium bicarbonate.

Again, the samples were vacuum dried, then rehydrated in 50 μl of 50 mM ammonium bicarbonate containing either sequencing grade modified trypsin or chymotrypsin at 20

μg/ml. After 10 min of incubation, an additional 20 μl of 50 mM ammonium bicarbonate was added to the samples that were then incubated overnight at room temperature.

Finally, the peptides were extracted several times from the polyacrylamide using an acetonitrile/formic acid solution (50% acetonitrile: 5% formic acid; v/v). The extracts were pooled, and then concentrated under vacuum to a final volume of approximately 25

µl.

2.8 Mass spectrometry

Capillary-liquid chromatography-nanospray tandem mass spectrometry (Nano-

LC/MS/MS) was performed on a Thermo Finnigan LTQ mass spectrometer equipped with a nanospray source operated in positive ion mode. The LC system was a

UltiMate™ Plus system (Dionex, Sunnyvale, CA) with a Famos autosampler and

Switchos column switcher. Solvent A was water containing 50mM acetic acid and solvent B was acetonitrile. Five microliters of each sample was first injected on to the trapping column, then washed with 50 mM acetic acid. The injector port was switched to inject and the peptides were eluted off of the trap onto the column. A 5 cm 75 μm ID

ProteoPep II C18 column (New Objective, Woburn, MA) packed directly in the nanospray tip was used for chromatographic separations. Peptides were eluted directly off the column into the LTQ system using a gradient of 2-80% solvent B over 50 49 minutes, with a flow rate of 300 nl/min. A total run time was 60 minutes. The scan sequence of the mass spectrometer was programmed for a full scan, a zoom scan to determine the charge of the peptide, and a MS/MS scan of the most abundant peak in the spectrum. Dynamic exclusion was used to exclude multiple MS/MS of the same peptide.

Sequence information from the MS/MS data was processed using Mascot Distiller to form a peaklist (.mgf file) and by using MASCOT MS/MS search engine and Turbo

SEQUEST algorithm in BioWorks 3.1 Software. Data processing was performed following the recommended guideline (55). Assigned peaks have a minimum of 10 counts (S/N of 3). The mass accuracy of the precursor ions were set to 1.5 Da to accommodate accidental selection of the C13 ion and the fragment mass accuracy was set to 0.5 Da. Considered modifications (variable) were methionine oxidation and carbamidomethyl cysteine.

2.9 DNA manipulations

Genomic DNA isolation was generally carried out by using the MO BIO Ultraclean

Microbial DNA Isolation kit (Carlsbad, CA). The E.coli strain TOP10 (Invitrogen, Inc.,

Carlsbad, CA) was used to propagate DNA and for sub cloning. E.coli was grown in

Luria Bertani media (56) broth and plates. Plasmid DNA isolations were carried out using the Qiagen miniprep, midiprep or maxiprep kits (Qiagen, Santa Clarita, CA). Antibiotics ampicillin and kanamycin were supplied at 100 µg/ml and 50 µg/ml concentrations respectively when required. All enzymes were obtained from New England Biolabs

(Beverly, MA) unless otherwise mentioned. A list of the different constructs used is presented in Table 5. 50

2.10 Primer design

Degenerate oligomer sequences were designed manually on the basis of least degeneracy in the codons of the matched portion of protein sequences in MASCOT. The degenerate primers (Integrated DNA Technologies, Coralville, IA) were chosen in such a way that the 3’ ends of the primers were amino acids with least degeneracy in the protein sequences (Table 1 & 2). The Primer 3 program (57) was used to design all other primers.

2.11 Cloning of pipA and pipB genes

Degenerate oligonucleotide primers were designed based on the PipA and PipB protein sequences, keeping in mind that T. aromatica strain T1 has a high G+C content

(Young, 1991). PCR was performed in a PTC-100 Programmable Thermal Controller

PCR machine (MJ Research Inc., St. Bruno, Quebec, Canada) using Taq polymerase at different temperatures in order to obtain a single band in the agarose gel. The single band

PCR products thus generated were treated with Pfu polymerase enzyme (Stratagene, La

Jolla, CA) at 37°C for 15 min to remove the ‘A’ overhang and cloned into the TOPO vector ( TOPO Blunt Cloning system, Invitrogen, Inc., Carlsbad, CA) following the manufacturer’s protocol. The plasmids were then transformed into the TOP10 cells

(Invitrogen, Inc., Carlsbad, CA). The cells were plated on LB-Kan plates and grown overnight at 370C (Lab-line Instruments Inc., Melrose Park, IL). Single colonies that appeared were transferred into LB-Kan broth and grown overnight at 370C at 225 rpm in a C25 incubator shaker (New Brunswick Scientific, Edison, NJ). Plasmid DNA was extracted from the cultures using Qiagen Miniprep Kit (Qiagen, Santa Clarita, CA). The plasmid DNA was digested with EcoR1 enzyme (New England Biolabs, Beverly, MA) 51 for 3 hours by using 7.5 µl of plasmid, 1 µl BSA, 1 µ l EcoR1buffer and 0.5 µl enzyme and run in an 1% agarose gel at 100V with 100 bp ladder (New England Biolabs,

Beverly, MA) as size standard to identify the clone with the correct insert. 50µl of the culture with the correct clone was incubated in 50ml of LB-Kan broth overnight at 370C at 225 rpm in a C25 incubator shaker (New Brunswick Scientific, Edison, NJ) and plasmid DNA was extracted using Qiagen Midiprep Kit (Qiagen, Santa Clarita, CA).

DNA concentration was measured by using the Nanodrop ND-1000 Spectrophotometer

(Thermo Scientific, Pittsburgh, PA). The plasmid DNA from the midiprep was sequenced in a 3130xl Genetic Analyzer (Agilent, Santa Clara, CA) by submitting the samples to the

Ohio University Genomics Facility.

2.12 RNA manipulations

Wild type T. aromatica strain T1 cells were grown under anaerobic conditions as reported above. After 3 days, they were re-fed with pyruvate, nitrate and benzoate/p- cresol. The next day, they were further induced with the substrates 0.5 mM benzoate or

0.5 mM p-cresol and grown for 2 hours before harvesting the cells. 50 ml of the cells were centrifuged at 16000g, 30 min, 40C with JA 25-50 rotor (Serial # 01U-2563,

Beckman Coulter TM, Palo Alto, CA) in a high speed centrifuge (Sys. ID # 436504,

Beckman Coulter TM, Palo, Alto, CA). The supernatant was discarded and the entire pellet was resuspended in 1ml of 100mM phosphate buffer (pH 7) in an eppendorf tube. The 1 ml culture was further centrifuged at 13000g at 40C for 10 min in a tabletop Marathon microA ultracentrifuge (Thermo Scientific, Pittsburgh, PA). The supernatant was discarded and the pellet was resuspended in 100µl of 400µg/ml lysozyme (Sigma 52

Chemical, St. Louis, MO) in Tris-EDTA buffer (pH 8) and incubated at room temperature for 3-5 minutes. RNA extraction was subsequently carried out according to the Qiagen RNeasy mini kit (Santa Clarita, CA) instructions. Extracted RNA was quantified by using the Nanodrop ND-1000 Spectrophotometer (Thermo Scientific,

Pittsburgh, PA).

2.13 Expression analysis

Reverse Transcriptase-PCR was performed on the total RNA extracted from T. aromatica strain T1 grown on benzoate or p-cresol with the help of internal primers designed based on the sequence obtained from the respective clones of pipA and pipB

(Table 3). DNase treatment was performed on the extracted total RNA to remove DNA that may interfere with the expression analysis results using the on-column RNase free

DNase set (Qiagen, Santa Clarita, CA) followed by DNase treatment by the Dna-free TM kit (Ambion, Austin, TX). PCR was performed with pipA and pipB internal primers and the RNA extracted from benzoate and p-cresol induced cells as templates to make sure there was no trace of contaminating DNA in the RNA sample. Analysis of mRNA levels by Reverse Transcriptase-PCR was done by the One-step RT-PCR kit (Qiagen, Santa

Clarita, CA). Equal amount of RNA was used in the process. Annealing temperature was set to 520C for pipA and 54.50C for pipB primers.

2.14 Real time PCR

Quantitative Real Time PCR was performed on total RNA extracted from cells induced by p-cresol vs. benzoate to determine the level of up-regulation of pipA at the transcriptional level. iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) was used to 53 generate equal amount of cDNA from the corresponding RNA sample. Essentially, 1 µg of RNA was used in a 20µl reaction mix to generate corresponding cDNA following the manufacturer protocol. The prepared cDNA was stored at -20oC.

Real Time PCR was performed using the iQ™SYBR® Green Supermix kit (Bio-Rad,

Hercules, CA), using 1 µl of cDNA and 2 µM of pipA gene-specific primers (Table 3)

(Integrated DNA Technologies, Coralville, IA) in a MyiQ™ Single Color Real-Time

PCR Detection System (Bio-Rad, Hercules, CA) following manufacturer’s protocol.

