Behaviour, Group Dynamics, and Health of Free-Ranging Eastern Grey Kangaroos

Home , Diprotodontia, Eastern grey kangaroo, Macropodidae, Macropodiformes, Namadgi National Park, Phascolarctos

Behaviour, group dynamics, and health of free-ranging eastern grey kangaroos

(Macropus giganteus)

Jai Mikaela Green-Barber

Submitted for the completion of a Doctor of Philosophy (Science) degree at Western

Sydney University

November 2017

Dedication

The following thesis is dedicated to my hero.

You instilled in me an appreciation of nature and of knowledge, you showed me the joys of solving puzzles and debating ideas, and you always encouraged me to be daring when the reward was worth the risk. Most importantly you always taught me to laugh along the way, to laugh at myself, and not take life too seriously. These gifts you have given me have led me down this path, and gave me the strength to complete the journey. Your influence will continue to shape the rest of my life.

This one’s for you Dad xoxo

Acknowledgements

I would like to thank Associate Professor Julie Old for the encouragement and support needed to complete this thesis. I really appreciate you putting up with my essay length emails full of questions and all the feedback on the countless draft manuscripts and presentations produced throughout my candidature.

To Dr Hayley Stannard, thank you for teaching me to collect blood samples and run blood chemistry analysis, and for the helpful feedback on draft manuscripts.

Thank you to Dr Oselyne Ong for teaching me how to run antimicrobial assays,

Megan Callander for teaching me how to use various microsatellite analysis software, and Professor John Hunt for providing feedback on draft manuscripts and advice on analysis.

To all the volunteers that assisted me in the field your help was greatly appreciated. Thank you to Dr Hayley Stannard, Eden Hermsen, Bradley Evans, Kym

Green, Fiona McDougall, Casey Borthwick, Mark Emanuel, Iris Bleach and Tim

Finter for their assistance with animal handling, and sample collection. To Rhys

Green-Barber and Bradley Evans, thank you for your assistance with tracking collared kangaroos. To Dr Hayley Stannard, Eden Hermsen, Dr Jason Flesch, and

Associate Professor Ricky Spencer, your assistance in locating kangaroo road mortalities was extremely helpful. Thank you to Rory Barber and Megan Fabian for providing additional photographs of kangaroos used in this thesis.

I would like to thank the technical staff and security staff that helped me with access to the equipment and facilities required for my research. Thank you to

Emirates One and Only Wolgan Valley Resort for allowing me to conduct research on their site.

This research would not have been possible without the project funding supplied by the School of Science and Health at Western Sydney University. Thank you to Western Sydney University for the Australian Post Graduate Award, Top Up

Scholarship, and Completion Scholarship which provided financial support during my candidature.

To the friends I have made during my candidature, it has been so wonderful to have the insight and support of others taking a similar path and I want to wish you all the best in your future endeavours. To my scaly, feathered, and furry friends;

Legs, Tetris, Blotch, Zeus, Charlie, Elwood, Lucky, Woodstock and Coco, thank you for all the cuddles when the stress got too much.

I would like to thank my family for all the support, love and patience that has helped me get to the end of this journey. You all always showed interest in my project and tried to understand what it is about, and you always made sure I knew you were proud of me. I would like to thank my Mum Kym for inspiring me to work hard, to my Dad Rory for always encouraging me to question things, and to my brothers Matthew and Rhys for always believing in me. Thank you to my better half

Bradley Evans for holding my hand every step of the way. I couldn’t have done this without you.

STATEMENT OF AUTHENTICATION

The work presented in this thesis is, to the best of my knowledge and belief, original

except as acknowledged in the text. I hereby declare that I have not submitted this

material, either in full or in part, for a degree at this or any other institution.

… ……….. Jai Green-Barber

30th November 2017

Table of Contents List of tables ...... iv List of figures and illustrations ...... v Preface ...... vii Publications ...... viii Conference presentations ...... ix Scholarships and awards ...... x Executive summary ...... xi 1. Introduction ...... 2 1.1. Marsupials ...... 3 1.1.2. Eastern grey kangaroos ...... 5 1.2. Population structure ...... 8 1.2.1. Levels of social organisation ...... 8 1.2.2. Group formation ...... 11 1.2.3. Group membership ...... 12 1.2.4. Dispersal ...... 14 1.3. Behaviour ...... 15 1.3.1. Activity patterns ...... 15 1.3.2. Social interactions ...... 16 1.4. Management and monitoring ...... 19 1.4.1. Management issues and strategies ...... 19 1.4.2. Monitoring kangaroo populations ...... 23 1.5. Aims ...... 25 1.6. Thesis outline ...... 26 1.7. Chapter references ...... 27 2. Is camera trap videography suitable for assessing activity patterns in eastern grey kangaroos? ...... 37 2.1. Chapter outline and authorship ...... 38 2.2. Introduction ...... 40 2.3. Methods ...... 43 2.4. Results ...... 45 2.5. Discussion ...... 52 2.6. References ...... 60 3. Town roo, country roo: a comparison of behavior in eastern grey kangaroos (Macropus giganteus) in urban and pristine habitats...... 65 3.1. Chapter outline and authorship ...... 66 i

3.2. Introduction ...... 68 3.3. Methods ...... 69 3.4. Results ...... 72 3.4.1. Vegetation ...... 72 3.4.2. Time of day and temperature ...... 72 3.4.3. Season ...... 73 3.4.4. Group size and density ...... 73 3.4.5. Vigilance, feeding, travelling, resting, and self-grooming ...... 74 3.4.6. Interactions...... 74 3.5. Discussion ...... 74 3.6. References ...... 82 4. What influences road mortality rates of eastern grey kangaroos in a semi- rural area? ...... 105 4.1. Chapter outline and authorship ...... 106 4.2. Background ...... 109 4.3. Methods ...... 111 4.3.1. Study area ...... 111 4.3.2. Transects ...... 111 4.3.3. Animals ...... 112 4.3.4. Season, weather and moon cycle ...... 112 4.3.5. Road, roadside and barriers ...... 112 4.3.6. Habitat features ...... 113 4.3.7. Vehicle speed and street lights...... 113 4.3.8. Analysis ...... 114 4.4. Results ...... 115 4.4.1. Season, weather and moon cycle ...... 115 4.4.2. Effect of road and roadside width, and barrier type ...... 116 4.4.3. Effect of habitat ...... 117 4.4.3. Effect of vehicle speed and street lighting ...... 118 4.5. Discussion ...... 118 4.6. References ...... 126 5. The genetic relatedness of an urban population of eastern grey kangaroos. . 136 5.1. Chapter outline and authorship ...... 137 5.2. Introduction ...... 138 5.3. Methods ...... 141

5.3.1. Study site ...... 141 5.3.2. Sample Collection and DNA Extraction ...... 142 5.3.3. Microsatellites ...... 142 5.3.4. Genetic diversity indices ...... 143 5.3.5. Parentage and sibship analysis ...... 144 5.3.6. Spatial analysis ...... 144 5.4. Results ...... 145 5.4.1. Microsatellite marker properties and genetic diversity indices ...... 145 5.4.2. Relatedness ...... 147 5.4.3. Geographical distance and home range ...... 148 5.5. Discussion ...... 149 5.6. References ...... 153 6. Blood constituents of free-ranging eastern grey kangaroos (Macropus giganteus)...... 160 6.1. Chapter outline and authorship ...... 161 6.2. Introduction ...... 163 6.3. Materials and methods ...... 164 6.3.1. Study sites ...... 164 6.3.2. Animals ...... 165 6.3.3. Field procedures ...... 165 6.3.4. Haematology and blood chemistry ...... 166 6.3.5. Evaluation of antibacterial activity ...... 168 6.3.6. Acute phase protein assays ...... 169 6.4. Results ...... 170 6.4.1. Blood chemistry ...... 171 6.4.2. Haematology ...... 171 6.4.3. Antimicrobial assay ...... 173 6.4.4. Acute phase protein assays ...... 174 6.5. Discussion ...... 176 6.6. References ...... 183 7. Discussion, recommendations and future directions for eastern grey kangaroo management and research...... 191 7.1. General discussion and conclusion ...... 192 7.2. Future Directions ...... 197 7.3. Chapter references ...... 199 Appendices ...... 203 iii

A1. A suspected case of myopathy in a free-ranging eastern grey kangaroo (Macropus giganteus)...... 204 A2. Antimicrobial activity of red-tailed phascogale (Phascogale calura) serum.216

List of tables Table 1. 1. Levels of social organisation of eastern grey kangaroos ………………..9 Table 2. 1. Categories used to record the behaviour of kangaroos …………...…....45 Table 3. 1. The number of cameras placed in each vegetation area at each site …...85 Table 3. 2. Categories used to record the behaviour of kangaroos ………………...86 Table 5. 1. microsatellite primers used for relatedness analysis of eastern grey kangaroos…………………………………………………………………………..142 Table 5. 2. Genetic diversity estimates of 16 microsatellite loci used for kinship assignment of eastern grey kangaroos...... 147 Table 5. 3. Parentage assignment of three eastern grey kangaroo offspring at Hawkesbury Campus of Western Sydney University ...... 148 Table 6. 1. Postcapture heart rate, respiration rate, and body temperature of eastern grey kangaroos from two populations in New South Wales during winter and spring 2014 and 2015 ……………………………………………………………………..172 Table 6. 2. Blood chemistry values for eastern grey kangaroos from two populations in New South Wales during winter and spring 2014 and 2015...... 172 Table 6. 3. Haematology values for eastern grey kangaroos from two populations in New South Wales during winter and spring 2014 ...... 174 Table 6. 4. Mean concentration of haptoglobin in blood serum of selected mammals, including healthy and unhealthy (euthanised) eastern grey kangaroos ...... 175 Table 6. 5. Concentration of serum amyloid A in adult male (healthy and unhealthy/euthanised), adult female and subadult male eastern grey kangaroos..... 176

List of figures and illustrations Fig 1. 1. A phylogenetic tree showing the orders and families within the marsupial subclass, adapted from Cardillo et al. (2004)...... 5 Fig 1. 2. A map showing the distribution of the eastern grey kangaroo (Macropus giganteus) , adapted from Munny et al. (2008)...... 6 Fig 1. 3. The size difference between male and female eastern grey kangaroos...... 7 Fig 1. 4. A female eastern grey kangaroo grazing (Photo by Rory Barber 2016)...... 8 Fig 1. 5. A group of eastern grey kangaroos in an open grassland habitat ...... 9 Fig 1. 6. Eastern grey kangaroos grazing within close proximity of a wombat...... 17 Fig 1. 7. Fighting between two male eastern grey kangaroos...... 18 Fig 1. 8. Eastern grey kangaroos grazing close to a roadside (Photo by Megan Fabian 2016)...... 22 Fig. 2. 1. The proportion of time that eastern grey kangaroos spent on each activity over..24 h: (a) summer, (b) autumn, (c) winter, (d) spring...... 46 Fig. 2. 2. The percentage of occurrences where different group sizes were observed (a) across different seasons and (b) at different times of day...... 48 Fig. 2. 3. The percentage of occurrences where each type of interaction was observed...... 49 Fig. 2. 4. The percentage of occurrences where each type of interaction was observed (a) across different seasons and (b) at different times of day...... 50 Fig. 2. 5. The number of kangaroo reactions to camera recorded (a) during the months following deployment of the cameras, and (b) during different times of the day...... 51 Figure 3. 1. Map of camera locations at A-a developed site located at Yarramundi Paddocks at Hawkesbury campus of Western Sydney University, Richmond NSW, and B- a natural site located at Emirates One and Only Wolgan Valley Resort, Newnes, NSW ...... 88 Figure 3. 2. The percentage of time kangaroos spent in woodland, grassland, and fringe areas at developed and natural sites ...... 89 Figure 3. 3. The diurnal and nocturnal activity levels of kangaroos observed at a developed site and a natural site...... 90 Figure 3. 4. Activity levels of kangaroos at varying temperatures at a developed site and a natural site...... 91 Figure 3. 5. Activity levels of kangaroos across different seasons (A=summer, B=autumn, C=winter, D=spring) at a developed site and a natural site ...... 92 Figure 3. 6. The number of individuals in groups of kangaroos at a developed site and a natural site……………………………………………………………..……...93 Figure 3. 7. Percentage of time each behavior category was observed at a developed site and a natural site ...... 94 Figure 3. 8. Percentage of time each type of interaction was observed at a developed site and a natural site ...... 95 Figure 4. 1. Hawkesbury campus (WSU) and transects on Castlereagh and Londonderry Roads, Richmond, NSW (2016)……………………………………………………………………...……….130 Figure 4. 2. The odds of a road mortality occurring in relation to the minimum temperature and rainfall ...... 131

Figure 4. 3. The odds of a road mortality occurring in relation to the different moon phases ...... 132 Figure 4. 4. The frequency of roadkilled kangaroos recorded near different combinations of fencing on both sides of roads ...... 133 Figure 4. 5. The percentage of each habitat type where kangaroo road mortalities occurred (both sides of road) ...... 134 Figure 4. 6. The percentage of roadkilled eastern grey kangaroos recorded various distances from street lights ...... 135 Figure 5. 1. Map of the Hawkesbury campus of the Western Sydney University and surrounding roads and buildings………………………………………………………………...………….157 Figure 5. 2. Genetic relationships of eastern grey kangaroos at Hawkesbury Campus of Western Sydney University ...... 158 Figure 5. 3. Home ranges of two adult male kangaroos at the Hawkesbury campus of Western Sydney University ...... 159 Fig 6. 1. Data collection sites: (a) Hawkesbury Campus site, (b) Wolgan Valley site, and (c) the relative locations of the Hawkesbury Campus and Wolgan Valley sites in New South Wales……………………...………………………………………………………..168 Fig 6. 2. Kinetics of antibacterial activity of 25% diluted serum from Macropus giganteus against (a) Klebsiella pneumonia, (b) Escherichia coli, (c) Staphylococcus aureus, and (d) Pseudomonas aeruginosa...... 175

Preface

This thesis is presented as a series of manuscripts which explore the aspects of eastern grey kangaroo health, behaviour, and population dynamics. All work presented has been published, accepted for publication, or is currently under review.

An introductory literature review and a general conclusion are included at the beginning and end of the thesis to prove the continuity. The closely related nature of the topics results in some repetition in the introductions of some chapters. Formatting including fonts and referencing used in manuscripts varies according to the requirements of the journal. References for each manuscript are located at the end of each chapter. All the presented manuscripts are jointly authored, but in all cases I am the primary author. Two additional manuscripts can be found at the end of the thesis which have not been included as chapters, but were written and published during my

PhD.

vii

Publications

• Green-Barber JM, Stannard HJ, Old JM (2018).A suspected case of myopathy in a

free-ranging eastern grey kangaroo (Macropus giganteus), Australian Mammalogy.

vol. 40, no. 1, pp. 122-126

• Green-Barber JM, Ong OT, Kanuri A, Stannard HJ, Old JM (2018). Blood

constituents of free-ranging eastern grey kangaroos (Macropus giganteus),

Australian Mammalogy. In Press

• Green-Barber JM, Old Julie M (2018) Are camera traps suitable for assessing

activity patterns in eastern grey kangaroos? Pacific Conservation Biology, In Press

• Green-Barber JM, Old JM (2018). Town roo, country roo: a comparison of

behaviour in eastern grey kangaroos Macropus giganteus in developed and natural

landscapes, Australian Zoologist. In Press

• Green-Barber JM, Old JM (2018). What influences road mortality rates of eastern

grey kangaroos in a semi-rural area? BMC Ecology. Under Review

• Green-Barber JM, Old Julie M (2018) The genetic relatedness of an urban

population of eastern grey kangaroos. BMC Research Notes, Under Review

• Ong OT, Green-Barber JM, Kanuri A, Young LJ, Old JM (2017). Antimicrobial

activity of red-tailed phascogale (Phascogale calura) serum, Journal of Innate

Immunity. vol. 51, pp. 41-48

viii

Conference presentations

Green-Barber JM, Old JM “What influences road mortality rates of eastern grey kangaroos” Australasian Wildlife Association, Katoomba (2017)

Green-Barber JM, Old JM “What influences road mortality rates of eastern grey kangaroos” Graduate Research School HDR Showcase, Parramatta (2017)

Green-Barber JM, Old JM “Town roo, country roo: a comparison of behavior in eastern grey kangaroos (Macropus giganteus) in urban and pristine habitats” International Urban

Wildlife Conference, San Diego State University (2017)

Green-Barber JM, Old JM “Comparative health of two populations of eastern grey kangaroo in developed and undeveloped landscapes” Australasian Wildlife Association,

Brisbane (2014)

Scholarships and awards

Higher Degree Research Completion scholarship (Western Sydney University) 2017

International Urban Wildlife Conference travel grant (Urban Wildlife Working

Group of the Wildlife Society) 2017

Higher Degree Research Top Up Scholarship (Western Sydney University) 2013-

2016

Australian Postgraduate Award (Australian Government) 2013-2016

Executive summary

Eastern grey kangaroos (Macropus giganteus) are one of Australia’s most iconic species. An increase in watering sites and urban development have dramatically influenced the species range and abundance. Current knowledge of group structure, dispersal and behaviour of eastern grey kangaroos is limited.

Developing a better understanding of these topics is essential in creation of effective management strategies. The following thesis explores multiple aspects of behavioural ecology and health in free ranging eastern grey kangaroos. Motion detecting infra-red camera traps were used to assess activity patterns and social interactions, as well as the suitability of this tool for measuring behaviour in this species. Activity patterns were compared between a modified and natural site. The location of 23 road killed kangaroos was studied to evaluate what influences road mortality. DNA extracted from tissue and blood samples were used to conduct microsatellite analysis and investigate genetic structure of the population. Baseline haematology, blood chemistry, and acute phase protein parameters were examined for eight kangaroos including three adult males, three adult females and two subadult males to assess health.

The aim of the research was to expand the existing knowledge of the behaviour, social organisation, population dynamics and health of eastern grey kangaroos to assist in developing more informed and effective management strategies for this species. Research was conducted at two sites in NSW, Yarramundi paddocks at the Hawkesbury campus of WSU, Richmond, NSW; an active farmland site fragmented by an urban environment consisting of 308 ha of pasture, grassland, marshes and open woodland, and the Emirates One and Only Wolgan Valley Resort,

Newnes, NSW; a largely undeveloped area and conservation reserve at an eco-resort situated on 1619 ha of grasslands, woodland and riparian areas surrounded by the sandstone cliffs of World Heritage listed National Parks.

Camera trap data was consistent with activity patterns of eastern grey kangaroos observed on foot in previous studies. The behaviour of kangaroos appeared to be influenced by the presence of cameras, however no kangaroos retreated from cameras and all appeared to become habituated to cameras after eight months. The findings suggest that camera traps are suitable for assessing the diurnal activity of kangaroos, however nocturnal activity appeared to be underrepresented.

Observations of unusual fighting behaviour illustrates the potential for camera traps to enable capture of novel observations.

Comparison of camera trap data showed that kangaroos at the modified site had a higher density, spent more time in larger groups, and had an earlier peak activity time than those at the natural site. More vigilance (standing still and scanning for threats) and less feeding were observed at the modified site. The higher population density at the modified site is likely to be a result of increased resources and restricted dispersal. The earlier peak activity time observed at the modified site may be in response to artificial lighting. Increased vigilance may be due human presence, and visual barriers in modified landscapes that reduce the line of sight.

Reduced feeding time is probably a result of the higher nutritional content of pasture grasses at the modified site.

Assessment of factors that influence kangaroo road mortality at the modified site demonstrated that more mortalities occurred during periods of low temperature and low rainfall, and during the waning gibbous phase of the lunar cycle. Periods of

xii

low temperature and low rainfall reduce forage quality, causing kangaroos to travel further to find high quality vegetation. High moon illumination provides increased visibility and allows for greater mobility of kangaroos. Significantly more road mortalities occurred a short distance from the end of a section of street lights. Gaps in roadside lighting are likely to reduce motorists’ ability to visually detect animals on roads while their eyes adjust to different lighting levels.

Investigation of the genetic structure within the population indicated one pair of kangaroos were full siblings, and a high proportion were identified as half siblings. Six positive parentage assignments were detected. The locus used for microsatellite analysis were polymorphic and highly informative for use in the study population. No genetic spatial autocorrelation was detected.

Examination of health parameters of free-ranging eastern grey kangaroos found preliminary differences in both the haematological and blood chemistry values of kangaroos of different ages and genders. The kangaroo serum had a strong antibacterial response to Klebsiella pneumoniae, and moderate responses to

Escherichia coli and Staphylococcus aureus. Haptoglobin and serum amyloid A were present in kangaroo serum, but only haptoglobin was elevated in a kangaroo with necrotic wounds.

Results confirm that camera traps are suitable for assessing the diurnal activity of eastern grey kangaroos and should be incorporated in into future studies to reduce observer effect and costs, thus enabling effective long term monitoring. The expanded knowledge of the factors found to increase kangaroo road mortality enable more effective road design planning and wildlife management strategies such as targeted wildlife crossing structures and warning signs. Understanding of the genetic

xiii

structure and dispersal patterns occurring within these free-ranging populations, and their health, will assist in effective population monitoring, which is necessary for the successful management of kangaroo populations in increasingly developed landscapes. Overall, the information gained from this research is essential for developing effective management practices for high density kangaroo populations in developed areas, which is necessary as a result of the increasing development and habitat fragmentation across Australia.

xiv

CHAPTER 1

1. Introduction

1.1. Marsupials

Marsupials (metatherians) are a subclass of mammal that occupies

Australasia and the Americas, but once occurred across all continents (Tyndale-

Biscoe 2005; Wooding & Burton 2008). Marsupials and eutherian mammals diverged approximately 147.7 million years ago, and Australasian marsupials diverged from American marsupials over 60 million years ago (Bininda-Emonds et al. 2007; Black et al. 2012). Australian and American marsupials are believed to have evolved independently and are treated as taxonomically distinct groups by many researchers (Hunsaker 2012).

Marsupials are anatomically unique in many ways, such as having a lower body temperature and metabolic rate compared to eutherians (Tyndale-Biscoe 2005).

Marsupials also have fewer chromosomes that are larger than eutherian chromosomes (Deakin 2018). These larger chromosomes are believed to have resulted from chromosomes fusing together forming larger chromosomes when marsupials diverged from eutherians (Deakin 2018). The reproductive biology of marsupials is particularly distinctive and separates them from eutherian (‘placental’ mammals) and prototherian (monotremes) subclasses (Wooding & Burton 2008).

Female marsupials possess two vaginae, uteri and oviducts, and give birth to relatively undeveloped young after a short gestation (Tyndale-Biscoe 2005). The newborn young have well developed forelimbs to allow them to crawl to the mother’s teat which is located inside a pouch in most species (Edwards & Deakin

2013; Van Dyck & Strahan 2008). The majority of development occurs during the lactation period (Edwards & Deakin 2013). Despite these developmental differences, the brain structure of marsupials is remarkably similar to eutherians and grows to be

as large, or sometimes larger than eutherians of a comparable body size (Weisbecker

& Goswami 2010).

There are seven extant orders of marsupial (Fig. 1.1) (Cardillo et al. 2004).

Divergence within Australian marsupials occurred in the mid to late Cenozoic period, resulting in four extant orders and the evolution of specialised adaptations that allowed emerging species to utilise varied habitats and diets in the Australian environment (Black et al. 2012; Meredith et al. 2008). The order Diprotodontia originating in the Tertiary period, is the most diverse order of Australian marsupials, and one of the largest families of all large terrestrial herbivorous mammals (Jarman

& Coulson 1989; Meredith et al. 2008). Species within this order being primarily herbivores are characterised by the presence of two forward pointing lower incisors

(Phillips & Pratt 2008). Diprotodontia contains ten families, accounts for approximately 40% of all extant marsupial species and includes the suborders

Vombatiformes (wombats and koalas), Phalangeriformes (possums and gliders), and

Macropodiformes (kangaroos, wallabies, bettongs and potoroos) (Meredith et al.

2008; Phillips & Pratt 2008). The predominantly grazing species in the

Macropodidae diverged from Potoroidae 14–17 Ma later than the majority of divergences within Diprotodontia (Meredith et al. 2008). Macropod species vary in size but most possess enlarged hind legs and a powerful tail that allows fast paced bipedal locomotion (Jackson & Vernes 2010).

Fig 1. 1. A phylogenetic tree showing the orders and families within the marsupial subclass, adapted from Cardillo et al. (2004). Australian subclasses = dashed outline

1.1.2. Eastern grey kangaroos

Eastern grey kangaroos (Macropus giganteus) are found in the eastern states of mainland Australia (Fig. 1.2). Increased watering sites over the last 30-40 years has led to the species dramatically expanding its range (Richardson 2012). They inhabit woodlands, sclerophyll forests, shrublands and heathlands, and their diet consists primarily of grasses, ferns, and shrubs (Richardson 2012). Agricultural lands

are often utilised by eastern grey kangaroos for grazing, with favoured grazing areas regularly shared with other macropods (Richardson 2012).

Fig 1. 2. A map showing the distribution of the eastern grey kangaroo (Macropus giganteus) , adapted from Munny et al. (2008).

Eastern grey kangaroos are sexually dimorphic (Richardson 2012). Males can grow up to 230 cm and weigh between 70-90 kg (Richardson 2012), which makes them one of the largest macropod species (Kaufmann 1975). The much smaller females (Fig. 1.3) grow up to 180 cm and weigh approximately 35 kg (Richardson

2012).

Male

Female

Fig 1. 3. The size difference between male and female eastern grey kangaroos.

In the wild, females reach sexual maturity at 18-24 months, and males at 30-

36 months, whilst captive eastern grey kangaroos reach sexual maturity slightly earlier than their wild counterparts (Richardson 2012). The oestrus cycle of eastern grey kangaroos lasts approximately 46 days (Richardson 2012). Gestation lasts around 35-36 days (Richardson 2012) and the average inter-birth interval is 373 days

(Poiani et al. 2002). The joey, which is born furless and blind, and weighing approx.

0.8 g, climbs into its mother’s pouch and attaches to the teat (Poole 1982; Russell

1984).

Eastern grey kangaroos perform several important ecological functions. Their selective grazing (Fig. 1.4) modifies habitats, and influences the presence of invertebrates and other vertebrates such as grassland birds by maintaining shorter

grasses (Neave & Tanton 1989). The browsing of native tree seedlings by kangaroos prevents woodland encroachment into grassland habitats (Webb 2001). Kangaroos also provide a food resource for predators, including dingoes (Canis lupus),

European red foxes (Vulpes vulpes), and wedge-tailed eagles (Aquila audax)

(Robertshaw & Harden 1989).

Fig 1. 4. A female eastern grey kangaroo grazing (Photo by Rory Barber 2016).

1.2. Population structure

1.2.1. Levels of social organisation

Eastern grey kangaroos are considered one of the most gregarious macropod species (Southwell 1984a). Individuals are more frequently observed in the company

of others, than as a solitary individual across different habitats, densities, and seasons

(Fig. 1.5) (Southwell 1984a).

Fig 1. 5. A group of eastern grey kangaroos in an open grassland habitat

Eastern grey kangaroo populations are broken into sub-populations known as mobs (Table 1.1) which are comprised of long term associates with overlapping home ranges (Jarman & Coulson 1989). Mobs consist of multiple open membership groups that vary in size and composition, which continually change as individuals regularly join and leave groups (Jarman & Coulson 1989).

Table 1. 1. Levels of social organisation of eastern grey kangaroos

POPULATION MOB

All individuals within a region Long term associates who share overlapping home ranges

GROUP SUB-GROUP

Individuals in close proximity individuals that interact more frequently

A group refers to the immediate proximity of and interaction between a number of individuals (Jarman & Coulson 1989), however different studies often use varying definitions of ‘group’. Many macropod studies define a group using a distance from nearest neighbour criteria, which vary between 15-69 m (Caughley

1964b; Jarman 1987), while others have used behavioural criteria such as visual communication between individuals (Colagross & Cockburn 1993; Southwell 1981).

Behavioural criteria creates a distinction between a ‘group’ and an ‘aggregation’, which is when individuals gather to exploit a resource (Jarman & Coulson 1989). A combination of distance and behavioural criteria were used to define a ‘group’ within this thesis based on the definition used by Jarman and Coulson (1989); individuals in significantly closer proximity to one another than to other individuals in the population, and are close enough to be able to interact with each other.

Smaller sub-groups have been included in some studies as an additional level of social organisation within groups and is defined as individuals that interact more frequently with one another than with the rest of the group and whose relationships persist over a longer period of time (Jarman & Coulson 1989).

1.2.2. Group formation

Early studies concluded that eastern grey kangaroos tend to form mixed sex groups which are continually changing in composition, have no particular social organisation, do not have permanent associations between individuals, and do not defend territory against intruders (Caughley 1964b; Kirkpatrick 1966).

The size of groups varies most commonly between 1-15 individuals and contains an average of three individuals (Caughley 1964b; Kaufmann 1975; Taylor

1982). Lone males and females occur in approximately equal numbers, however lone males may account for a higher proportion of total males since sex ratios biased towards females have been reported in some populations (Jarman & Southwell 1986;

Kaufmann 1975). Large males have frequently been observed alone which may be the result of moving between groups to check the reproductive state of females

(Southwell 1984b). Females with young at foot have also been frequently observed alone, however, females with pouch young or no young, and smaller males are more often observed in groups (Southwell 1984b). Individuals do not appear to prefer or avoid groups containing either gender (Southwell 1984b).

Group composition is therefore not fixed as individuals are frequently joining and leaving (Southwell 1984b).

There is a positive relationship between the rate of groups joining and population density, but not group size, indicating that group formation in the eastern

grey kangaroo is caused by random meetings (Southwell 1984b). The rate of groups splitting have been found to be related to population density and group size, indicating that splitting may be influenced by both internal and external factors

(Southwell 1984b). Large groups may split to form smaller ones so it is easier to coordinate movements, and individuals may be more inclined to leave a group when population density is high because neighbouring groups are closer by, whereas in low density populations, there is a greater risk of not finding another group to join

(Southwell 1984b).

1.2.3. Group membership

Caughley (1964b) and Kirkpatrick (1966) both concluded that groups are formed by random joining of individuals and smaller groups during feeding activities, and neither found evidence of permanent group organisation (Kaufmann

1975). The suggestion that group size was a result of a random process has been contradicted in many studies (Jaremovic & Croft 1991a; Kaufmann 1975; Southwell

1984b). Kaufmann (1975) suggests that if individuals are recognisable in studies, then long term associations between individuals could be evaluated. The studies by

Caughley (1964b) and Kirkpatrick (1966) did not identify individuals and therefore are not able to detect any patterns in associations (Kaufmann 1975). Previous studies on grouping in eastern grey kangaroos have measured group size but have not examined changes in group membership (Bell 1973; Grant 1973; Kaufmann 1975;

Kirkpatrick 1966).

If eastern grey kangaroo group formation was essentially random, then it would be expected that; 1) groups are open membership and individuals are free of constraint in joining or leaving groups, and 2) only random associations would exist

between individuals in these groups (Coulson 2009). Eastern grey kangaroos do form open membership groups which constantly change in size and composition from a fission-fusion dynamic (Jarman & Coulson 1989; MacFarlane 2006; Southwell

1984b). Individuals are free to leave and join groups, as this species do not form harems or defend territories (Kaufmann 1975). Males occasionally fight to establish dominance, although the fights are more ceremonial than actually damaging

(Coulson 1997; Croft & Snaith 1990).

Some associations between individuals are not random (Coulson 2009).

Individuals are more likely to interact with members of their own mob than with members of other mobs, and some evidence of recognition and positive association between individuals has been reported (Grant 1973). Non-random associations have been reported in many studies conducted at the population class level using categories based on gender, age, and reproductive status (Jaremovic & Croft 1991a;

Jarman 1994; Jarman & Southwell 1986; McCullough & McCullough 2000;

Southwell 1984b). Studies that have identified individuals such as Arnold et al.

(1990), Jaremovic and Croft (1991b), and Jarman (1994) have reported non-random associations between individuals. Jaremovic and Croft (1991b) found that a pair of adult females had almost a complete spatial overlap and frequently associated with each other, while only occasionally associating with other females in the area. The genetic relationships of individuals was unknown in the studies by Arnold et al.

(1990) and Jaremovic and Croft (1991b), however they were known in the study by

Jarman (1994) which found that females most frequently associated with females they were related to, as well as other females in the same reproductive state (Coulson

2009).

The suggestion that group size is a result of individuals randomly leaving and joining groups does not take into account non-random associations such as mother and young (Southwell 1984b). Group formation also may be influenced by males maintaining a close proximity with females in or nearing oestrus, which suggests that group formation is not an entirely random process (Southwell 1984b). Aside from a gregarious nature and non-random reproductive associations, group formation appears to be very flexible (Southwell 1984b).

1.2.4. Dispersal

Caughley (1964a) reported that eastern grey kangaroos disperse randomly and do not appear to hold territories. Southwell (1984a) found that individuals were more dispersed in tall shrubland habitats than in open forest habitats. The difference in dispersion between habitats may be explained by differences in vegetation structure, food availability, and reproductive activity (Southwell 1984a). Dense vegetation in tall shrubland habitats may create physical and visual barriers which result in the population being more widespread than in open forest habitats

(Southwell 1984a). Animals grazing in areas where food is not abundant, such as tall shrubland habitats, are less able to remain in a unified group because individuals are forced to move further apart to find resources (Southwell 1984a). Reproductive associations appear to occur more commonly in open forest habitats than in tall shrubland habitats, as these associations require a close although temporary proximity, it may explain the difference in spatial dispersion (Southwell 1984a).

Caughley (1964a) used aerial photographs to measure vertical canopy cover, and observed the distance of cover from head height of kangaroos to measure horizontal cover (Coulson 2009). No relationship was found between density and

canopy cover, however areas with thicker horizontal cover were found to have a greater density of kangaroos (Coulson 2009). Eastern grey kangaroos appear to prefer habitat with a combination of patches of cover and open grassy areas for grazing (Caughley 1964a; Coulson 2009). The relationship between cover and food has been demonstrated at several scales, including landscape (Hill 1981a; Mcalpine et al. 1999), population (Hill 1981b; Southwell, C 1987; Taylor 1980), and individual home range (Moore, Coulson & Way 2002; Viggers & Hearn 2005).

Natal dispersal fundamentally influences the genetic structure of wildlife populations (King, Garant & Festa‐Bianchet 2015). Sex based dispersal spatially separates opposite sexed kin, therefore reducing inbreeding (Blyton, Banks &

Peakall 2015). Male kangaroos commonly disperse from their mothers (King, Garant

& Festa‐Bianchet 2015), whereas female kangaroos are highly philopatric and exhibit preferential behaviour towards kin (Best et al. 2013). Environmental factors such as food availability and physical barriers in the landscape may limit dispersal and therefore affect genetics within a population (Southwell 1984a).

1.3. Behaviour

1.3.1. Activity patterns

The activity patterns of kangaroos within a 24 hour period were first quantified by Caughley (1964b) by recording the number of kangaroos either lying down, or participating in an activity such as foraging (Coulson 2009). Eastern grey kangaroos are mostly active at night, and very early or late in the day (Kaufmann

1975). Their activity gradually decreases between dawn and midday when a majority of the time is spent lying in the shade, and rarely leaving areas of greater plant cover during this time (Caughley 1964b). Activity increases towards sunset and most

activity, including grazing, occurs at night when they will venture into grassy open areas to forage (Caughley 1964b). It is important to note that Caughley's (1964) studies occurred when all grey kangaroos were considered one species (M. canguru) before Kirsch and Poole (1972) identified the eastern grey kangaroo (M. giganteus), and the western grey kangaroo (M. fuliginosus) as separate species. As a result, it is impossible to know which behaviours observed during this study are characteristic of either species of grey kangaroo, as both species were distributed in the study area and the data treats them as one species.

The study by Caughley (1964b) did not account for photoperiod or restless behaviour (eg. posture changes) (Coulson 2009). High levels of nocturnal activity have been observed in kangaroos in many studies, most of which concluded that season and photoperiod were influencing factors (Coulson 2009).

1.3.2. Social interactions

Observations of eastern grey kangaroos revealed that individuals are tolerant of other individuals in a population across all ages and genders, as well as other macropod and herbivore species (Fig. 1.6) (Kaufmann 1975). Individuals will regularly graze and rest in close proximity to others without directly interacting with them (Kaufmann 1975). Adult males have been regularly seen feeding in close proximity to one another (Kaufmann 1975). Physical interactions between individuals does also occur, such as touching noses, or sniffing each other’s head and shoulders when one individual approaches another, possibly as a sort of greeting

(Kaufmann 1975).

Fig 1. 6. Eastern grey kangaroos grazing within close proximity of a wombat.

Social grooming is rare in macropods and generally only occurs during mother-young interactions, mating interactions, and occasionally during agonistic interactions between males (Kaufmann 1974; Kitchener 1970; LaFollette 1971;

Russell 1970). In contrast, a study by Grant (1973) found that social grooming was common between two pairs of captive adult female eastern grey kangaroos.

Adult females have been observed hitting or shoving other adult females, or sub-adults who come close, and adult females, and sub-adults have also been observed grabbing or hitting juveniles who come close (Kaufmann 1975). It is possible that some aggressive behaviour observed is a result of nervous reactions

(Kaufmann 1975). Evidence of territorial behaviour such as chasing away members of another mob from a favoured grazing area has been reported by Grant (1973).

Ritualised fighting between adult male kangaroos is a familiar sight for most

Australians (Fig. 1.7) (Kaufmann 1975). Kaufmann (1975) suggested that eastern

grey kangaroos are likely to have a subtle dominance hierarchy within mobs, particularly among males.

Fig 1. 7. Fighting between two male eastern grey kangaroos.

The social interactions between eastern grey kangaroos predominantly relate to reproduction, including inspection of females’ reproductive state by males, mating, agonistic interactions between males over access to a female, and affinitive interactions between mother and young (Southwell 1984a). Oestrus in eastern grey kangaroos lasts only a few hours and occurs throughout the year (Kaufmann 1975), so males will regularly check females for signs of oestrus by sniffing the female’s cloaca (Kaufmann 1975). Courting of anoestrous females has been commonly observed in this species, including gently pawing each other’s head, neck and paws

(Kaufmann 1975).

Males do not maintain permanent associations with particular females and will attempt to mate with any female in oestrus (Kaufmann 1975). Even though there are no permanent mate pairings, there is an overall persistent association between

males and females within the same mob (Kaufmann 1975), but no evidence to suggests this species forms harems (Southwell 1984b).

Eastern grey kangaroos, like many macropod species, exhibit certain quiet vocalisations and postures during courting (Kaufmann 1975). Loud mating calls, such as those characteristic of other mammalian species including koalas

(Phascolarctos cinereus) (Ellis et al. 2015), greater sac-winged bats (Saccopteryx bilineata) (Voigt et al. 2008), and red deer (Cervus elaphus) (Charlton et al. 2014), do not occur in eastern grey kangaroos as they are unnecessary for populations that do not segregate on the basis of gender (Kaufmann 1975).

1.4. Management and monitoring

1.4.1. Management issues and strategies

Resources such as water and managed vegetation have increased since

European settlement, resulting in an increased distribution and abundance of eastern kangaroos (Coulson, Cripps & Wilson 2014; Richardson 2012). Kangaroos are abundant in peri-urban areas and utilise managed vegetation such as agricultural spaces (Coulson et al. 1999). Small eastern grey kangaroo populations can rapidly increase over the span of a decade, and barriers such as fencing restrict the dispersal of these populations, thus leading to high population densities (Adderton Herbert

2004; Coulson 1998, 2001; Southwell 1984a). Increasing urban development in

NSW will lead to increased barriers in the landscape and is therefore likely to restrict dispersal and increase the density of kangaroo populations.

The impacts of urban development on the health and welfare of kangaroo populations are an important consideration for management planning for this species.

Eastern grey kangaroos are susceptible to a range of diseases including bacterial

infections (Gordon & Cowling 2003; Roberts et al. 2010), viruses (Wilcox et al.

2011), and parasites (Jackson 2003), and disease transmission is frequent within kangaroo populations due to their large, high-density, and open- membership groups that lead to close proximity and frequent interaction between a range of individuals

(Cripps, Martin & Coulson 2016). Disease is particularly prevalent in urban kangaroo populations that experience increased transmission rates (Cripps, Martin &

Coulson 2016). Increased stress from the presence of noise and light generated by human activity has been shown to affect the behaviour, feeding rates, and reproductive success of wild animals (Newport, Shorthouse & Manning 2014).

Monitoring the health of kangaroo populations is limited by the lack of available baseline haematology and blood chemistry parameters for healthy free-ranging eastern grey kangaroos.

It is necessary to have detailed health parameters for free-ranging eastern grey kangaroos when assessing health in free ranging populations. Health parameters for other macropods have been found to differ between free-ranging and captive populations (Robert & Schwanz 2013), and is also likely the case for eastern grey kangaroos due to differences in food composition and availability, as well as other environmental factors that are controlled in captive settings. Health parameters for specific demographics within kangaroo populations are useful because variation is likely to exist between kangaroos of different ages, genders and reproductive states as variation exists in other macropod species (Barnes, Goldizen & Coleman 2008;

McKenzie, Deane & Burnett 2002; Takenaka et al. 1988).

Typical health assessments include body condition scores, and haematology and blood chemistry parameters. Scores of body condition are used to assess the nutritional state of an animal while accounting for its structural size, have been

published for eastern grey kangaroos, and are routinely used to assess health in this species (Miller et al. 2010). While body condition score indices exist for free-ranging eastern grey kangaroos, only limited haematological data for eastern grey kangaroos has been published (Presidente 1978), and haematology and blood chemistry values have been published for only a single kangaroo infected with gamma-herpes virus

(Wilcox et al. 2011). A lack of detailed health parameters for free-ranging eastern grey kangaroos, and hence adequate health monitoring, likely limits the effectiveness of management strategies.

The overabundance of kangaroos results in multiple economical and environmental human-wildlife conflicts, as well as animal welfare issues. Economic issues caused by kangaroos include agricultural loss through crop grazing and competition with livestock, as well as the insurance and medical costs associated with kangaroo-induced vehicle collisions (Coulson et al. 2014; Descovich et al.

2016). Environmental issues relating to increasing kangaroo populations include soil erosion, disruption of balance between plant and animal abundance, and loss of ecological biodiversity through selective grazing (Cheal 1986; Neave & Tanton

1989). Kangaroos in overabundant populations often experience reduced body condition and reproductive success (Coulson 2009).

As Australia’s largest terrestrial mammal, kangaroos are involved in a large proportion of wildlife-vehicle collisions. These collisions cause over 9 million macropod fatalities each year and result in costly vehicle damage, human injury and death (Barthelmess & Brooks 2010; Burgin & Brainwood 2008; Klöcker, Croft &

Ramp 2006). Wildlife vehicle collisions are influenced by landscape features near the road (Fig. 1.8) (Bashore, Tzilkowski & Bellis 1985; Hubbard, Danielson &

Schmitz 2000). Features such as high quality vegetation near roadsides increase the

incidence of wildlife road mortality and have been evaluated across multiple species but no species specific studies have evaluated the influence of landscape on kangaroo road mortality in temperate regions or peri-urban areas.

Fig 1. 8. Eastern grey kangaroos grazing close to a roadside (Photo by Megan Fabian 2016).

Management of kangaroo populations can be a controversial topic as they are an iconic Australian species that are important for cultural identity and tourism, yet are also considered a pest species (Pople & Grigg 1999). Overabundant kangaroo populations have caused similar management issues to those caused by deer in North

America and Europe (Côté et al. 2004; Porter 1992). Deer population density has been successfully reduced through culling, however approximately three million macropods are culled per year for commercial and non-commercial purposes, and

there is conflicting evidence for its effectiveness on long term kangaroo population density (Coulson 2009).

Descovich et al. (2016) argues that many non-lethal methods of kangaroo management exist and could be used in place of or in conjunction with culling.

Contraceptive implants and surgical sterilisation have both been used to successfully supress kangaroo populations, however the method involves the capture and handling of animals that have animal welfare implications (Descovich et al. 2015; Tribe et al.

2014). Translocation is commonly used in the management of vulnerable species but is not generally considered appropriate for abundant species such as eastern grey kangaroos (Clayton et al. 2014; Higginbottom & Page 2010). Deterrents have been used to reduce kangaroo abundance in specific areas. Auditory deterrents have been found to be ineffective in reducing kangaroo abundance, however predator faecal odour repellents have been found to be highly effective in preventing crop grazing by eastern grey kangaroos (Bender 2003; Cox et al. 2015).

1.4.2. Monitoring kangaroo populations

Monitoring changes in density, behaviour and habitat use is essential for effective management of wildlife populations. Kangaroos can be monitored using multiple methods including on foot observation, tracking collars, and camera traps

(Coulombe, Massé & Côté 2006; Rowcliffe et al. 2014). On foot observations of kangaroos have been used to assess population size and activity patterns (Caughley

1964b; Coulson 1990; Southwell, Colin. 1987). Detection is possible from a distance as kangaroos are a relatively large species, however it is still important to minimise human disturbance or contact when monitoring an animal’s movements (Mech &

Barber 2002).

There are practical limitations to following animals on foot for extended periods of time. Tracking collars can be fitted to animals for data collection on their movement by recording location fixes at predetermined intervals (Matthews et al.

2013). This type of data can provide insight into the area travelled by the individual, and the amount of time spent in different locations (Matthews et al. 2013), as well as assessing home range and habitat use (Jaremovic & Croft 1987; Moore, Coulson &

Way 2002). While monitoring animals using tracking collars reduces human influence during the tracking period, collaring free-ranging kangaroos requires invasive procedures including chemical restraint and handling when fitting the collars.

Non-invasive monitoring methods like infra-red camera traps can be used to remotely monitor wildlife (Meek, Ballard & Fleming 2015). Infrared sensors detect rapid changes in surface temperature caused by movement, which triggers the camera to capture an image or video (Welbourne et al. 2016).The use of camera traps reduces any observer effects by eliminating human presence, making them useful for studying species sensitive to human activity, and their use is now common in conservation research (Meek et al. 2014; Trolliet et al. 2014). . Camera traps can be used to collect data on multiple individuals in a specific area, 24 hours per day, seven days per week, which cannot be achieved by other methods, and have been used to assess presence, abundance and habitat use of numerous Australian mammal species

(Meek et al. 2015; Old, Hunter & Wolfenden 2018). Larger species such as kangaroos are ideal candidates for camera trap monitoring because they are more easily detected by infra-red sensors (Rowcliffe et al. 2014). There are many advantages to using camera traps, including reduced disturbance to animals, and the ability to collect data during inclement weather without posing any safety risks to

researchers (Meek et al. 2014). Specialised tracking collars can also be used to remotely monitor wildlife, however this method provides less context and detail than images or videos and can only document movement and posture (Coulombe, Massé

& Côté 2006). Collaring wild kangaroos is also more invasive than camera traps because it requires chemical restraint and handling.

1.5. Aims

In Australia, kangaroos are the largest terrestrial mammal species and generate many species management issues. Understanding the health parameters and behaviour of eastern grey kangaroos is key to the effective management of the species. The work within this thesis explores the health and behavioural ecology of free-ranging eastern grey kangaroos at two sites in NSW, Australia. One site was located in Richmond, Western Sydney NSW, and the other located in the Wolgan

Valley, in central west NSW. The Wolgan Valley is surrounded by natural wilderness and was used as a comparison site to the Richmond study site which is located in an urban area. The research aims to explore aspects of health, behaviour, and management in free-ranging eastern grey kangaroos, including;

1. Monitoring

2. Activity in urban and natural environments

3. Patterns in road mortality

4. Population genetics

5. Health parameters

1.6. Thesis outline

The thesis is separated into seven chapters (including introduction and a discussion). Five of the following chapters are written as publications, and differ in format according to the journal they were submitted to. The following six chapters aimed at:

Chapter 2: Evaluating whether camera traps are suitable for measuring activity patterns in eastern grey kangaroos

Chapter 3: Examining how the behaviour of eastern grey kangaroos differs between areas surrounded by anthropogenic development in comparison to areas surrounded by natural wilderness

Chapter 4: Exploring the spatial and temporal influences of road mortality of eastern grey kangaroos in an urban environment

Chapter 5: Identifying the genetic relationships present in a free-ranging population of eastern grey kangaroos in an urban area

Chapter 6: Investigating the health of eastern grey kangaroos, specifically determine baseline blood chemistry and haematology levels, verify the presence and levels of APPs, and examine the antibacterial response of serum in free-ranging eastern grey kangaroos.

Chapter 7: Discusses the results from the previous chapters, draws conclusions and discusses recommendations and future directions for eastern grey kangaroo research and management.

1.7. Chapter references

Adderton Herbert, C 2004, 'Long-acting contraceptives: a new tool to manage overabundant kangaroo populations in nature reserves and urban areas', Australian Mammalogy, vol. 26, no. 1, pp. 67-74.

Arnold, GW, Steven, DE & Grassia, A 1990, 'Associations between individuals and classes in groups of different size in a population of western gray kangaroos, Macropus fuliginosus', Wildlife Research, vol. 17, no. 6, pp. 551-62.

Barnes, TS, Goldizen, AW & Coleman, GT 2008, 'Hematology and serum biochemistry of the brush-tailed rock-wallaby (Petrogale penicillata)', Journal of Wildlife Diseases, vol. 44, no. 2, pp. 295-303.

Barthelmess, EL & Brooks, MS 2010, 'The influence of body-size and diet on road-kill trends in mammals', Biodiversity and Conservation, vol. 19, no. 6, pp. 1611-29.

Bashore, TL, Tzilkowski, WM & Bellis, ED 1985, 'Analysis of deer-vehicle collision sites in Pennsylvania', Journal of Wildlife Management, vol. 49, no. 3, pp. 769-74.

Bell, HM 1973, 'The ecology of three macropod marsupial species in an area of open forest and savannah woodland in north Queensland, Australia', Mammalia, vol. 37, no. 4, p. 527.

Bender, H 2003, 'Deterrence of kangaroos from agricultural areas using ultrasonic frequencies: efficacy of a commercial device', Wildlife Society Bulletin, pp. 1037-46.

Best, EC, Seddon, JM, Dwyer, RG & Goldizen, AW 2013, 'Social preference influences female community structure in a population of wild eastern grey kangaroos', Animal Behaviour, vol. 86, no. 5, pp. 1031-40.

Bininda-Emonds, OR, Cardillo, M, Jones, KE, MacPhee, RD, Beck, RM, Grenyer, R, Price, SA, Vos, RA, Gittleman, JL & Purvis, A 2007, 'The delayed rise of present-day mammals', Nature, vol. 446, no. 7135, p. 507.

Black, KH, Archer, M, Hand, SJ & Godthelp, H 2012, 'The rise of Australian marsupials: a synopsis of biostratigraphic, phylogenetic, palaeoecologic and palaeobiogeographic understanding', in Earth and life, Springer, pp. 983-1078.

Blyton, MD, Banks, SC & Peakall, R 2015, 'The effect of sex‐biased dispersal on opposite‐ sexed spatial genetic structure and inbreeding risk', Molecular Ecology, vol. 24, no. 8, pp. 1681-95.

Burgin, S & Brainwood, M 2008, 'Comparison of road kills in peri-urban and regional areas of New South Wales (Australia) and factors influencing deaths', Too Close for Comfort:

contentious issues in human-wildlife encounters, ed by D. Lunney, A. Munn and W. Meikle. Royal Zoological Society of New South Wales, Mosman, pp. 137-44.

Cardillo, M, Bininda-Emonds, OR, Boakes, E & Purvis, A 2004, 'A species-level phylogenetic supertree of marsupials', Journal of Zoology, vol. 264, no. 1, pp. 11-31.

Caughley, G 1964a, 'Density and dispersion of two species of kangaroo in relation to habitat', Australian Journal of Zoology, vol. 12, no. 2, pp. 238-49.

Caughley, G 1964b, 'Social organization and daily activity of the red kangaroo and the grey kangaroo', Journal of Mammalogy, vol. 45, no. 3, pp. 429-36.

Charlton, BD, Wyman, MT, Locatelli, Y, Fitch, WT & Reby, D 2014, 'Do red deer hinds prefer stags that produce harsh roars in mate choice contexts?', Journal of Zoology, vol. 293, no. 1, pp. 57-62.

Cheal, D 1986, 'A park with a kangaroo problem', Oryx, vol. 20, no. 02, pp. 95-9.

Clarke, JL, Jones, ME & Jarman, PJ 1995, 'Diurnal and nocturnal grouping and foraging behaviors of free-ranging eastern grey kangaroos', Australian Journal of Zoology, vol. 43, no. 5, pp. 519-29.

Clayton, JA, Pavey, CR, Vernes, K & Tighe, M 2014, 'Review and analysis of Australian macropod translocations 1969–2006', Mammal Review, vol. 44, no. 2, pp. 109-23.

Colagross, AML & Cockburn, A 1993, 'Vigilance and grouping in the eastern gray kangaroo, Macropus giganteus', Australian Journal of Zoology, vol. 41, no. 4, pp. 325-34.

Côté, SD, Rooney, TP, Tremblay, J-P, Dussault, C & Waller, DM 2004, 'Ecological impacts of deer overabundance', Annual Review of Ecology, Evolution, and Systematics, vol. 35, no. 1, pp. 113-47.

Coulombe, M-L, Massé, A & Côté, SD 2006, 'Quantification and accuracy of activity data measured with VHF and GPS telemetry', Wildlife Society Bulletin, vol. 34, no. 1, pp. 81-92.

Coulson, G 1990, 'Habitat separation in the grey kangaroos, Macropus giganteus (Shaw) and M. fuliginosus (Desmarest)(Marsupialia: Macropodidae) in Grampians National Park, western Victoria', Australian Mammalogy, vol. 13, pp. 33-40.

Coulson, G 1993, 'The Influence of population density and habitat on grouping in the western grey kangaroo, Macropus fuliginosus', Wildlife Research, vol. 20, no. 2, pp. 151-61.

Coulson, G 1997, 'Repertoires of social behaviour in captive and free-ranging grey kangaroos, Macropus giganteus and Macropus fuliginosus (Marsupialia: Macropodidae)', Journal of Zoology, vol. 242, no. 1, pp. 119-30.

Coulson, G 1998, 'Management of overabundant macropods-are there conservation benefits', in A Austin & P Cowan (eds), Managing Marsupial Abundance for Conservation Benefits. Issues in Marsupial Conservation and Management, Occasional Papers of the Marsupial CRC, vol. 1, pp. 37-48.

Coulson, G 2001, 'Overabundant kangaroo populations in southeastern Australia. In ‘Wildlife, Land, and People: Priorities for the 21st Century', in R Field, R Warren, H Okarma & P Sievert (eds), Proceedings of the 2nd International Wildlife Management Congress’. Bethesda, Maryland, USA, pp. 238-42.

Coulson, G 2009, 'Behavioural ecology of red and grey kangaroos: Caughley’s insights into individuals, associations and dispersion', Wildlife Research, vol. 36, no. 1, pp. 57-69.

Coulson, G, Alviano, P, Ramp, D & Way, S 1999, 'The kangaroos of Yan Yean: history of a problem population', Proceedings of the Royal Society of Victoria, vol. 111, pp. 121-30.

Coulson, G, Cripps, J & Wilson, M 2014, 'Hopping down the main street: eastern grey kangaroos at home in an urban matrix', Animals, vol. 4, no. 2, pp. 272-91.

Cox, TE, Murray, PJ, Bengsen, AJ, Hall, GP & Li, X 2015, 'Do fecal odors from native and non‐native predators cause a habitat shift among macropods?', Wildlife Society Bulletin, vol. 39, no. 1, pp. 159-64.

Cripps, JK, Martin, JK & Coulson, G 2016, 'Anthelmintic Treatment Does Not Change Foraging Strategies of Female Eastern Grey Kangaroos, Macropus giganteus', PLoS ONE, vol. 11, no. 1, pp. 1-14.

Croft, DB & Snaith, F 1990, 'Boxing in red kangaroos, Macropos Rufus: Aggression or play?', International Journal of Comparative Psychology, vol. 4, no. 3.

Deakin, JE 2018, 'Chromosome evolution in marsupials', Genes, vol. 9, no. 2, p. 72.

Descovich, K, McDonald, I, Tribe, A & Phillips, C 2015, 'A welfare assessment of methods used for harvesting, hunting and population control of kangaroos and wallabies', Animal Welfare, vol. 24, no. 3, pp. 255-65.

Descovich, K, Tribe, A, McDonald, IJ & Phillips, CJ 2016, 'The eastern grey kangaroo: current management and future directions', Wildlife Research, vol. 43, no. 7, pp. 576-89.

Edwards, MJ & Deakin, JE 2013, 'The marsupial pouch: implications for reproductive success and mammalian evolution', Australian Journal of Zoology, vol. 61, no. 1, pp. 41-7.

Ellis, W, FitzGibbon, S, Pye, G, Whipple, B, Barth, B, Johnston, S, Seddon, J, Melzer, A, Higgins, D & Bercovitch, F 2015, 'The role of bioacoustic signals in koala sexual selection: Insights from seasonal patterns of associations revealed with GPS-proximity units', PLoS ONE, vol. 10, no. 7, p. e0130657.

Gordon, DM & Cowling, A 2003, 'The distribution and genetic structure of Escherichia coli in Australian vertebrates: host and geographic effects.', Microbiology, vol. 149, no. 12, pp. 3575-86.

Grant, TR 1973, 'Dominance and association among members of a captive and a free-ranging group of grey kangaroos (Macropus giganteus)', Animal Behaviour, vol. 21, no. 3, pp. 449- 56.

Heathcote, CF 1987, 'Grouping of eastern grey kangaroos in open habitat', Wildlife Research, vol. 14, no. 4, pp. 343-8.

Higginbottom, K & Page, S 2010, '29 Monitoring the fate of translocated eastern grey kangaroos at the Gold Coast', Macropods: The Biology of Kangaroos, Wallabies, and Rat- kangaroos, p. 341.

Hill, G 1981a, 'Distribution of grey kangaroos in south, inland Queensland', The Rangeland Journal, vol. 3, no. 1, pp. 58-66.

Hill, G 1981b, 'A study of habitat preferences in the grey kangaroo', Wildlife Research, vol. 8, no. 2, pp. 245-54.

Hubbard, MW, Danielson, BJ & Schmitz, RA 2000, 'Factors influencing the location of deer-vehicle accidents in Iowa', Journal of Wildlife Management, vol. 64, no. 3, pp. 707-13.

Hunsaker, DI 2012, The biology of marsupials, Elsevier.

Jackson, S 2003, Australian Mammals: Biology and Captive Management, Collingwood: CSIRO Publishing.

Jackson, S & Vernes, K 2010, Kangaroo: A Portrait of an Extraordinary Marsupial, Allen & Unwin.

Jaremovic, RV & Croft, D 1991a, 'Social organization of eastern grey kangaroos in southeastern New South Wales. II. Associations within mixed groups', Mammalia, vol. 55, no. 4, pp. 543-54.

Jaremovic, RV & Croft, D 1991b, 'Social organization of the eastern grey kangaroo (Macropodidae, Marsupialia) in southeastern New South Wales. I. Groups and group home ranges', Mammalia, vol. 55, no. 2, pp. 169-86.

Jaremovic, RV & Croft, DB 1987, 'Comparison of Techniques to Determine Eastern Grey Kangaroo Home Range', Journal of Wildlife Management, vol. 51, no. 4, pp. 921-30.

Jarman, P 1987, 'Group size and activity in eastern grey kangaroos', Animal Behaviour, vol. 35, no. 4, pp. 1044-50.

Jarman, P 1994, 'Individual behaviour and social organisation of kangaroos', in P Jarman, Rossiter, A (ed.), Animal Societies: Individuals, Interactions and Organisations pp. 70-83.

Jarman, P & Southwell, C 1986, 'Grouping, associations, and reproductive strategies in eastern grey kangaroos', in R Wrangham & D Rubenstein (eds), Ecological aspects of social evolution, Princeton University Press, Princeton, pp. 399-428.

Jarman, PJ & Coulson, G 1989, 'Dynamics and adaptiveness of grouping in macropods', in PJaIH G. Grigg (ed.), Kangaroos, wallabies and rat-kangaroos, Surrey Beatty, Sydney, pp. 527-47.

Johnson, C 1985, 'Ecology, social behaviour and reproductive success in a population of red- necked wallabies', Thesis thesis, Ph. D. thesis, University of New England.

Kaufmann, JH 1974, 'Social ethology of the whiptail wallaby, Macropus parryi, in northeastern New South Wales', Animal Behaviour, vol. 22, no. 2, pp. 281-369.

Kaufmann, JH 1975, 'Field observations of the social behaviour of the eastern grey kangaroo, Macropus giganteus', Animal Behaviour, vol. 23, no. Journal Article, pp. 214-21.

King, WJ, Garant, D & Festa‐Bianchet, M 2015, 'Mother–offspring distances reflect sex differences in fine‐scale genetic structure of eastern grey kangaroos', Ecology and evolution, vol. 5, no. 10, pp. 2084-94.

Kirkpatrick, T 1966, 'Studies of Macropodidae in Queensland. 4. Social organization of the grey kangaroo (Macropus giganteus)', Queensland J. Anim. Agric. Sci., vol. 23, pp. 317-22.

Kirsch, J & Poole, W 1972, 'Taxonomy and distribution of the grey kangaroos, Macropus giganteus Shaw and Macropus fuliginosus (Desmarest), and their subspecies (Marsupialia : Macropodidae)', Australian Journal of Zoology, vol. 20, no. 3, pp. 315-39.

Kitchener, D 1970, 'Aspects of the response of the quokka to environmental stress', Ph.D. thesis, University of Western Australia.

Klöcker, U, Croft, DB & Ramp, D 2006, 'Frequency and causes of kangaroo–vehicle collisions on an Australian outback highway', Wildlife Research, vol. 33, no. 1, pp. 5-15.

LaFollette, RM 1971, 'Agonistic behaviour and dominance in confined wallabies, Wallabia rufogrisea frutica', Animal Behaviour, vol. 19, no. 1, pp. 93-101.

MacFarlane, AM 2006, 'Can the Activity Budget Hypothesis Explain sexual segregation in western grey kangaroos?', Behaviour, vol. 143, no. 9, pp. 1123-43.

Matthews, A, Ruykys, L, Ellis, B, FitzGibbon, S, Lunney, D, Crowther, MS, Glen, AS, Purcell, B, Moseby, K & Stott, J 2013, 'The success of GPS collar deployments on mammals in Australia', Australian Mammalogy.

Mcalpine, C, Grigg, G, Mott, J & Sharma, P 1999, 'Influence of landscape structure on kangaroo abundance in a disturbed semi-arid woodland of Queensland', The Rangeland Journal, vol. 21, no. 1, pp. 104-34.

McCullough, D & McCullough, Y 2000, Kangaroos in outback Australia: comparative ecology and behavior of three coexisting species, Columbia University Press, New York.

McKenzie, S, Deane, EM & Burnett, L 2002, 'Haematology and Serum Biochemistry of the Tammar Wallaby, Macropus eugenii', Comparative Clinical Pathology, vol. 11, no. 4, pp. 229-37.

Mech, LD & Barber, SM 2002, 'A critique of wildlife radio-tracking and its use in national parks', A report to the US National Park Service.

Meek, PD, Ballard, G-A & Fleming, PJ 2015, 'The pitfalls of wildlife camera trapping as a survey tool in Australia', Australian Mammalogy, vol. 37, no. 1, pp. 13-22.

Meek, PD, Ballard, G-A, Fleming, PJ, Schaefer, M, Williams, W & Falzon, G 2014, 'Camera traps can be heard and seen by animals', PLoS ONE, vol. 9, no. 10, p. e110832.

Meek, PD, Ballard, G-A, Vernes, K & Fleming, PJ 2015, 'The history of wildlife camera trapping as a survey tool in Australia', Australian Mammalogy, vol. 37, no. 1, pp. 1-12.

Meredith, RW, Westerman, M, Case, JA & Springer, MS 2008, 'A phylogeny and timescale for marsupial evolution based on sequences for five nuclear genes', Journal of Mammalian Evolution, vol. 15, no. 1, pp. 1-36.

Miller, EJ, Eldridge, MD, Cooper, DW & Herbert, CA 2010, 'Dominance, body size and internal relatedness influence male reproductive success in eastern grey kangaroos (Macropus giganteus)', Reproduction Fertility and Development, vol. 22, no. 3, pp. 539-49.

Moore, BD, Coulson, G & Way, S 2002, 'Habitat selection by adult female eastern grey kangaroos', Wildlife Research, vol. 29, no. 5, pp. 439-45.

Munny, P, Menkhorst, P & Winter, J 2008, Macropus giganteus, IUCN (International Union for Conservation of Nature), .

Neave, H & Tanton, M 1989, 'The Effects of grazing by kangaroos and rabbits on the vegetation and the habitat of other fauna in the Tidbinbilla Nature Reserve, Australian Capital Territory', Wildlife Research, vol. 16, no. 3, pp. 337-51.

Newport, J, Shorthouse, DJ & Manning, AD 2014, 'The effects of light and noise from urban development on biodiversity: Implications for protected areas in Australia', Ecological Management & Restoration, vol. 15, no. 3, pp. 204-14.

Old, J, Hunter, N & Wolfenden, J 2018, 'Who utilises bare-nosed wombat burrows?', Australian Zoologist, vol. In Press.

Phillips, MJ & Pratt, RC 2008, 'Family-level relationships among the Australasian marsupial “herbivores”(Diprotodontia: Koala, wombats, kangaroos and possums)', Molecular Phylogenetics and Evolution, vol. 46, no. 2, pp. 594-605.

Poiani, A, Coulson, G, Salamon, D, Holland, S & Nave, CD 2002, 'Fertility control of eastern grey kangaroos: Do Levonorgestrel implants affect behavior?', The Journal of Wildlife Management, vol. 66, no. 1, pp. 59-66.

Poole, W 1982, 'Macropus giganteus', Mammalian Species, vol. 187, pp. 1-8.

Pople, T & Grigg, GC 1999, Commercial harvesting of kangaroos in Australia, Environment Australia Canberra.

Porter, WF 1992, 'Burgeoning ungulate populations in national parks: Is intervention warranted?', in DR McCullough & RH Barrett (eds), Wildlife 2001: Populations, Springer Netherlands, Dordrecht, pp. 304-12.

Presidente, P 1978, 'Diseases seen in free-ranging marsupials and those held in captivity', in Proceedings of Course for Veterinarians. Fauna, parts A and B., Sydney, NSW, vol. 36, pp. 457-71.

Richardson, KC 2012, Australia's amazing kangaroos their conservation, unique biology and coexistence with humans, CSIRO Publishing, Collingwood, Victoria.

Robert, KA & Schwanz, LE 2013, 'Monitoring the health status of free-ranging tammar wallabies using hematology, serum biochemistry, and parasite loads', Journal of Wildlife Management, vol. 77, no. 6, pp. 1232-43.

Roberts, MW, Smythe, L, Dohnt, M, Symonds, M & Slack, A 2010, 'Serologic-based investigation of leptospirosis in a population of free-ranging eastern grey kangaroos

(Macropus giganteus) indicating the presence of Leptospira weilii serovar Topaz', Journal of Wildlife Diseases, vol. 46, no. 2, pp. 564-79.

Robertshaw, J & Harden, R 1989, 'Predation in Macropodidae: a review', in GC Grigg, P Jarman & ID Hume (eds), Kangaroos, wallabies and rat-kangaroos, Chipping Norton, N.S.W : Surrey Beatty & Sons, Chipping Norton, N.S.W.

Rowcliffe, JM, Kays, R, Kranstauber, B, Carbone, C & Jansen, PA 2014, 'Quantifying levels of animal activity using camera trap data', Methods in Ecology and Evolution, vol. 5, no. 11, pp. 1170-9.

Russell, E 1970, 'Observations on the behaviour of the red Kangaroo (Megaleia rufa) in captivity', Zeitschrift für Tierpsychologie, vol. 27, no. 4, pp. 385-404.

Russell, EM 1984, 'Social behaviour and social organization of marsupials', Mammal Review, vol. 14, no. 3, pp. 101-54.

Southwell, C 1981, 'Sociobiology of the eastern grey kangaroo, Macropus giganteus', Ph.D. thesis, University of New England.

Southwell, C 1987, 'Activity pattern of the eastern grey kangaroo, Macropus giganteus', Mammalia, vol. 51, no. 2, p. 211.

Southwell, C 1987, 'Macropod studies at Wallaby Creek .2. Density and distribution of macropod species in relation to environmental variables', Wildlife Research, vol. 14, no. 1, pp. 15-33.

Southwell, CJ 1984a, 'Variability in grouping in the eastern grey kangaroo, Macropus giganteus I. Group density and group size', Wildlife Research, vol. 11, no. 3, pp. 423-35.

Southwell, CJ 1984b, 'Variability in grouping in the eastern grey kangaroo, Macropus giganteus II. Dynamics of group formation', Wildlife Research, vol. 11, no. 3, pp. 437-49.

Takenaka, A, Gotoh, S, Watanabe, T & Takenaka, O 1988, 'Developmental changes of plasma alkaline phosphatase, calcium, and inorganic phosphorus in relation to the growth of bones in the Japanese macaque (Macaca fuscata)', Primates, vol. 29, no. 3, pp. 395-404.

Taylor, R 1980, 'Distribution of feeding activity of the eastern grey kangaroo, Macropus giganteus, in coastal lowland of south-east Queensland', Wildlife Research, vol. 7, no. 3, pp. 317-25.

Taylor, RJ 1982, 'Group size in the eastern grey kangaroo, Macropus giganteus, and the wallaroo, Macropus robustus', Wildlife Research, vol. 9, no. 2, pp. 229-37.

Tribe, A, Hanger, J, Mcdonald, I, Loader, J, Nottidge, B, Mckee, J & Phillips, C 2014, 'A Reproductive Management Program for an Urban Population of Eastern Grey Kangaroos (Macropus giganteus)', Animals, vol. 4, no. 3, pp. 562-82.

Trolliet, F, Huynen, M-C, Vermeulen, C & Hambuckers, A 2014, 'Use of camera traps for wildlife studies. A review', Biotechnologie, Agronomie, Société et Environnement, vol. 18, no. 3, p. 446.

Tyndale-Biscoe, CH 2005, Life of marsupials, Csiro Publishing.

Van Dyck, S & Strahan, R 2008, The mammals of Australia, New Holland Pub Pty Limited.

Viggers, KL & Hearn, JP 2005, 'The kangaroo conundrum: home range studies and implications for land management', Journal of Applied Ecology, vol. 42, no. 1, pp. 99-107.

Voigt, CC, Behr, O, Caspers, B, von Helversen, O, Knörnschild, M, Mayer, F & Nagy, M 2008, 'Songs, scents, and senses: Sexual selection in the greater sac-winged bat, Saccopteryx bilineata', Journal of Mammalogy, vol. 89, no. 6, pp. 1401-10.

Webb, C 2001, 'Macropod browsing damage: Impacts in Namadgi National Park and techniques for its control', Honours thesis, Australian National University.

Weisbecker, V & Goswami, A 2010, 'Brain size, life history, and metabolism at the marsupial/placental dichotomy', Proceedings of the National Academy of Sciences, vol. 107, no. 37, pp. 16216-21.

Welbourne, DJ, Claridge, AW, Paull, DJ & Lambert, A 2016, 'How do passive infrared triggered camera traps operate and why does it matter? Breaking down common misconceptions', Remote Sensing in Ecology and Conservation, vol. 2, no. 2, pp. 77-83.

Wilcox, RS, Vaz, P, Ficorilli, NP, Whiteley, PL, Wilks, CR & Devlin, JM 2011, 'Gammaherpesvirus infection in a free-ranging eastern grey kangaroo (Macropus giganteus)', Australian Veterinary Journal, vol. 89, no. 1-2, pp. 55-7.

Wooding, P & Burton, G 2008, 'Monotreme and Marsupial Placentation: Class Mammalia, Subclasses Prototheria (Monotremata, eg Platypus) and Metatheria (Marsupialia)', Comparative Placentation: Structures, Functions and Evolution, pp. 99-104.

CHAPTER 2

2. Is camera trap videography suitable for assessing

activity patterns in eastern grey kangaroos?

Jai M. Green-Barber and Julie M. Old

2.1. Chapter outline and authorship

Chapter 2 examines the activity patterns of eastern grey kangaroos using video data from camera traps. The study was conducted to evaluate whether camera traps are suitable for measuring activity patterns in eastern grey kangaroos. The use of cameras for studying the behaviour of kangaroos is likely to reduce the observer effect and therefore provide more useful data.

I am the primary and corresponding author of this jointly authored proof version of a paper accepted for publication. I conceived the initial proposal and I performed all field procedures and data analysis. I placed camera traps at varying locations at both sites, collected videos stored on cameras on a regular basis, and manually recorded behaviours observed on videos.

I performed data handling and analysis. A/Prof Julie Old supervised the research and provided feedback on the developing manuscript.

We would like to acknowledge and thank the editor and anonymous reviewers who provided feedback on the following manuscript prior to its acceptance by the journal.

This chapter is a published paper and should be cited as:

Green-Barber Jai M., Old Julie M. (2018) Is camera trap videography suitable for assessing activity patterns in eastern grey kangaroos? Pacific Conservation Biology, In Press. https://doi.org/10.1071/PC17051

Abstract

Camera traps are frequently used in wildlife research and may be a useful tool for monitoring behavioural patterns. The suitability of camera traps to monitor behaviour depends on the size, locomotion, and behaviour of the species being investigated.

The suitability of cameras for documenting the behaviour of eastern grey kangaroos was assessed here by comparing activity patterns collected using cameras to published activity patterns for the species. The activity patterns calculated from camera trap data were largely consistent with data from previous studies, although nocturnal activity appeared to be under-represented. Observations of unusual fighting behaviour illustrates the potential for camera traps to enable capture of novel observations. Kangaroo behaviour appeared to be influenced by the presence of cameras; however, no kangaroos retreated from cameras. Data suggested that kangaroos became habituated to cameras after eight months. The findings of this study suggest that camera traps are suitable for assessing the diurnal activity of eastern grey kangaroos and are useful tools for documenting their behaviour.

2.2. Introduction

Behavioural data from wildlife can be collected in multiple ways, including direct observation, tracking collars that record postures and camera traps (Coulombe et al.

2006; Rowcliffe et al. 2014). Camera traps allow researchers to monitor wildlife without being physically present by using infrared sensors to trigger the camera.

Infrared sensors detect electromagnetic radiation emitted from the surface of objects

(Welbourne et al. 2016). When an object moves within the sensor’s detection zone it usually causes rapid changes in surface temperature, which triggers the camera to capture an image or video (Welbourne et al. 2016). Camera traps are useful for studying nocturnal species and species sensitive to human activity and their use is now common in conservation research (Trolliet et al. 2014). Camera traps have been used in Australia to assess the presence of various mammals (Meek et al. 2015b; Old et al. 2018). They have been used for various types of management-based research such as population surveys, road-crossing structure use and bait efficacy. However, relatively few studies have used camera traps to evaluate animal behaviour (Meek et al. 2015b). They have been used to evaluate activity patterns of some small and medium-sized mammals in the Northern Hemisphere such as rats, squirrels, armadillo and deer (Rowcliffe et al. 2014). Caravaggi et al. (2017) suggest that camera traps can be a useful tool for measuring the behavioural changes of animals in response to anthropogenic activity or other environmental factors. It is important to understand changes in animal behaviour to ensure that conservation and management initiatives are effective.

Rowcliffe et al. (2014) found that cameras were better for assessing behaviour in some species than others and reported a higher detectability for larger and slower-moving species. No studies have used camera traps to assess the activity

patterns of kangaroos. Camera traps are likely suitable for evaluating activity patterns of eastern grey kangaroo (Macropus giganteus) because they are mostly large and highly detectable. Ecologically, eastern grey kangaroos serve important functions; for example, they are a source of food for predators such as dingoes

(Canis lupus dingo), their browsing of native tree seedlings prevents woodland encroachment into grassland habitats and their selective grazing influences the presence of invertebrates and vertebrates by maintaining shorter grasses (Jarman and

Southwell 1986; Neave and Tanton 1989; Webb 2001).

Kangaroo populations can rapidly increase when resources are abundant

(Adderton Herbert 2004; Descovich et al. 2016). Overabundance of kangaroos can result in multiple management issues, including detriment to human life/livelihood, decline of other species in the area, reduced body condition and reproductive success, and disruption of the balance between plant and animal numbers (Coulson

2009). Due to their increased distribution and abundance, it is important to understand the behaviour of this species so that effective and informed management strategies can be developed.

The activity patterns of kangaroos were first quantified by Caughley (1964), using direct observations on foot and recording the number of kangaroos either lying down, or participating in an activity (such as foraging). The study by Caughley

(1964) was conducted when eastern and western grey kangaroos (Macropus fuliginosus) were considered one species so it is unclear whether one or both species were included in these observations. Multiple studies have reported on activity patterns in more detail since Caughley (1964). Clarke et al. (1989) and Southwell

(1987) recorded the proportion of time that kangaroos spent on various behaviours in different seasons. Jarman (1987) simultaneously recorded behaviour of multiple

kangaroos in identical environmental conditions to assess the effect of group size on activity budgets. Although activity patterns have been previously reported in this species, variation is likely to exist between populations and over time.

Eastern grey kangaroos are a prey species and therefore it is likely that the presence of human observers would have a notable effect on their activity patterns.

Camera traps are likely to provide more detailed behavioural data than radio-collars that only detect movement and postures (Coulombe et al. 2006) and reduce observer effects by eliminating any influence of human presence (Meek et al. 2014).

However, Meek et al. (2014) suggest that most mammals can see the infrared illumination emitted by camera traps. Many mammal species are also able to hear the sounds emitted from the camera; however, other noises present in the environment and distance from the cameras are likely to reduce the detectability of the camera sounds (Meek et al. 2014). The illumination and sounds from camera traps have been shown to influence the behaviour of some species (Se´quin et al. 2003; Wegge et al.

2004; Schipper 2007). If animals avoid areas with camera traps this could result in misleading data, particularly in capture–recapture studies (Meek et al. 2015a). There are no published data on how eastern grey kangaroos react to the presence of camera traps. It is important to understand how different species react to the presence of camera traps when evaluating data.

In this study we assessed whether camera trap videography can be reliably used to describe the behaviour of free-ranging eastern grey kangaroos. Activity pattern data obtained using camera traps were compared with those reported in previous studies using direct observations.

2.3. Methods

Data collection was conducted from September 2014 to August 2016 at two sites in

New South Wales. One site was located at Yarramundi Paddocks at Hawkesbury campus of Western Sydney University, which consisted of 308 ha of pasture, grassland, marshes, and open woodland. The second site was located at the Emirates

One and Only Wolgan Valley Resort, Newnes, New South Wales, and consisted of a conservation reserve at an eco-resort situated on 1619 ha of grasslands, woodlands and riparian areas surrounded by national parks and sandstone cliffs.

We used the infrared camera traps (model BTC-1XR, Browning, Utah) available to us to monitor eastern grey kangaroos at both sites. Camera traps were pilot tested for a period of two weeks using different camera placements and settings.

Videos were examined to assess the most effective camera placement and settings for capturing footage of kangaroos. Camera traps were placed at 35 locations across the two sites and were distributed evenly throughout three habitat categories. The habitat categories were grassland (predominantly grass; 11 cameras), woodland

(predominantly shrubs and trees; 12 cameras) and fringe habitats (a mix of grasses, shrubs and trees that occurred between grassland and woodland habitats; 12 cameras). All cameras were attached to trees or fence posts ~120 cm from the ground in areas with flat terrain.

All cameras were set to record 1-min videos with a 3-min delay following each video. We chose to use a delay setting after each recording to avoid repeat capture of a single event, and we chose a short delay of 3 min to avoid missing important data because kangaroos can move very quickly and many kangaroos may pass by cameras in a short period. Cameras automatically recorded the time, date and

temperature. Further data were manually recorded from videos, including group size and behavioural occurrences. Behaviour categories used were from Green-Barber and Old (2018a) (Table 2.1). The first author transcribed data from all videos. The entirety of each video was checked for the presence of eastern grey kangaroos. The number of kangaroos displaying each behaviour at each 10-s interval throughout each video was recorded. Activity patterns were determined by examining the varying activity levels at different times of day and during different seasons.

Findings were compared with data from Clarke et al. (1989) and Southwell (1987).

Kangaroos that appeared to react to the presence of camera traps were recorded.

Potential behaviours regarded as reacting to the presence of the camera included: looking (looking at the camera for an extended period while standing still), investigating (moving around the camera, looking at it closely), sniffing (sniffing the camera repeatedly), and retreating (exiting the area upon noticing the camera).

Data were analysed using descriptive statistics (Microsoft Excel). The number of observations that occurred in each hour of the day and night were used to graph activity patterns throughout the study period and for separate seasons. The percentage of observations recorded by cameras in each habitat category was used to assess which areas were utilised most often. The percentage of videos containing each group size was calculated, as was the mean group size, range, and variance. The percentage of observations that contained each type of behaviour was calculated for different seasons and times of day. The number of times kangaroos reacted to cameras at different times of day and night and over the first 12 months of the study was included. Range and variance were calculated for the number of times that kangaroos reacted to cameras in different habitat categories. More advanced

statistical techniques were not used as they were not considered appropriate for this dataset.

2.4. Results

The cameras recorded a total of 13572 videos; however, only 3603 (26.55%) contained visible eastern grey kangaroos. Videos that did not contain any visible kangaroos were assumed not to be triggered by kangaroos and appeared to be primarily triggered by non-target species (36.04%), or weather-related disturbances

(37.42%), such as plants moving in the wind, rain and sunrise. Detection distance estimates were measured using landscape features close to kangaroos. Cameras were effective in detecting kangaroos at a range of distances during the day (up to ~30 m) and at shorter distances at night (up to ~10 m).

Activity in all seasons peaked between 0400 and 1100 hours, generally decreased in the middle of the day, and increasing again between 1400 and 1800 hours (Green-Barber and Old 2018a). The least activity was observed between 1700 and 0300 hours. Specific peak times varied between seasons with activity peaking earlier in spring and summer.

Table 2. 1. Categories used to record the behaviour of kangaroos

Taken from Green-Barber and Old (2017a)

Behaviour category Description Vigilance Stands on hind legs with the body in an upright position and the head either turning to scan the environment or still with only the ears moving. Feeding Any active uptake or chewing of food Travelling Multiple consecutive pentapedal or bipedal movements Resting Animal lies on the ground Self-grooming Licking or scratching themselves

Affinitive interaction Any non-aggressive and non-reproductive interaction between adult kangaroos, including; sitting or feeding in contact, allogrooming, social sniffing or licking. Agonistic interaction Any aggressive touch, movement or growl Reproductive Any interaction relating to reproduction, including; males interaction closely following females, males nosing the cloaca or pouch of a female, males having an everted and erect penis, and intromission. Mother-young Any interaction between a female kangaroo and it’s young interaction at foot, including; allogrooming, suckling, and play fighting.

Fig. 2. 1. The proportion of time that eastern grey kangaroos spent on each activity over 24 h: (a) summer, (b) autumn, (c) winter, (d) spring.

Lying down and self-grooming occurred primarily in the middle of the day and lying down was most frequent around noon in all seasons (Fig. 2.1). More time was spent lying down in summer (Fig. 2.1a) than in other seasons; however, lying down occurred later in the day in autumn (Fig. 2.1b). The most common nocturnal behaviours in summer, autumn and spring were feeding and vigilance. The most

common nocturnal behaviour in winter (Fig. 2.1c) was vigilance; however, there were some gaps in the data with no sightings in some nocturnal hours for winter and autumn. Travelling was most common in the early morning during summer and in the early morning and evening in autumn and spring. Feeding and travelling occurred in the early morning and mid-afternoon during winter. Feeding also occurred around the middle of the day in spring (Fig. 2.1d).