16SrDNA gene was used as the housekeeping gene in Real Time PCR (Table 3). This experiment was done once.

2.15 Cloning of full-length pipA and pipB genes

Primers for cloning the full-length genes pipA and pipB were determined from the available genome sequence of the related strain Thauera aromatica strain 3CB2 (58) which was made available by Dr. Bongkeun Song of University of North Carolina at

Wilmington (Table 4). These flanking primers were designed with the help of Primer3 software version 0.4.0 (57). PCR with Phusion enzyme (Thermo Scientific, Pittsburgh,

PA) were done on the pipA and pipB genes following the manufacturer’s protocol for GC rich conditions. The annealing temperature was set to 530C for the individual pipA and pipB full-length gene fragments and extension was set at 720C for 1 min. The right-sized band in PCR (2.3 kb for pipA and 1.9 kb for pipB) was separated in a 0.7% agarose gel with 1X Tris-Boric Acid-EDTA (TBE) buffer and 0.2% Ethidium Bromide and extracted from the agarose gel by the Qiaquick Gel Extraction Kit (Qiagen, Santa Clarita, CA). The gene fragment was cloned in a TOPO Blunt vector (Invitrogen, Inc., Carlsbad, CA) 54 following the manufacturer’s guidelines and the plasmid was transformed into the TOP10 cells (Invitrogen, Inc., Carlsbad, CA). The cells were grown on LB-Kan plates overnight in a 370C incubator (Lab-line Instruments Inc., Melrose Park, IL). Single colonies that appeared were transferred into LB-Kan broth and grown overnight at 370C at 225 rpm in a C25 incubator shaker (New Brunswick Scientific, Edison, NJ) and the plasmid DNA was extracted from the colonies using the Qiagen Miniprep Kit (Qiagen, Santa Clarita,

CA). Phusion PCR was performed on the plasmids to check for the clone with the correct insert. The correct clone was also determined by digesting the candidate plasmid DNA with EcoR1 enzyme (New England Biolabs, Beverly, MA) for 3 hours (7.5 µl of plasmid,

1 µl BSA, 1 µl buffer and 0.5 µl enzyme) and separating in a 1% agarose gel at 100V with 100 bp ladder (New England Biolabs, Beverly, MA) as size standard. Once the expected band was observed, 250µl of the culture with the correct insert was incubated in

250ml of LB-Kan broth overnight at 370C at 225 rpm and plasmid DNA was extracted using Qiagen Maxiprep Kit (Qiagen, Santa Clarita, CA). The DNA concentration was measured by using the Nanodrop ND-1000 Spectrophotometer (Thermo Scientific,

Pittsburgh, PA). The plasmid DNA from the maxiprep was sequenced with a 3130xl

Genetic Analyzer (Agilent, Santa Clara, CA) at the Ohio University Genomics Facility.

Apart from separately cloning the pipA and pipB genes in the TOPO vector, the DNA sequence of T. aromatica strain 3CB2 revealed that the genes similar to pipA and pipB were present in a cluster within the genome of 3CB2. With that information, a master clone of 3.6 kb DNA fragment containing both pipA and pipB was cloned in the TOPO vector by using pipA right primer and pipB left primers (Table 4). Annealing temperature 55 was set to 55oC and extension was 720C for 1 min for this PCR reaction with the Phusion enzyme (Thermo Scientific, Pittsburgh, PA). The pipAB PCR product (3.6 kb) was manipulated in the same way as the individual clones explained above to obtain the master clone.

2.16 Sequencing of pipA and pipB genes

The pipAB fragment was completely sequenced by designing multiple primers from overlapping sequences (Table 5) under conditions suitable for GC rich sequencing with a

3130xl Genetic Analyzer (Agilent, Santa Clara, CA) at the Ohio University Genomics facility. Each fragment was sequenced at least three times total, at least once in either direction. This primer walking method was used to sequence the full 3.6 kb clone of pipA and pipB genes. Also, where necessary, additional reactions were performed to address discrepancies. The sequenced genes were translated using Vector NTI software

(Invitrogen, Inc., Carlsbad, CA) to compare with the protein sequences obtained from MS analysis.

2.17 In silico analysis

The pipA and pipB DNA sequences and their respective translated protein sequences were subjected to various bioinformatic analyses to gain more insight into the structural and functional role of these proteins in the metabolism of p-cresol.

2.17.1 Physiological details of PipA and PipB protein sequences

ProtParam tool (59-61) was used to provide physiological details about the actual proteins from the T1 genome. BLAST (62) analysis was performed on the translated protein sequences obtained from PipA and PipB by the Vector NTI (Invitrogen, Inc., 56

Carlsbad, CA) software. The protein sequences were also run against the Motif Scan program (59, 63) (http://hits.isb-sib.ch/cgi-bin/PFSCAN) that showed the occurrence of known motifs in the respective proteins.

2.17.2 Localization details of PipA and PipB protein sequences

Protein localization software was used to determine the location of these proteins.

PSORTb version 3.0.2 (64) computer program was used to predict the protein localization sites in bacterial cells. Parameters were modified to restrict the search to

Gram-negative bacteria and output format was kept to normal.

TMpred program (Prediction of Transmembrane regions and Orientation) (60) was used to determine the number of transmembrane helices and the orientation of these proteins in the bacterial outer membrane.

Phyre2 (65) is a protein Homology Analogy software that predicts protein structure and function based on homologous proteins in the database. PipA and PipB protein sequences were submitted to the server to look for putative protein structure.

Finally, SignalP 4.0 server computer program (66) was used to determine the presence and location of any signal peptide cleavage sites in the amino acid sequences of

PipA and PipB. Organism group was restricted to Gram-negative bacteria under standard output format with graphics.

Table 1: The oligomeric sequences designed for the degenerate PCR of pipA gene. Hypothetical protein (Thauera aromatica) [Y=C/T, R=A/G, N=A/G/C/T] Forward primer: A Y Y Q Y E W GCA UAC UAC CAA UAC GAA UGG GCC UAU UAU CAG UAU GAG GCG GCU

5` GCN TAY TAY CAR TAY GAR TGG 3`

Reverse primer: W E G A S F V UGG GAA GGA GCA AGC UUC GUA GAG GGC GCC AGU UUU GUC GGG GCG UCA GUG GGU GCU UCC GUU UCG UCU

5` TGG GAR GGN GCN WSN TTY GTN 3`

Complementary: 3` ACC CTY CCN CGN WSN AAR CAN 5`

Final primer: 5` AC RAA NSW NGC NCC YTC CCA 3`

(N at 5` end omitted as it gives no specificity).

Table 2: The oligomeric sequences designed for the degenerate PCR of pipB gene. Hypothetical protein (Azoarcus sp. EBN1) [Y=C/T, R=A/G, N=A/G/C/T] Forward primer: N M A Q H A D AAU AUG GCA CAA CAU GCA GAC AAC GCC CAG CAC GCC GAU GCG GCG GCU GCU

5` AAY ATG GCN CAR CAY GCN GAY 3`

Reverse primer: N P A K M R W AAU CCU GCU AAA AUG CGU UGG AAC CCC GCC AAG CGC CCA GCA CGA CCG GCG CGG AGA AGG

5’AAY CCN GCN AAR ATG CGN TGG 3`

Complementary: 3` TTR GGN CGN TTY TAC GCN ACC 5`

Final primer: 5` CCA NCG CAT YTT NGC NGG RTT 3`

Table 3: List of different primers used in cloning and expression analysis of pipA and pipB gene fragments from the T1 genome Name of Sequence Use primer PC 16F 5’AGGCTCAGATGCATCGTCTT 3’ Forward primer RT- PCR and qPCR for pipA PC 16R 5’ AAGCTGCCGCAGTTCTACAT 3’ Reverse primer RT- PCR and qPCR for pipA PipB1F 5’ GCTGAAGAAATACCCGGACA 3’ Forward primer RT- PCR for pipB PipB1R 5’ TTCTTGAAGCCGAACTCGAT 3’ Reverse primer RT- PCR for pipB 16F 5’AGCCATGCCGCGTGAGTGAAGAAG 3’ Internal 16s rDNA forward primer 16R 5’ TCGACATCGTTTAGGGCGTGGACT 3’ Internal 16s rDNA reverse primer

Table 4: List of flanking primers based on T. aromatica strain 3CB2 sequence to clone pipA and pipB full-length genes from the T1 genome pipA-R 5’ CGGTGAGGTTTTTCACGAAT 3’ pipA gene cloning right primer from the sequence of strain 3CB2 pipA-L 5’ CTCAGCGCCAGGATAGAGAC 3’ pipA gene cloning left primer from the sequence of strain 3CB2 pipB-R 5’ CGGAATATTTCCAGGTCGTG 3’ pipB gene cloning right primer from the sequence of strain 3CB2 pipB-L 5’ GGCACATCAAGCTCAAAAGG 3’ pipB gene cloning left primer from the sequence of 3CB2