The mean group size was 2.9 kangaroos (statistical range = 19, variance =

6.63). The most commonly observed group size was 1–3 kangaroos across all seasons and times of day. A greater proportion of groups containing 4–15 kangaroos was observed in winter ( Fig. 2.2a). Groups of over 16 kangaroos were rare and were observed only in autumn and spring. Groups containing 1–6 kangaroos were most frequently observed between 0400 and 1000 hours ( Fig. 2.2b). Larger group sizes were observed between 1100 and 1400 hours.

Fig. 2. 2. The percentage of occurrences where different group sizes were observed (a) across different seasons and (b) at different times of day.

Social interactions between kangaroos were rarely observed and occurred in only 3.6% of recordings. Agonistic interactions were the most common kind of interaction observed, followed by reproductive interactions and affinitive interactions

( Fig. 2.3).

Fig. 2. 3. The percentage of occurrences where each type of interaction was observed.

Mother–young interactions were the least commonly observed type of interaction.

The most common type of interaction observed in summer was related to reproduction. In autumn agonistic interactions were the most common interaction type and in spring affinitive interactions were the most common type of interaction (

Fig. 2.4a). No interactions were observed during winter. Agonistic and reproductive interactions occurred most frequently between 0400 and 0900 hours ( Fig. 2.4b).

Affinitive and mother–young interactions occurred most frequently between 0800 and 1000 hours. Fighting behaviour included boxing (striking opponent with forelimbs) and kicking (striking opponent with hind limbs). Most fights observed involved two large males (89%); however, some fights involved two small males

(7%) or two males of different size (4%). Boxing and kicking behaviours were observed during all fights involving large males and males of different sizes, whereas only boxing was observed during fights between two small males. Fights involving two small males were most frequent in summer (4%) and also occurred in autumn

(2%). Fights involving different sized males occurred equally in summer and spring

(2%). Most fights between small males were observed between 0500 and 0900 hours

(54%) and fights between males of different sizes occurred equally in the morning

and afternoon. One fight involving two small males and one large male was also observed.

Fig. 2. 4. The percentage of occurrences where each type of interaction was observed (a) across different seasons and (b) at different times of day.

Fig. 2. 5. The number of kangaroo reactions to camera recorded (a) during the months following deployment of the cameras, and (b) during different times of the day.

There were 128 instances (3.55% of observations) of kangaroos reacting to the presence of the camera traps. The most common reaction was looking (51.56%), followed by investigating (45.31%). A small proportion of videos showed kangaroos sniffing the camera repeatedly. No retreating in reaction to the camera was observed.

A small number of tagged kangaroos were present at the sites as part of another study

(Green-Barber and Old 2018b) and one tagged female kangaroo was captured by the same camera seven times. Other tagged kangaroos were captured on camera only once or not at all. Kangaroos reacted to cameras in a range of locations (statistical range = 9, variance = 25.40). Most videos showing kangaroos reacting to the camera occurred 5–7 months after cameras were deployed ( Fig. 2.5a).

Only one video of a kangaroo reacting to a camera occurred within the first month, when a solitary kangaroo repeatedly sniffed the camera at 0604 hours. Small increases in the number of observed reactions to the camera occurred ,1 and 3 months after cameras were deployed and no reactions to cameras were observed more than 8 months after cameras were deployed. Most reactions to cameras occurred between 0200 and 0900 hours, peaking at, 0600 hours ( Fig. 2.5b).

Kangaroos reacted to the presence of cameras in 14 of the 35 locations. Most reactions to the camera occurred in grassland habitats (42.86%), closely followed by woodland habitats (35.71%).

2.5. Discussion

Infrared camera traps captured videos suitable for assessing some activity patterns of eastern grey kangaroos. A wide variety of solitary and social behaviours were captured by the video recordings. Diurnal activity patterns were well represented in videos; however, the observed level of nocturnal activity was lower than expected.

Some instances of kangaroos reacting to cameras were observed.

Eastern grey kangaroo activity increased around dawn and dusk and decreased around midday, which is consistent with the findings of other studies

(Caughley 1964; Southwell 1987; Clarke et al. 1989). The data also showed a decline in overall activity between 1700 and 0300 hours. Conversely, other studies have found that eastern grey kangaroos are very active at night, with most feeding occurring during that time (Caughley 1964; Southwell 1987). Lying down and self- grooming occurred primarily during daylight hours, which is consistent with

Southwell (1987) and Clarke et al. (1989). More time was spent lying down in summer than in other seasons, which is consistent with Clarke et al. (1989). Clarke et

al. (1989) found that kangaroos spent more hours feeding in winter. Longer feeding periods in winter were not observed in the camera data from this study; however, there were no recordings for some nocturnal hours during winter. Feeding and vigilance were the most commonly observed nocturnal behaviours. Travelling was most common around the early morning and evening in most seasons, which is consistent with Southwell (1987) and Clarke et al. (1989).

It is possible that nocturnal activity was under-represented in the data due to the shorter detection distance of camera traps at night, as described by Rowcliffe et al. (2014). The kangaroos were reasonably close to the camera for all night recordings, whereas many of the recordings during the day were triggered by kangaroos at a much greater distance. As kangaroos are relatively large animals they are likely to be detected by cameras at a greater distance (Rowcliffe et al. 2011), which may lead to increased detection rates during the day. The differences between diurnal and nocturnal detection rates by the cameras may explain why there was less nocturnal activity observed compared with previous studies. The under- representation of nocturnal activity in camera trap data may also be due to kangaroos foraging in different areas further from the cameras at these times. Southwell (1987) found that feeding occurred during nocturnal hours as well as early morning and late afternoon, which is consistent with the findings from the camera data. If nocturnal behaviour is under-represented in the camera data then it is likely that feeding behaviour, in particular, will be under-represented. However the proportion of feeding behaviour observed, during nocturnal hours, appears to be similar to Clarke et al. (1989).

The mean group size was 2.9 kangaroos, which is similar to the mean number per group of 3.3 reported by Caughley (1964). Larger groups were observed more during winter than other seasons, which may be due to restricted food availability.

Kaufmann (1974) suggested that seasonal group size variation in the whiptail wallaby (Macropus parryi) was due to the concentration of individuals around limited high-quality foraging areas during winter. Larger groups were most common during the middle of the day, which has been previously reported for eastern grey kangaroos (Clarke et al. 1995).

Agonistic interactions were the most common kind of interaction observed, followed by reproductive interactions and affinitive interactions. Agonistic and reproductive interactions occurred most frequently in the early morning when the kangaroos were most active overall. Seasonal variation in resource availability appears to influence reproductive and agonistic interaction rates. Reproductive interactions were most common in summer and spring and were consistent with

Southwell (1984). Agonistic behaviour occurred more frequently at times when reproductive activity was low. Newsome (1966) found that the reproductive behaviour of red kangaroos (Macropus rufus) was more frequent when food abundance was high, which was dictated by rainfall. The findings of this study also suggest that reproductive behaviour in eastern grey kangaroos is more frequent during seasons with higher rainfall when food is most abundant. Agonistic behaviour may be increased when food abundance is low due to increased competition for resources.

Some fights between males of different sizes were observed. A fight involving one large male and two smaller males was also observed. Fighting

behaviour in kangaroos usually occurs between males of the same size (Coulson et al. 2006). The presence of these observations in the video data illustrates the value of camera traps in documenting rare or difficult-toobserve behaviours.

No interactions were observed during winter despite large groups being observed more commonly. As kangaroos were in larger groups they would presumably encounter each other more frequently and therefore it was unexpected that no interactions were observed. However, only 10.16% of captured footage of kangaroos occurred during winter and therefore the lower number of observations captured during this time may explain why no interactions were observed. The lower number of observations during winter may be a result of kangaroos travelling further from the study site. Previously, Green-Barber and Old (2018c) found that road mortalities were more frequent during winter at this site and suggested that the reduced food availability in winter led to kangaroos travelling further and crossing roads more frequently to access resources.

Research has shown that the light and sounds emitted by camera traps can be detected by some species (Meek et al. 2014). In this study there were many instances where kangaroos appeared to react to the camera’s presence, which may have influenced their behaviour, hence affecting the data. Most reactions to the camera involved looking directly at it for an extended period, followed by investigation.

Kangaroos did not begin to investigate cameras until they had been in place for at least one month and they stopped investigating cameras after eight months. Meek et al. (2016) suggested that scents left when placing cameras cause animals to respond to the presence of cameras. Macropods have an acute sense of smell due to their prominent olfactory bulb and vomeronasal organ (Jones et al. 2003), hence scents

inadvertently left by researchers may have deterred kangaroos from approaching cameras for the first few weeks of this study. Wild animals often instinctively avoid human activity; however, repeated exposure to human stimulus can lead to habituation of individuals (Wheat and Wilmers 2016). Kangaroos likely became habituated to the cameras after eight months, when no more reactions to cameras were observed. Larrucea et al. (2007) similarly found that the capture rate of coyotes

(Canis latrans) was influenced by whether animals had become accustomed to the presence of cameras.

Kangaroos appeared to be more aware of cameras at certain times of the day.

Reactions to cameras occurred most frequently between 0200 and 0900 hours and peaked at ,0600 hours. It is likely that kangaroos became more aware of cameras when it is dark as infrared light emitted from the cameras was more visible to kangaroos at this time. Meek et al. (2014) states that nocturnal animals with vision adapted to night light can see infrared light. Alternatively, the higher number of reactions during the early morning may simply be because this was when they were most active.

Despite the high proportion of camera locations where kangaroos appeared to be aware of the cameras, only a small number of videos showed kangaroos reacting to the cameras. No evidence of adverse reactions to cameras was observed; however, as most of the kangaroos were not individually identified, it was not possible to quantify how many repeat visits were captured.

There are many advantages to using camera traps for wildlife research.

Camera traps may disturb the animal less, and hence have decreased influence on their behaviour (Meek et al. 2014). Camera traps are particularly useful for studying

animals that are sensitive to human presence (Trolliet et al. 2014), such as eastern grey kangaroos. Videos can provide more detail and context than specialised tracking collars, which can only document movement and posture (Coulombe et al. 2006).

Cameras are also less invasive than collaring animals. Collaring wild kangaroos requires invasive methods including chemical restraint during capture and handling, which sometimes leads to capture myopathy (Green-Barber et al. 2018). Camera traps allow for point location observation 24 hours per day, seven days per week, which cannot be achieved by other methods and can provide data during inclement weather without posing any safety risks to researchers; however, the findings of this study indicate that the weather and time of day may influence capture rates.

The use of camera traps to capture behaviour and activity patterns has some limitations. A high proportion of videos did not contain the target species; this has been noted in previous studies (Newey et al. 2015). Newey et al. (2015) suggested that strong winds and moving vegetation are likely to cause increased false triggers of camera traps. Additional sampling error may occur if animals within a sampling area do not enter the camera’s detection zone, or if an animal within the detection zone fails to be detected by a camera (Burton et al. 2015). Cameras are restricted to recording whatever is directly in front of the sensors so details and behaviours occurring just outside the frame would be missed. The physical limitations of camera trap detection zones means that data may over represent behaviours that occur within the detection zone and underrepresent behaviours that occur in other areas.

Recordings from camera traps have timers and stop recording after a set period of time and hence likely miss observations, however it is likely that cameras would miss equal proportions of all behaviours occurring within the detection zone.

Despite the limitations, the activity patterns of eastern grey kangaroos obtained from camera traps were largely consistent with data collected from previous studies conducted on foot. Overall nocturnal activity appeared to be underrepresented, however the behaviours observed during nocturnal hours were proportionately consistent with other studies. Seasonal variation in group size and rates of certain interactions were also consistent with other studies. Novel observations of unusual fighting behaviour illustrate the potential for camera traps to capture observations of rare or difficult-to-observe behaviours. Kangaroos appeared to react to cameras in some recordings, which influenced their behaviour. Kangaroos were more aware of cameras around dawn and it is likely that they can see the infrared light emitted from the cameras; however, no kangaroos retreated and they all became habituated to cameras after eight months.

On the basis of the findings of this study, camera traps are suitable for assessing the diurnal activity of eastern grey kangaroos and their use as a tool for monitoring changes in behavioural patterns is supported. Knowledge of the advantages and limitations of using camera traps to monitor kangaroos will enable wildlife managers to make optimal use of this tool for monitoring behavioural changes. Monitoring of behavioural variations within and between populations is essential for evaluating how different environmental factors, such as urban development or climate change, may affect this species.

Acknowledgements

Funding was provided by the School of Science and Health, Western Sydney

University, and Jai Green-Barber was supported by an Australian Postgraduate

Award Scholarship. Animal care and ethics (no. A10297) approval was obtained

from the Western Sydney University. A NSW scientific licence (no. SL101256) was obtained from the NSW National Parks and Wildlife Service.Wethank Bradley Evans and Kym Green for assisting with data collection, and the Emirates One and Only

Wolgan Valley Resort for the use of their site.

Conflicts of Interest

The authors declare no conflicts of interest.

2.6. References

Adderton Herbert, C. (2004). Long-acting contraceptives: a new tool to manage

overabundant kangaroo populations in nature reserves and urban areas.

Australian Mammalogy 26, 67–74.

Burton, A. C., Neilson, E., Moreira, D., Ladle, A., Steenweg, R., Fisher, J. T., Bayne,

E., and Boutin, S. (2015). Wildlife camera trapping: a review and

recommendations for linking surveys to ecological processes. Journal of

Applied Ecology 52, 675–685. doi:10.1111/1365-2664.12432

Caravaggi, A., Banks, P. B., Burton, C. A., Finlay, C., Haswell, P. M., Hayward, M.

W., Rowcliffe, M. J., and Wood, M. D. (2017).Areview of camera trapping

for conservation behaviour research. Remote Sensing in Ecology and

Conservation 3, 109–122. doi:10.1002/RSE2.48

Caughley, G. (1964). Social organization and daily activity of the red kangaroo and

the grey kangaroo. Journal of Mammalogy 45, 429–436.

doi:10.2307/1377416

Clarke, J., Jones, M., and Jarman, P. (1989). A day in the life of a kangaroo:

activities and movements of eastern grey kangaroos Macropus giganteus at

Wallaby Creek. In ‘Kangaroos, Wallabies and Rat-kangaroos’. (Eds G.

Grigg, P. Jarman, and I. Hume.) pp. 611–618. (CSIRO: Melbourne.)

Clarke, J. L., Jones, M. E., and Jarman, P. J. (1995). Diurnal and nocturnal grouping

and foraging behaviors of free-ranging eastern grey kangaroos. Australian

Journal of Zoology 43, 519–529. doi:10.1071/ZO9950519

Coulombe, M.-L., Masse´, A., and Coˆte´, S. D. (2006). Quantification and accuracy

of activity data measured with VHF and GPS telemetry. Wildlife Society

Bulletin 34, 81–92. doi:10.2193/0091-7648(2006)34 [81:QAAOAD]2.0.CO;2

Coulson, G. (2009). Behavioural ecology of red and grey kangaroos: Caughley’s

insights into individuals, associations and dispersion. Wildlife Research 36,

57–69. doi:10.1071/WR08038

Coulson, G., MacFarlane, A. M., Parsons, S. E., and Cutter, J. (2006). Evolution of

sexual segregation in mammalian herbivores: kangaroos as marsupial models.

Australian Journal of Zoology 54, 217–224. doi:10.1071/ZO05062

Descovich, K., Tribe, A., McDonald, I. J., and Phillips, C. J. (2016). The eastern grey

kangaroo: current management and future directions. Wildlife Research 43,

576–589.

Green-Barber, J., and Old, J. (2018a). Town roo, country roo: a comparison of

behavior in eastern grey kangaroos (Macropus giganteus) in urban and

pristine habitats. Urban Ecosystems.

Green-Barber, J., and Old, J. (2018b). The genetic relatedness of an urban population

of eastern grey kangaroos. BMC Research Notes.

Green-Barber, J., and Old, J. (2018c). What influences road mortality rates of eastern

grey kangaroos in a semi-rural area? Transportation Research Part D,

Transport and Environment.

Green-Barber, J., Stannard, H., and Old, J. (2018). A suspected case of myopathy in

a free-ranging eastern grey kangaroo (Macropus giganteus). Australian

Mammalogy 40, 122–126. doi:10.1071/AM16054

Jarman, P. (1987). Group size and activity in eastern grey kangaroos. Animal

Behaviour 35, 1044–1050. doi:10.1016/S0003-3472(87)80161-6

Jarman, P., and Southwell, C. (1986). Grouping, associations, and reproductive

strategies in eastern grey kangaroos. In ‘Ecological Aspects of Social

Evolution’. (Eds R. Wrangham, and D. Rubenstein.) pp. 399–428. (Princeton

University Press: Princeton, NJ.)

Jones, A. S., Lamont, B. B., Fairbanks, M. M., and Rafferty, C. M. (2003).

Kangaroos avoid eating seedlings with or near others with volatile essential

oils. Journal of Chemical Ecology 29, 2621–2635.

doi:10.1023/B:JOEC.0000008008.91498.62

Kaufmann, J. H. (1974). Social ethology of the whiptail wallaby, Macropus parryi,

in northeastern New South Wales. Animal Behaviour 22, 281– 369.

doi:10.1016/S0003-3472(74)80032-1

Larrucea, E. S., Brussard, P. F., Jaeger, M. M., and Barrett, R. H. (2007). Cameras,

coyotes, and the assumption of equal detectability. Journal of Wildlife

Management 71, 1682–1689. doi:10.2193/2006-407

Meek, P. D., Ballard, G.-A., Fleming, P. J., Schaefer, M., Williams, W., and Falzon,

G. (2014). Camera traps can be heard and seen by animals. PLoS One 9,

e110832. doi:10.1371/JOURNAL.PONE.0110832

Meek, P. D., Ballard, G.-A., and Fleming, P. J. (2015a). The pitfalls of wildlife

camera trapping as a survey tool in Australia. Australian Mammalogy 37, 13–

22. doi:10.1071/AM14023

Meek, P. D., Ballard, G.-A., Vernes, K., and Fleming, P. J. (2015b). The history of

wildlife camera trapping as a survey tool in Australia. Australian Mammalogy

37, 1–12. doi:10.1071/AM14021

Meek, P., Ballard, G., Fleming, P., and Falzon, G. (2016). Are we getting the full

picture? Animal responses to camera traps and implications for predator

studies. Ecology and Evolution 6, 3216–3225. doi:10.1002/ ECE3.2111

Neave, H., and Tanton, M. (1989). The effects of grazing by kangaroos and rabbits

on the vegetation and the habitat of other fauna in the Tidbinbilla Nature

Reserve, Australian Capital Territory. Wildlife Research 16, 337–351.

doi:10.1071/WR9890337

Newey, S., Davidson, P., Nazir, S., Fairhurst, G., Verdicchio, F., Irvine, R. J., and

van der Wal, R. (2015). Limitations of recreational camera traps for wildlife

management and conservation research: a practitioner’s perspective. Ambio

44, 624–635. doi:10.1007/S13280-015-0713-1

Newsome, A. (1966). The influence of food on breeding in the red kangaroo in

central Australia. CSIRO Wildlife Research 11, 187–196. doi:10.1071/

CWR9660187

Old, J., Hunter, N., and Wolfenden, J. (2018). Who utilises bare-nosed wombat

burrows? Australian Zoologist, In press. Rowcliffe, J., Carbone, C., Jansen,

P. A., Kays, R., and Kranstauber, B. (2011). Quantifying the sensitivity of

camera traps: an adapted distance sampling approach. Methods in Ecology

and Evolution 2, 464–476. doi:10.1111/J.2041-210X.2011.00094.X

Rowcliffe, J. M., Kays, R., Kranstauber, B., Carbone, C., and Jansen, P. A. (2014).

Quantifying levels of animal activity using camera trap data. Methods in

Ecology and Evolution 5, 1170–1179. doi:10.1111/2041-

210X.12278

Schipper, J. (2007). Camera-trap avoidance by kinkajous Potos flavus: rethinking the

‘‘non-invasive’’ paradigm. Small Carnivore Conservation 36, 38–41.

Se´quin, E. S., Jaeger, M. M., Brussard, P. F., and Barrett, R. H. (2003). Wariness of

coyotes to camera traps relative to social status and territory boundaries.

Canadian Journal of Zoology 81, 2015–2025. doi:10.1139/ Z03-204

Southwell, C. J. (1984). Variability in grouping in the eastern grey kangaroo,

Macropus giganteus. I. Group density and group size. Wildlife Research 11,

423–435. doi:10.1071/WR9840423

Southwell, C. (1987). Activity pattern of the eastern grey kangaroo, Macropus

giganteus. Mammalia 51, 211–224. doi:10.1515/MAMM. 1987.51.2.211

Trolliet, F., Huynen, M.-C., Vermeulen, C., and Hambuckers, A. (2014). Use of

camera traps for wildlife studies. A review. Biotechnologie, Agronomie,

Socie´te´ et Environnement 18, 446–454.

Webb, C. (2001). Macropod browsing damage: impacts in Namadgi National Park

and techniques for its control. B.Sc.(Honours) thesis, Australian National

University, Canberra.

Wegge, P., Pokheral, C. P., and Jnawali, S. R. (2004). Effects of trapping effort and

trap shyness on estimates of tiger abundance from camera trap studies.

Animal Conservation 7, 251–256. doi:10.1017/ S1367943004001441

Welbourne, D. J., Claridge, A. W., Paull, D. J., and Lambert, A. (2016). How do

passive infrared triggered camera traps operate and why does it matter?

Breaking down common misconceptions. Remote Sensing in Ecology and

Conservation 2, 77–83. doi:10.1002/RSE2.20

Wheat, R. E., and Wilmers, C. C. (2016). Habituation reverses fear-based ecological

effects in brown bears (Ursus arctos). Ecosphere 7, e01408.

doi:10.1002/ECS2.1408

CHAPTER 3

3. Town roo, country roo: a comparison of behaviour in

eastern grey kangaroos Macropus giganteus in

developed and natural landscapes

Jai M. Green-Barber and Julie M. Old

3.1. Chapter outline and authorship

After illustrating the usefulness of camera trap video data in assessing eastern grey kangaroo behaviour in chapter 2, chapter 3 uses video data to compare their activity patterns between a anthropogenically developed site and natural site. The developed site was located at

Yarramundi Paddocks, Hawkesbury Campus, Western Sydney University NSW, and the natural site was located at the Wolgan Valley Resort and Spa, Wolgan Valley, NSW. The study was conducted to explore how the activity patterns of kangaroos differ in a developed landscape that has been modified by human activity. Knowledge of the behavioural differences of kangaroos in modified landscapes is required for developing strategies to reduce the impacts of anthropogenic development on kangaroo populations.

I am the primary and corresponding author of this jointly authored manuscript that is under review for publication at the time of writing this thesis. I conceived the initial proposal and performed all field procedures and data analysis. I placed camera traps at varying locations at both sites, collected videos stored on cameras on a regular basis, and manually recorded behaviours observed on videos. I performed data handling and analysis. A/Prof Julie Old supervised the research and provided feedback on the developing manuscript.

We would like to acknowledge and thank the editor and anonymous reviewers who provided feedback on the following manuscript prior to its acceptance by the journal.

This chapter is a paper under review for publication and should be cited as:

Green-Barber Jai M., Old Julie M. (2018) Town roo, country roo: a comparison of behaviour in eastern grey kangaroos Macropus giganteus in developed and natural landscapes.

Australian Zoologist, In Press.

Abstract

Many species have adapted their behaviour to survive in anthropogenically developed environments (hereafter referred to as developed). Eastern grey kangaroos

Macropus giganteus are common in developed areas, however very few studies have evaluated their behavioural adaptations to developed landscapes. This study compared the behaviour of eastern grey kangaroos in a developed environment to those surrounded by a natural environment. Data were collected using infra-red camera traps that recorded one minute videos. Population density was calculated using pellet counts. The population of eastern grey kangaroos at the developed site had a higher density, spent more time in larger groups, and had an earlier peak activity time than those at the natural site. More vigilance and less feeding were observed at the developed site. A positive relationship between population density and group size was observed. The higher population density at the developed site is likely to be due to increased resources and restricted dispersal. Kangaroos in developed environments may be active earlier in the day in response to human activity occurring later in the day, and artificial lighting (street lighting) likely impacted nocturnal activity. Increased vigilance may be due to increased human activity, and visual barriers in developed landscapes that reduce the line of sight.

Reduced feeding time is probably due to the increased nutritional content of pasture grasses at the developed site. Knowledge of the behavioural differences of kangaroos in developed areas will assist in designing management strategies.

3.2. Introduction

Anthropogenic development removes natural habitats and creates grey spaces

(buildings and hard surfaces) and green spaces (managed vegetation such as gardens, lawns, paddocks) (McDonnell and Pickett 1990). Some wildlife are sensitive to development, while other species, including eastern grey kangaroos Macropus giganteus, have successfully adapted to occupy these developed areas, and their population expands as resources have increased (Coulson et al. 2014; Richardson

2012). High numbers of eastern grey kangaroos may occur in rural and developed areas where farming land is adjacent to woodland (Coulson et al. 1999). These populations can rapidly increase when resources are abundant (Adderton Herbert

2004; Descovich et al. 2016) and barriers such as fencing restricts dispersal, leading to high population densities (Adderton Herbert 2004; Coulson 1998; Coulson 2001;

Southwell 1984a). Increased food availability in developed areas may lead to a rise in population densities, and higher reproduction rates leading to further density escalation as seen in other macropods (Chambers and Bencini 2010; Schwanz and

Robert 2012). Greater numbers of kangaroos leads to multiple issues, including vehicle collisions (Bond and Jones 2014; Green-Barber 2018), effects on agriculture

(Coulson et al. 2014; Descovich et al. 2016), attacks on people and pets (Henderson et al. 2017), and environmental impacts, including soil erosion and biodiversity loss

(Cheal 1986; Neave and Tanton 1989).

The behaviour of wildlife species in human modified environments becomes altered in many ways including changes to temporal activity patterns, spatial distribution, and habitat use (Ditchkoff et al. 2006). There are multiple examples of wildlife adjusting their behaviour to adapt to developed environments, such as raccoons

Procyon lotor altering their feeding and dispersal patterns (Prange et al. 2004), and

Florida scrub-jays Aphelocoma coerulescens modifying their feeding and reproductive patterns (Fleischer Jr et al. 2003). Although eastern grey kangaroos are common in many developed areas, relatively few populations have been studied

(Coulson et al. 2014). Few studies have directly compared the activity patterns of eastern grey kangaroos in developed and natural landscapes. The expansion of urban development across NSW is likely to have a profound effect on eastern grey kangaroo numbers and behaviour and it is essential to understand these effects in order to develop informed management strategies. This study evaluates how the behaviours differ between eastern grey kangaroos inhabiting active farmland surrounded by a developed environment and those inhabiting former farmland surrounded by pristine wilderness.

3.3. Methods

Data collection was conducted from December 2013 - August 2016 at two sites (Fig.

3.1) in NSW, an active farmland site surrounded by a developed environment

(hereafter referred to as developed), and a former farmland site surrounded by pristine wilderness (hereafter referred to as natural). The developed site was located at Yarramundi Paddocks at the Hawkesbury campus of WSU (33°36'47.85 "S/

150°43'47.429 "E). The campus is located in the peri-urban suburb of Richmond in the outer western suburbs of Sydney NSW that has an elevation of 19 m above sea level. Yarramundi paddocks consist of 308 ha of pasture, grassland, marshes and open woodland. Pastures at the developed site are used for grazing cattle. The developed site was fragmented by the surrounding landscape by roads and buildings.

The natural site was located at the Emirates One and Only Wolgan Valley Resort,

Newnes, NSW (33°13'41.02 "S/ 150°11'47.757 "E). The Wolgan Valley is a largely undeveloped area surrounding the Wolgan River in central west NSW. The natural site consisted of a conservation reserve at an eco-resort situated on 1619 ha of grasslands, woodland and riparian areas surrounded by National Parks and sandstone cliffs with an elevation of 551 m above sea level. The natural site was not fragmented from the surrounding landscape and contained limited buildings or roads.

Temperatures at the developed site ranged between 2.6°C and 41.7°C, and temperatures at the natural site ranged between -6.4°C and 33.3°C. Mean annual rainfall at the developed site was 834 mm, and at the natural site was 813 mm.

Temperatures varied throughout the seasons.

Infra-red camera traps (model BTC-1XR, Browning, Utah) were placed at 23 locations at the developed site and 12 locations at the natural site (Fig. 3.1). The infra-red sensors in these camera traps detect changes in surface temperature caused by the presence of animals and triggers the camera. The use of these cameras has been demonstrated as effective in measuring activity in this species (Green-Barber and Old 2018). Due to physical barriers in the developed landscape multiple cameras were placed in separate but nearby locations facing various directions to ensure broad coverage of the site. Some cameras were adjusted due to plant growth and cattle at the developed site throughout the study. Adjustments included returning cameras to their approximate original position if they were substantially moved by cattle brushing against them, and repositioning the height of cameras where vegetation had grown to obscure the sensor or lens. Multiple cameras at the natural site were placed in the same location facing alternating directions as these locations were suitable for viewing multiple directions for an adequate distance. Due to the

different approaches in camera placement, the number of separate locations with cameras was much lower at the natural site, however the number of camera angles and time the cameras were actively recording were comparable. Vegetation within the sites was categorized as either grassland (dominant vegetation grass), woodland

(dominant vegetation shrubs and trees), or fringe (dominant vegetation a mix of grasses, shrubs and trees that occurred where grasslands and woodlands met).

Cameras were placed as evenly as possible throughout the sites and vegetation areas but variation occurred due to accessibility and availability of a suitable tree or fence post to attach cameras (Table 3.1).

Cameras were set to record 1 min videos each time the sensor was triggered, with a 3 min delay following each video to avoid repeated documentation of the same event, and based on the methods used by Green-Barber and Old (2018). Cameras automatically recorded the time, date and temperature. Further data were manually recorded from videos, including group size and behavioural occurrences (Table 3.2).

Activity levels were calculated by recording the number of kangaroos exhibiting each behavioural category at 10-s intervals throughout each video, and activity patterns were calculated by examining the varying activity levels at different times which were then compared between sites. The sex of kangaroos was recorded where possible, however large males, and females with visible pouch young, were much easier to visually determine the sex, than small males and females with no visible pouch young. Due to this potential data bias, sex was not included as a variable in analysis. Statistical range and variance were calculated using Microsoft Excel for cameras within in each vegetation area, activity patterns at different times of day, group size at each site, and behavioural categories between sites.

Population density indices were estimated using the pellet counting method outlined by Meers and Adams (2003), and the pellet production rate (493/day) published by

Johnson and Jarman (1987). Circular plots (20m2, developed=15, natural= 12) were setup along randomly selected 300m long transects (developed= 5, natural= 4) at

150m intervals between December 2013-August 2014. The direction of transects were positioned to include all three vegetation types. The number of pellets present in each pre-cleared plot after 14 days was recorded and means were used to estimate the population density index for each site.

3.4. Results

3.4.1. Vegetation

Kangaroos at the developed site spent most time in woodland/grassland fringe areas

(range=78, variance= 833), followed by grassland (range=136, variance= 2838), with the least amount of time in woodland (range=100, variance= 1845). Kangaroos at the natural site spent most time in grasslands (range=297, variance= 22742), and approximately equal time in woodland (range=196, variance= 8926), and woodland/grassland fringe areas (range=176, variance= 6856) (Fig. 3.2). No individual kangaroo was followed for a 24 h period in this study, thus data are based on observations of many kangaroos and it cannot be known if the same kangaroos were present in multiple observations.

3.4.2. Time of day and temperature

Kangaroos at both sites were most active in the early morning and least active late at night (Fig. 3.3). The term active is used here to refer to camera detection of kangaroos exhibiting any of the behavioural categories examined. Kangaroos at the

developed site were most active between 0400-0900 hours (range=161, variance=

2295), and those at the natural site were most active between 0600-1100 hours

(range=178, variance= 2554). Activity levels declined in the middle of the day and increased again slightly in the late afternoon/evening. The activity levels of kangaroos at the developed site increased between 1400-1600 hours (shortly before dusk), and at the natural site increased later, between 1600-1800 hours (around dusk). Kangaroos at the developed site were more active between 11-25 °C, compared to the natural site where they were more active between 6-20 °C (Fig. 3.4).

3.4.3. Season

For both sites, activity was more evenly spread throughout the day in summer, but peaked around the middle of the day in winter (Fig. 3.5). At the developed site, activity in autumn peaked between 0600-1100 hours, and activity in spring peaked between 0300-1000 hours. The natural site had greatest activity in autumn between

0600-1100 hours, and activity levels in spring were highest between 0300-1000 hours.

3.4.4. Group size and density

The population density at the developed site was 4.6 kangaroos/ha, and the natural site was 1.3 kangaroos/ha. Group size was determined by counting the number of kangaroos visible in each video. The mean group size was determined by calculating the mean group size from all videos at each site. Mean group size at the developed site was 3.45 (range=19, variance= 9) and the natural site was 2.36 (range=13, variance= 3) (Fig. 3.6). Kangaroos at both sites spent most time in groups containing

1-5 individuals, however kangaroos at the developed site spent more time in larger groups (6-15 members) compared to those at the natural site.

3.4.5. Vigilance, feeding, travelling, resting, and self-grooming

Kangaroos at both sites spent the majority of time feeding and being vigilant.

Kangaroos at the developed site spent slightly less time feeding (range=55, variance=

1513) and more time being vigilant (range=322, variance= 51842) compared to those at the natural site (Fig. 3.7). Those at the developed site also spent more time lying down than those at the natural site (range=214, variance= 22898). More travelling behaviour was observed at the natural site compared to the developed site

(range=122, variance= 7442).

3.4.6. Interactions

More agonistic interactions (such as displacement or fighting) were observed at the developed site compared with the natural site (range=32, variance= 502). Kangaroos at the natural site participated in non-aggressive social interactions more frequently than at the developed site, including affinitive (range=21, variance= 273) and reproductive (range=10, variance= 46) interactions (such as allogrooming or social sniffing) (Fig. 3.8).

3.5. Discussion

The behaviour of eastern grey kangaroos at a developed and natural site were compared. The overall activity levels peaked earlier at the developed site than at the natural site. Kangaroos at the developed site spent most of their time in woodland/grassland areas with a higher mean group size of 3.45 individuals, whereas

kangaroos at the natural site spent most of their time in grassland with a smaller mean group size of 2.36 individuals. The population density at the developed site was much higher than at the natural site. More vigilance and agonistic interactions, and less travelling and feeding behaviour were observed at the developed site.

The fragmented nature of developed areas causes animals to adjust their landscape use patterns in order to access adequate resources (Ditchkoff et al. 2006). The developed site contained a smaller area of woodland that was utilized less than the larger unfragmented woodland at the natural site. The smaller woodland area at the developed site may mean that there is less area suitable for use by this species. The developed site consists of agricultural pastures that are used for grazing cattle, and it is likely that the forage quality is higher than at the natural site which is no longer used for livestock grazing and not fertilized. The abundant high quality vegetation in developed areas may improve foraging efficiency (Ditchkoff et al. 2006). The improvement of foraging efficiency has been shown to influence distribution of large herbivores (Langvatn and Hanley 1993) and may explain why the kangaroos spent less time feeding at the developed site. It is likely that a greater proportion of area at the developed site contained higher quality forage, enabling kangaroos to feed in these areas and avoid venturing too far from the tree line. Furthermore, the higher temperatures at the developed site may have caused kangaroos to seek out shade more frequently. Western grey kangaroos Macropus fuliginosus have been shown to have a low tolerance for being in direct sunlight during high temperatures and it is likely to be similar for eastern grey kangaroos as they have similar habitat requirements (Roberts et al. 2016).

The findings of this study are consistent with other studies that have found that eastern grey kangaroo activity increases around dawn and dusk, and decreases around midday (Caughley 1964; Clarke et al. 1989; Southwell 1987). Very few night time observations were recorded in this study. Conversely, other studies have found that eastern grey kangaroos are very active at night with most feeding occurring during that time (Caughley 1964; Southwell 1987). The kangaroos were reasonably close to the camera in all night recordings, whereas many of the recordings during the day were triggered by kangaroos at a much greater distance from the camera.

Previous studies have shown that camera trap detection distances are shorter at night

(Rowcliffe et al. 2014), and therefore camera trap data will underrepresent the nocturnal activity of kangaroos. The seasonal variations observed in this study were consistent with Southwell (1987), whereby activity levels of eastern grey kangaroos peaked earlier in summer and spring compared to autumn and winter.

Activity of kangaroos at the developed site may peak earlier to avoid human activity during the day. Many species have been found to temporally adjust their activity patterns in developed areas to avoid human activity (Ditchkoff et al. 2006). The types of human activities present are likely to influence the degree to which wildlife avoids humans. The natural site is more frequently utilised by humans on foot for bush walking and wildlife watching, photography, and associated eco-tourism activities. The human activity at the developed site in comparison to the natural site often involves vehicles. Kangaroos at the natural site are therefore more likely to be habituated to humans on foot when compared to kangaroos at the developed site.

Animals that are more habituated to humans are less likely to adjust their activity patterns to avoid humans and would be less vigilant in close proximity to human

activity, which may explain why less vigilance and later peak activity times were observed at the natural site. Artificial lighting, such as street lighting, has also been shown to impact the movement of eastern grey kangaroos within the landscape at this developed site (Green-Barber 2018), and likely impacts nocturnal activity. The differences in altitude and average temperature between sites is likely to have impacted activity patterns and it is unclear what proportion of the differences are attributed to development of the landscape or site specific differences.

Southwell (1987) found that eastern grey kangaroos spent most of the time feeding followed by resting and being vigilant. In this study, these three behaviours along with travelling were the most common behaviours observed at both sites, however resting behaviour was far less frequently observed than feeding and being vigilant.

Resting behaviour for extended periods will be underrepresented in camera data as the camera is triggered by surface temperature changes caused by movement

(Welbourne et al. 2016). Some of the recordings containing resting kangaroos appeared to be triggered by other animals moving within the field of view.

Kangaroos at the developed site spent more time in larger groups and had a higher population density. These findings are consistent with other studies that suggest there is a positive relationship between group size and population density in eastern grey kangaroos (Southwell 1984a; Taylor 1982). Southwell (1984a) reported mean group sizes between 2.8-10.45 kangaroos per group, which was similar to the mean group sizes at both sites in this study. Varying definitions of the term group have been used in macropod studies and in this study all kangaroos within the field of view of the camera were considered a group, whereas Southwell (1984a) used a distance criteria of <50m and the ability to maintain visual contact to define a group. These

differences in how a group is defined may affect results, the limited field of view of the camera means that kangaroos counted as part of the group were within 50m of one another however additional kangaroos may have been present within 50m and not captured on video.

Reduction of suitable habitat and human-induced barriers result in increased densities in some wildlife populations (Ditchkoff et al. 2006). Wildlife at developed sites may be concentrated near food or other resources (Ditchkoff et al. 2006). The population density at the developed site has rapidly increased since the study by

Spencer et al. (2012) and is likely to result in substantial management implications in the future. A kangaroo road kill ‘hot spot’ was recently reported adjacent to the developed site (Green-Barber 2018) and if this population continues to increase at this rate, then road mortalities and other human/kangaroo conflicts are likely to increase in the area. The higher population density at the developed site is likely to influence group composition and social interaction rates. Individuals may be more inclined to join a different group when population density is high because neighbouring groups are closer in proximity (creating an external influence), whereas in low density populations there is a greater risk of not finding another group to join

(Southwell 1984b).

Kangaroos at the developed site may exhibit higher levels of vigilance due to an increased human presence and visual barriers in the developed landscape. Visual barriers result in a reduced line of sight which could result in increased vigilance.

Dogs surrounding both sites were observed, and predation of a wallaroo Macropus robustus by dogs was reported at the natural site during the study period (personal communication Simone Brooks). Dingoes Canis familiaris have been reported to

attack eastern grey kangaroos (Purcell 2010). Since dogs are present at both sites, the increased vigilance at the developed site is more likely to be related to human activity and landscape differences than predation.

If the high density population at the developed site exceeds its carrying capacity then competition for resources between kangaroos would likely be increased. Increased competition, as well as other site specific differences are likely to have contributed to the difference in vigilance levels. Cattle were grazing in many of the pasture lands utilised by kangaroos at the developed site which is likely to have caused interspecific and intraspecific competition for resources. Video observations of cattle and kangaroos grazing nearby showed that kangaroos were quickly displaced by the close proximity of cattle which has been reported previously (Kaufmann 1975; Payne and Jarman 1999).

The increased agonistic behaviour observed at the developed site is likely to be a result of increased density and competition for resources, leading to a greater number of conflicts between individual animals. However the lower rate of non-aggressive social interactions suggests that while kangaroos are encountering each other more frequently, the majority of these encounters are not affinitive.

Conclusions

The findings of this study suggest that the behaviour of kangaroos in developed environments is modified to adapt to the changed landscape. Kangaroos in developed areas appear to spend more time in larger groups than kangaroos in natural areas, most likely due to an increased population density. Woodland/grassland areas were

the most commonly utilised areas at the developed site, likely the result of modified cattle grazing pastures which provided higher quality forage close to the tree line than the natural site where more time was spent in open grassland areas. Activity levels peaked earlier at the developed site, likely to avoid the diurnal activities of humans. Increased vigilance and agonistic interactions, and reduced travelling and feeding at the developed site can be attributed to multiple factors including increased population density, human activity, and barriers in the landscape. The findings of this study suggest that the activity budget of kangaroos varied between seasons and must be taken into account when planning management strategies. The increased food availability and its effect on reproduction are likely to cause the already high-density population at the developed site to continue to increase. An increase in this population will inevitably lead to further management issues in the area. Knowledge of the earlier peak activity time of kangaroos in developed areas will assist in developing management strategies to reduce human-animal conflicts. The effect of development on kangaroo populations will vary for each population due to site specific factors. Based on the findings of this study, the use of camera traps for monitoring changes in activity patterns is recommended for high density kangaroo populations in developed areas so that specific issues can be identified and addressed.

Acknowledgements

Funding was provided by the Western Sydney University and Jai Green-Barber was supported by an Australian Postgraduate Award Scholarship. We would like to thank

Tim Finter, Bradley Evans, and Kym Green for assisting with data collection, and the

Emirates One and Only Wolgan Valley Resort for use of the natural site. Animal

Ethics Committee (#A10297), and biosafety (#B10414) approvals were obtained from Western Sydney University. A scientific licence (#SL101256) was obtained from the NSW National Parks and Wildlife Service.