Table 5: Bacterial constructs used in the study pipA-TOPO 558 bp pipA gene cloned in TOPO vector

by degenerate oligos pipB-TOPO 769 bp pipB gene cloned in TOPO vector

by degenerate oligos pipA-full 2.3 kb full-length gene sequence of pipA in

TOPO vector pipB-full 1.9 kb full-length gene sequence of pipB in

TOPO vector pipAB-full 3.6 kb full-length gene sequence of pipA

and pipB in a cluster in TOPO vector

Table 6: List of sequencing primers used

Serial No. Name of primer Sequence 1 PipAB 7AR2 5’ AACCCATGTTGTTGCGGTAG 3’ 2 pipAB7ARaTri 5’ GAACAGGGTCTCGCCATAGA 3’ 3 PipAB-T7 5’ TAATACGACTCACTATAGGG 3’ 4 PipAB B-S6R2 5’ GAGTCCTTCGCATCCATGTC 3’ 5 PipAB T7AR 5’ GAACAGGGTCTCGCCATAGA 3’ 6 PipAB 16Fa 5’AGCCATGCCGCGTGAGTGAAGA AG 3’ 7 PipABT7A 5 ‘TGTACAACGAATCCCACGAC 3’ 8 PipAB B-S6R 5’ GCCGACGTAGTGGGTGTAGT 3’ 9 PipAB 7B2 5’ TCTATGGCGAGACCCTGTTC 3’ 10 16F 5’AGCCATGCCGCGTGAGTGAAGA AG 3’ 11 16R 5’TCGACATCGTTTAGGGCGTGGA CT 3’ 12 PipAB 16Ra 5’TCGACATCGTTTAGGGCGTGGA CT 3’ 13 PipAB S6C 5’ GTCCGGGTATTTCTTCAGCA 3’ 14 PipAB B1Ra 5’ TTCTTGAAGCCGAACTCGAT 3’ 15 PipAB 7B3 5’ GCCGGAATATTTCCAGGTG 3’ 16 PipAB S6B 5’ CTGGCCGACCAGATACTG 3’ 17 B1R 5’ TTCTTGAAGCCGAACTCGAT 3’ 18 PipAB 7B4 5’ GGTGAATCTCTTCCCGAATG 3’ 19 B1F 5’ GCTGAAGAAATACCCGGACA 3’ 20 PipAB B1Fa 5’ GCTGAAGAAATACCCGGACA 3’ 21 PipAB-S6A 5’ CCGTGACCAGTTCATTGTTG 3’ 22 PipAB-B1F2 5’ TATTCGATCGAGGGCTGTTT 3’ 23 PipAB M13R 5’ CAGGAAACAGCTATGACC 3’ 24 PipAB-Sp6 5’ ATTTAGGTGACACTATAG 3’ 25 B1F3 5’ACGCCTACGACAAGTTCCAC 3’ 26 PipAB B1F3 5’ACGCCTACGACAAGTTCCAC 3’ 27 PipAB B1F4tri 5’ CAGATGCCCAACTTCTTCGT 3’

Primers 2&5, 6&10, 11&12, 14&17, 19&20, 25&26 primer sequences were run twice

(the second time under GC-rich conditions) to obtain better sequencing data. These sequences are listed twice here and in Figure 14. 63

Chapter 3: Results

3.1 Proteomics

Thauera aromatica strain T1 cells were isolated from anaerobic cultures induced either with 0.5 mM benzoate or 0.5 mM p-cresol were shipped to Dr. Chester R.Cooper’s lab at Youngstown State University for protein extraction and proteomic analysis. The aim was to look for protein spots selectively up-regulated in bacterial cells grown in p- cresol vs. benzoate, which is the downstream product of biodegradation of many aromatic compounds. 2DGE was performed at different pI ranges to get the correct range where the differential protein expression could be obtained. The corresponding protein spots obtained were analyzed and two of them matched with a 564 amino acid hypothetical protein from T. aromatica (NCBI Accession No. CAA05047) and a 454 amino acid hypothetical protein from Azoarcus sp. EbN1 (NCBI Accession No. CAI06296). Since most of the other spots were either found to contain no match in the database or were apparently unrelated to aromatic compound biodegradation, they were ignored in subsequent analyses. The identified spots were physically excised from the gel, sequenced and the data was processed using the MASCOT software ( Figure 9). The corresponding genes were called pipA and pipB respectively (for p-cresol induced protein). 64

Figure 9. Representative 2DGE images of proteins produced by T. aromatica strain

T1 grown in benzoate (left image) and p-cresol (right image) supplemented media.

These images are negatives of the original fluorescent SYPRO Ruby stained gels.

The boxes identify differentially regulated proteins. The arrow indicates the isolated protein PipA studied further. The molecular weight of protein spots and their pI range are noted in the figure.

3.2 Cloning of pipA and pipB gene fragments

The protein spots up-regulated by cells induced by p-cresol matched with a 564 amino acid hypothetical protein from T. aromatica (NCBI Accession No. CAA05047) and a 454 amino acid hypothetical protein from Azoarcus sp. EbN1 (NCBI Accession

No. CAI06296). In order to better understand the genetic make-up of these proteins, the 65 corresponding DNA fragments of pipA (558 bp) and pipB (769 bp) from the T. aromatica strain T1 genome were successfully cloned by designing degenerate oligonucleotides on the basis of least degeneracy in the codons of the matched portion of protein sequences in

MASCOT. The complete genome sequence of T.aromatica strain T1 is not available.

Thus, to clone fragment of the desired gene, the sequence information obtained from the

2DGE and MS analysis for comparison to known databases, including the published

Azoarcus-like strain EbN1 sequence and T. aromatica sequence, were used. EbN1 is a denitrifying strain which is closely related to T. aromatica strain T1 and is capable of metabolizing a number of aromatic compounds anaerobically, including toluene and p- cresol (17, 67, 68). The sequence result was translated and compared with the available protein sequence (Figures 10 & 11). The corresponding genes were named pipA and pipB respectively (for p-cresol Induced Protein). The translated DNA sequences were compared to their respective Thauera and Azoarcus matched sequences in the database.

For PipA protein, 4 mismatches were noticed, 1 mismatch was in the region containing mass spectrometry sequenced protein fragment from the T1. For PipB translated sequence, 17 mismatches were noticed, none of which were part of the sequenced protein fragments from the T1 genome. 66

Figure 10. The 564 amino acid sequence of the hypothetical T. aromatica (Ta) protein identified by 2DGE as differentially expressed in p-cresol induced cells compared to the translated peptide sequences of the cloned fragment from strain T1

(pipA). Bold red letters represent the peptide fragments sequenced by MS analysis of protein spots from 2DGE gels. Bold blue letters represent the same peptides in the corresponding cloned fragment. Differences in the two amino acid sequences are indicated with a ‘*’.

Figure 11.The 454 amino acid sequence of the hypothetical Azoarcus sp. EbN1 (Az) protein identified by 2DGE as differentially expressed in p-cresol induced cells compared to the translated peptide sequences of the cloned fragment from strain T1

(pipB). Bold red letters represent the peptide fragments sequenced by MS analysis of protein spots from 2DGE gels. Bold blue letters represent the same peptides in the corresponding cloned fragment. Differences in the two amino acid sequences are indicated with a ‘*’.

3.3 Expression analysis

After cloning of the pipA DNA fragment, RT-PCR was performed on the total RNA

extracted from T. aromatica strain T1 induced by benzoate or p-cresol. Primers were

designed within the pipA gene fragment that was cloned based on the amino acid

sequence match from the database. Analysis of mRNA levels after 35 cycles by RT-PCR

confirmed the proteomic analysis by demonstrating that expression of pipA significantly

increased in cultures grown in the presence of p-cresol when compared to benzoate

(Figure 12). Similar results were obtained with pipB as well. This data confirmed the

proteomic analysis and further proved that the up regulation of the pipA and pipB genes

was not due to any post-transcriptional or post-translational modifications that may have

occurred after the bacterial cells were exposed to p-cresol and benzoate. The presence or

absence of p-cresol determined the expression of these genes..

M B P

400 bp Figure 9. Expression analysis of the 300 bp gene encoding a hypothetical protein from T. aromatica strain T1 grown in the presence of benzoate (B) or p- 200 bp cresol (P). The 269 bp fragment in lane P was generated by RT-PCR. A very faint band can be seen in lane B. M, Figure 12.Expression analysis of pipA by RT-PCR shows differential up-regulation markers (200, 300 and 400 bp, respectively). for p-cresol treated cells in comparison to benzoate treated cells. M=marker (200,

300 and 400 bp), B=Cells grown in benzoate, P=Cells grown in p-cresol. Similar

results were obtained with pipB gene. 69

A one-time Real time PCR was also performed on the total RNA extracted from T. aromatica strain T1 cells grown on benzoate or p -cresol. 16S ribosomal DNA was used as the housekeeping gene. Results from the Real-time PCR showed that the expression of pipA was more than hundred fold up-regulated when the bacterial cells were grown in p- cresol in comparison to benzoate (Figure 13).