3.6. References

Adderton Herbert, C. 2004. Long-acting contraceptives: a new tool to manage overabundant kangaroo populations in nature reserves and urban areas. Australian Mammalogy 26: 67-74

Bond, A. R. F., Jones, D. N. 2014. Roads and macropods: interactions and implications. Australian Mammalogy 36: 1-14

Caughley, G. 1964. Social organization and daily activity of the red kangaroo and the grey kangaroo. Journal of Mammalogy 45: 429-436

Chambers, B., Bencini, R. 2010. Impact of human disturbance on the population dynamics and ecology of tammar wallabies on Garden Island, Western Australia. Pp. 211-218 in Macropods: the biology of kangaroos, wallabies and rat-kangaroos. edited by G. Coulson and M. Eldridge. CSIRO Publishing: Melbourne, Vic.

Cheal, D. 1986. A park with a kangaroo problem. Oryx 20: 95-99

Clarke, J., Jones, M., Jarman, P. 1989. A day in the life of a kangaroo: activities and movements of eastern grey kangaroos Macropus giganteus at Wallaby Creek. Pp. 611-618 in Kangaroos, wallabies and rat-kangaroos. edited by G. Grigg, P. Jarman and I. Hume. CSIRO Publishing: Melbourne, Victoria

Coulson, G. 1998. Management of overabundant macropods-are there conservation benefits. Pp. 37-48 in Managing Marsupial Abundance for Conservation Benefits. Issues in Marsupial Conservation and Management, Occasional Papers of the Marsupial CRC. Vol. 1. edited by A. Austin and P. Cowan.

Coulson, G. 2001. Overabundant kangaroo populations in southeastern Australia. In ‘Wildlife, Land, and People: Priorities for the 21st Century. Pp. 238-242 in Proceedings of the 2nd International Wildlife Management Congress’. 2001, Bethesda, Maryland, USA, edited by R. Field, R. Warren, H. Okarma and P. Sievert. The Wildlife Society: Valkó, Hungary.

Coulson, G., Alviano, P., Ramp, D., Way, S. 1999. The kangaroos of Yan Yean: history of a problem population. Proceedings of the Royal Society of Victoria 111: 121-130

Coulson, G., Cripps, J., Wilson, M. 2014. Hopping down the main street: eastern grey kangaroos at home in an urban matrix. Animals 4: 272-291. http://dx.doi.org/10.3390/ani4020272

Descovich, K., Tribe, A., McDonald, I. J., Phillips, C. J. 2016. The eastern grey kangaroo: current management and future directions. Wildlife Research 43: 576-589

Ditchkoff, S. S., Saalfeld, S. T., Gibson, C. J. 2006. Animal behavior in urban ecosystems: modifications due to human-induced stress. Urban Ecosystems 9: 5-12

Fleischer Jr, A. L., Bowman, R., Woolfenden, G. E. 2003. Variation in foraging behavior, diet, and time of breeding of Florida scrub-jays in suburban and wildland habitats. Condor 105: 515-527

Green-Barber, J., Old, J. 2018. Is camera trap videography suitable for assessing activity patterns in eastern grey kangaroos? Pacific Conservation Biology In Press. http://dx.doi.org/https://doi.org/10.1071/PC17051

Green-Barber, J. M. 2018. Behaviour, health, and group dynamics of free-ranging eastern grey kangaroos (Macropus giganteus). PhD. thesis, Western Sydney University, Richmond

Henderson, T., Rajaratnam, R., Vernes, K. 2017. Population density of eastern grey kangaroos (Macropus giganteus) in a periurban matrix at Coffs Harbour, New South Wales. Australian Mammalogy In Press. http://dx.doi.org/https://doi.org/10.1071/AM17010

Johnson, C. N., Jarman, P. J. 1987. Macropod studies at Wallaby Creek. 6. A validation of the use of dung-pellet counts for measuring absolute densities of populations of macropodids. Wildlife Research 14: 139-145. http://dx.doi.org/http://dx.doi.org/10.1071/WR9870139

Kaufmann, J. H. 1975. Field observations of the social behaviour of the eastern grey kangaroo, Macropus giganteus. Animal Behaviour 23: 214-221. http://dx.doi.org/10.1016/0003-3472(75)90066-4

Langvatn, R., Hanley, T. A. 1993. Feeding-patch choice by red deer in relation to foraging efficiency. Oecologia 95: 164-170

McDonnell, M. J., Pickett, S. T. 1990. Ecosystem structure and function along urban‐rural gradients: an unexploited opportunity for ecology. Ecology 71: 1232-1237

Meers, B. T., Adams, R. 2003. The impact of grazing by Eastern Grey Kangaroos (Macropus giganteus) on vegetation recovery after fire at Reef Hills Regional Park, Victoria. Ecological Management & Restoration 4: 126-132. http://dx.doi.org/10.1046/j.1442- 8903.2003.00147.x

Neave, H., Tanton, M. 1989. The Effects of grazing by kangaroos and rabbits on the vegetation and the habitat of other fauna in the Tidbinbilla Nature Reserve, Australian Capital Territory. Wildlife Research 16: 337-351. http://dx.doi.org/http://dx.doi.org/10.1071/WR9890337

Payne, A. L., Jarman, P. J. 1999. Macropod studies at Wallaby Creek. X. Responses of eastern grey kangaroos to cattle. Wildlife Research 26: 215-225

Prange, S., Gehrt, S. D., Wiggers, E. P. 2004. Influences of anthropogenic resources on raccoon (Procyon lotor) movements and spatial distribution. Journal of Mammalogy 85: 483-490

Purcell, B. V. 2010. A novel observation of dingoes (Canis lupus dingo) attacking a swimming eastern grey kangaroo (Macropus giganteus). Australian Mammalogy 32: 201- 204

Richardson, K. C. 2012. Australia's amazing kangaroos their conservation, unique biology and coexistence with humans. CSIRO Publishing: Collingwood, Victoria.

Roberts, J., Coulson, G., Munn, A., Kearney, M. 2016. A continent-wide analysis of the shade requirements of red and western grey kangaroos. Temperature 3: 340-353

Rowcliffe, J. M., Kays, R., Kranstauber, B., Carbone, C., Jansen, P. A. 2014. Quantifying levels of animal activity using camera trap data. Methods in Ecology and Evolution 5: 1170-1179

Schwanz, L. E., Robert, K. A. 2012. Reproductive ecology of wild tammar wallabies in natural and developed habitats on Garden Island, Western Australia. Australian Journal of Zoology 60: 111-119

Southwell, C. 1987. Activity pattern of the eastern grey kangaroo, Macropus giganteus. Mammalia 51: 211. http://dx.doi.org/10.1515/mamm.1987.51.2.211

Southwell, C. J. 1984a. Variability in grouping in the eastern grey kangaroo, Macropus giganteus I. Group density and group size. Wildlife Research 11: 423-435. http://dx.doi.org/10.1071/wr9840423

Southwell, C. J. 1984b. Variability in grouping in the eastern grey kangaroo, Macropus giganteus II. Dynamics of group formation. Wildlife Research 11: 437-449. http://dx.doi.org/10.1071/wr9840437

Spencer, R., Pankhurst, E., Dormer, J., Reid, A., Gould, A. 2012. Survey of Vertebrate Pests on the Hawkesbury Campus No. PESCWF12. University of Western Sydney.

Taylor, R. J. 1982. Group size in the eastern grey kangaroo, Macropus giganteus, and the wallaroo, Macropus robustus. Wildlife Research 9: 229-237. http://dx.doi.org/10.1071/wr9820229

Welbourne, D. J., Claridge, A. W., Paull, D. J., Lambert, A. 2016. How do passive infrared triggered camera traps operate and why does it matter? Breaking down common misconceptions. Remote Sensing in Ecology and Conservation 2: 77-83

Table 3. 1. The number of cameras placed in each vegetation area at each site.

Vegetation area Developed site Natural site Grassland 7 4 Woodland 8 4 Fringe 8 4

Vegetation area key: Grassland= dominant vegetation grass, Woodland= dominant vegetation shrubs and trees, Fringe= dominant vegetation a mix of grasses, shrubs and trees that occurred where grasslands and woodlands met

Table 3. 2. Categories used to record the behaviour of kangaroos.

Behaviour category Description

Vigilance Stands on hind legs with the body in an upright position

and the head either turning to scan the environment or still

with only the ears moving.

Feeding Any active uptake or chewing of food

Travelling Multiple consecutive pentapedal or bipedal movements

Resting Animal lies on the ground

Self-grooming Licking or scratching themselves

Affinitive interaction Any non-aggressive and non-reproductive interaction

between adult kangaroos, including; sitting or feeding in

contact, allogrooming, social sniffing or licking.

Agonistic interaction Any aggressive touch, movement or growl

Reproductive Any interaction relating to reproduction, including; males interaction closely following females, males nosing the cloaca or

pouch of a female, males having an everted and erect

penis, and intromission.

Mother-young Any interaction between a female kangaroo and it’s young interaction at foot, including; allogrooming, suckling, and play

fighting.

Figure captions

Figure 3.1. Map of camera locations at (A) a developed site located at Yarramundi

Paddocks at Hawkesbury campus of Western Sydney University, Richmond NSW, and (B) a natural site located at Emirates One and Only Wolgan Valley Resort,

Newnes, NSW.

Figure 3.2. The percentage of time kangaroos spent in woodland, grassland, and fringe areas at developed and natural sites.

Figure 3.3. The diurnal and nocturnal activity levels of kangaroos observed at a developed site and a natural site.

Figure 3.4. Activity levels of kangaroos at varying temperatures at a developed site and a natural site.

Figure 3.5. Activity levels of kangaroos across different seasons (A=summer,

B=autumn, C=winter, D=spring) at a developed site and a natural site.

Figure 3.6. The number of individuals in groups of kangaroos at a developed site and a natural site.

Figure 3.7. Percentage of time each behavior category was observed at a developed site and a natural site.

Figure 3.8. Percentage of time each type of interaction was observed at a developed site and a natural site.

Figures

Figure 3. 1.

A-

B-

Figure 3. 2.

30 natural

20 developed % time% spent in habitat 10

0 woodland grassland fringe

Habitat type

Figure 3. 3.

6 natural developed

% of occurrences 4

0 1 3 5 7 9 11 13 15 17 19 21 23 Hour of day (24h)

Figure 3. 4.

15 natural developed

% of occurrences 10

0 <5 6-10 11-1516-2021-2526-3031-3536-4041-4546-50 Temperature °C

Figure 3. 5.

16 20 14

12 15 10 8 10 6

% of occurrences% of 4 occurrences% of 5 2 0 0 1 3 5 7 9 11 13 15 17 19 21 23 1 3 5 7 9 11 13 15 17 19 21 23 Hour of day (24h) Hour of day (24h) A- B-

30 20

25 15 20

15 10

10 % of occurrences% of % of occurrences% of 5 5

0 0 1 3 5 7 9 11 13 15 17 19 21 23 1 3 5 7 9 11 13 15 17 19 21 23 Hour of day (24h) Hour of day (24h) C- D-

Figure 3. 1.

20 natural 15 developed % of occurrences 10

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Group size

Figure 3. 2.

100 90 80

70 interaction 60 self grooming 50 lying down 40 travelling % of occurrences 30 feeding 20 vigilance 10 0 natural developed Behaviour

Figure 3. 3.

100 90 80

70 60 mother young 50 reproductive 40 agonistic % of occurrences 30 other social 20 10 0 natural developed Type of interaction

Appendices- examples of photos from camera traps collected during this study

Appendix 1. Eastern grey kangaroos travelling in a fringe vegetation area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Fahrenheit.

Appendix 2. Eastern grey kangaroos displaying vigilance in a woodland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Fahrenheit.

Appendix 3. An eastern grey kangaroo looking at the camera in a woodland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Fahrenheit.

Appendix 4. Eastern grey kangaroos feeding in a fringe vegetation area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Fahrenheit.

Appendix 5. An eastern grey kangaroo being displaced by cattle in a fringe vegetation area at the developed site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

Appendix 6. An eastern grey kangaroo looking at the camera, and another travelling in a fringe vegetation area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and

the temperature is displayed in Fahrenheit.

Appendix 7. Eastern grey kangaroos having an agonistic interaction in a woodland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Fahrenheit.

Appendix 8. Eastern grey kangaroos grazing and displaying varied levels of vigilance in a fringe vegetation area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the

100

image, and the temperature is displayed in Fahrenheit.

Appendix 9. An eastern grey kangaroo displaying vigilance, and another feeding in a grassland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

Appendix 10. Eastern grey kangaroos feeding in a grassland area at the developed site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

101

Appendix 11. An eastern grey kangaroo resting in a grassland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

Appendix 12. An eastern grey kangaroo holding some grass in the left forelimb and displaying vigilance, and another feeding in a grassland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

102

Appendix 13. Eastern grey kangaroos feeding in a grassland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

Appendix 14. An eastern grey kangaroo self-grooming in a grassland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

103

Appendix 15. An eastern grey kangaroo looking at the camera in a grassland area at the developed site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

Appendix 16. Eastern grey kangaroos travelling in a grassland area at the developed site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

104

Appendix 17. Eastern grey kangaroos travelling in a grassland area at the developed site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

Appendix 18. An eastern grey kangaroo resting in a grassland area at the natural site, captured by infrared camera during surveys of eastern grey kangaroos. The date and time are displayed on the image, and the temperature is displayed in Celsius.

105

CHAPTER 4

4. What influences road mortality rates of eastern grey

kangaroos in a semi-rural area?

Jai M. Green-Barber and Julie M. Old

106

4.1. Chapter outline and authorship

Chapter 4 examines the spatial and temporal factors that influence road mortality in eastern grey kangaroos. The study was conducted on the roads surrounding Hawkesbury Campus,

Western Sydney University, Richmond NSW. The identification of spatial and temporal factors that influence road mortality in kangaroos highlights the necessary areas for improvement for future road design, and effective deterrent strategies that can be used to minimise the likelihood of wildlife road mortality.

I am the primary and corresponding author of this jointly authored manuscript that is under review for publication at the time of writing this thesis. I conceived the initial proposal and I performed all field procedures and most of the data analysis. I recorded the location of road killed kangaroos in the study area, setup transects to measure landscape features, and performed data handling and preliminary analysis. A/Prof Julie Old supervised the research and provided feedback on the developing manuscript.

We would like to acknowledge and thank the editor and anonymous reviewers who provided feedback on the following manuscript prior to its acceptance by the journal.

This chapter is a paper under review for publication and should be cited as:

Green-Barber Jai M., Old Julie M. (2018) What influences road mortality rates of eastern grey kangaroos in a semi-rural area? BMC Ecology, Under Review.

107

ABSTRACT

Background: Roads have major ecological impacts on wildlife. Vehicle collisions most frequently impact large herbivores due to their larger home range compared to smaller animals, and higher population density compared to carnivores. Kangaroos

(Macropus spp.) account for a large proportion of reported wildlife vehicle collisions that occur in NSW, Australia. We aimed to evaluate what influenced road mortality of eastern grey kangaroos (Macropus giganteus) in a temperate rural/suburban region. The location of roadkilled kangaroos found on or near two 1 km areas of road in Richmond NSW was recorded throughout 2014 and 2015. Weather and moon phase data were recorded for the date of each roadkilled kangaroo. Transects were setup on both roads, and multiple road and landscape features, including the width of roadside, fence construction, habitat type, and distance from street lights measured at

50 meter intervals. Data were analyzed to explore which landscape features and temporal factors influenced the occurrence of a roadkill hotspot.

Results: More kangaroo road mortalities occurred during periods of low temperature and low rainfall, and these factors are likely to affect forage quality. Fewer mortalities occurred when rain was falling. A greater number of mortalities occurred during the waning gibbous phase of the lunar cycle. Significantly more road mortalities occurred a short distance from the end of a section of street lights.

Conclusions: The findings suggest that illumination influences the likelihood of kangaroo road mortalities. Knowledge of factors that influence where and when kangaroos are most likely to cross roads can be used to inform more targeted management strategies and improve future road design to reduce the incidence of wildlife vehicle collisions.

108

109

4.2. Background

Roads have multiple ecological impacts on wildlife including fragmentation of habitats and isolation of populations [1, 2]. The most commonly and easily observed impact of roads on wildlife is road mortality. Large mammal species in the USA,

Canada and Europe, including roe deer (Capreolus capreolus), elk (Cervus canadensis) and moose (Alces alces) are the primary species involved in wildlife vehicle collisions [3, 4], and can significantly impact the population size of many species [5-8]. Roads affect wildlife directly through road mortality, and also impact habitat use and dispersal due to habitat fragmentation, barrier effects and noise disturbance [9-12].

Wildlife are attracted to roadsides by resources that are rare or limited in other areas, including water and high quality foods [13-16]. Roads provide foraging areas and reduce predation pressures for some species [12]. Urban development reduces the available habitat and therefore roadside vegetation provides a significant proportion of suitable habitat in modified landscapes [17]. Animals that frequently cross roads to gain access to resources have an increased risk of road mortality.

Roadkill hotspots are areas with a higher rate of wildlife vehicle collisions than other surrounding areas. Hotspots may result from resources or attractive habitat features occurring close to the roadside, or when two particularly valuable resources occur on opposite sides of the road causing animals to cross frequently. Hotspot analysis compares the features associated with areas of high wildlife vehicle collision rates, with areas of low wildlife vehicle collision rates [18-20]. Although some roadkill studies have examined the influence of landscape features, there are insufficient species specific studies that account for the different habitat preferences of different species in different areas [16].

110

With Australia’s road network covering over 810,600 km [21], and kangaroos being Australia’s largest native terrestrial mammal species, they account for a large proportion of wildlife vehicle collisions. Klöcker et al. [4] recorded the number of eastern grey kangaroos (Macropus giganteus), western grey kangaroos (Macropus fuliginosus), red kangaroos (Macropus rufus), common wallaroos (Macropus robustus) killed on a section of outback highway in far western NSW, and reported a roadkill rate of 0.03 kangaroos per km, per day, whilst Burgin and Brainwood [21] estimated that over 9 million kangaroos and wallabies are killed annually on

Australian roads. Kangaroo vehicle collisions lead to high costs for drivers and insurance companies, in the tens of millions of dollars, through vehicle damage and human distress, injury and death [4, 22].

The behavioral responses of different species affects road mortality rates [23].

Some prey species avoid threats by freezing, increasing the amount of time spent on roads when vehicles are approaching, and results in a higher road mortality rate [23].

Large macropods reportedly respond to threats in different ways. Western grey kangaroos respond to a perceived threat by slowing down or standing still, whereas red kangaroos respond to threats by fleeing [23]. Eastern grey kangaroos are physiologically more similar to western grey kangaroos and are likely to react to perceived threats in a similar way and therefore likely exhibit similar antipredator behavioral adaptations which increase their risk of road mortality.

Landscape features surrounding the road also influence the likelihood of road mortality. Klöcker et al. [4] compared locations with a high incidence of eastern grey kangaroo road mortality with locations without a high incidence of road mortality on a stretch of highway in an arid region of Australia, and found no relationship between the taller patches of vegetation and road mortality. Other studies that have

111

evaluated the effect of vegetation on road mortalities have focused on the reduced visibility to drivers caused by increased vegetation [18, 19]. Ramp et al. [24] modelled mortality hotspots for multiple wildlife species in the Snowy Mountains region of NSW and found a greater incidence of kangaroo road mortality in areas with little tree cover and near a large dam, whilst a study by Visintin et al [25] modelled eastern grey kangaroo vehicle collisions in Victoria. Insufficient species specific studies have been conducted which evaluate the influence of attractive landscape features on road mortality of eastern grey kangaroos in temperate regions or semi-rural/semi-suburban areas in N SW. We compare the spatial and temporal variables at locations and times that have high kangaroo road mortality, with areas of low kangaroo road mortality on roads adjacent to the Hawkesbury campus of

Western Sydney University (WSU), N S W. and surrounding farmlands.

4.3. Methods

4.3.1. Study area

Research was conducted on roads surrounding WSU Hawkesbury campus, a semi-rural site fragmented by university buildings and residential areas, but also fenced farm paddocks and woodlands (Fig.4.1). The Hawkesbury campus of WSU is located in the semi-rural suburb of Richmond in the temperate zone of NSW.

4.3.2. Transects

Two 1km transects were established along Castlereagh Road

(33°36'31.01"S/150°43'9.82"E - 33°36'12.12"S/150°43'39.18"E) and Londonderry

Road (33°37'24.80"S/150°44'23.33"E - 33°36'54.14"S/150°44'28.73"E) each with 20 sample sites at 50 m intervals. Landscape variables were measured on both sides of the road at each 50m interval.

112

4.3.3. Animals

We checked roads daily. Only freshly deceased (within 24h) eastern grey kangaroos were used for analysis. We recorded the GPS location of roadkilled kangaroos with blunt trauma injuries consistent with vehicle collision found on or near roads in the study area between February 2014 and December 2015. We estimated the strike location of each collision based on the position of the kangaroo and the location of vehicle tire marks and blood. The gender and body measurements

(testis circumference (males), head length, neck to tail base, foot length with and without toenail, tail length and tail diameter) of each animal were recorded. These morphometric measurements were chosen as they are commonly used to infer macropod body size and body condition [26-28].

4.3.4. Season, weather and moon cycle

Kangaroo vehicle collisions were assumed to have occurred during the evening prior to discovery. We recorded the season, maximum and minimum daily temperatures, average monthly rainfall, and moon phase for the date of each kangaroo road mortality. All weather data were obtained from Australian Bureau of

Meteorology records from the closet weather station to the study site [29], and moon cycle data from the Sydney Observatory website [30].

4.3.5. Road, roadside and barriers

We recorded the following parameters at each transect interval; the width of area between the painted road edge and the nearest barrier (fence), the width of the road, and the height and type of construction of the fence (if present) on each side of the road. Fence construction types were categorized as a horizontal wire cattle fence

(large flexible gaps >20cm), chain link fence (small flexible gaps <10cm), welded

113

mesh fence (small rigid gaps <10cm), wooden ranch fence (large rigid gaps >20cm), or sheet metal fence (no gaps).

4.3.6. Habitat features

Canopy cover (%) and habitat type were recorded at each interval on each side of the road. The percentage of canopy cover was calculated using guidelines from Walker and Hopkins [31].

Habitat types were categorized as woodland (predominantly (>50%) trees and shrubs), grassland (predominantly grass), or built environment (buildings and hard landscaping eg. concrete). Areas with woodland habitat on one side of the road and grassland habitat on the other side accounted for the majority (57.5%) of sample sites. Sites with grassland habitat on both sides of the road were the second most common (20%), closely followed by sites with grassland on one side of the road and built infrastructure on the other (17.5%). Very few sample sites had woodland habitat on both sides of the road.

4.3.7. Vehicle speed and street lights

The roads used in this study have both 60km/h and 80km/h speed zones. We recorded the distance of each roadkill from where the speed limit increases to

80km/h. The majority of sample sites (95%) were in areas where the speed limit was

80km/h. The sample sites used in the study were spaced at varying distances from where the speed limit changed from 60 km/h to 80 km/h. Most sample sites were further than 400 m (57.5%) from where the speed limit changed. The remaining sites were either within 100 m (12.5%), or between 100-200 m (10%), 200-300 m (10%), or 300-400 m (10%) from where the speed limit changed.

Both roads used in this study have sections with street lights and sections with no street lights. We measured the distance of each roadkill from the nearest

114

street light. The sample sites used in the study were spaced at varying distances from the nearest street light. Most sample sites were either within 100 m (20%) or further than 400 m (35%) from the nearest street light. The remaining sites were either between 100-200 m (15%), 200-300 m (15%), or 300-400 m (15%) from the nearest street light.

4.3.8. Analysis

Data from sample sites where roadkill were recorded were compared with data from sample sites where no roadkill were recorded. We analyzed data using

Microsoft Excel 2010 and SPSS 2015 to determine which landscape features and environmental conditions influence the occurrence of road mortality in kangaroos.

A generalized linear model with a logistic link and binomial error for the presence of a road mortality was used to analyze the effect of temperature, rainfall, moon visibility and different moon phases. A Firth penalized likelihood method was used to allow for collinearity and low prevalence. We used a chi-squared test to evaluate the overall effect of moon phase, and the Breusch-Godfrey test to test for temporal autocorrelation. The fit of the data were evaluated using the Hosmer and

Lemeshow goodness of fit test. Data for temperature, rainfall and moon cycle were plotted as odds ratios.

We used a generalized linear model with a logistic link and binomial error for the presence of a road mortality to analyze the effect of the width of the roadside, canopy cover, habitat type, size of fence and type of fence on each side of the road.

A generalized linear model with a log link and Poisson error for the presence of a road mortality was used to analyze the effect of the distance from speed limit change, distance from the nearest street light, the width of the road, habitat type, and the type of fence. For analysis we categorized the type of fence as either easy or hard. Easy

115

fences included wire cattle fences and those with gaps between fencing as these areas were considered the easiest for kangaroos to pass through. We categorized all other fence types as hard due to more rigid construction and lack of larger gaps. Fence type on both sides of the road was treated as a three level variable, with “easy-easy”,

“easy-hard” or “hard-hard”; where “easy-easy” meant there was an easy type of fence for a kangaroo to pass on both sides of the fence. We used a likelihood ratio test to further evaluate the effect of fence type on road mortalities.

4.4. Results

Twenty three roadkilled eastern grey kangaroos were recorded on roadsides in the study area. The data showed a slight male bias with 60% of all kangaroo roadkill being male, however this was not statistically significant. Roadkilled males had a mean tail length of 90 cm (± 14), and a mean tail diameter of 8 cm (± 3). Roadkilled females had a mean tail length of 65 cm (± 12), and a mean tail diameter of 5 cm (±-

1).

Residuals (the difference between observed and predicted values) must be independent of each other in order to assume that variables are not highly correlated.

No evidence was found of autocorrelation in the temporal residuals (P value=0.71).

Results of the Hosmer and Lemeshow goodness of fit test found X-squared = 2.4, df

= 8, P value = 0.97, suggesting that the generalized linear model used was a good fit for the data collected.

4.4.1. Season, weather and moon cycle

The most roadkilled kangaroos (48%) occurred during winter (June- August) on dates with average minimum and maximum daily temperatures of 5.7°C -20.3°C.

Fewer road mortalities occurred on days with a higher minimum temperature (P

116

value=0.07) (Fig.4.2). No kangaroo road mortalities occurred during summer. Most male kangaroo roadkill occurred during winter (83.33%) and the remainder occurred during autumn (16.67%), however half of female kangaroo roadkill occurred during autumn (50%), and the rest occurred during spring (37.5%) and winter (12.5%).

Kangaroo road mortalities occurred more frequently during months with lower rainfall, and significantly fewer mortalities occurred on days with recorded rainfall than on days with no rainfall (P value=0.03).

The results of the chi-squared test showed that the overall effect of moon phase on road mortalities was not significant (chi-squared=7.85 df= 7 P value= 0.346).

More mortalities occurred during moon phases with high illumination, although this result was also not significant (P value =0.20). However a significantly greater number of road mortalities (47%) occurred during the waning gibbous phase compared with all other moon phases (P value=0.02) (Fig.4. 3).

4.4.2. Effect of road and roadside width, and barrier type

Sites where kangaroo road mortalities occurred had a mean taller fence and narrower road and roadside than sites with no kangaroo mortalities, however this was not statistically significant.

The majority of kangaroo road mortalities occurred near wire cattle fences

(65%), the rest were near welded mesh fences (20%), and chain link fences (15%).

No kangaroo road mortalities were recorded near sheet metal fences, wooden ranch fences or areas with no nearby fence. The majority of sites with multiple kangaroo road mortalities recorded throughout the study period were near wire cattle fences

(60%), the rest were near chain link fences (20%), and welded mesh fences (20%).

More male kangaroo road mortalities occurred near wire cattle fences (39%) and more female kangaroo road mortalities occurred near welded mesh fences (57%).

117

As kangaroos were likely to be crossing the road when mortalities occurred it is important to consider fencing on the opposite side of the road from roadkilled kangaroos. Most kangaroo road mortalities occurred in areas with wire cattle fences on both sides of the road (52%), followed by wire cattle fences on one side of the road and welded mesh fence on the opposite side (21%), and chain link fence on one side of the road and welded mesh fence on the opposite side (17%) (Fig.4. 4).

No significant difference was observed between the number of road mortalities that occurred near fences categorized as ‘easy’ or ‘hard’ to pass through (P value=0.13). The number of road mortalities that occurred in areas with ‘easy’ to pass through fences on both sides of the road and areas with hard to pass through fencing on one side (P value=0.39) or both sides (P value=0.92) was not significantly different. The results of the likelihood ratio test also showed the effect of fence type on road mortality was not significant (Deviance=0.90315, df =2 , P value= 0.64).

4.4.3. Effect of habitat

Areas with less than 20% canopy cover on both sides of the road accounted for most (42.5%) sample sites. The majority of remaining sites had less than 20% canopy cover on one side of the road, and either between 60-79% (17.5%), 80-100%

(15%) or 40-59% (10%) canopy cover on the other side of the road. Only 10% of sample sites had greater than 20% canopy cover on both sides of the road, and 5% of sites had greater than 60% canopy cover on both sides of the road.

Almost 85% of all kangaroo road mortalities occurred adjacent to a woodland habitat, however the association between mortalities and woodland habitat was not significant (P value= <0.98). Kangaroo road mortalities occurred at all sites surveyed with woodland on both sides of the road, 52% of sites surveyed with woodland on one side of the road and grasslands on the other, and 33% of sites surveyed with

118

grassland on both sides of the road (Fig.4. 5). The association between sites with woodland habitat on at least one side of the road was not significant (P value= 0.11).

Sites with kangaroo road mortalities had a slightly higher average canopy cover (31

± 37%) than sites with no kangaroo road mortalities (canopy cover 24 ± 34%), however the difference was not significant (P value=0.55).

4.4.3. Effect of vehicle speed and street lighting

The majority of kangaroo road mortalities (90%) occurred in areas where the speed limit was 80 km/h. Most kangaroo road mortalities occurred between 300-400 m (20%) and 800-900 m (20%) where speed limits increased from 60km/h to

80km/h. Only 15% of kangaroo road mortalities occurred within 100 m of where the speed limit increased. The association between the distance from the speed limit change and the occurrence of roadkill was not significant (P value= 0.31).

The majority of kangaroo road mortalities (95%) occurred on sections of road with no street lighting. Most kangaroo road mortalities (40%) occurred within 100m of a street light, and the second most (35%) occurred between 100-200 meters from a street light (Fig.4. 6). The distance from the nearest street light significantly affected the probability of roadkill occurrence (P value=0.02).

4.5. Discussion

We investigated the occurrence of kangaroo road mortalities in the temperate, semi-rural area of Richmond NSW. A slight male bias of roadkilled kangaroos was observed. Increased kangaroo road mortalities occurred during periods of low temperatures and low rainfall, which corresponded to winter, as well as during moon phases with higher illumination and in unlit areas near street lights. No significant effect of habitat on kangaroo road mortality was observed, however more mortalities

119

occurred in areas with a woodland habitat on at least one side of the road and had a slightly higher percentage canopy cover than areas with no kangaroo road mortalities.

A male bias in road mortalities has previously been reported for eastern grey kangaroos and other macropods [32, 33]. Populations of eastern grey kangaroos however have a higher proportion of females [34-36]. Therefore the higher proportion of male kangaroo road mortalities is probably due to behavioral differences and larger home range that cause males to be more exposed to the risk of road mortality [33, 37-39].

Male eastern grey kangaroos are larger than females [40], and this difference in body size may contribute to the male bias in road mortality. Road mortality involving larger species reportedly occur more often than smaller species, and usually involves mammals rather than birds or reptiles [41]. Ford and Fahrig [42] suggested that body size may influence road mortality in two ways; smaller animals occupy less space which can allow vehicles to pass by or over the animal without hitting it, however smaller animals are more difficult for a motorist to visually detect and actively avoid.

The effect of body size may not be the same for species over a certain size. The smallest adult animal in the current study was a female kangaroo with a neck to tail base measurement of 32 cm and tail length of 40 cm so is still a relatively large animal and is likely to be visually detected. Female eastern grey kangaroos are not small enough to safely pass beneath a vehicle without being hit. Therefore, the male bias observed is probably due to behavioral differences that cause males to cross roads more frequently or make them more difficult to actively avoid.

Most kangaroo road mortalities occurred during winter, perhaps due to a decrease in food availability and nutritional value, and is likely to cause kangaroos to

120

travel further and cross roads more frequently to access resources over a wider area.

An increase in kangaroo road mortality during winter is consistent with the findings of a study by Coulson et al. [43]. Winter has less hours of daylight, which is likely to result in an increased number of vehicles on the road outside daylight hours, and may also lead to extended hours of activity for nocturnal and crepuscular species of wildlife. Kangaroo road mortalities occurred more often in months with low temperature and low rainfall which most likely resulted in decreased pasture growth

[44] and may have attracted kangaroos to high quality vegetation nearer the roadside or caused them to travel further to access high quality vegetation in other areas.

The findings of the current study indicate that significantly fewer road mortalities occurred on dates when there was rainfall. There is likely to be reduced visibility during rainfall which could decrease the ability of drivers to detect an animal on the road, therefore if kangaroos were crossing roads at equal rates in different weather then kangaroo vehicle collisions should occur more frequently when it is raining. Fewer kangaroo road mortalities occurred when it was raining which suggests that kangaroos may be less active when it is raining and are less likely to cross the road in these conditions.

The majority of male kangaroo road mortalities occurred in winter, however a high proportion of female kangaroo road mortalities occurred in autumn and spring.

Male eastern grey kangaroos may range further in winter compared to females because of their larger body size [45, 46] and to access females from multiple groups. These results are consistent with the findings of Coulson et al. [43] that male kangaroos ranged further during winter to access a variety of habitats and resources, whereas females remained in the same area.

121

Significantly more kangaroo road mortalities occurred during the waning gibbous moon phase than any other phase of the lunar cycle. An increase in kangaroo road mortality around the full moon phase of the lunar cycle has been previously reported, however this finding was based on four phases of the lunar cycle (rather than eight) [32, 47]. As the waning gibbous phase immediately follows the full moon it is likely that road mortalities during this phase have previously been reported as part of the full moon phase. Coulson [32] suggested that the observed increase in kangaroo road mortality around the full moon indicates that kangaroos are more active during this time, and as kangaroos are crepuscular, adequate moonlight illumination may allow for greater mobility than during times of complete darkness.

Built infrastructure acts as barriers, which may limit the direction in which animals can disperse. No significant influence of different fencing on kangaroo road mortality was detected in this study, however more kangaroo road mortalities occurred near wire cattle fences than other fence types. Wire cattle fences are ‘easy’ for kangaroos to pass through, making it easier to access the road and roadside areas at these locations. Clevenger et al.[48] suggested that fencing along road sides can contribute to roadkill hotspots because they ‘funnel’ animals to cross roads in the areas where there are gaps in the fencing. Sections of fence that are easier to pass through than other fences along the same road are likely to produce a similar effect.

One fence type is likely to allow kangaroos to pass through easily and enter the road area, where as the other fence type is presumably more difficult for the kangaroos to pass through and may prevent exiting from the road area, or vice versa.

No significant difference was observed between the number of kangaroo road mortalities in different habitats, however more occurred in areas with a woodland habitat on at least one side of the road, and some had grassland habitat on the other

122

side. Slightly more sample sites used in this study had woodland on one side of the road and grassland habitat on the other than any other habitat combination, which may have influenced the results. Kangaroos utilize a variety of habitats and regularly leave heavily wooded areas to access grassland habitats [49]. Therefore if different resources occur on either side of a road, then kangaroos are more likely to cross that road.

Woodland habitats create greater visual cover which may provide perceived security for wildlife, but may also obstruct motorists’ ability to see wildlife and result in an increased incidence of roadkill [18, 19]. Areas with kangaroo road mortalities had a slightly higher percentage canopy cover than areas with no kangaroo road mortalities; however most sample sites had less than 20% canopy cover on both sides of the road, so the true effect of canopy cover may not be reflected in these results.

Night time illumination varies temporally in relation to the moon cycle. The level of night time illumination also varies spatially due to the presence of artificial street lighting. Significantly more road mortalities occurred on sections of road with no street lighting but were within 200 m of street lighting. The sample sites were very close to evenly distributed between the varying distances from street lighting which further suggests that this finding is an accurate reflection of the effect of street lighting on kangaroo road mortality. Predatory species such as dingoes (Canis lupus dingo) and wild dogs increase activity in lighter conditions whereas prey species decrease activities in lighter conditions in response to a perceived increased risk to predators [50]. As a prey species, macropods are likely to prefer darker areas of the landscape to reduce their risk of predation [50]. Coulson [32] suggests that subdued lighting allows for increased mobility which may explain why kangaroos choose to traverse the edge of lit areas. Based on this it is speculated that the effect of the

123

distance from street lighting on kangaroo road mortality would decrease as moonlight illumination increased, however further investigation would be required to confirm this.

The location of street lights is likely to affect where wildlife cross roads, and may also impact motorists’ ability to detect wildlife on the road. The distance at which wildlife on the road can be detected by drivers is significantly influenced by fur brightness, rather than body size [51]. As eastern grey kangaroos have dark fur they are likely to be detected at a shorter distance at night than species with brighter fur. The human retina is able to detect light at very low intensities. Cone receptors adapt to light change faster than rod receptors [52] resulting in it taking more time for the human eye to adjust from bright light to low light than it does to adjust from low light to bright light. Due to the retinas delayed adaptation from bright light to low light, it is likely that drivers are less able to see wildlife on or near roads in unlit areas that occur immediately after a well-lit area. These effects would be magnified when travelling at higher speeds.

Most kangaroo road mortalities occurred within an 80 km/h speed zone, and occurred at varying distances (100-900m) from areas where the speed limit increased. The distance from the location where the speed limit increased from 60 km/h to 80 km/h did not have a significant effect on kangaroo road mortalities.

Hobday A.J. and Minstrell [11] found that areas with higher vehicle speeds had increased road mortality for a variety of taxa, however road mortality at lower speeds was higher for some species such as wallabies that often dash suddenly out of roadside vegetation. The findings of the current study support the suggestion of

Hobday A.J. and Minstrell [11] that reduced vehicle speed is more effective in reducing road mortality for slower moving and slower reacting species, and less

124

effective for faster moving species such as macropods that are still likely to be killed at lower speeds.

Conclusions

Based on the findings of this study, it appears that illumination influences the likelihood of kangaroo road mortalities. Moon illumination cannot be altered to reduce the likelihood of road mortalities because it varies with the moon cycle .

Warning drivers of the increased kangaroo activity during certain moon phases may assist in reducing kangaroo road mortalities. Temporary flashing signs have shown some success in reducing deer roadkill [53]. Flashing road signs that activate during times of high moon illumination should be trialed in areas with a high incidence of kangaroo road mortalities to evaluate whether this would be effective in reducing kangaroo road mortalities.

Street lighting however can be altered to reduce the likelihood of road mortalities and should be a consideration of urban design. It is recommended that lighting along roadsides should aim to be more uniform where practicable and not create gaps where wildlife will be funneled into areas of lower visibility and result in roadkill hotspots. Chachelle, Chambers, Bencini and Maloney [54] found that the construction of a large arched underpass reduced the likelihood of road mortality for western grey kangaroos without affecting their home ranges. Similar methods are likely to reduce road mortality in eastern grey kangaroos as the two species have many morphological and behavioral similarities. Eastern grey kangaroos have been reported to utilize underpasses however no studies have been conducted to evaluate their effectiveness in reducing road mortality rates [55]. Chachelle, Chambers,

Bencini and Maloney [54] conducted their study on an area of highway that was

125

completely fenced which is likely to have increased the success of this method and should be considered in future management plans.

Declarations

Ethics approval and consent to participate

Animal care and ethics (#A10297), and biosafety (#B10414) approvals were obtained from WSU. A NSW scientific license (#SL101256) was obtained from the

National Parks and Wildlife Service.

Consent for publication

Not applicable.

Availability of data and material

All information is included in the manuscript

Competing interests

The authors declare that they have no competing interests.

Funding

Funding was provided by Western Sydney University and Jai Green-Barber was supported by an Australian Postgraduate Award Scholarship.

Authors' contributions

JMGB and JMO participated in the study conception and study design. JMGB was responsible for data collection and data analysis. JMGB wrote the initial draft of the manuscript, which was reviewed critically by JMO. All the co-authors participated in revising the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We would like to thank Bradley Evans for assistance with collecting field data, and

Hayley Stannard, Eden Hermsen, Jason Flesch, and Ricky Spencer for assistance in locating kangaroo road mortalities.

126

4.6. References

1. Lode T. Effect of a motorway on mortality and isolation of wildlife populations. Ambio. 2000;29:163-166. 2. Corlatti L, Hacklaender K, Frey‐Roos F. Ability of wildlife overpasses to provide connectivity and prevent genetic isolation. Conserv Biol. 2009;23:548-556. 3. Seiler A. Predicting locations of moose–vehicle collisions in Sweden. J Appl Ecol. 2005;42:371-382. 4. Klöcker U, Croft DB, Ramp D. Frequency and causes of kangaroo–vehicle collisions on an Australian outback highway. Wildl Res. 2006;33:5-15. 5. Puglisi MJ, Lindzey JS, Bellis ED. Factors associated with highway mortality of white-tailed deer. J Wildl Manage. 1974;38:799-807. 6. McCown JW, Kubilis P, Eason TH, Scheick BK. Effect of traffic volume on American black bears in central Florida, USA. Ursus. 2009;20:39-46. 7. Dique DS, Thompson J, Preece HJ, Penfold GC, de Villiers DL, Leslie RS. Koala mortality on roads in south-east Queensland: the koala speed-zone trial. Wildl Res. 2003;30:419-426. 8. Jones ME. Road upgrade, road mortality and remedial measures: impacts on a population of eastern quolls and Tasmanian devils. Wildl Res. 2000;27:289-296. 9. Brandenburg DM. Effects of roads on behavior and survival of black bears in coastal North Carolina. Thesis. University of Tennessee, 1996. 10. Francis CD, Barber JR. A framework for understanding noise impacts on wildlife: an urgent conservation priority. Front Ecol Environ. 2013;11:305-313. 11. Hobday AJ, Minstrell ML. Distribution and abundance of roadkill on Tasmanian highways: human management options. Wildl Res. 2008;35:712-726. 12. Morelli F, Beim M, Jerzak L, Jones D, Tryjanowski P. Can roads, railways and related structures have positive effects on birds?–A review. Transportation Research Part D: Transport and Environment. 2014;30:21-31. 13. Lee E. The ecological effects of sealed roads in arid ecosystems. Thesis. University of New South Wales, 2006. 14. Barrientos R, Bolonio L. The presence of rabbits adjacent to roads increases polecat road mortality. Biodivers Conserv. 2009;18:405-418. 15. Grosman P, Jaeger J, Biron P, Dussault C, Ouellet J-P. Reducing moose-vehicle collisions through salt pool removal and displacement: an agent-based modeling approach. Ecol Soc. 2009;14:139. 16. Bond ARF, Jones DN. Roads and macropods: interactions and implications. Aust Mammal. 2014;36:1-14. 17. Soanes K. The conservation of mammals in Victoria's roadsides. Victorian Naturalist, The. 2016;133:79. 18. Bashore TL, Tzilkowski WM, Bellis ED. Analysis of deer-vehicle collision sites in Pennsylvania. J Wildl Manage. 1985;49:769-774. 19. Hubbard MW, Danielson BJ, Schmitz RA. Factors influencing the location of deer- vehicle accidents in Iowa. J Wildl Manage. 2000;64:707-713. 20. Litvaitis J, Tash J. An approach toward understanding wildlife-vehicle collisions. Environ Manage. 2008;42:688-697. 21. Burgin S, Brainwood M. Comparison of road kills in peri-urban and regional areas of New South Wales (Australia) and factors influencing deaths. In: D. Lunney, Munn A, Meikle W, editors.Too close for comfort: Contentious issues in human- wildlife encounters. Mosman: Royal Zoological Society of New South Wales; 2008. p. 137-144.

127

22. Barthelmess EL, Brooks MS. The influence of body-size and diet on road-kill trends in mammals. Biodivers Conserv. 2010;19:1611-1629. 23. Jacobson SL, Bliss Ketchum LL, Rivera CE, Smith WP. A behavior based framework for assessing barrier effects to wildlife from vehicle traffic volume. Ecosphere. 2016;7. 24. Ramp D, Caldwell J, Edwards KA, Warton D, Croft DB. Modelling of wildlife fatality hotspots along the snowy mountain highway in New South Wales, Australia. Biol Conserv. 2005;126:474-490. 25. Visintin C, Ree R, McCarthy MA. A simple framework for a complex problem? Predicting wildlife–vehicle collisions. Ecology and evolution. 2016;6:6409-6421. 26. Frith H, Sharman G. Breeding in wild populations of the red kangaroo, Megaleia rufa. Wildl Res. 1964;9:86-114. 27. Poole W, Merchant J, Carpenter S, Calaby J. Reproduction, growth and age determinatipon in the yellow footed rock wallaby Petrogale xanthopus Gray, in captivity. Wildl Res. 1985;12:127-136. 28. Moss G, Croft D. Body condition of the red kangaroo (Macropus rufus) in arid Australia: the effect of environmental condition, sex and reproduction. Aust J Ecol. 1999;24:97-109. 29. Climate Data Online [http://www.bom.gov.au/climate/data/] 30. Moon phase calendar [https://maas.museum/sydney-observatory/astronomy- resources/moon-phase-calendar/] 31. Walker J, Hopkins M. Vegetation. In: McDonald R, Isbell R, Speight J, Walker J, Hopkins M, editors.Australian Soil and Land Survey Field Handbook. 2 edition. Melbourne: Inkata Press; 1990. 32. Coulson G. Road-kills of macropds on a section of highway in central victoria. Wildl Res. 1982;9:21-26. 33. Coulson G. Male Bias in Road-kills of Macropods. Wildl Res. 1997;24:21-25. 34. Jarman P, Southwell C. Grouping, associations, and reproductive strategies in eastern grey kangaroos. In: Wrangham R, Rubenstein D, editors.Ecological aspects of social evolution. Princeton: Princeton University Press; 1986. p. 399-428. 35. Jaremovic RV, Croft D. Social organization of the eastern grey kangaroo (Macropodidae, Marsupialia) in southeastern New South Wales. I. Groups and group home ranges. Mammalia. 1991;55:169-186. 36. Quin D. Age structures, reproduction and mortality of the eastern grey kangaroo (Macropus giganteus Shaw) from Yan Yean, Victoria. In: Grigg G, Jarman P, Hume I, editors.Kangaroos, Wallabies and Rat-kangaroos. Chipping Norton: Surrey Beatty & Sons Pty. Ltd; 1989. p. 787-794. 37. Arnold GW, Steven DE, Grassia A, Weeldenburg J. Home-range size and fidelity of western grey kangaroos (Macropus fuliginosus) living in remnants of Wandoo Woodland and adjacent farmland. Wildl Res. 1992;19:137-143. 38. Evans M. Home ranges and movement schedules of sympatric bridled nailtail and black-striped wallabies. Wildl Res. 1996;23:547-555. 39. Paplinska JZ, Eldridge MD, Cooper DW, Temple-Smith PD, Renfree MB. Use of genetic methods to establish male-biased dispersal in a cryptic mammal, the swamp wallaby (Wallabia bicolor). Aust J Zool. 2009;57:65-72. 40. Richardson KC. Australia's amazing kangaroos their conservation, unique biology and coexistence with humans. Collingwood, Victoria: CSIRO Publishing; 2012. 41. Teixeira FZ, Coelho IP, Esperandio IB, da Rosa Oliveira N, Peter FP, Dornelles SS, Delazeri NR, Tavares M, Martins MB, Kindel A. Are road-kill hotspots coincident among different vertebrate groups? Oecologia Australis. 2017;17:36-47. 42. Ford AT, Fahrig L. Diet and body size of North American mammal road mortalities. Transp Res Part D: Transp Environ. 2007;12:498-505. 43. Coulson G, Cripps J, Wilson M. Hopping down the main street: eastern grey kangaroos at home in an urban matrix. Animals. 2014;4:272-291.

128

44. Keys M, Leech F. The graziers guide to pastures. Dubbo and Orange: NSW Agriculture; 2000. 45. Michelena P, Bouquet PM, Dissac A, Fourcassie V, Lauga J, Gerard J-F, Bon R. An experimental test of hypotheses explaining social segregation in dimorphic ungulates. Anim Behav. 2004;68:1371-1380. 46. Ruckstuhl KE, Neuhaus P. Sexual segregation in ungulates: a comparative test of three hypotheses. Biol Rev Camb Philos Soc. 2002;77:77-96. 47. Buchanan K. Sharing the way with wildlife: road mortality, macropods and mitigation. Thesis. Griffith University, 2005. 48. Clevenger AP, Chruszcz B, Gunson KE. Highway mitigation fencing reduces wildlife-vehicle collisions. Wildl Soc Bull. 2001;29:646-653. 49. Viggers KL, Hearn JP. The kangaroo conundrum: home range studies and implications for land management. J Appl Ecol. 2005;42:99-107. 50. Gaston KJ, Bennie J, Davies TW, Hopkins J. The ecological impacts of nighttime light pollution: a mechanistic appraisal. Biol Rev Camb Philos Soc. 2013;88:912- 927. 51. Hobday AJ. Nighttime driver detection distances for Tasmanian fauna: informing speed limits to reduce roadkill. Wildl Res. 2010;37:265-272. 52. Purves D, Augustine GJ, Fitzpatrick D, Katz LC, LaMantia A-S, McNamara JO, Williams SM. Functional specialization of the rod and cone systems. In: editors.Neuroscience. 2 edition. Sunderland MA: Sinauer Associates; 2001. 53. Sullivan TL, Williams AF, Messmer TA, Hellinga LA, Kyrychenko SY. Effectiveness of temporary warning signs in reducing deer-vehicle collisions during mule deer migrations. Wildl Soc Bull. 2004;32:907-915. 54. Chachelle PD, Chambers BK, Bencini R, Maloney SK. Western grey kangaroos (Macropus fuliginosus) include fauna underpasses in their home range. Wildl Res. 2016;43:13-19. 55. Cramer P, Olsson M, Gadd ME, van der Ree R, Sielecki LE. Transportation and large herbivores. In: Rodney vdR, Smith DJ, Grilo C, editors.Handbook of Road Ecology.

John Wiley & Sons, Ltd; 2015. p. 344-352.

129

Figure captions

Fig. 4.1. Hawkesbury campus (WSU) and transects on Castlereagh and Londonderry

Roads, Richmond, NSW (2016).

Fig. 4.2. The odds of a road mortality occurring in relation to the minimum temperature and rainfall.

Fig. 4.3. The odds of a road mortality occurring in relation to the different moon phases.

Fig. 4.4. The frequency of roadkilled kangaroos recorded near different combinations of fencing on both sides of roads.

Key: WC= wire cattle fence, WM= wire mesh fence, CL= chain link fence, WR= wooden ranch fence, G= gap

Fig. 4.5. The percentage of each habitat type where kangaroo road mortalities occurred (both sides of road).

Key: W= woodland, G= grassland, B= built (eg. building or driveway), RK= roadkill present, no RK= no roadkill present. Only habitat combinations present within the study site were included in this graph.

Fig. 4.6. The percentage of roadkilled eastern grey kangaroos recorded various distances from street lights.

130

Figures

Figure 4. 1.

131

Figure 4. 2.

132

Figure 4. 3.

133

Figure 4. 4.

134

Figure 4. 5.

135

Figure 4. 6.

136

CHAPTER 5

5. The genetic relatedness of an urban population of

eastern grey kangaroos.

Jai M. Green-Barber and Julie M. Old

137

5.1. Chapter outline and authorship

Chapter 5 identifies the genetic relationships present in a free-ranging population of eastern grey kangaroos in an urban area. The study was conducted at Hawkesbury Campus, Western

Sydney University, NSW. Knowledge of the genetic relationships present in a population of kangaroos provides insight on the genetic diversity and dispersal of this high density and fragmented population.

I am the primary and corresponding author of this jointly authored manuscript that is under review for publication at the time of writing this thesis. Julie Old and I conceived the initial proposal and I performed all field procedures and data analysis, and the majority of the laboratory procedures. I collected blood and tissue samples from deceased or captured kangaroos, and extracted DNA from samples. Fine mapping and custom genotyping was performed by the Australian Genome Research Facility. I analysed the data to assess genetic diversity and identify parent-offspring and sibling relationships using CERVUS 3.0.7.,

GENEPOP 4.2 and COLONY 2.0.6.1. A/Prof Julie Old supervised the research and provided feedback on the developing manuscript.

We would like to acknowledge and thank the editor and anonymous reviewers who provided feedback on the following manuscript prior to its acceptance by the journal.

This chapter is a paper under review for publication and should be cited as:

Green-Barber Jai M., Old Julie M. (2018) The genetic relatedness of an urban population of eastern grey kangaroos. BMC Research Notes, Under Review.

138

Abstract

Objectives and methods: The genetics of an eastern grey kangaroo (Macropus giganteus) population surrounded by landscape barriers was examined. DNA was extracted from tissue samples from 22 road killed kangaroos, as well as blood samples from four live captured kangaroos. Amplified loci were used to determine relatedness between individual kangaroos.

The level of relatedness and location of road killed kangaroos were compared to evaluate spatial autocorrelation.

Results: The expected and observed heterozygosity confirmed the locus were polymorphic and highly informative for use in this population. One pair of kangaroos were identified to be full siblings, and a high proportion were identified as half siblings. Six positive parentage assignments were detected. No correlation between relatedness and crossing site was detected.

5.2. Introduction

Social animals have distinct mating and dispersal patterns which influence the genetics within populations [1]. Understanding how these mating and dispersal patterns influence genetics is useful for developing management strategies and conservation efforts. Various factors influence reproductive performance of individuals, including group composition, nutrition, and kin selection [2]. Group composition and kin selection are affected by dispersal patterns [3]. Roads create barriers in the landscape that can restrict the dispersal and therefore gene flow of wildlife populations [4]. Populations with restricted gene flow may suffer from inbreeding and an increase in genetic defects [5]. Genetic markers have been used to evaluate the barrier effect of roads in a variety of vertebrate species including the common frog (Rana temporaria), bank vole (Clethrionomys glareolus), desert bighorn sheep (Ovis canadensis nelsoni), and roe deer (Capreolus capreolus) [6-9].

There is insufficient data available regarding the genetic impacts of roads on macropods

[10], and very little is known about the group structure of eastern grey kangaroos. Although

139

there is some evidence that suggests that the social organization of eastern grey kangaroos

(Macropus giganteus) is random, many studies have found non-random associations that relate to gender, age, and reproductive status [11-16]. Therefore it is likely that the social organization of this species may be more structured than previously thought.

Eastern grey kangaroo mobs (sub-populations) are comprised of long term associates with overlapping home ranges [17]. Mobs consist of multiple groups that vary in size and composition as individuals regularly join and leave different groups [17]. The home range of male eastern grey kangaroos can reportedly range between 7.6 - 269 ha, and the home rage of females can range between 9.3 - 248 ha [18]. Adult males often have a larger home range than females and associate with multiple sets of females which vary in age and reproductive status [19, 20]. Eastern grey kangaroos disperse randomly and do not appear to hold territories [21]. Physical barriers in the landscape may limit movement, and low food availability causes populations to be more dispersed, hence both factors likely affect genetics within a population [22].

Molecular techniques of DNA analysis are commonly used to study population genetics [23].

The relatedness of individuals can be determined using microsatellites [24]. Microsatellites are loci (sections within DNA sequences) consisting of repeating tandem sequences of one- six nucleotides [24]. Repeat units are surrounded by DNA know as flanking regions [25]. A combination of repeat units and flanking regions are used in developing microsatellite primers [25].

Since the analysis of microsatellites was enabled by the introduction of polymerase chain reaction (PCR) amplification in the late 1980s, they have become widely used in population genetics and genome mapping [26]. Microsatellites are often highly polymorphic, suggesting that mutations are frequent, and therefore makes them useful genetic markers [26]. In marsupials, the use of microsatellite markers in population studies is limited by the success of PCR to amplify specific loci [23] [27]. Loci are amplified from DNA samples by PCR

140

[28], and the successful amplification of alleles is visualized using gel electrophoresis, and genetic relationships between individuals assessed [27].

Microsatellite markers have been developed for several species and can often be used for closely related species [29]. Nine microsatellite markers were developed for eastern grey kangaroos in a study by Zenger and Cooper [30]. The microsatellite loci of eastern grey kangaroos were found to be highly polymorphic and contain between 8-19 alleles [30]. The use of microsatellites to analyses genetic relationships within populations will likely enhance and expand our knowledge of social structures in kangaroos.

There are numerous advantages to using microsatellites as genetic markers. Microsatellite markers are locus specific, and therefore more useful than multi-locus markers such as minisatellites [31]. Because PCR amplification is used, small quantities or degraded tissue can be examined [25], such as that associated with road kill samples. Microsatellite markers have a wide range of applications including degree of relatedness and parentage of individuals in a population [25, 27]. Group information can also be discovered using microsatellites, including size, demographic history, genetic distances, and gene flow between populations [25].

Genetic analysis can also be used to determine spatial autocorrelation (correlation between genetics and geographic distance) which provides insight on gene flow and dispersal. Spatial autocorrelation is a statistical method used to compare genetic and geographical distance between individuals to examine the degree of spatial genetic structure within a population

[32, 33]. Neaves et al. [18] has reported that eastern grey kangaroo populations had a negative correlation between relatedness and geographic distance. Males often disperse more than females in many species, particularly social mammals [34]. As a result, a higher level of spatial autocorrelation is expected in females [18]. Some species may adjust sex-specific dispersal patterns in response to local social and environmental pressures [3]. Adjusted dispersal patterns have been observed in many species, including Red deer (Cervus elaphus),

141

Mountain gorillas (Gorilla beringei beringei) and Seychelles warblers (Acrocephalus sechellensis) [35-37]. Knowledge of spatial genetic structure within a population can also be very useful for informing management strategies.

Roads surrounding a 308ha paddock in Richmond NSW were identified as a road kill hot spot for eastern grey kangaroos [38]. The population density of kangaroos inhabiting the paddock was previously estimated as 4.6 kangaroos/ha [39]. Based on the site area and population density, there were estimated to be 1416 kangaroos utilizing the site. Previous research into kangaroos at this site has included live capture where blood samples were taken

[40]. The presence of a road kill hot spot and other landscape barriers are likely to impact dispersal and gene flow. This chapter focusses on the genetics of those individuals sampled as part of the aforementioned studies. Sibships and parent-offspring relationships were identified to determine whether there is a high level of relatedness in this population. The study also examined whether there was any correlation between relatedness and road crossing site.

5.3. Methods

5.3.1. Study site

Research was conducted at Yarramundi Paddocks (33°36'47.85"S/ 150°43'47.429"E), WSU

Hawkesbury campus, a semi-rural site fragmented by university buildings and residential areas, but also fenced farm paddocks and woodlands (Fig. 5.1). Yarramundi Paddocks has an area of approximately 308 ha, and consists of pastures, grasslands, marshes, and open woodland. The site is located on the corner of Bourke Street and Londonderry Road, in the semi-rural suburb of Richmond, NSW. The two main roads included in this study were

Castlereagh and Londonderry Roads which run through approximately 4km of university property and separate paddocks and woodland areas. Multiple other smaller and residential roads immediately surrounding the site were also included. Built infrastructures such as buildings and fencing present at the site and may affect the dispersal of animals in this area.

142

5.3.2. Sample Collection and DNA Extraction

Ear clippings were collected from 22 deceased kangaroos found on or near roads in the study area between July 2013 and October 2015. Body measurements, gender, GPS location and general observations were also recorded [38]. Ear clippings were stored in zip lock bags at -

80°C. Blood samples were taken from four live kangaroos. A blood sample was taken from the tail vein using a 21 gauge needle from four live kangaroos at the site that were captured using chemical restraint as part of another study [40]. Blood samples were stored in EDTA coated Vacutainer tubes (Becton, Dickinson and Company, New Jersey) stored at -80°C.

Genomic DNA was extracted from ear clippings or blood samples from 26 kangaroos (7 adult female, 15 adult male, and 4 juvenile) using the Qiagen DNeasy® Blood and Tissue

Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.

5.3.3. Microsatellites

Individuals were genotyped at 20 fluorescently labelled microsatellite loci (Table 5.1), using a primer panel compiled by Mark Eldridge. The panel comprised of five tammar wallaby

(Macropus eugenii) primers labelled ‘Me’ [41], since used for eastern grey kangaroos by

Zenger, Eldridge and Cooper [42], five eastern grey kangaroo primers labelled ‘G’ [30], and seven primers isolated from the tammar wallaby and cross-amplified in the eastern grey kangaroo labelled ‘T’ [43]. Genotyping was carried out at the Australian Genome Research

Facility (AGRF), Melbourne.

Table 5. 1. microsatellite primers used for relatedness analysis of eastern grey kangaroos

Size Primer Repeat Forward Sequence Reverse Sequence Dye Panel Range GTTTCTTCCAGACAAGTAAGGAT Me17 di GGGGTATGAACTAGATGACC 117-147 FAM 1 GCTG GGGACAGAATTTTATTGACCT GTTTCTTTAATTTCTCTGGGTGA T46.5 tetra 177-192 FAM 1 AGTG GCACAG GTAGAAACCCACCCATTTACC GTTTCTTTGCTAGACACCTGTGG T4.2 di 122-167 NED 1 C TTTGAG GTTTCTTTTGTGGAGTAGGAGA Me2 di CTCTCCCCATAAGAAAGATC 227-277 NED 1 AGGTC

143

AGTGTGCTACAGTTGTATTTGTGTTTCTTAAATTATATTTGCACCT G20.2 di 147-167 PET 1 C AGAATAAG GTTTCTTACCCCAACACTCTCCCT G16.1 di CAGAGGCTCTCTTATCATCCTG 167-187 VIC 1 TC AGCTAATTGAGTGTGTGTGGA GTTTCTTAATGTAGGGATACAA T3.1T tetra 257-337 VIC 1 TAG GGAAACATC GTTTCTTCCATCTATGCTCTTGTG G31.1 di CATCTTCCTTTGGAGACCTCAC 122-142 FAM 2 GAAAC GTTTCTTCCAGTGGGAGTTGAG Me14 di ACTGGGGCAAAATACAGGG 167-217 FAM 2 TCATATC TGGATAGGTAAATGAATAGATGTTTCTTAGCTTTGATAAAGGAA T19.1 tetra 127-182 NED 2 AG TATC GTTTCTTCTTGTCTCACACAGCC Me15 di GGAGCCATCTTAGGAAGACT 232-277 NED 2 TAGG GTTTCTTGGTGCCAAAAATCCCT Me1 di AATATCACTCCCTTCCCCCCA 147-177 PET 2 GG ATTGTGGCTAGCATAACAGTG GTTTCTTGGCTGATATTTTTGGT T15.1 di 152-167 VIC 2 C AAATTCC GTTTCTTAAGGGAGAGATAATA G26-4 tetra GGTCTTTCCTCAACTTTTGTTC 267-377 VIC 2 AGGATGG TCAGGATTTTATTCTTCCATCT GTTTCTTTTGGGGAGAAGATTTT T31.1 di 122-147 FAM 3 TTC TGAGAG GTTTCTTGGACACATTGTCAAAG G15.4 di TCTGCCTCTGATTCTATTGCTG 207-247 FAM 3 AGATGC GTTTCTTAGCTAACCAAATAAAC T32.1 di CTCCCCATAGGAGTCTCCAC 142-167 NED 3 TACAC GTTTCTTGGAATCCTCAGGCGCT Me16 di TTGGGCTGTCTCCTCATCTG 247-287 NED 3 ATGA GTTTCTTCAATCAAGCATCCCAG Me28 di GAGGTGGTGGGATTGGAATC 147-197 PET 3 ACAG GTTTCTTACAGTTTGCTTGCACG Me27 di CCTCTAGCCATTTTACAAAT 167-177 VIC 3 CATC

* ‘Me’ primers were obtained from [41], ‘G’ primers were obtained [30], and ‘T’ primers were obtained from [43].

5.3.4. Genetic diversity indices

Allele frequencies, PIC (Polymorphic Information Content), the observed heterozygosity

(Ho) and expected heterozygosity (He), exclusion probabilities and estimate potential null- allele rates were calculated using CERVUS 3.0.7. GENEPOP 4.2 was used to test for departure from Hardy-Weinberg Equilibrium (with 1000 iterations per 500 batches, S. E. >

0.01), and genetic linkage disequilibrium (with1000 iterations per 1000 batches, S.E. > 0.01).

Markov chain parameters were used for all tests and the log likelihood ratio statistic was also used for genetic linkage disequilibrium testing. Loci were considered to deviate from the

Hardy-Weinberg Equilibrium if p<0.05. Loci were considered to have linkage disequilibrium

144

if p<0.000. Loci that did not deviate from the Hardy-Weinberg Equilibrium or have linkage disequilibrium, and had a null allele frequency < 0.05, were determined to be a potential marker to determine relatedness.

5.3.5. Parentage and sibship analysis

Molecular analysis of blood samples was used to determine genetic relationships including parentage and sibship among the study subjects. CERVUS 3.0.7 was used to determine the most likely parent pair for each candidate offspring using a pair-wise maximum likelihood estimation. Parent offspring pairs were positively assigned if they had an LOD score greater than 0, and also had 1 or fewer mismatched loci. All adult kangaroos sampled were included as candidate parents and all kangaroos (juvenile and adult) sampled were included as candidate offspring. Full and half sibships were calculated using COLONY 2.0.6.1. Only sibships with a probability value of 0.5 or higher were included in the results.

Excel was used to calculate means and create summary tables. Excel to Graphviz

Relationship Visualizer was used to create a chart showing the genetic relationships identified in the study population.

5.3.6. Spatial analysis

The distance between pairs of road killed kangaroos was measured using Google Earth.

Kangaroos found in close proximity were assumed to have overlapping home ranges. The majority of road killed kangaroos were found on roads on the north-west side, and south-east side of the study site. Kangaroos found on the north-west side of the study site were assumed to utilize the adjacent semi-rural residential properties as part of their home range.

Kangaroos found on the south-east side of the study site were assumed to utilize the adjacent

WSU campus paddocks as part of their home range. Linear regression (IBM SPSS Statistics

23) was used to evaluate if there was a relationship (>0.5) between the relatedness of pairs of road killed kangaroos and the distance between their locations, as well as between relatedness and the direction of the road kill from Yarramundi Paddocks.

145

Two adult male kangaroos were fitted with a colored ear tag (Allflex Pty Ltd, Capalaba

Australia) and a VHF tracking collar (Sirtrack Ltd, Hawkes Bay New Zealand). Kangaroos were tracked on foot using a VHF antenna from July 2014 to May 2016. Locations were calculated using the GPS location of the researcher and the distance (determined by a range finder) of the kangaroo.

The data from VHF tracking was used to estimate the home range of the tracked kangaroos.

Home ranges were analyzed using the online ZoaTrack facility (The University of

Queensland) [44]. Minimum convex polygons were calculated for all points (100%), approximate home range (95%), and core range (50%) based on the definitions of Jaremovic and Croft [45]. Polygons were calculated using the R package adehabitatHR within the

ZoaTrack facility [46]. The proportion of overlapping ranges were calculated using the static territorial interaction equation as described in White and Garrott [47].

5.4. Results

5.4.1. Microsatellite marker properties and genetic diversity indices

Twenty-four kangaroo (7 adult females, 14 adult males, and 3 juveniles) microsatellite markers were sufficiently amplified for genetic analysis. One locus (Me2) failed to amplify and was removed from further testing. Three loci (Me1, Me27, and T46.5) deviated from the

Hardy-Weinberg Equilibrium and significant null allele frequencies (> 0.05) were observed, therefore these loci were not included in further analysis. Significant null allele frequencies were also observed for G20.2, Me14, Me15, Me16, Me17, T15.1 and T31.1, however as these loci were within the Hardy-Weinberg Equilibrium they were still included in analysis.

Genetic linkage disequilibrium (p > 0.000) was not observed in any of the loci tested.

The mean expected heterozygosity of microsatellite loci analyzed was 0.707, the mean observed heterozygosity was 0.661, and the mean PIC score (polymorphism information content) was 0.658 (Table 5.2). The number of alleles per locus ranged between 23 to 24

146

(mean 23.625). The majority (14/16) of the loci had an expected and observed heterozygosity, and PIC score greater than 0.5. Locus G20.2 had an observed heterozygosity, and PIC score less than 0.5, and locus T4.2 had an expected and observed heterozygosity, and PIC score less than 0.5.

147

Table 5. 2. Genetic diversity estimates of 16 microsatellite loci used for kinship assignment of eastern grey kangaroos

Locus N HObs HExp PIC F(Null) NE-1P NE-2P NE-PP

G15.4 23 0.870 0.848 0.808 -0.027 0.512 0.340 0.165

G16.1 23 0.913 0.829 0.791 -0.061 0.529 0.354 0.167

G20.2 24 0.417 0.508 0.469 0.080 0.864 0.701 0.523

G26-4 24 0.875 0.835 0.795 -0.036 0.529 0.354 0.174

G31.1 23 0.696 0.708 0.653 -0.005 0.713 0.534 0.342

Me14 24 0.625 0.786 0.734 0.111 0.623 0.445 0.262

Me15 24 0.542 0.674 0.619 0.106 0.747 0.570 0.379

Me16 23 0.696 0.807 0.759 0.061 0.587 0.408 0.224

Me17 23 0.696 0.839 0.796 0.082 0.534 0.359 0.182

Me28 24 0.708 0.795 0.750 0.048 0.593 0.414 0.223

T15.1 24 0.500 0.675 0.599 0.148 0.766 0.608 0.442

T19.1 23 0.870 0.700 0.659 -0.185 0.701 0.512 0.301

T3.1T 24 0.708 0.704 0.648 -0.020 0.719 0.541 0.352

T31.1 24 0.583 0.674 0.606 0.058 0.751 0.586 0.404

T32.1 24 0.667 0.734 0.672 0.038 0.692 0.520 0.336

T4.2 24 0.208 0.191 0.169 -0.049 0.983 0.915 0.852 mean 23.625 0.661 0.707 0.658 0.022 0.678 0.510 0.333

Number of alleles (N), observed heterozygosity (HObs), expected heterozygosity (HExp) polymorphism information content (PIC), the frequency of null alleles (F (null)), and average non-exclusion probabilities (NE-1P, NE-2P, NE-PP) as estimated by CERVUS.

5.4.2. Relatedness

COLONY was used to assign sibship for 24 eastern grey kangaroos (Fig. 5.2). Relationships were detected for 92% of kangaroos examined. One full sibling was identified, and 54 half sibships were identified (relatedness probability >0.5). Parentage analysis was conducted for

148

21 candidate parents and 24 candidate offspring using CERVUS. Positive parentage assignments were determined for six offspring (Table 5.3). LOD scores ranged between 2.5-

8.8. No sibships of parent offspring relationships were detected for two of the male kangaroos sampled (RK04 and RK17).

Table 5. 3. Parentage assignment of three eastern grey kangaroo offspring at Hawkesbury Campus of Western Sydney University

Offspring Candidate parent LOD Pair loci mismatching

RK16 DCH3 8.062 0

RK12 RK13 5.096 0

RK19 RK23 2.466 0

RK24 RK21 7.262 0

RK7B RK7A 8.798 0

RK19 RK20 0.951 1

Criteria for positive assignment of parentage = LOD > 0, mismatch ≤ 1.

5.4.3. Geographical distance and home range

Seventy seven percent (N=13) of kangaroos killed while crossing Londonderry road were related to other kangaroos killed on Londonderry road. RK02, RK08, RK12, RK18, RK19,

RK20 and RK21 were all killed on Londonderry road and also had at least one half sibling also killed on Londonderry road. RK13 and RK20 were identified as the most likely parents of RK12 and RK19, all of which were also killed on Londonderry road. No kangaroos killed while crossing Castlereagh road were related to other kangaroos killed on Castlereagh road, however 64% were related to kangaroos killed on Londonderry road and 36% were killed on other nearby roads. No significant correlation was found between the probability of relatedness and the distance between road kill (R=0.362) or the direction of road kill from

Yarramundi paddocks (R=0.314).

149

The total home range of the collared male kangaroos using all points (100%) was 170.9 ha

(DCH3), and 174.8 ha (DCH5) (Fig. 5.3). The approximate home range (95%) was 67.3 ha

(DCH3), and 52.1 ha (DCH5). The core ranges were calculated to be 10.3 ha (DCH3), and

18.5 ha (DCH5). Home ranges of both males included areas within Yarramundi paddocks and the semi-rural residential properties to the north/west across Castlereagh road. The proportion of DCH3s total (100%) home range that was overlapped by DCH5 was 0.17

(95%=0.42, 50%=0.40). the proportion of DCH5s total (100%) home range that was overlapped by DCH3 was 0.16 (95%=0.54, 50%=0.22). Sibship analysis determined a relatedness probability of 0.1 for half sibship of the two tracked males which does not constitute a positive sibship assignment.

5.5. Discussion

Genetic analysis was used to determine the relatedness of 24 eastern grey kangaroos in an urban population in Richmond, NSW. The expected and observed heterozygosity confirmed the locus were polymorphic and highly informative. One pair of kangaroos was identified to be full siblings, and a high proportion were identified to be half siblings. Six positive parentage assignments were detected. The majority of kangaroos killed while crossing

Londonderry road were related to other kangaroos killed on Londonderry road, however no significant relationship between relatedness and crossing site was observed.

Expected and observed heterozygosity, as well as PIC score was greater than 0.5 for 14 of the locus analyzed, and therefore were confirmed to be polymorphic and highly informative.

Previous studies have also reported heterozygosity estimates greater than 0.5 for other populations of eastern grey kangaroos [18, 42, 48].

Little evidence of genetic structure was observed in this population of eastern grey kangaroos and is consistent with previous research [18]. One full sibling was identified. A high proportion of kangaroos in this population were identified as half siblings. Half of the identified sibships (50%) were between male and female kangaroos. Male-male sibships

150

were more common (38%) than female-female sibships (12%). At least one relationship was detected for all female kangaroos sampled, however no relationships were detected for two male kangaroos (RK04 and RK17). The average number of relationships was slightly higher for females (5.14) than males (4.29). The spatial genetic structure of eastern grey kangaroos is influenced by movement patterns, home ranges, and densities [49]. Male kangaroos have a larger home range than female kangaroos [19]. The higher level of relatedness among males in this population may be an indication that dispersal is restricted. The greater number of male-male sibships observed may also be a result of the greater number of males sampled in this study. Neaves et al. [18] found limited differences in the spatial genetic structure of male and female eastern grey kangaroos.

Positive parentage assignments were identified for six offspring. Other assigned parents had

LOD scores lower than 0, or had multiple mismatching loci and therefore were probably more distantly related. The majority (four) of the assigned parents were female. Female parents had positively identified offspring of both genders whereas male parents only had positively identified male offspring. Males and females with positively identified offspring had a slightly higher average number of relationships (5.00 and 4.50 respectively) than other kangaroos in this study, indicating that individuals with more genetic relationships within the population also had greater reproductive success. In contrast Miller et al. [48] found that female kangaroos prefer mates that are less genetically similar to avoid inbreeding. It was not possible to sample all potential parents or offspring in this population, therefore it is likely that the parents and offspring of sampled kangaroos may have still been present within the site but were not included in the study.

Kangaroos killed in some locations were more related to each other than those at other locations, however genetic relatedness did not significantly correlate with choice of crossing area. Conversely, Neaves et al. [18] reported a negative correlation between relatedness and geographic distance in eastern grey kangaroos. The majority (77%) of kangaroos killed while

151

crossing Londonderry road were related to other kangaroos killed on Londonderry road.

However, no kangaroos killed while crossing Castlereagh road were related to other kangaroos killed on Castlereagh road, but some were related to other kangaroos killed on

Londonderry road and other nearby roads. VHF collar tracking of two adult male kangaroos captured at the site indicate that their home range includes areas on both sides of Castlereagh road. Londonderry road runs between Yarramundi paddocks and other adjacent paddocks, whereas Castlereagh road runs between Yarramundi paddocks and semi-rural residential properties. High levels of dispersal and immigration between populations is common in eastern grey kangaroos [42]. The data is likely to be influenced by the majority of kangaroos dispersing in similar directions across Londonderry road to access resources in the other paddocks, regardless of relatedness.

The total (100%) home ranges for tracked kangaroos were 170.9 ha (DCH3), and 174.8 ha

(DCH5) and included areas within Yarramundi paddocks as well as the semi-rural residential properties to the north/west across Castlereagh road. These findings are consistent with previously reported home ranges of male eastern grey kangaroos which can vary anywhere between 7.6 - 269 ha [18]. Approximate home ranges (95%) were notably smaller and occurred mostly within Yarramundi paddocks with only a small amount of DCH3s home range crossing into the adjacent semi-rural residential properties to the north/west. The core ranges occurred entirely within Yarramundi paddocks indicating that the majority of their activity occurred within this site, and that further away areas were utilized occasionally. The greatest proportion of home range overlap was observed for the 95% minimum convex polygons. These findings indicate that these kangaroos utilize a common area but disperse in slightly different directions when travelling further from the core range. Although these kangaroos occupy a common area, they also appear to occupy different ranges within the common area. No kinship was detected between the two tracked kangaroos. Unrelated male kangaroos may share overlapping home ranges because they utilize common resources such as grazing areas, resting spots, and mates. Adult male kangaroos reportedly associate with

152

multiple sets of females [19, 20]. The overlapping ranges within Yarramundi paddocks may be indicative of the location of females within the site visited by both males, whereas the different areas outside the site may include separate groups visited by each male.

Limitations

The sample size used in this study was limited by the availability of blood and tissue samples. Unfortunately the kangaroos at the study site had a very large flight distance and were extremely difficult to capture to obtain blood samples. Tissue samples were obtained opportunistically from road-killed kangaroos which proved to be a more effective and non- invasive method of collecting samples for DNA extraction. Based on the estimated population size at the site, this sample size accounts for less than 2% of the population. As this is a small sample of a large population, then a high level of relatedness between individuals was not expected. Access to potential nearby sites containing eastern grey kangaroos was limited and use of a greater number of individuals over a wider area is likely to have produced more robust results. The use of further microsatellite loci may also have reduced potential errors [50]. Only limited data is available for eastern grey kangaroo genetics and as such there are only a limited number of loci determined for this species.

Some previous research on this species has used between 10-13 loci [18, 48]. Despite limited samples these findings are largely consistent with previous findings for this species and provides valuable insight into the genetic structure of this peri-urban population of eastern grey kangaroos.

Declarations'

Ethics approval and consent to participate

Animal care and ethics (#A10297), and biosafety (#B10414) approvals were obtained from

WSU. A NSW scientific license (#SL101256) was obtained from the National Parks and

Wildlife Service.

Consent for publication

153

Not applicable.

Availability of data and material

All information is included in the manuscript

Competing interests

The authors declare that they have no competing interests.

Funding

Funding was provided by Western Sydney University and Jai Green-Barber was supported by an Australian Postgraduate Award Scholarship.

Authors' contributions

JMGB and JMO participated in the study conception and study design. JMGB was responsible for data collection, laboratory procedures, and data analysis. JMGB wrote the initial draft of the manuscript, which was reviewed critically by JMO. All the coauthors participated in revising the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We would like to thank Megan Callander for assistance with using population genetics software, Bradley Evans, Dr Hayley Stannard, Fiona McDougall, Casey Borthwick, Eden

Hermsen, Mark Emanuel and Iris Bleach for assistance with animal handling, and sample collection, Rhys Green-Barber and Bradley Evans for assistance with tracking collared kangaroos, and Dr Hayley Stannard, Eden Hermsen, Dr Jason Flesch, and Associate

Professor Ricky Spencer for assistance in locating kangaroo road mortalities.

5.6. References

1. Parreira BR, Chikhi L. On some genetic consequences of social structure, mating systems, dispersal, and sampling. Proc Natl Acad Sci USA. 2015;112:E3318-E3326. 2. Silk JB. The adaptive value of sociality in mammalian groups. Philos Trans R Soc Lond B Biol Sci. 2007;362:539-559.

154

3. Wikberg EC, Sicotte P, Campos FA, Ting N. Between-group variation in female dispersal, kin composition of groups, and proximity patterns in a black-and-white colobus monkey (Colobus vellerosus). PLoS ONE. 2012;7:e48740. 4. Forman RTT, Alexander LE. Roads and their major ecological effects. Annu Rev Ecol Syst. 1998;29:207. 5. Jaeger JA, Jeff Bowman, Julie Brennan, Lenore Fahrig, Dan Bert, Julie Bouchard, Neil Charbonneau, Karin Frank, Bernd Gruber, and Katharina Tluk von Toschanowitz. Predicting when animal populations are at risk from roads: an interactive model of road avoidance behavior. Ecol Modell. 2005;185:329-348. 6. Reh W, Seitz A. The influence of land use on the genetic structure of populations of the common frog Rana temporaria. Biol Conserv. 1990;54:239-249. 7. Gerlach G, Musolf K. Fragmentation of landscape as a cause for genetic subdivision in bank voles. Conserv Biol. 2000;14:1066-1074. 8. Epps CW, Palsbøll PJ, Wehausen JD, Roderick GK, Ramey RR, McCullough DR. Highways block gene flow and cause a rapid decline in genetic diversity of desert bighorn sheep. Ecol Lett. 2005;8:1029-1038. 9. Kuehn R, Hindenlang KE, Holzgang O, Senn J, Stoeckle B, Sperisen C. Genetic effect of transportation infrastructure on roe deer populations (Capreolus capreolus). J Hered. 2006;98:13-22. 10. Bond ARF, Jones DN. Roads and macropods: interactions and implications. Aust Mammal. 2014;36:1-14. 11. Southwell CJ. Variability in grouping in the eastern grey kangaroo, Macropus giganteus II. Dynamics of group formation. Wildl Res. 1984;11:437-449. 12. Jarman P, Southwell C. Grouping, associations, and reproductive strategies in eastern grey kangaroos. In: Wrangham R, Rubenstein D, editors.Ecological aspects of social evolution. Princeton: Princeton University Press; 1986. p. 399-428. 13. Jarman P. Individual behaviour and social organisation of kangaroos. In: Jarman P, Rossiter, A, editors.Animal Societies: Individuals, Interactions and Organisations 1994. p. 70-83. 14. McCullough D, McCullough Y. Kangaroos in outback Australia: comparative ecology and behavior of three coexisting species. New York: Columbia University Press; 2000. 15. Jaremovic RV, Croft D. Social organization of eastern grey kangaroos in southeastern New South Wales. II. Associations within mixed groups. Mammalia. 1991;55:543-554. 16. Carter AJ, Macdonald SL, Thomson VA, Goldizen AW. Structured association patterns and their energetic benefits in female eastern grey kangaroos, Macropus giganteus. Anim Behav. 2009;77:839-846. 17. Jarman PJ, Coulson G. Dynamics and adaptiveness of grouping in macropods. In: G. Grigg PJaIH, editors.Kangaroos, wallabies and rat-kangaroos. Sydney: Surrey Beatty; 1989. p. 527-547. 18. Neaves LE, Roberts MW, Herbert CA, Eldridge MD. Limited sex bias in the fine- scale spatial genetic structure of the eastern grey kangaroo and its relationship to habitat. Aust J Zool. 2017;65:33-44. 19. Jaremovic RV, Croft D. Social organization of the eastern grey kangaroo (Macropodidae, Marsupialia) in southeastern New South Wales. I. Groups and group home ranges. Mammalia. 1991;55:169-186. 20. Kaufmann JH. Field observations of the social behaviour of the eastern grey kangaroo, Macropus giganteus. Anim Behav. 1975;23:214-221. 21. Caughley G. Density and dispersion of two species of kangaroo in relation to habitat. Aust J Zool. 1964;12:238-249. 22. Southwell CJ. Variability in grouping in the eastern grey kangaroo, Macropus giganteus I. Group density and group size. Wildl Res. 1984;11:423-435.