Figure 13. Real time PCR comparison of p-cresol and benzoate treated bacterial cells. The gene corresponding to the cloned fragment shows more than hundred fold induction.16S ribosomal DNA was used as control in Real-time PCR.

3.4 Full-length gene sequence analysis

Sequence information obtained from a related Thauera aromatica strain 3CB2 was used to clone the full-length genes pipA and pipB from the T. aromatica strain T1 genome. T. aromatica strain 3CB2 is closely related to T. aromatica strain T1, having 70 similar morphology, G+C content, and optimum growth conditions (29). Additionally,

DNA hybridization between these two strains revealed a 66.0% DNA similarity (28, 58).

The gene fragments similar to pipA and pipB genes were present side by side in adjacent positions within the 3CB2 genome. The initial cloning primers were designed based on the 3CB2 genome. By using primer walking, the complete sequence of the full-length genes pipA and pipB was determined where subsequent primers were designed based on the previous DNA sequence obtained. Multiple reactions were performed to remove any discrepancies in base sequences. Sequence analysis showed the genes to reside side by side in a cluster within the T. aromatica strain T1 genome as well, with a gap of about 27 nucleotides between the stop and start of the two genes (Figure 14).

Both the pipA and pipB genes were found to contain a potential Shine-Dalgarno sequence at their 5’ end (pipA= AGGAGG, pipB=AGGAGA) suggesting that they may have different binding sites for the ribosome during translation (Figure 15). The Shine-

Dalgarno sequence is a highly conserved sequence at the 5´ end of the mRNA transcript in prokaryotes which serves as a ribosome-binding site. It is a purine rich stretch of 3-10 nucleotides and forms base pairing with a highly conserved, pyrimidine-rich region of the

16S rRNA which is part of the 30S ribosomal subunit which aligns the start AUG codon in the P site of the 30S ribosomal subunit (69).

Previous information on tut genes has shown that the toluene degrading genes in T. aromatica strain T1 are organized in an operon. In the case of the pip genes, evidence could not be obtained that that showed the pip genes to be organized in an operon. RT- 71

PCR experiment with primers designed at the junction of pipA and pipB genes did not show the presence of a single transcript.

pipB pipA

Figure 14. Sequencing of full-length pipA and pipB clones from T. aromatica strain T1 genome with primers based on related

T. aromatica strain 3CB2 sequence. Primer walking was used to sequence the entire clone. pipA and pipB genes were determined to reside in a cluster within the T1 genome. See table 6 for the sequences of the numbered primers. gtgaggtttttcacgattttctcaagccgccggaacgcccttttcttccgcactgcgcaaggcatgttgcgtcgtgcgaatcgagcccgcattttt gaaggagcagccacgtcctgcaccgcagcatcaatacattagaaaaatgactggcacgatccatgctccttatccggagcagctgaagacc agttcacataatgattaaaagcgagcgcgggcccgctgctcatgggcccggccattcgaagcgcttctgcaacaaacctgccgccgtcgct ggccgcagggacaaaaagccagtccatttgctcaaggaggaagacatgaacgacaagcaatcccgtttcgaccccggcttcgcgccgcg gatttcacccctcggccgggccgtcgccaccgtttgcgccggcatggcaatttcaggcgccgcgttcggcttcaccattgacacgggcaatt ccgacctgtcggtgcgctgggacaacacgatcaagtacaacgccagctggcgtgtggagaaacaggacggcagcgggcccgcctcgga cgcgggggcgcagatcaacaccaacgacggcgaccgcaacttcagccgtggcctgatttcgaaccgggccgacctgctctccgaattcga cctgcgctaccgcaacaacatgggtttccgggtcagcggcgccgcctggtacgaccaggtgtacaacgaatccaacgaccgcagccaac gctacgcctggtcgctcaaccagcgttcggccgatttcgacgaattcaccaccgccaccgagaagctccacgggcgcaaggcggagttcc tcgatgccttcgtctatggccgcaccgagatcgccggcaagggcctgaacctgaaggcggggcgcttcacccagctctatggcgagaccc tgttcttcggcgccaacggcatcgccggtgcgcagaccccgctcgatctggcccgtgcgctgtcggtgccgaactcgcagttcaaggaagt cgcgcgcccggtcggccaggtctcggcgcagctgcagctcagccccgacctctcgatcggcgcctactaccagtacgaatggcgcgact cgcgcctgccgggggcgggaagctacttcgccttcgccgacttccccggcgccggtggcgagttcctgtacgggccgttcgggcccaac ggcacgctgcgccggggcgatgacatggatgcgaaggactccggtcagggcggtattcaggtcaagttccgtgccggcgacaccgagta cgggctgtacgccgcccagttccacgacaagctgccgcagttctacatccggcccggggtgaacgccgatccggggcgcggcatcgatg gcgactacgtcctcgtctatgcggaaaacatccgcaccatcggcgccagctttgccaccctggtgggggagacgaacgtctcgggcgaact gtcgttccgcgagaaccagccgctggtgggcaccggcaacgtccttctcggcctgggcggggcggacaacgacaacgatgcgaccttcc cgaaaggcaagacgatgcatctgagcctgtcggcgatcagcgtcctgccggccaatgcgctgtgggagggcgcctctttcgtcggcgagt cgcctacaaccgggtgctcagcgtcaccgacaaccgcgccgcgctcgacccgaacgccacccgcgaagccagcgcgatccagttcgtgt tcacgccggaatatttccaggtgatgcccgggctcgatctgcaggtgccgatcggcgtcaactacggcttggccgggcgctcctcggtcaat ggcgtgctgttcccgtcggagaacggcggcagcctgagcatcggggtgaaggccgactaccgcaagacctggcagggcgggctgaact acacccactacgtcggctcctcgggttcgatcgtcaatccggccggcgagctgtcctatgacaatttccacggcgaccgcgacttcgtgtcg ctcacgatccagcgcaccttctgattcttataaaacgaccgaggagatcaatatgttccagttcaagaagaccttgctgtgcgtctccctcctg gcgctgggcgccggcgtgcagagcaccctggccgccgtcagtgcggacgaagcggcaaaactcaaggccaccctcaccccgctcggc ggggaaaaggccggcaacaaggacggcaccattccggcgtggaccggggggcagagcggtgcggtggcggggccgaaagtgggcg acatcccggtgaatctcttcccgaatgaaaagccggttctgcagatcaccgcatcgaacatggcccagcatgccgacaagctcaccgaggg cacgcaggcgctgctgaagaaatacccggacacgttccgcgtcgacgtgtatccgacccatcgcacggcgacggtgcccgaacacgtgg cggccaacaccttcaagaatgcgaccgagtgcaagacgatcgaaggcggctattcgatcgagggctgtttcggcggcctcccgttcccgat tccgcagaccggtgcagaggtggtgtggaattacctgctgcgggtcgagcccgaatcgatcgagttcggcttcaagaacatcgtcggctcct cggacggcaatcacactctggccacccgcaacgacaacttcttccagcacccctacaactacaaggatggctcgtgggagagctggtcga aagacggcaaaggcgaatacttcctgcagcgcttcagtaccacggcgccctccttcaaggtgggcgagtcactggtcatccgcgacagcat cgaccccaaaaccccgcgccaggcctggcagtatctggtcggccagcgccgcgtgcgccgcgcaccgacggtcgcctacgacacgccg gacttcgtcgcctcgggggcgaactatttcgacgaggtgcaaggtttcttcggccaccccgaccgctacgagtggaagctcgtcggcaagc gcgagatgtacgtcccctacaacaacaatgaactggtcacggccaaggttgccgacgcctacgacaagttccacctgaatccggccaaggt gcgctgggagctgcaccgggtgtgggaagtcgaaggcacggtggtgtcgggcaagcgccatgcggtgccgaagcgcaagtattacttcg acgaggacaccgggctgatggtgctgatggatggctacgacgccgaaggcaagctctggcgcacttcgcagatgcccaacttcttcgtccc cgccgttccggcgctcctggtcaagcaggtgacggtgttcaacctgcaggccggcacgatgagcacggtgcaggggctcaacgacgagt cgtaccgggtcgtgccgcgcaagcccgagaccttcttcaccggggatgccgtcgccgccgacgccgcacgctgacctcccccggcggc ggaaccgccgccggagggctgccgggctgcaggcaggccctccgtttctcagaccgggtttttcgttgttgaacgacgttccgtccacggc accgccccacggggtcggctgctgggcgacggcgcgcgaatgagagtaggccacatggttctgaacactgcgctgcggcccctgctggc ggccgtccttttgagcttgatgt

Figure 15 .Full pipAB gene sequence. Red=pipA, green=pipB, underlined in black=Shine Dalgarno sequence, underlined in red=start and stop of pipA, underlined in green=start and stop of pipB. 74

The complete DNA sequence obtained from sequencing the pipA and pipB genes from the T1 genome were translated by the Vector NTI software (Invitrogen, Inc.,

Carlsbad, CA) and compared to the respective matches in the MASCOT database by

ClustalW. For the pipA translated sequence, results showed that there was a 91% similarity between the PipA and its corresponding match (T. aromatica hypothetical protein) (Figure 16). For the pipB translated sequence the match was 89% similar in spite of the sequence being from the more distant Azoarcus species (Figure 17). These results indicated that the full-length pipA and pipB genes were successfully cloned from the T1 genome and are conserved in other bacterial species as well. Further bioinformatic analysis was needed to identify additional physiological properties of these proteins.