155

23. Zenger KR, Eldridge MDB, Pope LC, Cooper DW. Characterisation and cross- species utility of microsatellite markers within kangaroos, wallabies and rat kangaroos (Macropodoidea : Marsupialia). Aust J Zool. 2003;51:587-596. 24. Sweet MJ, Scriven LA, Singleton I. Microsatellites for Microbiologists. In: Geoffrey MG, Sima S, editors.Advances in applied microbiology. San Diego: Academic Press; 2012. p. 169-207. 25. Selkoe KA, Toonen RJ. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol Lett. 2006;9:615-629. 26. Ellegren H. Microsatellites: simple sequences with complex evolution. Nat Rev Genet. 2004;5:435-445. 27. Webster MS, Reichart L. Use of Microsatellites for Parentage and Kinship Analyses in Animals. Methods Enzymol. 2005;395:222-238. 28. Weier HU, Gray JW. A programmable system to perform the polymerase chain reaction. DNA. 1988;7:441-447. 29. Strassmann JE, Solis C, Peters JM, Queller D. Strategies for finding and using highly polymorphic DNA microsatellite loci for studies of genetic relatedness and pedigrees. In: Ferraris J, Palumbi, SR, editors.Molecular zoology: advances, strategies and protocols. New York: Wiley-Liss; 1996. p. 163-180. 30. Zenger KR, Cooper DW. A set of highly polymorphic microsatellite markers developed for the eastern grey kangaroo (Macropus giganteus). Mol Ecol Notes. 2001;1:98-100. 31. Sunnucks P. Efficient genetic markers for population biology. Trends Ecol Evol. 2000;15:199-203. 32. Fortin M, Dale M. Spatial Analysis. A Guide for Ecologists. Cambridge, UK: Cambridge University Press; 2005. 33. Epperson BK, Li T. Measurement of genetic structure within populations using Moran's spatial autocorrelation statistics. Proc Natl Acad Sci USA. 1996;93:10528- 10532. 34. Mabry KE, Shelley EL, Davis KE, Blumstein DT, Van Vuren DH. Social mating system and sex-biased dispersal in mammals and birds: a phylogenetic analysis. PLoS ONE. 2013;8:e57980. 35. Pérez‐González J, Carranza J. Female‐biased dispersal under conditions of low male mating competition in a polygynous mammal. Mol Ecol. 2009;18:4617-4630. 36. Robbins AM, Stoinski T, Fawcett K, Robbins MM. Leave or conceive: natal dispersal and philopatry of female mountain gorillas in the Virunga volcano region. Anim Behav. 2009;77:831-838. 37. Eikenaar C, Brouwer L, Komdeur J, Richardson DS. Sex biased natal dispersal is not a fixed trait in a stable population of Seychelles warblers. Behaviour. 2010;147:1577-1590. 38. Green-Barber J, Old J. What influences road mortality rates of eastern grey kangaroos in a semi-rural area? BMC Ecol. unpublished data;under review. 39. Green-Barber J, Old J. Town roo, country roo: a comparison of behaviour in eastern grey kangaroos Macropus giganteus in developed and natural landscapes. Aust Zool. 2018;In Press. 40. Green-Barber J, Ong O, Kanuri A, Stannard H, Old J. Blood constituents of free- ranging eastern grey kangaroos (Macropus giganteus). Aust Mammal. 2018;In Press 41. Taylor A, Cooper D. A set of tammar wallaby (Macropus eugenii) microsatellites tested for genetic linkage. Mol Ecol. 1998;7:925-926. 42. Zenger KR, Eldridge MDB, Cooper DW. Intraspecific variation, sex-biased dispersal and phylogeography of the eastern grey kangaroo (Macropus giganteus). Heredity. 2003;91:153. 43. Zenger KR, Cooper DW. Characterization of 14 macropod microsatellite genetic markers. Anim Genet. 2001;32:166-167.

156

44. Dwyer RG, Brooking C, Brimblecombe W, Campbell HA, Hunter J, Watts M, Franklin CE. An open Web-based system for the analysis and sharing of animal tracking data. Animal Biotelemetry. 2015;3:1-11. 45. Jaremovic RV, Croft DB. Comparison of Techniques to Determine Eastern Grey Kangaroo Home Range. J Wildl Manage. 1987;51:921-930. 46. Calenge C. The package “adehabitat” for the R software: a tool for the analysis of space and habitat use by animals. Ecol Modell. 2006;197:516-519. 47. White GC, Garrott RA. Analysis of wildlife radio-tracking data. San Diego: Academic Press; 2012. 48. Miller EJ, Eldridge MD, Cooper DW, Herbert CA. Dominance, body size and internal relatedness influence male reproductive success in eastern grey kangaroos (Macropus giganteus). Reprod Fertil Dev. 2010;22:539-549. 49. Eldridge M, Coulson G. Family Macropodidae (kangaroos and wallabies). In: editors.Handbook of the Mammals of the World. 2015. p. 630-735. 50. Ferrie GM, Cohen OR, Schutz P, Leighty KA, Plasse C, Bettinger TL, Hoffman EA. Identifying parentage using molecular markers: improving accuracy of studbook records for a captive flock of marabou storks (Leptoptilus crumeniferus). Zoo Biol. 2013;32:556-564.

Figure titles

Fig. 5.1. Map of the Hawkesbury campus of the Western Sydney University and surrounding roads and buildings.

Fig. 5.2. Genetic relationships of eastern grey kangaroos at Hawkesbury Campus of Western

Sydney University.

Fig. 5.3. Home ranges of two adult male kangaroos at the Hawkesbury campus of Western

Sydney University.

157

Figures

Figure 5. 1.

158

Figure 5. 2.

Key: Male: Parent-offspring: blue text Female: Full sibling: pink text Juvenile: Half sibling: black text

159

Figure 5. 3.

Key: DCH3= orange, DCH5= green a= all points (100%), b= approximate home range (95%), c= and core range (50%)

160

CHAPTER 6

6. Blood constituents of free-ranging eastern grey

kangaroos (Macropus giganteus).

Jai M. Green-Barber, Oselyne T. W. Ong, Anusha Kanuri, Hayley J. Stannard and

Julie M. Old

161

6.1. Chapter outline and authorship

Chapter 6 establishes the health parameters of a free ranging population of eastern grey kangaroos at Yarramundi Paddocks, Hawkesbury Campus, Western Sydney University

NSW, and the Wolgan Valley Resort and Spa, Wolgan Valley, NSW. The study was conducted to determine the baseline blood chemistry and haematology levels, verify the presence and levels of APPs, and examine the antibacterial response of serum in free-ranging eastern grey kangaroos. Baseline data for measuring and comparing health in free ranging kangaroos enables identification of sick individuals, which is essential for effectively monitoring and managing kangaroo populations.

I am the primary author of this jointly authored proof version of a paper accepted for publication, and I performed all field procedures, most laboratory procedures, and all data analysis. I tranquilised kangaroos using a CO2 Injection Rifle which required specialised fire arm safety training and obtain a tranquilliser firearm licence. I handled chemically restrained kangaroos and monitored their recovery. Dr Hayley Stannard and I performed the blood sample collections. Laboratory procedures that I performed included blood chemistry analysis, white blood cell counts and serum amyloid A (SAA) assays. Dr Oselyne Ong and I performed the antimicrobial assays. Anusha Kanuri performed the haptoglobin (Hp) assays.

A/Prof Julie Old and I conceived the initial proposal. I completed the required animal ethics and biosafety applications for these procedures. A/Prof Julie Old supervised the research, provided feedback on the developing manuscript and acted as the corresponding author.

We would like to acknowledge and thank the editor and anonymous reviewers who provided feedback on the following manuscript prior to its acceptance by the journal.

This chapter is a published paper and should be cited as:

162

Green-Barber Jai M., Ong Oselyne T. W., Kanuri Anusha, Stannard Hayley J., Old Julie M.

(2018) Blood constituents of free-ranging eastern grey kangaroos (Macropus giganteus).

Australian Mammalogy, In Press. https://doi.org/10.1071/AM17002

Abstract. Baseline haematology, blood chemistry and acute phase protein parameters have not previously been published for free-ranging eastern grey kangaroos (Macropus giganteus). Eight eastern grey kangaroos, including three adult males, three adult females and two subadult males from two different populations, were examined. Assays assessed the antibacterial activity of kangaroo serum against one Gram-positive and three Gram-negative bacteria. The kangaroo serum had a strong antibacterial response to Klebsiella pneumoniae, and moderate responses to Escherichia coli and Staphylococcus aureus. The presence and level of acute phase proteins, haptoglobin and serum amyloid A in kangaroos was investigated. Haptoglobin and serum amyloid A were present in kangaroo serum, but only haptoglobin was elevated in a kangaroo with capture myopathy and necrotic wounds. The ﬁndings of this study provide preliminary data on health parameters of free-ranging eastern grey kangaroos. These parameters can be used to assist in assessing health in free-ranging populations.

163

6.2. Introduction

Eastern grey kangaroos (Macropus giganteus) are an abundant, iconic and easily recognisable Australian species; however, there is a lack of available data on health and disease for the species. Generally, limited information is available on the haematological and blood chemistry values of macropod species, especially for wild macropods. Haematology reference intervals have been determined for some free- ranging macropod species (Shield 1971; Arundel et al. 1979; Arnold 1987; Spencer and Speare 1992; Stirrat 2003; Barnes et al. 2008; Vaughan et al. 2009; Ruykys et al. 2012; Robert and Schwanz 2013). Blood chemistry and haematology values have been published for a single eastern grey kangaroo infected with gamma-herpes virus (Wilcox et al. 2011), and some limited haematological data for free-ranging eastern grey kangaroos (14 yearlings, 10 adults), and red kangaroos (Macropus rufus) (n = 57) at different stages of maturity (Presidente 1978). However, Presidente (1978) only conducted total white blood cell counts and no differential white blood cell count data were included.

Eastern grey kangaroos are susceptible to a range of diseases such as bacterial infections from Escherichia coli and Leptospira weilii (Gordon and Cowling 2003; Roberts et al. 2010b), viruses such as Herpesvirus (Wilcox et al. 2011), as well as parasites including Cryptosporidium (Power et al. 2004), Toxoplasma gondii (Jackson 2003), multiple species of Coccidia (Jackson 2003), and over 20 species of strongyle nematodes (Garnick et al. 2010). The incidence of disease is frequent and persistent amongst this species, and it is likely that this high disease prevalence is attributed to their large, high-density, open- membership groups, and close foraging proximity, which enables frequent transmission between individuals (Cripps et al. 2016). Due to the increased likelihood of transmission, many individuals in a population of eastern grey kangaroos would be exposed to any diseases and parasites present.

Acute phase proteins (APPs) and complement proteins that have antimicrobial properties are found in serum (Cray et al. 2009; Sarma and Ward 2011). APPs have many applications in human medicine, and are a useful tool for diagnosing and monitoring animal health (Tothova et al. 2014). A key response during

164

inflammation or infection is a drastic increase in the concentration of APPs, including haptoglobin (Hp) and serum amyloid A (SAA) (Cray et al. 2009). Due to the fluctuating levels of APPs in animals affected by these conditions, APPs are a useful indicator of the presence of inflammation or disease (Tothova et al. 2014). The levels of Hp increase during infection, inflammation, trauma or disease. The biological function of Hp is to bind to haemoglobin in order to prevent excessive loss of iron through urinary excretion as Hp helps in regulating the renal threshold for haemoglobin (Putnam 1973). However, Hp decreases during severe hepato-cellular deficiency and haemolytic conditions (Dobryszycka 1997).

SAA is a major APP that has been identified in multiple mammal species including humans (Homo sapiens) (Whitehead et al. 1992), mice (Mus musculus) (De Beer et al. 1994), and horses (Equus caballus) (Jacobsen et al. 2006). SAA is an indicator of acute inflammation; however, the slower-reacting Hp indicates chronic inflammation (Alsemgeest et al. 1994; Horadagoda et al. 1999). Horses with inflammation or tissue damage have been found to have higher SAA concentrations than healthy horses. Measuring SAA levels may therefore be a useful method of monitoring disease activity in mammals (Hultén and Demmers 2002). Both Hp and SAA presence was assessed in eastern grey kangaroos to evaluate whether marsupials, like eutherians, are able to produce APPs, triggered during an infection or trauma.

The overall objective of this study was to determine measures of health in free- ranging eastern grey kangaroos by (1) determining baseline blood chemistry and haematology levels, (2) verifying the presence and levels of APPs, and (3) examining the antibacterial response of serum. One adult male was euthanised by a veterinarian after capture due to capture myopathy and the results of a post mortem examination are reported in a separate paper (Green-Barber et al. 2017).

6.3. Materials and methods

6.3.1. Study sites

Data were collected at two sites in New South Wales (NSW) (Fig. 6.1). One site was a semirural site surrounded by built infrastructure such as roads and buildings.

165

The other site had relatively little built infrastructure and is a conservation area surrounded by National Parks’ land containing cliffs and bushland. ‘Yarramundi Paddocks’, Hawkesbury Campus, Western Sydney University, NSW (33°3704.00300S, 150°44011.45700E) is located on the corner of Bourke Street and Londonderry Road, Richmond, NSW. The ‘Yarramundi Paddocks’ has an area of ~308 ha, and consists of pastures, grasslands, marshes, and open woodland.

The Hawkesbury campus is located in a semirural area and is surrounded by urban development. Built infrastructures create barriers that may limit the directions in which animals can disperse, and reduce areas suitable for foraging, which is likely to affect the dispersal of animals in this area.

The Wolgan Valley Resort and Spa (33°15018.47800S, 150°11023.23400E), located in the Wolgan Valley, NSW, is a 1619-ha property surrounded by national parks and sandstone cliffs. There is signiﬁcantly less built infrastructure, and therefore fewer barriers in this area than at the campus site.

Research was conducted during winter and early spring when pasture quality was lower than during summer, when rainfall is higher. The densities of the two study populations were measured in 2014 and found to be 4.6 kangaroos per hectare at the Hawkesbury site, and 1.3 kangaroos per hectare at the Wolgan Valley site. There were no other macropod species present at the Hawkesbury site; however, other macropod species were present at the Wolgan Valley site.

6.3.2. Animals

In total, eight wild eastern grey kangaroos were sampled. Three adult males were captured at ‘Yarramundi Paddocks’, and three adult females were captured at Wolgan Valley. Two subadult males were captured, one at each site. All animals were captured between June and October 2014 and 2015 (late winter to spring).

6.3.3. Field procedures

Haematology and blood chemistry data from wild macropods are needed for clinical health assessments. However, utilising wild macropods has potential safety risks (King et al. 2011). The size and strength of kangaroos are a risk to the

166

researcher, and there is a high risk of injury to the animal when using traps or nets to capture macropods (King et al. 2011). For the safety of researchers and kangaroos: animals were captured using chemical restraint with zoletil at 5–7 mg kg, administered using 3-mL darts with 60-mm-long needles via a CO2 Injection Riﬂe (Dan-Inject, Denmark).

Darting was conducted between 0700 and 0900 hours. Air temperatures during darting were 10-26°C at the Hawkesbury site and 2-12°C at the Wolgan Valley site. Kangaroos were darted in the upper hind leg, thigh or rump from a distance of 23– 28 m in accordance with recommendations made by Roberts et al. (2010a). When the kangaroo dropped to the ground it was approached slowly and quietly, a hessian sack was placed over its head and the tail and hind limbs were restrained during processing. The average time between administering the dart and approaching the animal was ~15 min. All kangaroos in the study showed signs of anaesthesia within 10 min of darting. Larger males were still partially mobile when ﬁrst approached and required additional dosages of tranquiliser.

Morphometric measurements, including foot length, tail diameter, tail length and total body mass, were collected from each individual. Body condition was estimated from morphological measurements. Fur condition, the presence of injuries, and evidence of ectoparasites were also recorded.

6.3.4. Haematology and blood chemistry

A blood sample (10–15 mL) was taken from the tail vein using a 21-gauge needle from all kangaroos captured. Two-thirds of the sample was placed immediately into an EDTA-coated Vacutainer tube (Becton, Dickinson and Co., New Jersey) and the remaining third into a Venosafe tube containing a clot- activating additive (Terumo Europe, Belgium) and refrigerated before transportation to the laboratory. Serum was harvested and biochemical tests were conducted within 24 h of collection.

Blood chemistry values were measured using whole blood and a Vetscan VS2 blood chemistry analyser and comprehensive diagnostic proﬁle rotor plates (Abaxis, Union City, USA), as per the manufacturer’s instructions. The rotor plates measured the following parameters; albumin (g L–1), alkaline phosphatase (U L–1), alanine

167

aminotransferase (U L–1), amylase (U L–1), urea nitrogen (mmol L–1), creatinine (mmol L–1), globulin (g L–1), glucose (mmol L–1), potassium (mmol L–1), sodium (mmol L–1), phosphorus (mmol L–1), total bilirubin (mmol L–1), and total protein (g L–1). White blood cell counts were calculated from manual counts of blood smears on a microscope slide stained with DiffQuick stain (Bacto Laboratories Pty Ltd, Mount Pritchard, Australia) using an Olympus CX31RBSF compound microscope. White blood cell counts were included for only one of the adult females.

168

Fig 6. 1. Data collection sites: (a) Hawkesbury Campus site, (b) Wolgan Valley site, and (c) the relative locations of the Hawkesbury Campus and Wolgan Valley sites in New South Wales.

6.3.5. Evaluation of antibacterial activity

169

An antimicrobial assay was performed to assess the antibacterial activity of kangaroo serum. Serum was pooled from multiple individuals for each sex. Pooled serum was then diluted to make concentrations of 25% and 50% serum using a sterile saline solution. Heated serum (56°C for 30 min with shaking), and saline were used as negative controls for comparison.

Three Gram-negative bacteria (Escherichia coli (K12), Pseudomonas aeroginosa (ATCC 27853), Klebsiella pneumoniae (ATCC 13883)) and one Gram-positive bacterium (Staphylococcus aureus (ATCC 25923)) were used in this study. Bacteria were grown on nutrient agar slants and transferred to a sterile nutrient broth liquid culture. The culture was incubated overnight to obtain a log-phase in a 37°C shaking incubator. The optical density of the culture was tested using the Benchmark Plus™ microplate spectrophotometer (Biorad, Hercules, USA) at a wavelength of 600 nm to ensure the optical density was 0.2–1 (growth phase). The culture was then diluted to a concentration of 1x105 with sterile 0.9% saline.

Equal volumes of diluted bacteria were added to the diluted serum, heated serum, and saline to create a 1 : 1 ratio. Serum– bacterial solutions were incubated for increments of 0, 10, 20 and 30 min at 37°C with shaking. Solutions were then plated in triplicate (50 mL each) on nutrient agar plates immediately following each incubation time. Inverted plates were incubated overnight (37°C). Colonies were counted and used to obtain averages. Colony-forming units (CFUs mL–1) were calculated using the method described in Merchant (2003) (colonies x dilution X10).

6.3.6. Acute phase protein assays

Haptoglobin assay

The PHASE Haptoglobin assay (Tridelta Development Ltd, Bray, Ireland) was used according to the manufacturer’s instructions to determine the presence and concentration of Hp protein in eastern grey kangaroo serum, using rabbit (Oryctolagus cuniculus) serum (Sigma-Aldrich, Castle Hill, Australia) and sheep (Ovis aries) serum (Serum Australia Pty Ltd, Manilla, Australia) as comparative controls. Serum from two male kangaroos (one healthy and one unhealthy with

170

evidence of necrotic wounds and capture myopathy) were utilised. A set of Hp standards with known concentrations (2.5 mg mL–1, 1.25 mg mL–1, 0.625 mg mL–1, 0.312 mg mL–1 and 0 mg mL–1), and serum samples were plated in triplicate in a microtitre plate. The absorbance was read at 630 nm using a Benchmark Plus™ microplate spectrophotometer, and the results interpreted on the basis of a standard curve of known Hp samples.

Serum amyloid A assay

The LZ Test ‘Eiken’ SAA kit (Eiken Chemical Co. Ltd, Tokyo, Japan) was used to determine SAA protein concentration in the serum from three adult male eastern grey kangaroos (two healthy, and one unhealthy that showed signs of capture myopathy and necrotic wounds), as well as three adult females and two subadult males. Horse serum (Vector Laboratories, Burlingame, USA) collected from healthy horses was used as a eutherian reference for comparison. The test was performed according to the manufacturer’s instructions using a 96-well microplate, and analysed using a Benchmark Plus™ microplate spectrophotometer.

6.4. Results

All kangaroos in this study recovered from anaesthesia without ill effects, with the exception of one adult male that exhibited signs of capture myopathy and was euthanised as a result. All study subjects (except the euthanised male) appeared to be in good health with adequate body condition, no evidence of injuries, and no obvious ectoparasites. Table 6.1 summarises the heart rates, respiration rates and body temperature of the anesthetised kangaroos after initial darting. Adult males (n = 3) had a mean weight of 43 kg (±3.62) and adult females (n = 3) had a mean weight of 27 kg (±6.36). The subadult males (n = 2) had a mean weight of 18 kg (±2.33). The foot length of adult males was 36 cm (±0.87), the foot length of adult females was 30 cm (±1.26), and the foot length of the subadult males was 31 cm (±0.07). The tail of adult males was 107 cm (±5.51) long with a diameter of 89 mm(±22.59), the tail of adult females was 78 cm (±5.41) long with a diameter of 42 mm (±12.16), and the tail of the subadult males was 71 cm (±2.83) long with a diameter of 54 mm (±22.37). All three adult females were lactating and had pouch young. Two females were also observed to have young at foot.

171

6.4.1. Blood chemistry

Notable differences in blood chemistry (Table 6.2) were observed between the sexes and between adults and subadults. Mean levels of alkaline phosphatase were higher in female eastern grey kangaroos (341 U L–1) than subadults (145 U L–1) and adult males (97 U L–1). Adult females had lower levels of alanine aminotransferase (53.67 U L–1), than both the adult males (77 U L–1) and subadults (66 U L–1). Amylase was found to be higher in subadults (282 U L–1). Adult males had distinctly higher levels of creatinine (125 mmol L–1) and glucose (8 mmol L-1).

6.4.2. Haematology

The mean haematological values in Table 6.3 show variations between the sexes and between adults and subadults. The values for the male that was euthanised are excluded from these results.

172

Table 6. 1. Postcapture heart rate, respiration rate, and body temperature of eastern grey kangaroos from two populations in New South Wales during winter and spring 2014 and 2015

Data shown are ranges (with mean in parentheses) Males Females Subadult (n = 2) (n = 3) males (n = 2) Heart rate (beats 82–92 (90.44) 79–93 (85.91) 79–100 (91.67) Body temperat ure (o C) 35.70–38.80 (36.46) 33.70–36.20 (35.14) 34.40–35.70 (35.02)

Table 6. 2. Blood chemistry values for eastern grey kangaroos from two populations in New South Wales during winter and spring 2014 and 2015

Data shown are ranges (with mean in parentheses) Blood chemistry Males (n = 2) Females (n = 3) Subadult males (n = ALB (g L– 1) 47–48 (47.50) 42–49 (45.33) 42 –45 (43.50) ALP (U L–1) 97–97 (97.00) 117–530 (341.33) 100–190 (145.00)

ALT (U L–1) 72–81 (76.50) 41–66 (53.67) 58–74 (66.00)

AMY (U L–1) 160–214 (187.00) 170–250 (203.00) 219–345 (282.00)

TBIL (mmol L–1) 7–7 (7.00) 7–8 (7.33) 7–7 (7.00)

BUN (mmol L–1) 8.4–8.8 (8.60) 8.8–10.1 (9.57) 7.7–8.7 (8.20)

P (mmol L–1) 1.77–2.15 (1.96) 1.90–2.33 (2.08) 2.17–2.73 (2.45)

CRE (mmol L–1) 121–129 (125.00) 66–84 (75.00) 65–95 (80.00)

GLU (mmol L–1) 7.0–9.7 (8.35) 3.1–4.5 (3.67) 4.8–5.8 (5.30)

Na+ (mmol L–1) 157–165 (161.00) 150–163 (156.33) 158–161 (159.50)

K+ (mmol L–1) 3.1–4.9 (4.00) 2.0–7.2 (4.20) 4.2–6.1 (5.15)

TP (g L–1) 56–60 (58.00) 50–67 (61.00) 57–58 (57.50)

GLOB (g L–1) 8–13 (10.50) 5–25 (15.67) 12–16 (14.00)

173

The adult female had the highest lymphocyte count (35.66%). It was slightly higher than the lymphocyte counts for subadults (33.00%) and higher than for the adult males (27.00%). Adult males had the highest neutrophil count (55.83%), whereas the lowest neutrophil count was recorded for the adult female (41.00%). A greater number of neutrophils than lymphocytes were observed for all animals in this study. The adult female had a neutrophil to lymphocyte ratio (NLR) of 1.15. Subadult males had more neutrophils with a NLR of 1.47. Adult males had the highest NLR of 2.07. The monocyte count for the adult female (9.66%) was higher than both adult (7.33%) and subadult (7.16%) males. The adult female had a higher eosinophil count (8.66%) than did the adult males (5.16%) and was slightly higher than for the subadult males (7.33%). Subadult eastern grey kangaroos appear to have a slightly lower basophil count (4.00%) than adults of either sex (males, 4.66%; females, 5.00%).

6.4.3. Antimicrobial assay

Serum diluted to 25% was chosen for analysis because the bacterial colonies were clearer and easier to count accurately, compared with the colonies on plates with serum diluted to 50%. Test plates (containing serum) generally had far fewer CFUs than control plates containing heated serum or saline (Fig. 6.2). However, the trend was not observed in all plates; for example, P. aeruginosa test plates generally had more CFUs than control plates. Test plates had the fewest CFUs after 20 and 30 min of incubation.

Test plates with K. pneumoniae had fewer CFUs than the controls. The number of CFUs increased after 10 min of incubation, and then declined at 20 min incubation for all test plates; however, the number of CFUs continued to decline after 30 min of incubation for female test plates, but increased for male test plates.

Test plates with male serum and E. coli had fewer CFUs at 0 and 30 min; however, they had more CFUs than most control plates at 10 min and more CFUs than some control plates at 20 min. The most CFUs were observed for the male test plate at 30 min incubation, and the fewest CFUs were observed at 20 min. Results for females showed a clearer pattern. The female

174

Table 6. 3. Haematology values for eastern grey kangaroos from two populations in New South Wales during winter and spring 2014

Data shown are ranges (with mean in parentheses)

Leucocytes Male2 (n = 2) Female Subadult male2

(n = 1) (n = 2)

Neutrophils (per 51.00–60.66 (55.83) 41.00 39.00–58.00 (48.50) 100)

Lymphocyte (per 20.00–34.00 (27.00) 35.66 23.66–42.33 (33.00) 100)

Monocyte (per 100) 7.00–7.66 (7.33) 9.66 5.66–8.66 (7.16)

Eosinophils (per 2.66–7.66 (5.16) 8.66 5.66–9.00 (7.33) 100)

Basophils (per 100) 4.66–4.66 (4.66) 5.00 3.66–4.33 (4.00) test plate and controls showed a sharp increase in CFUs at 20 min incubation followed by a sharp decline at 30 min.

Male test plates with S. aureus had the fewest CFUs at 30 min incubation, with fewer CFUs than all controls at this length of incubation. Male test plates also had most CFUs at 0 min of incubation. Female test plates had fewer CFUs at 10 min incubation and the most CFUs at 20 min.

No evidence for adequate antibacterial response to P. aeruginosa was observed. Test plates produced more CFUs than one or both of the controls on all occasions.

6.4.4. Acute phase protein assays

Haptoglobin

The assay results indicate that Hp is present in eastern grey kangaroos. Concentrations of Hp were determined from the Hp standard curve for both kangaroos (Table 6.4). Hp levels were higher for the euthanised kangaroo (6.96 mg mL–1) than for the healthy kangaroo (2.03 mg mL).

175

Serum amyloid A

Concentrations of SAA protein were determined from the standard curve for all kangaroos (Table 6.5). It was higher for adult females (6.13 mg mL–1) than it was for healthy and unhealthy (euthanised) adult males (healthy, 4.8 mg mL–1; unhealthy, 4.27 mg mL–1) and subadult males (3.3 mg mL–1). The SAA protein concentrations of all kangaroos were within the normal

Fig 6. 2. Kinetics of antibacterial activity of 25% diluted serum from Macropus giganteus against (a) Klebsiella pneumonia, (b) Escherichia coli, (c) Staphylococcus aureus, and (d) Pseudomonas aeruginosa.

Table 6. 4. Mean concentration of haptoglobin in blood serum of selected mammals, including healthy and unhealthy (euthanised) eastern grey kangaroos

Serum specimen Concentration of unknown sample (mg mL–1)

Eastern grey kangaroo (unhealthy) 6.96

176

Eastern grey kangaroo (healthy) 2.03

Rabbit 1.06

Sheep 0.61

Table 6. 5. Concentration of serum amyloid A in adult male (healthy and unhealthy/euthanised), adult female and subadult male eastern grey kangaroos

Serum specimen Concentration of unknown sample (mg mL–1)

Adult male (healthy) (n = 2) 4.13–5.47 (4.80)

Adult male (unhealthy) (n = 1) (4.27)

Adult female (n = 3) 2.53–11.00 (6.13)

Subadult male (n = 2) 2.0 7 – 4.53 (3.30)

Horse (32.67) reference ranges speciﬁed by the SAA kit (<8 mg mL–1). The horse serum showed a concentration of 32.67 mg mL–1, which is notably higher than the normal reference range for the horse (Jacobsen and Andersen 2007).

6.5. Discussion

The results of this research provide valuable information about the health parameters and disease susceptibility of free-ranging eastern grey kangaroos. Preliminary differences relating to age and sex were detected in both the haematological and blood chemistry values. The sample size used in this study is small, however, while the results indicate differences between groups such as sex or age, this may be a result of differences between individuals rather than between the groups they represent. Sex, age and season have been determined to inﬂuence haematology and blood chemistry in other marsupials (Presidente 1978; Barnett et al. 1979; Haynes and Skidmore 1991; Baker and Gemmell 1999). Some of the haematological and blood chemistry values in this study were consistent with those found in other macropod species such as brush-tailed rock wallabies (Petrogale penicillata) and tammar wallabies (Macropus eugenii) (Deane et al. 1997; Barnes

177

et al. 2008).

Levels of alkaline phosphatase were higher in female eastern grey kangaroos than in subadult males, and both had higher levels than adult males. All females were lactating and had pouch young and two also had young at foot. Alkaline phosphatase has been found to dramatically increase during gestation in humans (Okesina et al. 1995). Similarly, pregnant bobcats (Felis rufus) reportedly have significantly higher alkaline phosphatase levels than males (Fuller et al. 1985). Alkaline phosphatase levels in female kangaroos may also fluctuate due to reproductive state. Alkaline phosphatase is involved in bone growth and calcification (Takenaka et al. 1988), so younger growing animals are likely to have higher alkaline phosphatase levels. For example, older eastern quolls (Dasyurus viverrinus) have been found to have approximately half the level of alkaline phosphatase as younger individuals (Stannard et al. 2013). Higher alkaline phosphatase values in younger animals has also been documented in tammar wallabies (McKenzie et al. 2002) and brush-tailed rock wallabies (Barnes et al. 2008); however, the levels for both these species

(tammar wallaby, 520–2357 U L–1; brush-tailed rock wallaby, 405–1412 U L–1) were substantially higher than the values found in the eastern grey kangaroos. Blood samples were collected from some animals in winter and others in spring, which may have contributed to the differences in alkaline phosphatase levels between individuals. Studies have found that tammar wallabies and brush-tailed rock wallabies have higher alkaline phosphatase levels in summer than in other seasons (McKenzie et al. 2002; Barnes et al. 2008).

Alanine aminotransferase was markedly higher in males than females in this study. Elevated levels of alanine aminotransferase in macropods may indicate issues with liver function (McKenzie et al. 2004). Overall values are comparable with those recorded in the tammar wallaby (43–53 U L–1) (McKenzie et al. 2002).

Adult males had higher creatinine and glucose levels than females and subadults. Creatinine levels relate to muscle mass, therefore the higher levels of creatinine in males is most likely a reﬂection of their larger body size (Stirrat 2003). Reduced creatinine levels may indicate poor nutrition (Domingo-Roura et al. 2001; Trumble et al. 2006; Hall et al. 2007). Higher creatinine levels in

178

adult males have also been observed in brush-tailed rock wallabies, tammar wallabies and Tasmanian devils (Sarcophilus harrisii) (Deane et al. 1997; Barnes et al. 2008; Peck et al. 2015); however, glucose was found to be lower in adults than subadults in all of these species (Deane et al. 1997; Barnes et al. 2008; Peck et al. 2015). Increased glucose levels are associated with increased stress (Barnett et al. 1979; Fuller et al. 1985; Wells et al. 2000; Stannard et al. 2013).

Potassium levels were higher in subadults than in adult males and females in this study. Levels of potassium observed in subadults is comparable with the levels found in southern hairy-nosed wombats (Lasiorhinus latifrons) (5.7 mmol L-

1) (Gaughwin and Judson 1980). Gaughwin and Judson (1980) suggest that high potassium values observed in wombats may be due to an adaptation to minimise water loss. Globulin levels were lowest in adult males compared with females and subadults. Globulin values that are higher in adults than subadults have been observed in brush-tailed rock wallabies (Barnes et al. 2008) and Tasmanian devils (Stannard et al. 2016), which are not consistent with the higher levels in subadults found in this study. The levels of globulin observed were low compared with published values for other macropod species (Stirrat 2003; Vaughan et al. 2009; Ruykys et al. 2012). All other values were similar to those published for other macropod species.

Stirrat (2003) suggested that macropod blood chemistry values are inﬂuenced by the availability and nutritional value of vegetation, which varies between seasons. Lower levels of protein, urea nitrogen and albumin levels have been observed in agile wallabies (Macropus agilis) during spring compared with autumn (Stirrat 2003). It is likely that seasonal variations may have impacted the values in the current study as samples were collected in both winter and spring.

This study found that lymphocytes were higher in subadult male eastern grey kangaroos than in adult males, which is consistent with lymphocyte decrease associated with age in tammar wallabies (McKenzie et al. 2002). The adult female kangaroo that was lactating had the highest lymphocyte value, which compares with the increased lymphocyte values observed in brush-tailed rock wallabies during a time of high lactation demand (Barnes et al. 2008).

179

Neutrophils were higher in adult males than in both females and subadults. Conversely, tammar wallabies have higher neutrophil values at 2–3 years old, with the values of younger juveniles being similar to those of adults, and with values dropping only at ~3 years of age (McKenzie et al. 2002). The neutrophil to lymphocyte (N : L) ratio was 2.04 for adult males, 1.17 for adult females, and 1.45 for subadult males.

Monocyte values for adult and subadult males were fairly consistent; however, the monocyte values of tammar wallabies have been shown to be lower at 0–1 and 3 years old, peaking at ~2 years old and increasing again as an adult (McKenzie et al. 2002). The adult female had a notably higher eosinophil count than did the males, and was lactating as this kangaroo had one pouch young, and one young at foot. The higher eosinophil value was in contrast with values observed in brush-tailed rock wallabies, in which eosinophil counts were notably lower during a time of high lactation demand (Barnes et al. 2008). A greater number of female eastern grey kangaroos in varying states of reproduction would be required to determine whether eosinophil counts are signiﬁcantly affected by lactation. Subadults were found to have higher eosinophil values than adult males, which differs from that reported for the brush-tailed rock wallaby (Barnes et al. 2008); however, the captive tammar wallaby has been found to have the highest eosinophil values at 2–3 years old, and slighter lower values at 0–2 years old and as adults (McKenzie et al. 2002). Barnes et al. (2008) suggest that higher eosinophil values may be related to exposure to parasites, which would be greater in older animals. Higher eosinophil values in older individuals were not observed in eastern grey kangaroos; however, the parasite loads for these animals is unknown. Higher-density populations have a higher rate of contact between individuals, which results in an increased endoparasite transmission rate (Takemoto et al. 2005). Eastern grey kangaroos were extremely abundant at both study sites. It is likely that the kangaroos at both study sites had high endoparasite burdens due to the high number of individuals at each site.

Overall variations in haematological values were observed between the sexes; however, it needs to be noted that this may not be due to true sex differences and may be due to individual differences. No signiﬁcant differences in haematological

180

values have previously been reported between the sexes for this species. Both haematological and blood chemistry values have been found to differ among captive tammar wallabies of different stages of maturity and between seasons (McKenzie et al. 2002; Young and Deane 2006), and likewise differences between brush- tailed rock wallabies of different ages and sex (Barnes et al. 2008).

The bacteria used to assess antibacterial properties were chosen because they are commonly used to assess antibacterial resistance, and because they are likely pathogens of eastern grey kangaroos. For example, S. aureus and P. aeruginosa infections in some macropods, P. aeruginosa infections in koalas (Phascolarctos cinereus), and K. pneumoniae infections in common brushtail possums (Trichosurus vulpecula) have been reported (Osawa et al. 1992; Ladds 2009; Edwards et al. 2012).

The results indicate that eastern grey kangaroos have some level of antibacterial response towards the bacteria tested. Antibacterial responses to the Gram-negative bacteria K. pneumonia and P. aeruginosa were generally less effective in females than males, and this is consistent with the suggestion that Gram- negative bacteria are more abundant in marsupials that are in oestrus, gestating, or carrying pouch young (Edwards et al. 2012). Numbers of Gram-positive bacteria have been found to be higher in female common brushtail possums during anoestrus, oestrus or gestation, or whilst carrying pouch young (Edwards et al. 2012). If these bacteria are present in eastern grey kangaroos, then it is likely there will be differences in the numbers of bacteria in males and females, and that bacterial levels will differ among females during different reproductive states. In contrast, the antibacterial response to the Gram-positive bacteria S. aureus was notably higher in males, which is not consistent with the suggestion that numbers of Gram-positive bacteria are higher in females. The abundance of Gram-negative bacteria E. coli was also higher for males than females. Edwards et al. (2012) suggests that certain strains of bacteria in the pouch of marsupials may be excluded or favoured by maternal mechanisms and that a selective response towards Gram- negative bacteria occurs in preparation for parturition.

The decreased bacterial growth after a longer incubation indicates that

181

antibacterial effects increased over time. In a recent study by Ong et al. (2017) the antibacterial effects of red-tailed phascogale (Phascogale calura) serum were also found to decrease over time. It is unknown whether the antibacterial effects of eastern grey kangaroo serum would continue to increase or decrease after 30 min as this was the longest incubation time used in this study and in that of Ong et al. (2017).

In this study, the concentration of Hp protein in eastern grey kangaroos was successfully measured, and confirms its presence in eastern grey kangaroo serum. The serum from the euthanized kangaroo showed a marked elevation in Hp protein concentration. APPs are stimulated by infection, trauma and inflammation (Cray et al. 2009). It is likely that the euthanised kangaroo may have had an inflammatory condition; however, the normal blood serum Hp range for kangaroos is not known because insufficient data are available on APPs in marsupials.

Hp studies on ungulates using 151 serum samples from wild species in the families Bovidae, Cervidae and Equidae have shown that Hp levels were similar to those of related domestic animals (Stefaniak et al. 1997). Infections and injuries contributed to increased Hp levels in the sera, and suggested the potential and usefulness of observing the Hp levels as part of a routine examination for the diagnostics of inﬂammation in wild species (Stefaniak et al. 1997). Hp concentration in the grey short-tailed opossum (Monodelphis domestica) has been shown to increase almost 6-fold after the injection of lipopolysaccharide (Richardson et al. 1998), which suggest that measuring Hp levels may also be a valuable method of identifying diseases and other inﬂammatory disorders in marsupials, including kangaroos.

All kangaroos in this study had SAA protein concentrations within the normal reference ranges speciﬁed by the SAA kit (<8 mg mL–1). SAA protein concentration was highest in adult females, followed by adult males, and subadults had the lowest SAA concentration.

There was no difference in the protein concentration of SAA between the euthanised adult male and the healthy adult males. SAA is an indicator of acute inﬂammation; however, the slower- reacting Hp indicates chronic inﬂammation

182

(Alsemgeest et al. 1994; Horadagoda et al. 1999). The injuries of the euthanised kangaroo were more consistent with a chronic condition, which may explain why Hp protein levels were elevated, but SAA levels were not. The results from this study are preliminary ﬁndings that demonstrate the use of this kit for measuring levels of SAA protein in marsupial serum. The horse serum in this study showed a concentration of 32.67 mg mL–1, which is slightly higher than the normal reference ranges but lower than the SAA level of horses with an inﬂammatory condition (Jacobsen and Andersen 2007).

This paper contributes additional data to the scarcity of information on the haematology and blood chemistry values of free-ranging eastern grey kangaroos, and reports the ability of their serum to inhibit bacterial growth. It also reports that marsupials, like eutherians, are capable of producing APPs that are triggered during an infection or trauma event. While the results indicate differences between the sexes in many of these blood parameters, the sample size is too small to draw deﬁnitive conclusions. Further research with a larger sample size would need to be conducted to conﬁrm that these differences were related to sex and not just differences of the individuals in the study.

Conﬂicts of interest

No authors have a conﬂict of interest.

Acknowledgements

Funding was provided by the Western Sydney University and JMG-B was supported by an Australian Postgraduate Award Scholarship. Animal care and ethics (no. A10297), and biosafety (no. B10414) approvals were obtained from the Western Sydney University. A NSW scientiﬁc licence (no. SL101256) was obtained from the National Parks and Wildlife Service. We thank Fiona McDougall, Casey Borthwick, Eden Hermsen, Mark Emanuel and Iris Bleach for their assistance with animal handling, and sample collection. We also thank Emirates One and Only Wolgan Valley for allowing us access to their property and assistance with locating kangaroos on site. None of the authors have a conﬂict of interest.

183

6.6. References

Alsemgeest, S., Kalsbeek, H., Wensing, T., Koeman, J., Van Ederen, A., and Gruys, E. (1994). Concentrations of serum amyloid-a (SAA) and haptoglobin (HP) as parameters of inﬂammatory diseases in cattle. The Veterinary Quarterly 16, 21– 23. doi:10.1080/01652176.1994.9694410

Arnold, G. (1987). Blood urea nitrogen, haemaglobin level and fecal nitrogen concentrations as indices of the nutritional status of western grey kangaroo. Proceedings of the International Symposium on Nutrition of Herbivores 2, 181– 182.

Arundel, J., Beveridge, I., and Presidente, P. (1979). Parasites and pathological ﬁndings in enclosed and free-ranging populations of Macropus rufus (Demarest) (Marsupialia) at Menindee, New South Wales. Wildlife Research 6, 361–379. doi:10.1071/WR9790361

Baker, M. L., and Gemmell, R. T. (1999). Physiological changes in the brushtail possum (Trichosurus vulpecula) following relocation from Armidale to Brisbane, Australia. The Journal of Experimental Zoology 284, 42–49. doi:10.1002/(SICI)1097-010X(19990615)284:1<42::AID- JEZ7>3.0.CO;2-3

Barnes, T. S., Goldizen, A. W., and Coleman, G. T. (2008). Hematology and serum biochemistry of the brush-tailed rock-wallaby (Petrogale penicillata). Journal of Wildlife Diseases 44, 295–303. doi:10.7589/ 0090-3558-44.2.295

Barnett, J., How, R., and Humphreys, W. (1979). Blood parameters in natural populations of Trichosurus species (Marsupialia: Phalangeridae). I. Age, sex and seasonal variation in T. caninus and T. vulpecula. II. Inﬂuence of habitat and population strategies of T. caninus and T. Vulpecula. Australian Journal of Zoology 27, 913–926. doi:10.1071/ ZO9790913

Cray, C., Zaias, J., and Altman, N. H. (2009). Acute phase response in

animals: a review. Comparative Medicine 59, 517–526.

184

Cripps, J. K., Martin, J. K., and Coulson, G. (2016). Anthelmintic treatment does not change foraging strategies of female eastern grey kangaroos, Macropus giganteus. PLoS One 11, e0147384. doi:10.1371/journal. pone.0147384

De Beer, M., Kindy, M. S., Lane, W. S., and De Beer, F. (1994). Mouse serum amyloid A protein (SAA5) structure and expression. The Journal of Biological Chemistry 269, 4661–4667.

Deane, E. M., Basden, K., Burnett, L., Proos, A., and Cooper, D. W. (1997). Serum analytes in the tammar wallaby, Macropus eugenii. Australian Veterinary Journal 75, 141–142. doi:10.1111/j.1751-0813.1997.tb14177.x Dobryszycka, W. (1997). Biological functions of haptoglobin – new pieces to an old puzzle. European Journal of Clinical Chemistry and Clinical Biochemistry 35, 647–654.

Domingo-Roura, X., Newman, C., Calafell, F., and Macdonald, D. W. (2001). Blood biochemistry reﬂects seasonal nutritional and reproductive constraints in the Eurasian badger (Meles meles). Physiological and Biochemical Zoology 74, 450– 460. doi:10.1086/320417

Edwards, M., Hinds, L., Deane, E., and Deakin, J. (2012). A review of complementary mechanisms which protect the developing marsupial pouch young. Developmental and Comparative Immunology 37, 213–220. doi:10.1016/j.dci.2012.03.013

Fuller, T. K., Kerr, K. D., and Karns, P. D. (1985). Hematology and serum chemistry of bobcats in northcentral Minnesota. Journal of Wildlife Diseases 21, 29–32. doi:10.7589/0090-3558-21.1.29

Garnick, S. W., Elgar, M. A., Beveridge, I., and Coulson, G. (2010). Foraging efﬁciency and parasite risk in eastern grey kangaroos (Macropus giganteus). Behavioral Ecology 21, 129–137. doi:10.1093/beheco/ arp162

Gaughwin, M., and Judson, G. (1980). Haematology and clinical chemistry of hairy- nosed wombats (Lasiorhinus latifrons). Journal of Wildlife Diseases 16, 275– 280. doi:10.7589/0090-3558-16.2.275

185

Green-Barber, J., Stannard, H., and Old, J. (2017). A suspected case of myopathy in a free-ranging eastern grey kangaroo (Macropus giganteus). Australian Mammalogy, In press. doi:10.1071/AM16054

Gordon, D. M., and Cowling, A. (2003). The distribution and genetic structure of Escherichia coli in Australian vertebrates: host and geographic effects. Microbiology 149, 3575–3586. doi:10.1099/mic.0.26486-0

Hall, A. J., Wells, R. S., Sweeney, J. C., Townsend, F. I., Balmer, B. C., Hohn, A. A., and Rhinehart, H. L. (2007). Annual, seasonal and individual variation in hematology and clinical blood chemistry proﬁles in bottlenose dolphins (Tursiops truncatus) from Sarasota Bay, Florida. Comparative Biochemistry and Physiology. Part A, Molecular & Integrative Physiology 148, 266–277. doi:10.1016/j.cbpa.2007.04.017

Haynes, J., and Skidmore, G. (1991). Hematology of the dasyurid Marsupials Sminthopsis crassicaudata and Sminthopsis macroura. Australian Journal of Zoology 39, 157–169. doi:10.1071/ZO9910157

Horadagoda, N. U., Knox, K. M. G., Gibbs, H. A., Reid, S. W. J., Horadagoda, A., Edwards, S. E. R., and Eckersall, P. D. (1999). Acute phase proteins in cattle: discrimination between acute and chronic inﬂammation. The Veterinary Record 144, 437–441. doi:10.1136/vr.144.16.437

Hultén, C., and Demmers, S. (2002). Serum amyloid A (SAA) as an aid in the management of infectious disease in the foal: comparison with total leucocyte count, neutrophil count and ﬁbrinogen. Equine Veterinary Journal 34, 693–698. doi:10.2746/042516402776250360

Jackson, S. (2003). ‘Australian Mammals: Biology and Captive Management.’ (CSIRO Publishing: Melbourne.)

Jacobsen, S., and Andersen, P. H. (2007). The acute phase protein serum amyloid A (SAA) as a marker of inﬂammation in horses. Equine Veterinary Education 19, 38–46. doi:10.1111/j.2042-3292.2007.tb00550.x Jacobsen, S., Kjelgaard- Hansen, M., Petersen, H. H., and Jensen, A. L. (2006). Evaluation of a commercially available human serum amyloid A (SAA) turbidometric

186

immunoassay for determination of equine SAA concentrations. Veterinary Journal (London, England) 172, 315–319. doi:10.1016/j.tvjl.2005.04.021

King, W. J., Wilson, M. E., Allen, T., Festa-Bianchet, M., and Coulson, G. (2011). A capture technique for free-ranging eastern grey kangaroos (Macropus giganteus) habituated to humans. Australian Mammalogy 33, 47–51. doi:10.1071/AM10029

Ladds, P. (2009). ‘Pathology of Australian Native Wildlife.’ (CSIRO Publishing: Melbourne.)

McKenzie, S., Deane, E. M., and Burnett, L. (2002). Haematology and serum biochemistry of the tammar wallaby, Macropus eugenii. Comparative Clinical Pathology 11, 229–237 [In English]. doi:10.1007/s005800200024

McKenzie, S., Deane, E. M., and Burnett, L. (2004). Are serum cortisol levels a reliable indicator of wellbeing in the tammar wallaby, Macropus eugenii? Comparative Biochemistry and Physiology. Part A, Molecular & Integrative Physiology 138, 341–348. doi:10.1016/j.cbpb.2004.05.004

Merchant, M. E., Roche, C., Elsey, R. M., and Prudhomme, J. (2003). Antibacterial properties of serum from the American alligator (Alligator mississippiensis). Comparative Biochemistry and Physiology. Part B, Biochemistry & Molecular Biology 136, 505–513. doi:10.1016/S1096- 4959(03)00256-2

Okesina, A. B., Donaldson, D., Lascelles, P. T., and Morris, P. (1995). Effect of gestational age on levels of serum alkaline phosphatase isoenzymes in healthy pregnant women. International Journal of Gynaecology and Obstetrics: the Ofﬁcial Organ of the International Federation of Gynaecology and Obstetrics 48, 25–29. doi:10.1016/0020-7292(94) 02248-8

Ong, O. T., Green-Barber, J. M., Kanuri, A., Young, L. J., and Old, J. M. (2017). Antimicrobial activity of red-tailed phascogale (Phascogale calura) serum. Comparative Immunology, Microbiology and Infectious Diseases 51, 41–48. doi:10.1016/j.cimid.2017.03.001

187

Osawa, R., Blanshard, W. H., and O’Callaghan, P. G. (1992). Microﬂora of the pouch of the koala (Phascolarctos cinereus). Journal of Wildlife Diseases 28, 276–280. doi:10.7589/0090-3558-28.2.276

Peck, S., Corkrey, R., Hamede, R., Jones, M., and Canﬁeld, P. (2015). Hematologic and serum biochemical reference intervals for wild Tasmanian devils (Sarcophilus harrisii). Veterinary Clinical Pathology 44, 519–529. doi:10.1111/vcp.12304

Power, M. L., Slade, M. B., Sangster, N. C., and Veal, D. A. (2004). Genetic characterisation of Cryptosporidium from a wild population of eastern grey kangaroos Macropus giganteus inhabiting a water catchment. Infection, Genetics and Evolution 4, 59–67. doi:10.1016/j.meegid.2004. 01.002

Presidente, P. (1978). Diseases seen in free-ranging marsupials and those held in captivity. Proceedings of Course for Veterinarians. Fauna, parts A and B 36, 457– 471.

Putnam, F. (1973). Alpha, Beta, Gamma, Omega? The Past, Present and Future of Plasma Proteins. Protides of the Biological Fluids: Proceedings of the Twenty-First Colloquium 21, 3–18.

Richardson, S. J., Dziegielewska, K. M., Andersen, N. A., Frost, S., and Schreiber, G. (1998). The acute phase response of plasma proteins in the polyprotodont marsupial Monodelphis domestica. Comparative Biochemistry and Physiology. Part B, Biochemistry & Molecular Biology 119, 183–188. doi:10.1016/S0305- 0491(97)00304-0

Robert, K. A., and Schwanz, L. E. (2013). Monitoring the health status of free- ranging tammar wallabies using hematology, serum biochemistry, and parasite loads. Journal of Wildlife Management 77, 1232–1243. doi:10.1002/jwmg.561

Roberts, M., Neaves, L., Claassens, R., and Herbert, C. (2010a). Darting eastern grey kangaroos: a protocol for free-ranging populations. In ‘Macropods: The Biology of Kangaroos, Wallabies and Rat-Kangaroos’. (Eds G. Coulson and M. Eldridge.) pp. 325–339. (CSIRO Publishing: Melbourne, Vic.)

188

Roberts, M. W., Smythe, L., Dohnt, M., Symonds, M., and Slack, A. (2010b). Serologic-based investigation of leptospirosis in a population of free- ranging eastern grey kangaroos (Macropus giganteus) indicating the presence of Leptospira weilii serovar Topaz. Journal of Wildlife Diseases 46, 564–579. doi:10.7589/0090-3558-46.2.564

Ruykys, L., Rich, B., and McCarthy, P. (2012). Haematology and biochemistry of warru (Petrogale lateralis MacDonnell Ranges race) in captivity and the wild. Australian Veterinary Journal 90, 331–340. doi:10.1111/j.1751- 0813.2012.00956.x

Sarma, J. V., and Ward, P. A. (2011). The complement system. Cell and Tissue Research 343, 227–235. doi:10.1007/s00441-010-1034-0

Shield, J. (1971). A seasonal change in blood cell volume of the Rottnest Island quokka, Setonix brachyurus. Journal of Zoology 165, 343–354. doi:10.1111/j.1469-7998.1971.tb02192.x

Spencer, P., and Speare, R. (1992). Hematology of wild allied rock-wallabies, Petrogale assimilis Ramsay, 1877 (Marsupialia, Macropodidae), in north Queensland. Australian Journal of Zoology 40, 355–364. doi:10.1071/ ZO9920355

Stannard, H. J., Young, L. J., and Old, J. M. (2013). Further investigation of the blood characteristics of Australian quoll (Dasyurus spp.) species. Veterinary Clinical Pathology 42, 476–482. doi:10.1111/vcp.12094

Stannard, H. J., Thompson, P., McAllan, B. M., and Raubenheimer, D. (2016). Hematology and serum biochemistry reference ranges of healthy captive Tasmanian devils (Sarcophilus harrisii) and their association with age, gender and seasonal variation. Mammalian Biology 81, 393–398. doi:10.1016/j.mambio.2016.03.007

Stefaniak, T., Gospodarek, A., Klima, F., Schadow, D., and Katnik, I. (1997). Haptoglobin concentration in blood sera of hoofed mammals in captivity. Archivum Immunologiae et Therapiae Experimentalis 45, 223–228.

189

Stirrat, S. C. (2003). Body condition and blood chemistry of agile wallabies (Macropus agilis) in the wet–dry tropics. Wildlife Research 30, 59–67. doi:10.1071/WR01041

Takemoto, R. M., Pavanelli, G. C., Lizama, M. A. P., Luque, J. L., and Poulin, R. (2005). Host population density as the major determinant of endoparasite species richness in ﬂoodplain ﬁshes of the upper Paraná River, Brazil. Journal of Helminthology 79, 75–84. doi:10.1079/ JOH2004264

Takenaka, A., Gotoh, S., Watanabe, T., and Takenaka, O. (1988). Developmental changes of plasma alkaline phosphatase, calcium, and inorganic phosphorus in relation to the growth of bones in the Japanese macaque (Macaca fuscata). Primates 29, 395–404. doi:10.1007/BF0 2380962

Tothova, C., Nagy, O., and Kovac, G. (2014). cute phase proteins and their use in the diagnosis of diseases in ruminants: a review. Veterinarni Medicina 59, 163– 180.

Trumble, S. J., Castellini, M. A., Mau, T. L., and Castellini, J. M. (2006). Dietary and seasonal inﬂuences on blood chemistry and hematology in captive harbor seals. Marine Mammal Science 22, 104–123. doi:10.1111/ j.1748- 7692.2006.00008.x

Vaughan, R. J., Warren, K. S., Mills, J. S., Palmer, C., Fenwick, S., Monaghan, C. L., and Friend, A. J. (2009). Hematological and serum biochemical reference values and cohort analysis in the Gilbert’s potoroo (Potorous gilbertii). Journal of Zoo and Wildlife Medicine 40, 276–288. doi:10.1638/ 2008-0058.1

Wells, R., Jones, A., Clout, M., Sarre, S., and Anderson, R. (2000). Seasonal effects on the haematology and blood chemistry of wild brushtail possums, Trichosurus vulpecula (Marsupialia: Phalangeridae) in New Zealand. Comparative Haematology International 10, 68–73. doi:10.1007/s005800070010

Whitehead, A., De Beer, M., Steel, D., Rits, M., Lelias, J., Lane, W., and De Beer, F. (1992). Identiﬁcation of novel members of the serum amyloid A protein superfamily as constitutive apolipoproteins of high density lipoprotein. The Journal of Biological Chemistry 267, 3862–3867.

190

Wilcox, R. S., Vaz, P., Ficorilli, N. P., Whiteley, P. L., Wilks, C. R., and Devlin, J. M. (2011). Gammaherpesvirus infection in a free-ranging eastern grey kangaroo (Macropus giganteus). Australian Veterinary Journal 89, 55–57. doi:10.1111/j.1751-0813.2010.00662.x

Young, L. J., and Deane, E. M. (2006). A longitudinal study of changes in blood leukocyte numbers in the tammar wallaby, Macropus eugenii. Comparative Clinical Pathology 15, 63–69. doi:10.1007/s00580-006- 0608-4

191

CHAPTER 7

7. Discussion, recommendations and future directions for eastern grey kangaroo management and research.

192

7.1. General discussion and conclusion

The research conducted for this thesis has successfully determined:

1) Suitability of camera traps for assessing kangaroo behaviour,

2) Activity patterns of eastern grey kangaroos in developed and natural

landscapes,

3) Spatial and temporal factors that influence road mortality in

kangaroos,

4) Genetic relationships within a free-ranging population of eastern grey

kangaroos,

5) Haematology and blood chemistry values, antibacterial activity, and

presence and level of acute phase proteins in a free-ranging

population of eastern grey kangaroos.

This thesis is the first time camera traps have been used to assess behaviour of kangaroos, and this research has illustrated their usefulness in monitoring activity patterns in kangaroo populations. Activity data from camera traps was found to be consistent with other observational studies of kangaroos. Camera traps provide researchers and managers with an efficient tool for documenting changes within and between populations. The potential for camera traps to capture novel observations of rare or difficult to observe behaviours was also demonstrated. Kangaroos became habituated to the presence of cameras and the effect on their behaviour was minimal.

Camera traps are more cost effective and less labour intensive than tagging or direct observation, and can be used to collect long term data on multiple individuals in a wide range of field settings (Rowcliffe et al. 2014). The use of cameras for studying

193

the behaviour of kangaroos is likely to reduce the observer effect and therefore provide more useful data.

The behavioural patterns of kangaroos in developed and natural landscapes have been compared for the first time in this species. It is essential to understand how kangaroo activity differs in developed landscapes in order to generate informed management strategies. The activity patterns, space use, group size, and frequency of certain behaviours were found to differ between kangaroos in developed and natural landscapes. Kangaroos at the natural site gathered in larger groups, spent more time in woodland/grassland fringe habitats, peaked in activity earlier in the day, and exhibited increased vigilance and agonistic interactions, and reduced travelling and feeding. Behavioural changes were attributed to human activity, built infrastructure, and increased population density at the developed site. Knowledge of these behavioural changes is required for developing strategies to reduce the impacts of urbanisation on kangaroo populations, such as designing new developments to minimise habitat fragmentation and light pollution.

Very few studies have examined the influence of attractive landscape features on eastern grey kangaroo road kill mortality rates and none have been conducted in temperate regions or semi-rural/semi-suburban areas. Based on the findings of this study, it appears that illumination influences the likelihood of kangaroo road mortalities. Other factors that contribute to the occurrence of kangaroo road mortality include low temperatures and low rainfall which are likely to affect forage quality.

The identification of spatial and temporal factors that influence road mortality in kangaroos has highlighted necessary areas for improvement for future road design

194

and effective deterrent strategies that can be used to minimise the likelihood of wildlife road mortality.

Spatial genetic structure is influenced by dispersal, home ranges of individuals, and population density (Eldridge & Coulson 2015). Barriers in the landscape such as roads restrict dispersal and therefore gene flow of wildlife populations (Forman & Alexander 1998) . Genetic markers have been used to evaluate the barrier effect of roads for multiple vertebrate species (Epps et al. 2005;

Gerlach & Musolf 2000; Kuehn et al. 2006; Reh & Seitz 1990). Knowledge of spatial genetic structure within a population is useful for developing informed management strategies. Limited evidence of genetic structure was observed in the population of kangaroos studied and is consistent with previous findings (Neaves et al. 2017). Knowledge of the genetic relationships present in a population of kangaroos provides insight on the genetic diversity and dispersal of this high density and fragmented population.

Health impacts individual animals as well as populations of animals, particularly in high density populations where disease transmission is increased due to close contact between individuals (Cripps, Martin & Coulson 2016). Urban development can negatively impact the health of nearby wildlife populations, and stress induced immune modulation can occur as a result of human disturbances

(Acevedo-Whitehouse & Duffus 2009). Stress can also affect behaviour, feeding rates, and reproductive success (Newport, Shorthouse & Manning 2014).

It is important to monitor the health of kangaroo populations near human development as it also has implications for the health of human populations.

Kangaroos can act as reservoirs for diseases that affect humans such as Q fever

195

(Coxiella burnetii) and Ross River virus (Cooper et al. 2012; Old & Deane 2005).

Kangaroos are susceptible to Toxoplasma gondii and may transfer these parasites to other wildlife populations which causes high mortality rates in marsupials (Jackson

2003; Miller, Faulkner & Patton 2003). The presence of high density kangaroo populations that are close to human development increases the likelihood of transmission of zoonotic diseases to human populations. For this reason health parameters were investigated for the first time in free-ranging eastern grey kangaroos. The findings of this research provide information on the haematology and blood chemistry values of kangaroos, and reports on the ability of their serum to inhibit bacterial growth. Differences in both the haematological and blood chemistry values were detected between kangaroos of different ages and genders, however further research with a larger sample size is needed to confirm if these differences occur consistently between genders and age groups. Kangaroo serum showed a strong antibacterial response to Klebsiella pneumoniae, and moderate responses to

Escherichia coli and Staphylococcus aureus. Antibacterial responses varied between females and males which is consistent with the suggestion that the marsupial pouch may favour or exclude particular strains of bacteria (Deakin & Cooper 2004; Old &

Deane 1998).

Acute phase proteins, haptoglobin and serum amyloid A were confirmed to be present in kangaroo serum using biochemical assays. Haptoglobin was elevated in the kangaroo with chronic inflammation but SAA was not which is consistent with other studies (Alsemgeest et al. 1994; Horadagoda et al. 1999). These findings suggest that marsupials are capable of producing acute phase proteins in reaction to trauma. High density kangaroo populations such as those in developed areas experience increased disease transmission rates (Cripps, Martin & Coulson 2016).

196

The use of baseline data for measuring health in free ranging kangaroos is essential for effectively monitoring animals in high density populations.

The range of eastern grey kangaroos has dramatically expanded over the last

30-40 years (Richardson 2012). The behaviour, population ecology, and health of kangaroo populations are affected by human activity, as additional resources created by human development of the landscape have allowed kangaroo populations to increase in abundance and distribution (Coulson, Cripps & Wilson 2014; Richardson

2012). Overabundance of kangaroos can result in various management issues including agricultural loss, animal welfare concerns, detriment to human life/livelihood, and loss of biodiversity (Coulson 2009; Descovich et al. 2016). Both kangaroo and human populations in Western Sydney are increasing, leading to greater human-wildlife conflicts. Multiple management techniques have been utilised to address overabundant kangaroo populations, including culling (NSW Commercial

Kangaroo Harvest Management Plan 2017), reproductive management (Tribe et al.

2014), and auditory and olfactory deterrents (Bender 2003; Cox et al. 2015). Limited knowledge exists about how human activity affects the behaviour, population ecology, and health of free-ranging eastern grey kangaroos and obtaining this information is essential in order for management strategies to be effective.

The research presented has increased the existing knowledge of the behaviour, population ecology, and health of eastern grey kangaroos. The findings demonstrate that camera trap data is useful for assessing activity patterns in eastern grey kangaroos and that these activity patterns differ between a developed and natural landscape. Multiple factors were found to influence kangaroo road mortality such as illumination, temperature, and rainfall. Parent and sibling relationships were detected

197

using microsatellite analysis, and no genetic spatial autocorrelation was detected.

Haematological and blood chemistry values were established for free ranging kangaroos of different ages and genders, and the antibacterial response and presence of acute phase proteins in kangaroo serum was verified. These studies could be replicated across Western Sydney and broader areas to establish a more comprehensive database for free-ranging eastern grey kangaroos to assist in developing more effective management strategies for the future.

7.2. Future Directions

Camera traps should be incorporated into future studies of eastern grey kangaroo behaviour to reduce observer effects, cost, and enable long term monitoring. Further research should be conducted to fully evaluate how varying levels of development effect the behavioural patterns of kangaroo populations. It is important to monitor the behavioural differences of kangaroo populations in developed landscapes in order to improve management strategies and reduce human- animal conflicts. Knowledge of the activity patterns of kangaroos in different areas allows wildlife managers to develop informed strategies to minimise effects of urban development, such as ensuring new developments are designed to avoid habitat fragmentation and light pollution, and modifying existing structures such as roads and fencing to reduce current impacts .

Spatial and temporal factors that affect kangaroo road mortality should be considered in future road design and management planning for this species. It is recommended that safe wildlife crossing areas are constructed in areas where kangaroos cross roads most frequently as noted by increased roadside mortality.

Eastern grey kangaroos are known to successfully use underpasses to cross roads,

198

however no studies have been conducted to evaluate their effectiveness in reducing kangaroo road mortality rates (Cramer et al. 2015). Flashing warning signs have been effective in reducing deer road mortality and should be used to alert drivers of temporal factors such as high moon illumination that increase the likelihood of kangaroos crossing roads (Sullivan et al. 2004). Further studies are required to evaluate whether these are the most relevant influencing factors of kangaroo road mortality over a wider geographical area.

Additional research is recommended to evaluate the spatial genetic structure of other eastern grey kangaroo populations across Western Sydney using larger sample sizes and additional microsatellite loci to obtain more robust results. An increased understanding of the genetic structure of kangaroo populations in Western

Sydney is required to fully evaluate the effect of increasing urban development on gene flow, and would enable a more in depth evaluation of other factors that influence their dispersal patterns. Management of eastern grey kangaroos requires monitoring of overabundant populations, and effective monitoring can only occur with a comprehensive understanding of the genetic structure and dispersal patterns occurring within these populations (Zenger, Eldridge & Cooper 2003). Populations identified as having restricted gene flow could be addressed using fertility control or reduction of landscape barriers where appropriate.

Reference values for healthy free-ranging eastern grey kangaroos are useful for assessing health and disease susceptibility of free-ranging populations. More research is needed to evaluate how these parameters vary over a larger geographical area, as well as to establish whether gender and age differences occur consistently in other populations. Assessing the health of kangaroo populations in developed areas is

199

essential for identifying specific health issues effecting these populations, and developing strategies to address them such as removal of toxic substances from an area. Ongoing monitoring of parasites present in kangaroo populations is recommended especially for areas where kangaroos are harvested for human consumption or may pose a risk to human health, such as contamination of water sources.

Future research will benefit our understanding of eastern grey kangaroo biology and hence improve management of kangaroos in evolving landscapes.

Although we are increasing our knowledge of eastern grey kangaroo biology, there is still much to learn.

7.3. Chapter references

Acevedo-Whitehouse, K & Duffus, AL 2009, 'Effects of environmental change on wildlife health', Philosophical Transactions of the Royal Society of London B: Biological Sciences, vol. 364, no. 1534, pp. 3429-38.

Alsemgeest, S, Kalsbeek, H, Wensing, T, Koeman, J, Van Ederen, A & Gruys, E 1994, 'Concentrations of serum Amyloid ‐a (SAA) and hapt inflammatory diseases in cattle', Veterinary Quarterly, vol. 16, no. 1, pp. 21-3.

Bender, H 2003, 'Deterrence of kangaroos from agricultural areas using ultrasonic frequencies: efficacy of a commercial device', Wildlife Society Bulletin, pp. 1037-46.

Cooper, A, Barnes, T, Potter, A, Ketheesan, N & Govan, B 2012, 'Determination of Coxiella burnetii seroprevalence in macropods in Australia', Veterinary Microbiology, vol. 155, no. 2, pp. 317-23.

Coulson, G 2009, 'Behavioural ecology of red and grey kangaroos: Caughley’s insights into individuals, associations and dispersion', Wildlife Research, vol. 36, no. 1, pp. 57-69.

Coulson, G, Cripps, J & Wilson, M 2014, 'Hopping down the main street: eastern grey kangaroos at home in an urban matrix', Animals, vol. 4, no. 2, pp. 272-91.

200

Cox, TE, Murray, PJ, Bengsen, AJ, Hall, GP & Li, X 2015, 'Do fecal odors from native and non abitat‐native shift predators among cause macropods?', a h Wildlife Society Bulletin, vol. 39, no. 1, pp. 159-64.

Cramer, P, Olsson, M, Gadd, ME, van der Ree, R & Sielecki, LE 2015, 'Transportation and large herbivores', in vdR Rodney, DJ Smith & C Grilo (eds), Handbook of Road Ecology, John Wiley & Sons, Ltd, pp. 344-52.

Cripps, JK, Martin, JK & Coulson, G 2016, 'Anthelmintic Treatment Does Not Change Foraging Strategies of Female Eastern Grey Kangaroos, Macropus giganteus', PLoS ONE, vol. 11, no. 1, pp. 1-14.

Deakin, J & Cooper, DW 2004, 'Characterisation of and immunity to the aerobic bacteria found in the pouch of the brushtail possum Trichosurus vulpecula', Comparative Immunology, Microbiology and Infectious Diseases, vol. 27, no. 1, pp. 33-46.

Descovich, K, Tribe, A, McDonald, IJ & Phillips, CJ 2016, 'The eastern grey kangaroo: current management and future directions', Wildlife Research, vol. 43, no. 7, pp. 576-89.

Eldridge, M & Coulson, G 2015, 'Family Macropodidae (kangaroos and wallabies)', in Handbook of the Mammals of the World, vol. 5, pp. 630-735.

Epps, CW, Palsbøll, PJ, Wehausen, JD, Roderick, GK, Ramey, RR & McCullough, DR 2005, 'Highways block gene flow and cause a rapid decline in genetic diversity of desert bighorn sheep', Ecology Letters, vol. 8, no. 10, pp. 1029-38.

Forman, RTT & Alexander, LE 1998, 'Roads and their major ecological effects', Annual Review of Ecology and Systematics, vol. 29, p. 207.

Gerlach, G & Musolf, K 2000, 'Fragmentation of landscape as a cause for genetic subdivision in bank voles', Conservation Biology, vol. 14, no. 4, pp. 1066-74.

Horadagoda, NU, Knox, KMG, Gibbs, HA, Reid, SWJ, Horadagoda, A, Edwards, SER & Eckersall, PD 1999, 'Acute phase proteins in cattle: discrimination between acute and chronic inflammation', Veterinary Record, vol. 144, no. 16, pp. 437-41.

Jackson, S 2003, Australian Mammals: Biology and Captive Management, Collingwood: CSIRO Publishing.

Kuehn, R, Hindenlang, KE, Holzgang, O, Senn, J, Stoeckle, B & Sperisen, C 2006, 'Genetic effect of transportation infrastructure on roe deer populations (Capreolus capreolus)', Journal of Heredity, vol. 98, no. 1, pp. 13-22.

201

Miller, DS, Faulkner, C & Patton, S 2003, 'Detection of Toxoplasma gondii IgG antibodies in juvenile great grey kangaroos, Macropus giganteus giganteus', Journal of Zoo and Wildlife Medicine, vol. 34, no. 2, pp. 189-93.

Neaves, LE, Roberts, MW, Herbert, CA & Eldridge, MD 2017, 'Limited sex bias in the fine-scale spatial genetic structure of the eastern grey kangaroo and its relationship to habitat', Australian Journal of Zoology, vol. 65, no. 1, pp. 33-44.

Old, JM & Deane, EM 1998, 'The effect of oestrus and the presence of pouch young on aerobic bacteria isolated from the pouch of the tammar wallaby, Macropus eugenii', Comparative Immunology, Microbiology and Infectious Diseases, vol. 21, no. 4, pp. 237-45.

Old, JM & Deane, EM 2005, 'Antibodies to the Ross River virus in captive marsupials in urban areas of eastern New South Wales, Australia', Journal of Wildlife Diseases, vol. 41, no. 3, pp. 611-4.

Reh, W & Seitz, A 1990, 'The influence of land use on the genetic structure of populations of the common frog Rana temporaria', Biological Conservation, vol. 54, no. 3, pp. 239-49.

Richardson, KC 2012, Australia's amazing kangaroos their conservation, unique biology and coexistence with humans, CSIRO Publishing, Collingwood, Victoria.

Rowcliffe, JM, Kays, R, Kranstauber, B, Carbone, C & Jansen, PA 2014, 'Quantifying levels of animal activity using camera trap data', Methods in Ecology and Evolution, vol. 5, no. 11, pp. 1170-9.

Storm, DJ, Samuel, MD, Rolley, RE, Shelton, P, Keuler, NS, Richards, BJ & Van Deelen, TR 2013, 'Deer density and disease prevalence influence transmission of chronic wasting disease in white Ecosphere‐tailed deer',, vol. 4, no. 1, pp. 1-14.

Sullivan, TL, Williams, AF, Messmer, TA, Hellinga, LA & Kyrychenko, SY 2004, 'Effectiveness of temporary warning signs in reducing deer-vehicle collisions during mule deer migrations', Wildlife Society Bulletin, vol. 32, no. 3, pp. 907-15.

202

Zenger, KR, Eldridge, MDB & Cooper, DW 2003, 'Intraspecific variation, sex- biased dispersal and phylogeography of the eastern grey kangaroo (Macropus giganteus)', Heredity, vol. 91, no. 2, p. 153.

203

Appendices

204

Appendix 1

A1. A suspected case of myopathy in a free-ranging

eastern grey kangaroo (Macropus giganteus).

Jai M. Green-Barber, Hayley J. Stannard and Julie M. Old

205

Abstract

Macropods are susceptible to capture myopathy. A post mortem examination, and haematological and blood chemistry analysis was conducted on a male eastern grey kangaroo (Macropus giganteus) believed to have capture myopathy. Changes in blood chemistry and necrosis of muscle tissue are the most prevalent sign of myopathy in eastern grey kangaroos.

Introduction

Capture myopathy is a metabolic disease commonly associated with the capture and restraint of animals (Paterson et al. 2007). It occurs when altered blood flow results in inadequate delivery of nutrients and oxygen, increased lactic acid production, and decreased cellular waste removal, which causes necrosis of the muscle tissue (Spraker 1993). The pathology of capture myopathy was first described in a Hunter’s hartebeest (Damaliscus hunteri) (Jarrett et al. 1964), and has since been reported in many mammalian species including ungulates (Hadlow 1955; Hebert and Cowan 1971; Hofmeyr et al. 1973; Wobeser et al. 1976; Dierenfeld and Dolensek 1988), and other eutherians (McConnell et al. 1974; Herráez et al. 2007), as well as several avian species (Young 1967; Spraker et al. 1987; Marco et al. 2006; Businga et al. 2007). Clinical and haematological signs of capture myopathy include tachycardia, elevated body temperature, a weak pulse, and elevated creatinine, aminotransferase and lactate dehydrogenase. Manifestations of capture myopathy vary between species (Paterson et al. 2007). Shepherd et al. (1988)identified necrosis of muscle (particularly skeletal or cardiac muscle) as the primary clinical sign of capture myopathy in red kangaroos (Macropus rufus).

During anaesthesia and subsequent capture of one adult male kangaroo, a capture myopathy event occurred. This paper provides the first detailed report of capture myopathy in an eastern grey kangaroo (Macropus giganteus).

206

Methods

Eastern grey kangaroos were captured to obtain blood samples as part of a study to determine measures of health in free-ranging eastern grey kangaroos (Green- Barber et al. 2017). Animals were captured using chemical restraint with Zoletil at 5–7 mg kg–1, administered using 3-mL darts with 60-mm-long needles via a

CO2 Injection Rifle (Dan-Inject, Denmark). Kangaroos were darted in the upper hind leg, thigh or rump from a distance of 23–28 m in accordance with recommendations made by Roberts et al. (2010). When each kangaroo dropped to the ground it was approached slowly and quietly, a hessian sack was placed over its head and the tail and hind limbs were restrained during processing.

A blood sample was taken from the lateral tail vein using a 21 gauge needle from all kangaroos captured as part of a study investigating heath and disease in eastern grey kangaroos (Green-Barber et al. 2017). Two-thirds of each sample was placed immediately into an EDTA-coated Vacutainer tube (Becton, Dickinson and Co., New Jersey) and the remaining third into a Venosafe tube containing a clot-activating additive (Terumo Europe, Belgium) before transportation to the laboratory. Body condition was assessed by measuring the diameter of the base of the tail using Vernier callipers. One kangaroo failed to recover from chemical restraint, and had to be euthanased. A post mortem examination was performed to assess the occurrence of capture myopathy.

Blood chemistry values were measured using a Vetscan VS2 blood chemistry analyser and comprehensive diagnostic profile rotor plates (Abaxis, CA, USA). The rotor plates measured the following parameters: albumin (g L–1), alkaline phosphatase (U L–1), alanine aminotransferase (U L–1), amylase (U L–1), urea nitrogen (mmol L–1), creatinine (μmol L–1), globulin (g L–1), glucose (mmol L–1), potassium (mmol L–1), sodium (mmol L–1), phosphorus (mmol L–1), total bilirubin (μmol L–1), and total protein (g L–1). Serum samples were analysed for creatine kinase (CK) and lactic dehydrogenase (LDH) by IDEXX Laboratories (Rydalmere, NSW) for the kangaroo with assumed capture myopathy. White blood cell counts were calculated from manual counts of blood smears on a microscope slide stained with DiffQuick stain (Bacto Laboratories Pty Ltd, Mount Pritchard, NSW) using an Olympus CX31RBSF compound microscope.

207

The myocardium, lungs, kidney, spleen, pancreas, liver, thigh muscle, and right hind foot with a pre-existing injury were dissected and examined. The thigh muscles examined included both vastus lateralis and biceps femoris. Myocardium, liver, kidney and thigh skeletal muscle tissues were sent to IDEXX Laboratories (Rydalmere, NSW) for histopathology.

Results

The one adult male kangaroo that exhibited capture myopathy was darted but a full dose of Zoletil (Virbac, Australia) was not successfully administered, resulting in incomplete immobilisation. Additional tranquiliser was administered until the kangaroo became fully immobilised. It was not possible to determine precisely how much tranquiliser was successfully administered during the initial dose; however, the total dose rate, including additional tranquiliser, was estimated to be 6–9 mg kg–1. After routine measurements were taken, the kangaroo was allowed to recover in the shade and the heart rate, respiration rate, capillary refill time and body temperature were monitored. The kangaroo appeared to be old, had very poor body condition, and exhibited periodic leg spasms during recovery. The poor body condition was not apparent at the time of darting due to a thick winter coat. Signs of tachycardia (160 bpm), tachypnoea (120–140 breaths min–1), hyperthermia (body temperature 40.7°C), and a sluggish capillary refill time (~2 s), indicated possible onset of capture myopathy. The kangaroo failed to recover from anaesthesia after 7 h. The heart rate, respiration rate, and body temperature reduced to below normal parameters of other healthy kangaroos captured during the study (Green-Barber et al. 2017), and the kangaroo showed signs of cardiovascular and circulatory collapse. Euthanasia was required, which was administered by a veterinarian in the form of an intraperitoneal injection of Lethabarb (Virbac, Australia).

A post mortem examination conducted on the dead kangaroo revealed extensive areas of muscle damage and necrosis. Areas of skeletal muscle were pale in macroscopic appearance, which is consistent with capture myopathy. A significant proportion of the hind limbs (Fig. 1) and myocardium was found to be pale and necrotic. Congestion was present in the lungs, and the kidneys had a swollen and mottled appearance (Fig. 2). Age was estimated by examining the teeth using a

208

method derived from Kirkpatrick (1965), which indicated that the kangaroo was 16– 20 years old as all molars had progressed past the rim of the eye cavity.

Fig. 1. The muscle condition of an adult male eastern grey kangaroo suffering from capture myopathy, showing (A) vastus lateralis general pallor and the deeper areas of friable/gelatinous muscle tissue, (B) the normal shoulder muscle tissue, compared with (C) friable/gelatinous biceps femoris, and (D) pale vastus lateralis.

209

Fig. 2. The lungs and kidneys of an adult male eastern grey kangaroo suffering from capture myopathy, showing (A) the lung were congested and oedematous, and (B) the kidneys appeared mottled and swollen.

Evidence of pre-existing injuries associated with trauma were observed, which may have increased the likelihood of myopathy. A partially open wound and swelling were present on the right hind foot. Further examination of the foot showed extensive areas of muscle damage and necrosis. The right forelimb was held in an abnormal position and showed excessive movement in the carpus, indicating possible ligament and/or tendon damage.

Histopathology results found mild, patchy congestion and small areas of acute haemorrhage within the interstitium of the heart muscle. The liver and kidneys also showed signs of congestion and there was mild swelling of centrilobular to midzonal hepatocytes, demonstrated by increased cytoplasmic pallor and volume compared with periportal hepatocytes. The kidney tissue appeared mottled, and had signs of moderate, multifocal to coalescing congestion. Thigh skeletal muscle appeared normal.

Blood chemistry values for the dead kangaroo (Table 1) were compared with those of healthy free-ranging kangaroos (Green-Barber et al. 2017). The dead kangaroo had substantially lower levels of alkaline phosphatase (11 U L–1), and phosphorus (0.77 mmol L-1), and notably elevated levels of alanine aminotransferase (187 U L–1), amylase (408 U L–1), creatinine (220 μmol L–1), and globulin (40 g L–1). Evidence of dehydration (PVC-50) and some electrolyte abnormalities (Table 1) were also observed. White blood cell counts (Table 1) had markedly lower eosinophil values

210

than that observed in healthy individuals. The monocyte and lymphocyte values were also lower.

Table 1. Blood chemistry and haematology values of an adult male eastern grey kangaroo suffering from capture myopathy compared with healthy males

Discussion

Capture myopathy is reportedly common in macropods, but few reports have been formally documented, with only three reported to date, these being for red kangaroos (Shepherd et al. 1988), agile wallabies (Macropus agilis) (Stirrat 1997), and a Tasmanian pademelon (Thylogale billardierii) (McMahon et al. 2013). No reports of capture myopathy have been described in eastern grey kangaroos.

211

Several factors can increase the likelihood of capture myopathy, such as extreme ambient temperatures, difficult terrain, excessive handling, prolonged restraint, and pre-existing injuries and diseases (Paterson et al. 2007). Very old or very young animals are likely to have a greater susceptibility to capture myopathy (Ebedes et al. 2002). The kangaroo was in an extremely poor condition with a complete absence of fat. Two healthy males had a much greater mean tail diameter (98 mm) than the male with myopathy (72 mm), despite having comparable tail lengths (healthy male mean, 1060 mm; male with myopathy, 1040 mm) (Green-Barber et al. 2017).

The most significant finding from the histopathology was the hepatic necrosis. This may be due to very early hypoxic injury due to decreased perfusion/shock, especially given the significant hepatic congestion. Abnormalities may be present in the tissues of animals with capture myopathy, including haemorrhage or oedema throughout muscles, swollen mottled kidneys, and congestion in the lungs (Wallace et al. 1987; Spraker 1993; Finlay and Jeske 1997). Heart and liver tissue are particularly susceptible to damage from hypoxia. Shepherd (1983) found evidence of myoglobinuria in many of the red kangaroos with capture myopathy but did not find evidence of cardiac necrosis or kidney damage. Wallace et al. (1987) found no signs of kidney damage in multiple ungulates with capture myopathy, which suggests that the physical manifestations of capture myopathy differ vastly between species.