Figure 16. The translated protein sequence from pipA DNA sequence compared to the 564 amino acid sequence of the conserved T. aromatica (thauera) protein identified by 2DGE. (*) indicates positions which have a single, fully conserved residue. (:) indicates conservation between groups of strongly similar properties. (.) indicates conservation between groups of weakly similar properties.

Figure 17. The translated protein sequence from pipB DNA sequence compared to the 454 amino acid sequence of the conserved hypothetical Azoarcus sp. EbN1 (Az) protein identified by 2DGE. (*) indicates positions which have a single, fully conserved residue. (:) indicates conservation between groups of strongly similar properties. (.) indicates conservation between groups of weakly similar properties.

3.5 In silico analysis

PipA and PipB translated protein sequences were subject to blastx analysis (62)

(Figure 11 and 12) that involves matching a translated nucleotide sequence to the available protein sequences in the database. Results showed that PipA contains a Domain 77 of Unknown Function 1302 (DUF 1302) between residues 23-561in their sequence and

PipB contains a Domain of Unknown Function 1329 (DUF 1329) between residues 62-

434 (Figure 18). These DUF’s are reported to be present in a range of bacterial species involved in aromatic compound biodegradation according to BLAST analysis (73)

(Figures 19 and 20).

ATP binding motif

Figure 18. DUF 1329 and DUF 1302 domains found in PipB and PipA translated protein sequences from T1 genome with P-loop in the PipA protein.

Figure 19. Blastx of PipA translated sequence against the available protein sequences in the database shows presence of a number of hypothetical proteins similar to PipA in a range of bacterial species.

Figure 20. Blastx of PipB translated sequence against the available protein sequences in the database also shows presence of a number of hypothetical proteins similar to PipB in a range of bacterial species.

3.5.1 Protparam analysis

Protparam tool (59-61)provided details on the physicochemical properties of PipA and PipB protein sequences. The results matched closely with the related proteins in the database.

Table 7: Protparam analysis of PipA and PipB proteins

Properties PipA PipB

Number of amino acids 561 456

Molecular weight 60744.2 50546.1

Theoretical pI 5.14 7.13

Instability index 24.43 32.94

Stability Stable Stable

3.5.2 Motif Scan

Motif Scan (60, 63) of PipA protein sequence showed the presence of ATP/GTP- binding site motif A (P-loop) between residues 404-411. This is defined as a glycine-rich region that can form a flexible loop between a β-strand and α-helix. This loop interacts with one of the phosphate groups of the nucleotide (70). The consensus sequence is

(G/A) XXXXGK (T/S) where G is glycine, A is alanine, K is lysine, T is threonine, S is serine and X is any amino acid. The lysine (K) residue is important for nucleotide- binding. (70).

3.5.3 PSORTb analysis

PSORTb is protein localization software that predicts the intracellular location of a particular protein (64). Results obtained with PipA and PipB protein sequences suggest that PipA is most likely localized in the outer membrane of the Gram-negative bacterium strain T1 where as a definite location for PipB could not be predicted.

Analysis Report of PipA:

ModHMM 3 internal helices found Signal No signal peptide detected Localization Scores: Outer Membrane 9.49 Extracellular 0.38 Periplasmic 0.09 Cytoplasmic 0.03 Cytoplasmic Membrane 0.01 Final Prediction: Outer Membrane 9.49

Analysis report of PipB:

ModHMM One internal helix found Signal Signal peptide detected Localization Scores: Cytoplasmic Membrane 2.50 Outer Membrane 2.50 Periplasmic 2.50 Extracellula 2.50 Cytoplasmic 0.00 Final Prediction Unknown 3.5.4 SignalP 4.0

The respective protein sequences were subject to SignalP 4.0 server (66) to see whether there were any signal peptides in the protein sequence. While PipA did not have any signal sequence present, PipB showed the presence of a signal sequence at residue

25-26 (Alanine 25-Valine 26) (Figure 21). 82

Figure 21. Protein sequence of PipB showed presence of a signal peptide at residue

A25-V26 that targets PipB protein outside the cytoplasmic membrane.

3.5.5 TMPred analysis

TMPred (60) is a prediction of the number of possible transmembrane helices in a protein sequence. Only peaks above 500 are considered significant (with star). PipB is predicted to have one transmembrane helix (Figure 22), whereas PipA is shown to contain 3 strong helices spanning from inside to outside (Figure 23).

Figure 22. TMPred analysis of PipB showing presence of one transmembrane helix that is marked with a star ranging from amino acids 7-27 (inside-outside).

Preferred model: N-terminus inside.

Figure 23. TMPred analysis of PipA showing presence of three transmembrane helices that are marked with a star. Preferred model: N-terminus outside. The helices range from amino acids 22-41 (outside-inside), 259-278 (inside-outside) and

409-426 (outside-inside).

3.5.6 Phyre2:

Phyre2 is protein Homology Analogy software that predicts protein structure and function based on homologous proteins in the database (65). The following is the result obtained for PipA (Figure 24) and PipB (Figure 25) translated protein sequences. Phyre2 software analysis predicts the PipA protein to belong to a family of outer membrane transport protein and suggests that the PipB protein to belongs to a family of outer membrane lipoprotein-sorting protein. 85

Fold: Transmembrane beta-barrels

Superfamily: Porins

Family: Outer membrane transport protein

Figure 24. Phyre2 software analysis predicts PipA protein to be a family of outer membrane transport protein.

Family: Putative outer membrane lipoprotein-sorting protein

Figure 25. Phyre2 software analysis predicts PipB protein to belong to a family of outer membrane lipoprotein-sorting proteins. Residues 164-452 (64% of the sequence) of PipB aligned with the crystal structure of a putative outer membrane lipoprotein sorting protein domain from Vibrio parahaemolyticus.

Chapter 4: Discussion

Thauera aromatica strain T1 is a denitrifying, facultative anaerobic, Gram-negative soil bacterium that was isolated on the basis of its growth on toluene (58, 71). Results have since shown that the bacterium can degrade p-cresol as well (28). It was noticed that the toluene degrading genes and the p-cresol degrading genes are different as one mutant unable to degrade toluene tutD can metabolize p-cresol (Coschigano, unpublished results). Hence, the aim of this work was to find the genes related to p-cresol degradation by comparing the proteomic profile of the bacterial cells induced by benzoate vs. p- cresol.

The bioinformatic analyses of PipA and PipB proteins gave new insights to the putative function of these proteins with respect to p-cresol metabolism. As revealed from the results, PipA is likely to be present in the outer membrane of the Gram-negative bacteria T. aromatica strain T1 and functions in the transport of small molecules. It is possible that it may play a role in the uptake of p-cresol from the media, since it is up- regulated in the presence of p-cresol in comparison to benzoate. The presence of an

ATP/GTP binding motif within DUF 1302 hints that the process may be energy- dependent. Therefore, it is likely from the above results that PipA may be involved in the uptake of p-cresol from the environment in an energy-dependent manner.

PipA is found to be conserved across many bacterial species that can degrade toxic aromatic compounds, but not all of them are known to degrade p-cresol, for example

Delftia sp (See figure 19). Also, the presence of DUF 1302 as the major domain in the

PipA protein sequence and the presence of this same domain in a range of other bacterial 88 species not known to degrade p-cresol also suggest that PipA though suggested here to transport p-cresol may also be involved in the transport of other compounds from the environment. There has been evidence that p-cresol degradation pathway feeds into the 4- hydroxybenzoate pathway (see Figure 6) (5). Thus, it may be possible that 4- hydroxybenzoate and p-cresol uptake by the bacterial cell may utilize similar transport proteins.

Benzoate transport within the bacterial cells may be carried out both facilitated diffusion along a downhill concentration or there may be specific transporters involved for the process (72). In Corynebacterium glutamicum, the BenK and BenE proteins have already been identified as benzoate transporters (73). Since PipA expression is negligible in the presence of benzoate in strain T1, it is unlikely that the transporter proteins of p- cresol and benzoate are the same in strain T1. This also represents the unique adaptive capability of different bacteria with respect to metabolite transport within the bacterial cells.

Gram-negative bacteria have a distinct membrane architecture that is different from the Gram-positive bacteria. Gram positive bacteria have a thick, multilayered cell wall that consists mainly of a peptidoglycan layer surrounding the cytoplasmic membrane and allows diffusion of metabolites to the plasma membrane (74, 75). This layer is essential for the survival of the bacterium in hostile conditions (74). On the other hand, a Gram negative cell wall contains a thin peptidoglycan layer outside the cytoplasmic membrane.

External to the peptidoglycan layer lays the outer membrane that is unique to Gram negative bacteria only (76-79). The area in between the cytoplasmic membrane and the 89 outer membrane is referred to as the periplasmic space that contains many enzymes vital for the survival of a Gram negative bacterium (77). Bacterial lipoproteins are proteins that have a lipid moiety attached to them and are usually localized in the periplasmic space, spanning the outer membrane. They have different functional roles, including pathogenesis or help in transport of molecules across the outer membrane (80). Since the outer membrane is composed of the hydrophilic lipopolysaccharides, bacteria need the help of specialized proteins for the transport of the hydrophobic molecules across the membrane (34). Examples of such proteins are the FadL superfamily of proteins in E.coli that transports fatty acids (35, 37) and TodX protein in Pseudomonas putida (38, 81) that transports toluene.

For PipB, no conclusive data could be obtained about its localization pattern based on the translated protein sequence. However, PipB was determined to contain a signal sequence between residues 25-26 that targets the protein outside the cytoplasmic membrane of the bacteria. Also, it was found to span the membrane at the same residues, which may indicate that it is cleaved at residues 25-26 and released outside the cytoplasmic membrane. Phyre2 software predicted PipB to be a putative outer membrane lipoprotein sorting protein based on the crystal structure of the putative outer membrane lipoprotein sorting protein domain from Vibrio parahaemolyticus (a Gram-negative bacterium that can cause gastrointestinal disease in humans when ingested) (82-84). Also, about 62% of the PipB sequence aligned with the crystal structure of the LolA superfamily protein ne2245 from Nitrosomonas europaea and about 58% of PipB protein sequence matched with the crystal structure of Pseudomonas aeruginosa LolA protein as 90 per the Phyre analysis. Therefore, it can be argued that PipB could be involved in lipoprotein sorting from cytoplasmic membrane to outer membrane of strain T1.

The lipoprotein sorting mechanism is still not very clear in prokaryotes. Most of the work is reported in the Gram-negative organism E.coli. A specific lip oprotein carrier

LolA acts as a chaperone and is known to target the lipoproteins towards the outer membrane across the periplasmic space in E.coli (76, 85, 86). In E. coli, lipoproteins may be anchored to the periplasmic side of either the inner or outer membrane through N- terminal lipids. The presence of aspartate at position 2 directs the lipoproteins to remain attached to the inner membrane, and any other residues target the lipoproteins to the outer membrane. A complex of Lol proteins (L ocalization of lipoproteins) are found to be involved in the sorting of lipoproteins to the outer membrane. LolCDE protein complex is an ABC transporter that releases the outer membrane targeted lipoproteins from the inner membrane and the molecular chaperone LolA helps the lipoproteins cross the periplasm and bind to the outer membrane receptor LolB that anchors the lipoproteins to the outer membrane (87-90) (Figure 26). Bioinformatic analysis of PipB structure shows that PipB could be carrying out a function similar to LolA as a periplasmic chaperone for targeting lipoproteins towards the outer membrane. Also, since LolA activity was purified from periplasmic space and PipB is also predicted to be targeted outside the cytoplasmic membrane, it suggests that both proteins are maybe localized similarly and may have similar functional roles.

Figure 26. Lol system in prokaryotes (91)

A recent study with Delftia sp. Cs1-4, a Gram negative bacterium known to survive in soils contaminated with chromium and capable of metabolizing phenanthrene (92, 93) throws interesting light with respect to possible functional roles of PipA and PipB. By growing Delftia in phenanthrene and examining it under transmission electron microscope, the authors have discovered a novel bacterial structure described as

“nanopod” that can project outer membrane vesicles (OMV) from the cell. Imaging results have shown that these nanopods are tubular structures composed of cell surface layer protein that carry the OMV and they project out of the outer membrane of the 92 bacteria. The authors analyzed the protein content of whole nanopod samples and apart from the structural proteins and the periplasmic enzymes, they also found the genes for two proteins of unknown function located adjacently within the gene cluster encoding phenanthere degradation. Those two proteins contain DUF 1302 and 1329, exactly as found for PipA and PipB (96). They hypothesized that these proteins could be related to phenanthrene degradation, since nanopod formation was induced by phenanthrene.

Taken together with our results described here, it indicates that the proteins of unknown functions containing domains 1302 and 1329 present in whole nanopod samples are similar to PipA and PipB proteins. We can thus hypothesize that both PipA and PipB may be constituents of bacterial nanopods, and they may be involved in active uptake of the metabolite across the outer membrane by the ATP/GTP binding motif present in PipA. PipA is hypothesized to be the transport protein involved in transport of macromolecules whereas PipB may be a putative periplasmic chaperone that directs bacterial lipoproteins across the periplasmic space. How the lipoproteins can function in the uptake of aromatic molecules will be interesting to determine as a future course of action. Lipoproteins are known to be structurally dynamic and may respond to many signals depending on environmental conditions, so it could be possible that PipB expression is subject to environmental conditions. It can also be stated that these proteins may have a much broader role in the transport of macromolecules, since p-cresol and phenanthrene are not known to share any similarity in biodegradation. The fact that these genes are located in a cluster within the genome is important, signifying that their expression could be coupled as well. 93

A diagrammatic representation of the possible roles of PipA and PipB in strain T1 is summarized in the following diagram (Figure 27). PipA is shown to reside in the outer membrane and function as a possible transport protein that may help in uptake of p-cresol with the help of ATP. PipB is shown to be targeted outside the cytoplasmic membrane and function as a chaperone to bring designated lipoproteins from the inner membrane to the outer membrane of the bacteria that can decide vesicle formation from a region in the membrane. Since the nanopod is shown to be contiguous with the outer membrane layer, it may be possible that these proteins are members of the outer membrane as well as the vesicles that pinch out from the outer membrane. In that case, it will be interesting to determine if p-cresol degradation occurs at the OMV itself and the simpler compounds can diffuse through the membrane or enter via specific transporters. Also, the possibility that the vesicles are dynamic and the formation and fusion of the vesicles from the outer membrane may occur simultaneously in energy dependent manner cannot be ruled out.

Further sequencing of the pipAB gene cluster can reveal other proteins involved in this pathway.

Extracellular

Intracellular

Figure 27. Diagrammatic representation of the roles of PipA and PipB in p-cresol uptake. PM = Plasma Membrane, PG = Peptidoglycan, PS = Periplasmic Space, OM

= Outer Membrane, OMV = Outer Membrane Vesicles, SLP = Surface Layer

Protein.

Chapter 5: Future Perspectives

The gene sequences of pipA and pipB provides interesting insights in bacterial biodegradation mechanisms in Gram-negative bacteria like T. aromatica strain T1.

Analyses of the PipA and PipB proteins have shown that these proteins may be involved in transport of macromolecules across bacterial outer membrane for metabolization within the cell.

It would be interesting to determine the actual role of PipB in this transport mechanism, knowing that it has similarity to periplasmic chaperones. Also, since in

Delftia sp. similar proteins are found within the phenanthrene degrading gene cluster, it could be possible that the genes adjacent to PipA and PipB may contain genes that will degrade p-cresol as well (94). Further sequencing of the genes surrounding pipA and pipB can reveal interesting information about p-cresol degrading genes. There is previous evidence that transporter genes are tightly linked to the metabolic genes in Pseudomonas putida (81). However, since pipA and pipB genes seem to be more diverse in their transport mechanism with respect to substrate specificity, it would be interesting to identify their expression level in the presence of other aromatic compounds to gain more insight in their transport mechanism.

Though efforts to generate pipA and pipB deletion mutants have not been successful, this would be an important step to understand the roles of these proteins in the physiology of strain T1. The wild type cells could be viewed for the presence of nanopods using electron microscopy and can be compared to the deletion mutants to visualize any change in nanopod structure. 96

Together, these results indicates novel pathways of aromatic compound metabolism by strain T1, which can be important to understand the physiology of strain T1 and its role in bioremediation of aromatic compounds in the environment.

Bibliography

1. Lovley DR (2001) Bioremediation. Anaerobes to the rescue. Science 293: 1444-1446.

2. Lovley DR (2000) Anaerobic benzene degradation. Biodegradation 11: 107-116.

3. Lovley DR & Lloyd JR (2000) Microbes with a mettle for bioremediation. Nat

Biotechnol 18: 600-601.

4. Lovley DR, Fraga JL, Coates JD & Blunt-Harris EL (1999) Humics as an electron donor for anaerobic respiration. Environ Microbiol 1: 89-98.

5. Carmona M, et al (2009) Anaerobic catabolism of aromatic compounds: A genetic and genomic view. Microbiol Mol Biol Rev 73: 71-133.

6. Fuchs G, Boll M & Heider J (2011) Microbial degradation of aromatic compounds - from one strategy to four. Nat Rev Microbiol 9: 803-816.

7. Fuchs G (2008) Anaerobic metabolism of aromatic compounds. Ann N Y Acad Sci

1125: 82-99.

8. Gibson J & S Harwood C (2002) Metabolic diversity in aromatic compound utilization by anaerobic microbes. Annu Rev Microbiol 56: 345-369.

9. Olaniran AO & Igbinosa EO (2011) Chlorophenols and other related derivatives of environmental concern: Properties, distribution and microbial degradation processes.

Chemosphere 83: 1297-1306. 98

10. Yu L, Blaser M, Andrei PI, Pierik AJ & Selmer T (2006) 4-hydroxyphenylacetate decarboxylases: Properties of a novel subclass of glycyl radical enzyme systems.

Biochemistry 45: 9584-9592.

11. Peters F, Heintz D, Johannes J, van Dorsselaer A & Boll M (2007) Genes, enzymes, and regulation of para-cresol metabolism in Geobacter metallireducens. J Bacteriol 189:

4729-4738.

12. Cunane LM, et al (2000) Structures of the flavocytochrome p-cresol methylhydroxylase and its enzyme-substrate complex: Gated substrate entry and proton relays support the proposed catalytic mechanism. J Mol Biol 295: 357-374.

13. Haggblom M (1990) Mechanisms of bacterial degradation and transformation of chlorinated monoaromatic compounds. J Basic Microbiol 30: 115-141.

14. Hopper DJ, Bossert ID & Rhodes-Roberts ME (1991) p-cresol methylhydroxylase from a denitrifying bacterium involved in anaerobic degradation of p-cresol. J Bacteriol

173: 1298-1301.

15. Schnell S, Bak F & Pfennig N (1989) Anaerobic degradation of aniline and dihydroxybenzenes by newly isolated sulfate-reducing bacteria and description of

Desulfobacterium anilini. Arch Microbiol 152: 556-563.

16. Bossert ID & Young LY (1986) Anaerobic oxidation of p-cresol by a denitrifying bacterium. Appl Environ Microbiol 52: 1117-1122. 99

17. Rabus R (2005) Functional genomics of an anaerobic aromatic-degrading denitrifying bacterium, strain EbN1. Appl Microbiol Biotechnol 68: 580-587.

18. Wohlbrand L, Wilkes H, Halder T & Rabus R (2008) Anaerobic degradation of p- ethylphenol by "Aromatoleum aromaticum" strain EbN1: Pathway, regulation, and involved proteins. J Bacteriol 190: 5699-5709.

19. Muller JA, Galushko AS, Kappler A & Schink B (2001) Initiation of anaerobic degradation of p-cresol by formation of 4-hydroxybenzylsuccinate in Desulfobacterium cetonicum. J Bacteriol 183: 752-757.

20. Muller JA, Galushko AS, Kappler A & Schink B (1999) Anaerobic degradation of m- cresol by Desulfobacterium cetonicum is initiated by formation of 3- hydroxybenzylsuccinate. Arch Microbiol 172: 287-294.

21. Carmona M & Diaz E (2005) Iron-reducing bacteria unravel novel strategies for the anaerobic catabolism of aromatic compounds. Mol Microbiol 58: 1210-1215.

22. Pelletier DA & Harwood CS (1998) 2-ketocyclohexanecarboxyl coenzyme A hydrolase, the ring cleavage enzyme required for anaerobic benzoate degradation by

Rhodopseudomonas palustris. J Bacteriol 180: 2330-2336.

23. Gibson J, Dispensa M & Harwood CS (1997) 4-hydroxybenzoyl coenzyme A reductase (dehydroxylating) is required for anaerobic degradation of 4-hydroxybenzoate 100 by Rhodopseudomonas palustris and shares features with molybdenum-containing hydroxylases. J Bacteriol 179: 634-642.

24. Harwood CS & Parales RE (1996) The beta-ketoadipate pathway and the biology of self-identity. Annu Rev Microbiol 50: 553-590.

25. Larimer FW, et al (2004) Complete genome sequence of the metabolically versatile photosynthetic bacterium Rhodopseudomonas palustris. Nat Biotechnol 22: 55-61.

26. VerBerkmoes NC, et al (2006) Determination and comparison of the baseline proteomes of the versatile microbe Rhodopseudomonas palustris under its major metabolic states. J Proteome Res 5: 287-298.

27. Egland PG, Gibson J & Harwood CS (1995) Benzoate-coenzyme A ligase, encoded by badA, is one of three ligases able to catalyze benzoyl-coenzyme A formation during anaerobic growth of Rhodopseudomonas palustris on benzoate. J Bacteriol 177: 6545-

6551.

28. Song B, Young LY & Palleroni NJ (1998) Identification of denitrifier strain T1 as

Thauera aromatica and proposal for emendation of the genus thauera definition. Int J

Syst Bacteriol 48 Pt 3: 889-894.

29. Coschigano PW & Bishop BJ (2004) Role of benzylsuccinate in the induction of the tutE tutFDGH gene complex of T. aromatica strain T1. FEMS Microbiol Lett 231: 261-

266. 101

30. Coschigano PW (2002) Construction and characterization of insertion/deletion mutations of the tutF, tutD, and tutG genes of Thauera aromatica strain T1. FEMS

Microbiol Lett 217: 37-42.

31. Coschigano PW (2000) Transcriptional analysis of the tutE tutFDGH gene cluster from Thauera aromatica strain T1. Appl Environ Microbiol 66: 1147-1151.

32. Coschigano PW & Young LY (1997) Identification and sequence analysis of two regulatory genes involved in anaerobic toluene metabolism by strain T1. Appl Environ

Microbiol 63: 652-660.

33. Bhandare R, Calabro M & Coschigano PW (2006) Site-directed mutagenesis of the

Thauera aromatica strain T1 tutE tutFDGH gene cluster. Biochem Biophys Res Commun

346: 992-998.

34. Hearn EM, Patel DR & van den Berg B (2008) Outer-membrane transport of aromatic hydrocarbons as a first step in biodegradation. Proc Natl Acad Sci U S A 105: 8601-8606.

35. van den Berg B (2005) The FadL family: Unusual transporters for unusual substrates.

Curr Opin Struct Biol 15: 401-407.

36. Lee SH, Choi JI, Park SJ, Lee SY & Park BC (2004) Display of bacterial lipase on the Escherichia coli cell surface by using FadL as an anchoring motif and use of the enzyme in enantioselective biocatalysis. Appl Environ Microbiol 70: 5074-5080. 102

37. Zou H, et al (2008) Dynamic mechanism of fatty acid transport across cellular membranes through FadL: Molecular dynamics simulations. J Phys Chem B 112: 13070-

13078.

38. Silva-Jimenez H, et al (2012) Study of the TmoS/TmoT two-component system:

Towards the functional characterization of the family of TodS/TodT like systems. Microb

Biotechnol 5: 489-500.

39. Silva-Jimenez H, Ramos JL & Krell T (2012) Construction of a prototype two- component system from the phosphorelay system TodS/TodT. Protein Eng Des Sel 25:

159-169.

40. Ditty JL & Harwood CS (2002) Charged amino acids conserved in the aromatic acid/H+ symporter family of permeases are required for 4-hydroxybenzoate transport by

PcaK from Pseudomonas putida. J Bacteriol 184: 1444-1448.

41. Boll M & Fuchs G (2005) Unusual reactions involved in anaerobic metabolism of phenolic compounds. Biol Chem 386: 989-997.

42. Coates JD, Chakraborty R & McInerney MJ (2002) Anaerobic benzene biodegradation--a new era. Res Microbiol 153: 621-628.

43. Breese K, Boll M, Alt-Morbe J, Schagger H & Fuchs G (1998) Genes coding for the benzoyl-CoA pathway of anaerobic aromatic metabolism in the bacterium Thauera aromatica. Eur J Biochem 256: 148-154. 103

44. Heider J & Fuchs G (1997) Anaerobic metabolism of aromatic compounds. Eur J

Biochem 243: 577-596.

45. Gibson J, Dispensa M, Fogg GC, Evans DT & Harwood CS (1994) 4- hydroxybenzoate-coenzyme A ligase from Rhodopseudomonas palustris: Purification, gene sequence, and role in anaerobic degradation. J Bacteriol 176: 634-641.

46. Egland PG, Gibson J & Harwood CS (1995) Benzoate-coenzyme A ligase, encoded by badA, is one of three ligases able to catalyze benzoyl-coenzyme A formation during anaerobic growth of Rhodopseudomonas palustris on benzoate. J Bacteriol 177: 6545-

6551.

47. Coates JD, et al (2001) Anaerobic benzene oxidation coupled to nitrate reduction in pure culture by two strains of Dechloromonas. Nature 411: 1039-1043.

48. Chakraborty R, O'Connor SM, Chan E & Coates JD (2005) Anaerobic degradation of benzene, toluene, ethylbenzene, and xylene compounds by Dechloromonas strain RCB.

Appl Environ Microbiol 71: 8649-8655.

49. Chakraborty R & Coates JD (2005) Hydroxylation and carboxylation--two crucial steps of anaerobic benzene degradation by Dechloromonas strain RCB. Appl Environ

Microbiol 71: 5427-5432. 104

50. Kuhner S, et al (2005) Substrate-dependent regulation of anaerobic degradation pathways for toluene and ethylbenzene in a denitrifying bacterium, strain EbN1. J

Bacteriol 187: 1493-1503.

51. Kuntze K, et al (2011) Enzymes involved in the anaerobic degradation of meta- substituted halobenzoates. Mol Microbiol 82: 758-769.

52. Song B & Ward BB (2003) Nitrite reductase genes in halobenzoate degrading denitrifying bacteria. FEMS Microbiol Ecol 43: 349-357.

53. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-

254.

54. Cooper CR & Vanittanakom N (2008) Insights into the pathogenicity of Penicillium marneffei. Future Microbiol 3: 43-55.

55. Carr S, et al (2004) The need for guidelines in publication of peptide and protein identification data: Working group on publication guidelines for peptide and protein identification data. Mol Cell Proteomics 3: 531-533.

56. Bertani G (1951) Studies on lysogenesis. I. the mode of phage liberation by lysogenic

Escherichia coli. J Bacteriol 62: 293-300.

57. Rozen S & Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132: 365-386. 105

58. Song B, Palleroni NJ, Kerkhof LJ & Haggblom MM (2001) Characterization of halobenzoate-degrading, denitrifying Azoarcus and Thauera isolates and description of

Thauera chlorobenzoica sp. nov. Int J Syst Evol Microbiol 51: 589-602.

59. Gasteiger E, et al (2003) ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res 31: 3784-3788.

60. Artimo P, et al (2012) ExPASy: SIB bioinformatics resource portal. Nucleic Acids

Res 40: W597-W603.

61. Wilkins MR, et al (1999) Protein identification and analysis tools in the ExPASy server. Methods Mol Biol 112: 531-552.

62. Altschul SF, Gish W, Miller W, Myers EW & Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403-410.

63. de Castro E, et al (2006) ScanProsite: Detection of PROSITE signature matches and

ProRule-associated functional and structural residues in proteins. Nucleic Acids Res 34:

W362-W365.

64. Yu NY, et al (2010) PSORTb 3.0: Improved protein subcellular localization prediction with refined localization subcategories and predictive capabilities for all prokaryotes. Bioinformatics 26: 1608-1615.

65. Kelley LA & Sternberg MJ (2009) Protein structure prediction on the web: A case study using the phyre server. Nat Protoc 4: 363-371. 106

66. Petersen TN, Brunak S, von Heijne G & Nielsen H (2011) SignalP 4.0:

Discriminating signal peptides from transmembrane regions. Nat Methods 8: 785-786.

67. Champion KM, Zengler K & Rabus R (1999) Anaerobic degradation of ethylbenzene and toluene in denitrifying strain EbN1 proceeds via independent substrate-induced pathways. J Mol Microbiol Biotechnol 1: 157-164.

68. Rabus R, et al (2005) The genome sequence of an anaerobic aromatic-degrading denitrifying bacterium, strain EbN1. Arch Microbiol 183: 27-36.

69. Shine J & Dalgarno L (1975) Determinant of cistron specificity in bacterial ribosomes. Nature 254: 34-38.

70. Saraste M, Sibbald PR & Wittinghofer A (1990) The P-loop--a common motif in

ATP- and GTP-binding proteins. Trends Biochem Sci 15: 430-434.

71. Coschigano PW & Young LY (1997) Identification and sequence analysis of two regulatory genes involved in anaerobic toluene metabolism by strain T1. Appl Environ

Microbiol 63: 652-660.

72. Collier LS, Nichols NN & Neidle EL (1997) benK encodes a hydrophobic permease- like protein involved in benzoate degradation by Acinetobacter sp. strain ADP1. J

Bacteriol 179: 5943-5946.

73. Chaudhry MT, et al (2007) Genome-wide investigation of aromatic acid transporters in Corynebacterium glutamicum. Microbiology 153: 857-865. 107

74. Salton MR (1953) Studies of the bacterial cell wall. IV. The composition of the cell walls of some gram-positive and gram-negative bacteria. Biochim Biophys Acta 10: 512-

523.

75. Jiang W, et al (2004) Elucidation of functional groups on gram-positive and gram- negative bacterial surfaces using infrared spectroscopy. Langmuir 20: 11433-11442.

76. Tokuda H (2009) Biogenesis of outer membranes in gram-negative bacteria. Biosci

Biotechnol Biochem 73: 465-473.

77. Beveridge TJ (1999) Structures of gram-negative cell walls and their derived membrane vesicles. J Bacteriol 181: 4725-4733.

78. Yao X, Jericho M, Pink D & Beveridge T (1999) Thickness and elasticity of gram- negative murein sacculi measured by atomic force microscopy. J Bacteriol 181: 6865-

6875.

79. Pink D, Moeller J, Quinn B, Jericho M & Beveridge T (2000) On the architecture of the gram-negative bacterial murein sacculus. J Bacteriol 182: 5925-5930.

80. Kovacs-Simon A, Titball RW & Michell SL (2011) Lipoproteins of bacterial pathogens. Infect Immun 79: 548-561.

81. Ramos-Gonzalez MI, et al (2002) Cross-regulation between a novel two-component signal transduction system for catabolism of toluene in Pseudomonas mendocina and the

TodST system from pseudomonas putida. J Bacteriol 184: 7062-7067. 108

82. Shinoda S (2011) Sixty years from the discovery of Vibrio parahaemolyticus and some recollections. Biocontrol Sci 16: 129-137.

83. Dabanch PJ, et al (2009) Vibrio parahaemolyticus bacteremia: Case report and literature review. Rev Chilena Infectol 26: 360-362.

84. Takeda Y (2011) Vibrio parahaemolyticus, enterotoxigenic Escherichia coli, enterohemorrhagic Escherichia coli and Vibrio cholerae. Proc Jpn Acad Ser B Phys Biol

Sci 87: 1-12.

85. Tokuda H & Matsuyama S (2004) Sorting of lipoproteins to the outer membrane in E. coli. Biochim Biophys Acta 1693: 5-13.

86. Tokuda H (2003) Protein localization in bacteria. Seikagaku 75: 109-118.

87. Terada M, Kuroda T, Matsuyama SI & Tokuda H (2001) Lipoprotein sorting signals evaluated as the LolA-dependent release of lipoproteins from the cytoplasmic membrane of Escherichia coli. J Biol Chem 276: 47690-47694.

88. Miyamoto A, Matsuyama S & Tokuda H (2001) Mutant of LolA, a lipoprotein- specific molecular chaperone of Escherichia coli, defective in the transfer of lipoproteins to LolB. Biochem Biophys Res Commun 287: 1125-1128.

89. Tanaka K, Matsuyama SI & Tokuda H (2001) Deletion of lolB, encoding an outer membrane lipoprotein, is lethal for Escherichia coli and causes accumulation of lipoprotein localization intermediates in the periplasm. J Bacteriol 183: 6538-6542. 109

90. Narita S, Tanaka K, Matsuyama S & Tokuda H (2002) Disruption of lolCDE, encoding an ATP-binding cassette transporter, is lethal for Escherichia coli and prevents release of lipoproteins from the inner membrane. J Bacteriol 184: 1417-1422.

91. Okuda S & Tokuda H (2011) Lipoprotein sorting in bacteria. Annu Rev Microbiol 65:

239-259.

92. Shetty A, Chen S, Tocheva EI, Jensen GJ & Hickey WJ (2011) Nanopods: A new bacterial structure and mechanism for deployment of outer membrane vesicles. PLoS One

6: e20725.

93. Chen S & Hickey WJ (2011) Development of tools for genetic analysis of phenanthrene degradation and nanopod production by Delftia sp. Cs1-4. Front Microbiol

2: 187.

94. Hickey WJ, Chen S & Zhao J (2012) The phn island: A new genomic island encoding catabolism of polynuclear aromatic hydrocarbons. Front Microbiol 3: 125. ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

Thesis and Dissertation Services ! !