Skeletal muscle necrosis was described histologically in red kangaroos with capture myopathy (Shepherd et al. 1988); however, in this study there was no evidence of similar skeletal muscle damage in the muscles examined. Despite the lack of histological skeletal muscle tissue necrosis in the eastern grey kangaroo examined, Shepherd et al. (1988) indicated that macroscopic muscle necrosis (demonstrated by the pallor of the skeletal muscle) was related to the severity of myopathy experienced by an individual kangaroo, and therefore determined that macroscopic muscle colour was a more reliable indication of myopathy than histopathology.

Alanine aminotransferase levels were substantially elevated in the male kangaroo, and have been linked to capture myopathy in other species (Chalmers and Barrett 1982; Vassart et al. 1992). Capture myopathy in other species has been observed to result in increases of creatine kinase (CK), aspartate aminotransferase (AST), and

212

lactic dehydrogenase (LDH) (Wallace et al. 1987). CK has previously been used to assess the occurrence of capture myopathy in other species (Spraker 1993; Ruykys et al. 2012). CK, AST and LDH levels were considerably higher in the kangaroo than in other marsupials (Gaughwin and Judson 1980; McKenzie et al. 2002; Barnes et al. 2008); however, no published data for CK, AST or LDH could be found for healthy wild eastern grey kangaroos to enable comparison. The elevated CK levels may indicate muscle death, e.g. myocardial infarction and renal failure (Wyss and Kaddurah-Daouk 2000; Clarkson et al. 2006), suggesting that he was affected by capture myopathy. Elevated LDH and AST are reliable indicators of necrosis (Wallace et al. 1987).

The neutrophil to lymphocyte (N : L) ratio of the kangaroo with capture myopathy was higher (3.68) than for healthy free-ranging kangaroos (Green-Barber et al. 2017). Elevated N : L ratios have been associated with poor health and disease in tammar wallabies (Young and Deane 2006).

On the basis of the findings of the post mortem examination, and blood chemistry analysis, it is likely that the reason the animal failed to recover from anaesthesia was peracute capture myopathy. Evidence of pre-existing trauma injuries and poor body condition suggests that this kangaroo was in poor health before capture, which is likely to have increased this individual’s susceptibility to capture myopathy. Capture myopathy in eastern grey kangaroos is similar to that described for red kangaroos.

Conflicts of interest

The authors declare no conflicts of interest.

Acknowledgements

213

examination, animal handling, and sample collection. None of the authors have a conflict of interest.

References

Barnes, T. S., Goldizen, A. W., and Coleman, G. T. (2008). Hematology and serum biochemistry of the brush-tailed rock-wallaby (Petrogale penicillata). Journal of Wildlife Diseases 44, 295–303.

Businga, N. K., Langenberg, J., and Carlson, L. (2007). Successful treatment of capture myopathy in three wild greater sandhill cranes (Grus canadensis tabida). Journal of Avian Medicine and Surgery 21, 294–298.

Chalmers, G., and Barrett, M. (1982). Capture myopathy. In ‘Noninfectious Diseases of Wildlife’. (Eds G. L. Hoff and J. W. Davis.) pp. 84–95. (Iowa State University Press: Ames, IA.)

Clarkson, P. M., Kearns, A. K., Rouzier, P., Rubin, R., and Thompson, P. D. (2006). Serum creatine kinase levels and renal function measures in exertional muscle damage. Medicine and Science in Sports and Exercise 38, 623–627.

Dierenfeld, E. S., and Dolensek, E. P. (1988). Circulating levels of vitamin E in captive Asian elephants (Elephas maximus). Zoo Biology 7, 165–172.

Ebedes, H., Van Rooyen, J., and Du Toit, J. G. (2002). Capturing wild animals. In ‘Game Ranch Management’. 4th edn. (Ed. J. D. P. Bothma.) pp. 382–430. (Van Schaik Publishers: Pretoria, South Africa.)

Finlay, M. C., and Jeske, C. W. (1997). Capture myopathy in a captive black-bellied whistling duck. Wildfowl48, 181–185.

Gaughwin, M., and Judson, G. (1980). Haematology and clinical chemistry of hairy- nosed wombats (Lasiorhinus latifrons). Journal of Wildlife Diseases 16, 275–280.

Green-Barber, J., Ong, O., Kanuri, A., Stannard, H., and Old, J. (2017). Blood constituents of free-ranging eastern grey kangaroos (Macropus giganteus). Australian Mammalogy , .

Hadlow, W. (1955). Degenerative myopathy in a white-tailed deer, Odocoileus virginianus. The Cornell Veterinarian 45, 538–547.

Hebert, D. M., and Cowan, I. M. (1971). White muscle disease in the mountain goat. Journal of Wildlife Management 35, 752–756.

Herráez, P., Sierra, E., Arbelo, M., Jaber, J. R., de los Monteros, A. E., and Fernández, A. (2007). Rhabdomyolysis and myoglobinuric nephrosis (capture myopathy) in a striped dolphin. Journal of Wildlife Diseases 43, 770–774.

214

Hofmeyr, J., Louw, G., and Du Preez, J. (1973). Incipient capture myopathy as revealed by blood chemistry of chased zebras. Madoqua 7, 45–50.

Jarrett, W., Jennings, F., Murray, M., and Harthoorn, A. (1964). Muscular dystrophy in wild Hunter’s antelope. African Journal of Ecology 2, 158–159.

Kirkpatrick, T. H. (1965). Studies of Macropodidae in Queensland 2. Age estimation in the grey kangaroo, the red kangaroo, the eastern wallaroo and the red-necked wallaby, with notes on dental abnormalities. Queensland Journal of Agricultural and Animal Sciences 22, 301–317.

Marco, I., Mentaberre, G., Ponjoan, A., Bota, G., Mañosa, S., and Lavín, S. (2006). Capture myopathy in little bustards after trapping and marking. Journal of Wildlife Diseases 42, 889–891.

McConnell, E., Basson, P., De Vos, V., Myers, B., and Kuntz, R. (1974). A survey of diseases among 100 free-ranging baboons (Papio ursinus) from the Kruger National Park. The Onderstepoort Journal of Veterinary Research 41, 97–167.

McKenzie, S., Deane, E. M., and Burnett, L. (2002). Haematology and serum biochemistry of the tammar wallaby, Macropus eugenii. Comparative Clinical Pathology 11, 229–237.

McMahon, C., Wiggins, N., French, V., McCallum, H., and Bowman, D. (2013). A report of capture myopathy in the Tasmanian pademelon (Thylogale billardierii). Animal Welfare (South Mimms, England) 22, 1–4.

Paterson, J., West, G., Heard, D., and Caulkett, N. (2007). Capture myopathy. In ‘Zoo Animal and Wildlife Immobilization and Anesthesia’. (Eds D. H. G. West, and N. Caulkett.) pp. 115–122. (Blackwell Publishing Ltd: Oxford.)

Roberts, M., Neaves, L., Claassens, R., and Herbert, C. (2010). Darting eastern grey kangaroos: a protocol for free-ranging populations. In ‘Macropods: The Biology of Kangaroos, Wallabies and Rat-Kangaroos’. (Eds G. Coulson and M. Eldridge.) pp. 325–339. (CSIRO Publishing: Melbourne.)

Ruykys, L., Rich, B., and McCarthy, P. (2012). Haematology and biochemistry of warru (Petrogale lateralisMacDonnell Ranges race) in captivity and the wild. Australian Veterinary Journal 90, 331–340.

Shepherd, N. C. (1983). An investigation of some aspects of capture myopathy in the red kangaroo (Macropus rufus). Ph.D. Thesis, University of Sydney.

Shepherd, N., Hopwood, P., and Dostine, P. (1988). Capture myopathy – two techniques for estimating its prevalence and severity in red kangaroos, Macropus rufus. Wildlife Research 15, 83–90.

215

Spraker, T. R. (1993). Stress and capture myopathy in artiodactyls. In ‘Zoo and Wild Animal Medicine, Current Therapy’. 3rd edn. (Ed. M. E. Fowler.) pp. 481–488. (W.B. Saunders: Philadelphia, PA.)

Spraker, T. R., Adrian, W. J., and Lance, W. R. (1987). Capture myopathy in wild turkeys (Meleagris gallopavo) following trapping, handling and transportation in Colorado. Journal of Wildlife Diseases 23, 447–453.

Stirrat, S. C. (1997). Behavioural responses of agile wallabies (Macropus agilis) to darting and lmmobilisation with tiletamine hydrochloride and zolazepam hydrochloride. Wildlife Research 24, 89–95.

Vassart, M., Greth, A., Anagariyah, S., and Mollet, F. (1992). Biochemical parameters following capture myopathy in one Arabian oryx (Oryx leucoryx). The Journal of Veterinary Medical Science 54, 1233–1235.

Wallace, R. S., Bush, M., and Montali, R. J. (1987). Deaths from exertional myopathy at the National Zoological Park from 1975 to 1985. Journal of Wildlife Diseases 23, 454–462.

Wobeser, G., Bellamy, J., Boysen, B., MacWilliams, P., and Runge, W. (1976). Myopathy and myoglobinuria in a wild white-tailed deer. Journal of the American Veterinary Medical Association 169, 971–974.

Wyss, M., and Kaddurah-Daouk, R. (2000). Creatine and creatinine metabolism. Physiological Reviews 80, 1107–1213.

Young, E. (1967). Leg paralysis in the greater flamingo and lesser flamingo Phoenkopterus ruber roseusand Phoeniconaias minor following capture and transportation. International Zoo Yearbook 7, 226–227.

Young, L. J., and Deane, E. M. (2006). A longitudinal study of changes in blood leukocyte numbers in the tammar wallaby, Macropus eugenii. Comparative Clinical Pathology 15, 63–69.

216

Appendix 2

A2. Antimicrobial activity of red-tailed phascogale

(Phascogale calura) serum.

Oselyne T. Ong, Jai M. Green-Barber, Anusha Kanuri, Lauren J. Young, and Julie

M. Old

217

Abstract

Antimicrobial substances in serum include circulating complement proteins and acute phase proteins (APPs). We identified gene sequences for APPs, haptoglobin

(Hp), C-reactive protein (CRP) and serum amyloid A (SAA) in marsupial genomes.

Hp and SAA levels were measured in red-tailed phascogale (Phascogale calura) sera using commercially available assays. Hp levels were higher in males than females, while SAA levels suggest the phascogales used in this study were healthy. Serum was co-cultured with four bacterial species. Bacterial growth was inhibited after incubation at 37 °C, however effectiveness differed with bacteria and incubation time. The least amount of bacterial growth was noticed after introduction to K. pneumoniae, and most when introduced to P. aeruginosa. Despite marsupials not having mature immune tissues at birth, and unable to mount specific immune responses, this study suggests other immune strategies, such as APPs in serum likely aid marsupials in their defence against pathogens.

1. Introduction

The innate immune system defends the body against pathogens shortly after infection has occurred. After detection, specific cells will mediate the removal or destruction of bacteria (reviewed in [1]). Maternal-derived strategies and innate immunity are likely to be particularly important during marsupial development, as these animals are born with no mature immune tissues and unable to mount their own specific immune responses [2,3]. Studies of immunoglobulin (Ig) isolated from neonatal and foetal serum of tammar wallabies (Macropus eugenii) prior to suckling [4,5], have shown their production appears to occur immediately or prior to birth, and provides immune protection. The presence of Igs relates to the complement system as Igs

218

identify antigens on bacterial surfaces and subsequently, in eutherian mammals, activates the Classical complement pathway [6,7].

Mainly synthesised in the liver, complement proteins provide the serum with its antimicrobial properties. Studying marsupial and eutherian mammal immunity, we find that although different, components of the two immune systems are comparable.

Research on marsupial immunity will provide insights into the phylogeny of the immune system, contribute to novel therapies in medical science and aid us in developing an understanding of marsupial disease, and potentially benefit conservation of vulnerable and endangered marsupials.

Studies of marsupial complement are scarce [15–17], however it is important to characterise the complement system in marsupials to identify if it is utilised similarly to their eutherian counterparts. All three marsupial species studied to date have been reported to use the Classical complement pathway, a complement pathway activated using Igs [8]. The Alternative complement pathway has also been detected in the gray short-tailed opossum (Monodelphis domestica) [9] and red-tailed phascogale

(Phascogale calura) [10], showing that the marsupial complement system is able to be activated without the presence of Igs [11]. The Lectin complement pathway, a complement pathway activated by various types of lectins (reviewed in [12]), is also likely present in marsupials based on bioinformatic and gene expression studies [13].

Although complement in red-tailed phascogale serum is able to lyse foreign cells [10], the antimicrobial properties of serum have yet to be reported. Other proteins present in serum, for example lactoferrin and transferrin, also aid in the destruction of foreign cells by destroying bacteria [14].

219

Acute phase proteins (APPs), such as haptoglobin (Hp), C-reactive protein (CRP) and serum amyloid A (SAA) are produced by the liver [15]. Hps are haemoglobin- binding proteins and iron sequesters that inhibit the growth of microbes by making iron inaccessible [16]. Hp is also important for the synthesis of prostaglandins, leukocyteconscription and migration, and aids in the production of cytokines in response to injury and infection [17]. Hp has been identified in tammar wallaby milk [18], Virginia opossum (Didelphis virginiana) [19] and gray short-tailed opossum serum [20] but not in the serum of any dasyurid marsupial.

CRP is also important in the host’s defence against infection [21]. CRP is able to activate the Classical complement pathway in eutherians and is involved in phagocytosis [22]. The CRP gene has been identified in the gray short-tailed opossum, Tasmanian devil (Sarcophilus harrisii) and koala (Phascolarctos cinereus) genomes [23] but has not been characterised at either the gene or protein expression levels.

The gene for SAA has only been identified in one marsupial genome: the tammar wallaby [24]. SAA has been reported to activate an inflammasome cascade, promoting the maturation of certain inflammatory cytokines [25]. The level of SAA protein superfamily increases as high as 1000-fold during inflammation, indicating its importance in innate immunity [26].

While antimicrobial activities have been shown to be present in marsupials, the antimicrobial properties of marsupial serum have not been examined previously. The aim of this study was to focus on the identification of molecules associated with the ability of complement proteins to destroy bacterial cells as part of the innate immune system. Specifically, we sought to identify the gene expression of two APPs (Hp and

220

CRP) and quantify the presence of Hp and SAA proteins in red-tailed phascogale sera using commercially available assays. The red-tailed phascogale was chosen for this study because of its conservation significance, and additional studies on this species would contribute to our understanding of the immunology of vulnerable or endangered dasyurid marsupials. The finding of acute phase proteins (APPs) in the red-tailed phascogale would not only indicate the presence of innate immunity in the species, but also provide evidence that this component of the marsupial immune system is comparable to eutherians.

2. Materials and methods

2.1. Sequence identification of haptoglobin, C-reactive protein and serum amyloid a in marsupials

The presence of human Hp, CRP and SAA were identified by searching the human genome database on GenBank. Similarity searches were conducted using Basic Local

Alignment Search Tools (BLAST) [27], nucleotide BLAST (BLASTN) and protein

BLAST (BLASTP) in the gray short-tailed opossum, tammar wallaby, Tasmanian devil and koala to identify Hp, CRP and SAA gene homologues in marsupial genomes.

For koala sequences, BLASTN and BLASTP were conducted on the Koala Genome

Consortium [28] (https://www.koalagenome.org/). Predicted or translated protein sequences were aligned using ClustalW [29] to identify regions of amino acid conservation in marsupials. Sequences from two eutherian species, human and mouse, were used as reference sequences in alignments. A phylogenetic tree was constructed using eutherian and marsupial predicted protein sequences using

Geneious R6.1 by Biomatters (http://www.geneious.com) with the Blosum62 alignment score matrix, a gap open penalty score of 12 and gap extension penalty

221

score of 3, and using the neighbour-joining tree build method. The sequences were simulated on the tree according to the Jukes-Cantor model.

2.2. Animals and sample collection

Red-tailed phascogales are small, dasyurid marsupials distributed in Western

Australia [30]. In this study, we utilised captive-bred red-tailed phascogales housed in the Small Native Mammal Teaching and Research Facility at Western Sydney

University, Richmond, NSW, Australia. For further details regarding housing and husbandry refer to [31].

Phascogales were captured and euthanased as per standard protocols approved by the

Western Sydney University Animal Ethics Committee (A10534 and A9694). Whole blood was collected in sterile 1.5 mL tubes via heart puncture using a 2 mL syringe and 23-gauge needle immediately after euthanasia, and centrifuged for 10 min at

5000 rpm (at 4 °C). Serum was collected after centrifugation, and kept in the −80 °C freezer until required, for a maximum of three months. Altogether, one-year old male

(n = 5), one year old female (n = 5), five month old male (n = 6) and three adult female (aged 2.25, 3.25 and 5.25 years) red-tailed phascogales were used for serum collection to determine antibacterial activity of serum, and levels of Hp and SAA

(WSU Animal Care and Ethics Approval A9872). To determine antibacterial activity of serum, negative controls heated at 56 °C for 30 min were used to inactivate antimicrobial/antibacterial proteins. Prior to the experiment, sera were placed in a

37 °C incubator.

Tissue samples were opportunistically obtained from animals euthanased for population control reasons (excess breeding stock and older males and females). For the identification of Hp and CRP, tongue, lung, heart, liver, gastrointestinal tract,

222

spleen and kidney tissues were collected from two adult (male, two years old; female, four years old) and two juvenile (male, 6 months old; female 5 months old) red-tailed phascogales. Liver was collected from pouch young of unknown sex, ages

12, 17, 24, 32 days old, and a 3.5 month old male and 60 day old female. Whole bodies were sampled for pouch young of unknown sex (ages three and seven days old) as they were too small to dissect. Tissues and pouch young bodies were placed in RNAlater®(Ambion, Austin, TX, USA) and kept in the −80 °C freezer until use.

2.3. RNA extraction and cDNA synthesis

Total RNA of pouch young whole bodies and tongue, lung, heart, liver, gastrointestinal tract, spleen and kidney tissues, were extracted using the SV Total

RNA Isolation System (Promega, Wisconsin, USA) as per manufacturer’s instructions. cDNA synthesis was performed using the Superscript III First Strand

Synthesis System (Invitrogen, California, USA) as per manufacturer’s instructions.

Final cDNA products were stored in the −20 °C freezer until use.

223

2.4. Primer design and polymerase chain reaction (PCR)

Hp and CRP primers were designed based on predicted cDNA sequences available from GenBank, Tasmanian devil Hp (XM_003758541.2) and Tasmanian devil CRP(XM_003767868.1), respectively [32]. Primer sequences for Hp are as follows: forward primer 5′-GCGGACTGCTGTCTGTAG-3′- and reverse primer 5′-

GGTCTCTTGGTTTCCCAC-3′; and primer sequences for CRP are as follows: forward primer 5′ CCCAAGACAGTCTCAGGA-3′ and reverse primer 5′-

CTGCTGTCCCTTTCATGA-3′.

The PCR mix of 20 μL was prepared to give end volumes of: 0.5 μL cDNA, 4 μL

×10 GoTaq flexi buffer, 3 μL MgCl2 (3.75 mM), 0.4 μL dNTP (0.2 mM), 1 μL forward primer (5 μM), 1 μL reverse primer (5 μM), 9.8 μL water and 0.3 μL of

GoTaq DNA Polymerase (0.075 u/μL) (Promega Corporation, WI, USA). The PCR conditions used were 94 °C for 7 min followed by 35 cycles of amplification also at

94 °C for 2 min, 50 °C for 1 min with a final extension at 72 °C for 5 min.

2.5. Sequence analysis

PCR products were evaluated by electrophoresis using 2% agarose gel in TBE. The bands were excised from the gel, ligated into a pCR™2.1-TOPO® vector using the

TOPO TA cloning kit (both from Invitrogen, California, USA). Plasmids were cleaned up using Purelink® Quick Plasmid Miniprep Kit (Invitrogen, California,

USA) and sequenced at the Australian Genome Research Facility (AGRF),

Westmead, Sydney. To assign identity, a similarity search was performed using the

Nucleotide Basic Local Alignment Search Tool (BLASTN; Altschul et al. [27]) available on Genbank [32](http://www-ncbi-nlm-nih- gov.ezproxy.uws.edu.au/genbank).

224

2.6. Haptoglobin and serum amyloid a assay

Serum for the Hp assay was obtained from a one year old male and a one year old female red-tailed phascogale. The concentration of Hp in serum was determined using the “PHASE”™ Haptoglobin Assay (Tridelta Development Limited, Bray,

Ireland) and was conducted as per manufacturer’s instruction. As a reference, commercially available rabbit (Oryctolagus cuniculus) (Sigma-Aldrich, New South

Wales, Australia) and sheep (Ovis aries) (Serum Australis, New South Wales,

Australia) serum was used. Samples were analysed using the Benchmark Plus™ microplate reader at 630 nm wavelength, and interpreted based on a standard curve of known Hp samples of 0, 0.312, 0.625, 1.25 and 2.5 mg/mL provided by the kit. All standards and samples were performed in triplicate.

Serum for the SAA assay was obtained from six juvenile males (5 months old) and three adult female red-tailed phascogales aged 2.25, 3.25 and 5.25 years old. The concentration of SAA was determined using the SAA kit (LZ Test ‘Eiken’ SAA-

Eiken Chemical Co., Ltd., Tokyo, Japan) and was conducted as per manufacturer’s instruction. As a reference, commercially available horse (Equus caballus) serum

(Vector Laboratories, CA, USA) was also used for a comparison of eutherian and marsupial serum samples. Samples were analysed using the Benchmark Plus™ microplate reader at 570 nm wavelength, with a standard curve for each reaction to determine the SAA concentrations.

2.7. Bacterial cultures and CFU counts

The four bacterial cultures used for the experiment were: Escherichia coli (K12), Pseudomonas aeruginosa (ATCC 27853), Staphylococcus aureus (ATCC

25923) and Klebsiella pneumoniae (ATCC 13883). These bacteria, and specifically

225

these strains of bacteria, were chosen as they are commonly used to assess antibacterial activity and are opportunistic pathogens of humans and potentially marsupials. Bacterial cultures were maintained on nutrient agar slants and kept in the

4 °C fridge until use. The cultures were inoculated into 10 mL sterile Luria broth (LB) and incubated at 37 °C overnight in a shaking incubator at 200 rpm. To ensure that the bacteria were growing at log-phase, the absorbance of the inoculated nutrient broth was measured using the Benchmark Plus™ microplate spectrophotometer (Biorad, Hercules, CA, USA) at 600 OD. A measurement between 0.2 and 1 indicates a log-phase culture.

The bacteria were initially diluted to 1 × 105, and then further diluted by 25% and

50% using sterile LB. The introduction of bacteria and red-tailed phascogale serum was performed in sterile tubes, with a 1:1 ratio of bacteria and serum. The bacteria- serum mixture was plated onto nutrient broth agar in Petri dishes in triplicates.

Samples were incubated for 0, 10, 20 and 30 min prior to plating and then incubated overnight at 37 °C. Negative controls consisted of 25% and 50% bacteria incubated with heated serum (56 °C for an hour prior to experiment).

Each plate was inoculated with 50 μL of bacteria and serum mix onto a nutrient broth agar plate to determine the colony-forming units (CFUs) of each sample. After incubation at 37 °C overnight, with the exception of E. coli which was grown for

48 h due to slow growth. The colonies on each plate were counted using a manual colony counter.

Bacterial growth incubated in active sera for 10, 20 and 30 min were compared with growth at 0 min incubation, to determine the difference in bacterial growth as incubation times increased. The antibacterial capacity was determined by comparing

226

the average bacterial growth of each bacterium in active sera at 10, 20 and 30 min incubation to bacterium in inactive sera at 10, 20 and 30 min incubation. All bacterial growths were measured using mean ± SD percentages of CFUs/mL.

3. Results

Both red-tailed phascogale Hp and CRP cDNA sequences were confirmed using

BLASTN [27]. The red-tailed phascogale Hp sequence obtained had an e-value of

3e-132 with nucleotide sequence identity of 292/308 (95%) with the Tasmanian devil

Hp sequence (XM_003758541.1). The red-tailed phascogale CRP sequence obtained an e-value of 7e-31 with the sequence identity of 121/142 (85%) with the Tasmanian devil CRP sequence (XM_003767868.1). The comparison between protein sequences indicates that Hp, CRP and SAA marsupial sequences had protein identities above 60%. Protein alignments also included red-tailed phascogale Hp and CRP, and unrooted phylogenetic tree for Hp, CRP and SAA indicate that eutherian sequences were more similar to each other than marsupial sequences (Fig. 1). All protein alignments can be found in Supplementary material 2–4.

227

Fig. 1. Unrooted phylogenetic tree developed using (A) haptoglobin, (B) C-reactive protein and (C) serum amyloid A protein sequences. Source of protein sequences can be found in Table 3.

228

Results indicate that Hp and CRP is expressed in all six red-tailed phascogale tissues examined; tongue, lung, heart, liver, gastrointestinal tract, spleen and kidney of adult and juveniles (Fig. 2). The presence of Hp was detected in red-tailed phascogales from ages three to 60 days, and the presence of CRP was detected from ages seven to

60 days (Fig. 2c), with BLASTN searches confirming sequence identities. The quantification of Hp in adult male and female red-tailed phascogale serum shows that concentrations of Hp are higher in males compared to females. Average haptoglobin protein levels obtained using the “PHASE” Haptoglobin Assay is presented in Table

Fig. 2. PCR amplified products separated on 2% agarose gel of (A) haptoglobin using liver tissues obtained from male and female adult and juvenile phascogales, (B) C-reactive protein using liver tissues from male and female adult and juvenile phascogales, and (C) haptoglobin and C-reactive protein using whole body tissues from phascogale pouch young of different ages.

229

Table 1. Average concentration (±SD) of Serum Amyloid A (SAA) and haptoglobin protein levels in male and female red-tailed phascogales. Haptoglobin protein levels were tested with rabbit and sheep serum as eutherian references.

Animal SAA protein levels (μg/mL) Haptoglobin protein levels (mg/mL)

Phascogale (male) 4.10 (±0.305) 0.232 (±0.017)

Phascogale (female) 3.82 (±0.025) 0.410 (±0.004)

Rabbit (sex unknown) – 1.064

Sheep (sex unknown) – 0.608

SAA concentrations in all red-tailed phascogale serum had an average of 4 μg/mL

(±0.277), with the lowest SAA concentration being 3.8 μg/mL in one male juvenile and one adult female. SAA concentrations for all individuals were well below the

8 μg/mL cut-off level as defined by the SAA kit, presumably indicating that the red- tailed phascogale individuals were healthy (Table 1). However the horse serum utilised in the assay reported an SAA concentration of 30 μg/mL, indicating that the individual horse may have had a minor inflammatory disease at the time of sampling.

For the antimicrobial analysis, serum diluted at 25% showed more effective results than serum diluted to 50%, and therefore were chosen for analysis, with a range of up to 300 CFUs present on the Petri dish for each bacterium. Compared to inactivated serum, results show that the growth of K. pneumoniae was reduced with time for male and female serum, showing an increase in percentage difference between bacteria introduced to active serum and inactivated serum (Fig. 3). While this decrease in bacterial growth is also seen with E. coli, S. aureus and P. aeruginosa for male and female serum from 10 to 20 min incubation times (except for male P. aeruginosaserum), an increase in bacterial growth was observed from 20 to 30 min incubation times. However, we still conclude that there is some bacterial protection

230

against all the bacteria tested as positive percentage differences were observed at 20 and 30 min incubation times for E. coli, S. aureus, P. aeruginosa and K. pneumoniae (Fig. 3).

Fig. 3. The percentage difference between the average CFU/mL of active and inactivated serum(heated at 56 °C for 30 min) against (A) E. coli, (B) S. aureus, (C) P. aeruginosa and (D) K. pneumoniae. A positive percentage difference indicates that bacterial growth was higher when incubated with inactivated serum, which was expected prior to the experiment, as inactivated complement in serum would not have the ability to prevent bacterial growth.

4. Discussion

In this study, we report the presence of APPs, Hp, CRP and SAA, in marsupialgenomes, amplification of Hp and CRP genes in developing red-tailed phascogales using PCR, quantification of the levels of Hp and SAA proteins in juvenile males and adult females using commercially available assay kits, and found the capability of serum to provide some protection against three Gram-negative bacteria (E. coli, P. aeruginosa and K. pneumoniae) and one Gram-positive bacterium (S. aureus).

231

The identification of Hp, CRP and SAA sequences in marsupial genomes indicate that the APPs are present in marsupials. The protein alignments for Hp, CRP and SAA in eutherians (human and mouse) and other marsupial species reported identities above

60% (Tables 2 and 3; Supplementary material 2–4). The phylogenetic tree of Hp, CRPand SAA protein sequences show that the eutherian sequences (human and mouse) are in a clade, and so are red-tailed phascogale and Tasmanian devil sequences for Hp and CRP protein alignments. This result is not surprising given eutherian mammals are more closely related to each other, and red-tailed phascogales and Tasmanian devils are both dasyurid marsupials (Fig. 1).

232

Table 2. Human and marsupial nucleotide sequences used, along with the E-value and identities when compared to their respective human sequences.

Human sequen E-values/Identities compared to Gene ces Marsupial sequences human sequences NM_0 Haptoglo 01126 Opossum bin(Hp) 102.2 (XM_001378598.3) E-value = 3e-173 Identities = 720/969 (74%) Tasmanian devil (XM_003758541.2) E-value = 2e-150 Identities = 746/1042 (72%) Koala (Locus, 2585; Transcript, 13of73; Confidence, 0.015; Length, 1147) E-value = 3e-114 Identities = 757/1018 (74%) Red -tailed phascogale E-value = 2e-38 Identities = 203/285(71%) C- reactive Protein(C BC125 Opossum RP) 135.1 (XM_007481666.2) E-value = 1e-72 Identities = 483/696 (69%) Tasmanian devil (XM_003767868.1) E-value = 2e-57 Identities = 426/619 (69%) Red -tailed phascogale E-value = 0.001 Identities = 14/14(100%) *(In comparison to opossum nucleotide sequence, E- value = 7e−31; Identities = 121/142(85%)) Serum Amyloid M2615 Opossum A(SAA) 2.1 (XM_016423426.1) E-value = 1e-37 Identities = 218/299 (73%) Tasmanian devil (XM_012552499.1) E-value = 4e-38 Identities = 271/387 (70%)

*Red-tailed phascogale CRP nucleotide sequences was also compared to the gray- short tailed opossum sequence because of its high E-value. This result shows that red-tailed phascogale CRP have more sequence similarities to a marsupial compared to humans.

233

Table 3. Human and marsupial protein sequences used, along with amino acid identities when compared to their respective human sequences. Comparison is also made for translated red-tailed phascogale sequences.

Human E-values/Identities compared Gene sequences Marsupial sequences to human sequences Haptoglobin( AAA88080 Opossum (translated from Hp) .1 XM_001378598.3) E-value = 0 Identities = 236/318 (74%) Tasmanian devil (XP_003758589.2) E-value = 9e-178 Identities = 224/318(70%) Koala (m.132331 g.132331) E-value = 1e-179 Identities = 235/318 (74%) Red -tailed phascogale E-value = 3e-41 Identities = 55/88(63%) C-reactive AAL48218 Opossum (translated from Protein (CRP) .2 XM_007481666.2) E-value = 2e-102 Identities = 140/224(63%) Tasmanian devil (translated from XM_003767868.1) E-value = 2e-100 Identities = 135/225(60%) Koala (m.483439 g.483439) E-value = 8e-99 Identities = 143/224 (64%), Red -tailed phascogale E-value = 1e-10 Identities = 21/41(51%) Serum Amyloid AAA60297 Opossum (translated from A (SAA) .1 XM_016423426.1) E-value = 2e-48 Identities = 80/128(63%) Tasmanian devil (XP_003773620.1) E-value = 4e-56 Identities = 80/126(63%) Koala (m.216752 g.216752) E-value = 1e-53 Identities = 88/127 (69%)

We identified the expression of Hp in pouch young as young as three days old through to adults using PCR, and quantified Hp in adult male and female red-tailed phascogale serum. The Hp level in serum is dependent on the species. For example, goat (Capra aegagrus hircus) Hp concentrations at 0.00–0.05 mg/mL [33], and dog

Hp concentrations of 0.3–3.5 mg/mL are regarded as within the expected range for these species [34]. Rabbit and sheep serum in this study indicated Hp protein levels

234

in these individuals were 1.064 and 0.608 mg/mL, respectively. Male red-tailed phascogales had a higher Hp concentration compared to female red-tailed phascogales (Table 1). The normal range of Hp concentrations in marsupials, particularly red-tailed phascogales, have not been reported previously. The reason for higher Hp concentrations in males is unknown, but it is probable that high haptoglobin concentrations are related to male semelparity. Hp increases in mammals as a response to acute infection, inflammation, stress, neoplasia and trauma

(reviewed in [35]). For example, an increase in Hp levels was reported in goats with induced inflammation, with significant differences (P <0.05) occurring three and four days after inflammation was induced [33].

CRP is involved in the complement system and in mice has been reported to protect the body against microbial pathogens [36]. CRP has the ability to precipitate the somatic C-polysaccharide of Streptococcus pneumoniae[37]. Unlike Hp, the presence of CRP was not detected in the three day old pouch young, but in pouch young aged seven days to adulthood. Even though CRP was not amplified as early in newborn red-tailed phascogales, results obtained in this study still indicate pouch young are capable of responding to infectious agents, necrosis and trauma (reviewed in [38]) during relatively early postpartum life.

All red-tailed phascogale serum in this study had SAA concentrations <8 μg/mL

(Table 1), indicating that serum were likely extracted from healthy red-tailed phascogales. It has been reported that the SAA sequence in the tammar wallaby is different compared to its eutherian counterparts (i.e. human and mouse) due to concerted evolution [24], suggesting that SAA sequence similarity may only have occurred within a mammalian species, instead of between mammalian species. As we

235

only tested the serum of presumably healthy red-tailed phascogale individuals in this assay, and had no clinically unhealthy individuals for comparison we cannot confirm that an SAA concentration of <8 mg/mL confirms a healthy status in marsupials; however we can report that SAA concentrations of clinically healthy eutherians should report SAA concentrations <8 μg/mL [39], and is presumably similar for red- tailed phascogales, assuming the function of SAA is similar in eutherians and marsupials. Although the horse serum was included as a reference to show that eutherian and marsupial SAA serum concentrations were comparable, the horse serum reported an unexpectedly high serum concentration of 30 μg/mL, which may indicate the presence of a minor inflammatory disease. According to Jacobsen et al. [39], clinically healthy horses and horses with non-inflammatory diseases usually reported SAA concentrations <0.48 μg/mL while horses with inflammatory diseases reported an average of 1018 μg/mL of SAA.

Based on previous studies we know that APPs are not the only immune molecules that have antimicrobial functions in marsupials. As stated previously the complement system is present and active in marsupial serum [9,40], including the red-tailed phascogale [10]. While complement proteins have been reported to lyse foreign erythrocytes, proving that they have the capabilities to destroy foreign cells, the antimicrobial capacity of complement proteins and other serum components in the red-tailed phascogale are largely unknown. The results obtained in this study show the capability of serum to protect the body against three Gram-negative bacteria (E. coli, P. aeruginosa and K. pneumoniae) and one Gram-positive bacterium (S. aureus).

Results indicated some growth inhibition was detected for all four bacteria tested when introduced to active serum. Overall, K. pneumoniae growth was most inhibited

236

when introduced to red-tailed phascogale serum compared to inactivated serum, regardless of incubation time. The growth of K. pneumoniae was more than double the amount in inactivated serum compared to activated serum after 30 min incubation

(Fig. 3). At the 30 min incubation time-point, bacterial growth inhibition was strongest against K. pneumoniae. The sensitivity of the type of bacteria to serum could depend on the structure and surface of the bacteria (reviewed in [41,42]). As bacterium with lower sensitivity towards serum are more pathogenic to those that are not [42], results of this study indicate that K. pneumoniae likely has the highest pathogenic potential in red-tailed phascogales compared to E. coli, S. aureus and P. aeruginosa. In a study by Osawa et al. [43], K. pneumoniae was indicated as the casutive agent in the death of a pouch young koala, confirming K. pneumoniae is a pathogen of marsupials.

Instead of high antimicrobial activity at the start of incubations, female serum against E. coli and, male and female serum against K. pneumoniae showed that their antimicrobial activity started off low but increased as time progressed from 10 to

30 min. The introduction of 25% (v/v) Komodo dragon serum against E. coli also showed a similar effect where CFUs decreased between 10 to 20 min incubation times [44]. The results of our study showed a steady decrease of E. coli growth for female serum but results were not significant (P > 0.05). Results were also not significant for male serum against E. coli; however bacterial activity was still detected for both male and female serum (Fig. 3).

As expected, the bacterial growth in inactivated serum resulted in a higher number of colonies compared to bacterial growth in activated serum for most samples. As inactivated serum is heated at 56 °C for 30 min prior to the experiment, the heat

237

should de-activate the serum by destroying cytolytic activity of the complement system, leading to deactivation of antibacterial proteins [45]. Samples that had higher bacterial growth in activated serum were all observed within the first 10 min of incubation, and applied to either male or female serum for all bacteria except for K. pneumoniae. Therefore, the results for active female serum introduced to E.coli and P. aeruginosa and active male serum introduced to S. aureus indicated that serum were not effective during the first 10 min of incubation (Fig. 3). Other results reported less bacterial growth when introduced to active serum compared to inactivated serum, showing the effectiveness of serum after 10 min.

The results of E. coli and P. aeruginosa after 10 min incubation could be dismissed due to the lower number of colonies in inactive compared to active serum. We also found that overall growth inhibition was higher for males than females for E. coli and P. aeruginosa after 30 min incubation, but higher for females compared to males for S. aureus and K. pneumoniae. The results suggest the capacity of individuals defending themselves against bacteria may be reliant on gender, although the investigation of female pouches has indicated antimicrobial activity against E. coli and not S. aureus[46]. However, antibacterial activity against S. aureus and K. pneumoniae is usually passed on from mother to offspring during lactation [47,48].

Further investigations are required to assess differences in male and female immune competence in marsupials.

The results of this study confirm the presence of APPs; Hp, CRP and SAA, and that marsupial serum has antimicrobial properties that can inhibit some Gram-positive and Gram-negative bacterial growth. The results of this study provide evidence that suggest marsupials have robust innate immune mechanisms, particularly with respect

238

to their capacity to deal with early immune challenges. This study provides the basis for further studies on APPs in marsupials and the innate immune mechanisms, particularly newborn marsupials.

Conflicts of interest

We declare that there are no conflicts of interest.

Funding

Funding was provided by the School of Science and Health, Western Sydney University.

References

[1] C.A. Janeway Jr., R. Medzhitov Innate immune recognition Annu. Rev. Immunol., 20 (1) (2002), pp. 197-216

[2] J. Old, E. Deane Development of the immune system and immunological protection in marsupial pouch young Dev. Comp. Immunol., 24 (5) (2000), pp. 445-454

[3] C.R. Borthwick, L.J. Young, J.M. Old The development of the immune tissues in marsupial pouch young J. Morphol., 275 (7) (2014), pp. 822-839

[4] E.M. Deane, D.W. Cooper, M.B. Renfree Immunoglobulin G levels in fetal and newborn tammar wallabies (Macropus eugenii) Reprod. Fertil. Dev., 2 (1990), pp. 369-375

[5] M.B. Renfree The composition of fetal fluids of the marsupial Macropus eugenii

Dev. Biol., 33 (1) (1973), pp. 62-79

[6] J.V. Sarma, P.A. Ward The complement system Cell Tissue Res., 343 (1) (2011), pp. 227-235

[7] H. Korhonen, P. Marnila, H. Gill Milk immunoglobulins and complement factors

Br. J. Nutr., 84 (S1) (2000), pp. 75-80

[8] N.R. Cooper The classical complement pathway: activation and regulation of the first complement component Adv. Immunol., 37 (1985), pp. 151-216

[9] T.L. Koppenheffer, K.D. Spong, H.M. Falvo The complement system of the marsupial Monodelphis domestica Dev. Comp. Immunol., 22 (2) (1998), pp. 231-237

239

[10] O.T. Ong, L.J. Young, J.M. Old Detection of an active complement system in red-tailed phascogales (Phascogale calura) Comp. Clin. Pathol., 24 (6) (2015), pp. 1527-1534

[11] J.M. Thurman, V.M. Holers The central role of the alternative complement pathway in human disease J. Immunol., 176 (3) (2006), pp. 1305-1310

[12] T. Fujita Evolution of the lectin–complement pathway and its role in innate immunity Nat. Rev. Immunol., 2 (5) (2002), pp. 346-353

[13] O.T. Ong, L.J. Young, J.M. Old Sequences and expression of pathway- specific complement components in developing red-tailed phascogale (Phascogale calura) Dev. Comp. Immunol., 65 (2016), pp. 314-320

[14] R.T. Ellison III, F.M. LaForce, T.J. Giehl, D.S. Boose, B.E. Dunn Lactoferrin and transferrin damage of the Gram-negative outer membrane is modulated by Ca2+ and Mg2+ Microbiology, 136 (7) (1990), pp. 1437-1446

[15] E. Tatsuta, T. Shirahama, J.D. Sipe, M. Skinner, A.S. Cohen Kinetics of SAP and SAA production by cultured mouse liver cells Ann. N. Y. Acad. Sci., 389 (1) (1982), pp. 467-–470

[16] M.R. Langlois, J.R. Delanghe Biological and clinical significance of haptoglobin polymorphism in humans Clin. Chem., 42 (10) (1996), pp. 1589-1600

[17] J. Pillay, F. Hietbrink, L. Koenderman, L. Leenen The systemic inflammatory response induced by trauma is reflected by multiple phenotypes of blood neutrophils Injury, 38 (12) (2007), pp. 1365-1372

[18] J. Joss, M. Molloy, L. Hinds, E. Deane Proteomic analysis of early lactation milk of the tammar wallaby (Macropus eugenii) Comp. Biochem. Physiol. Part D Genomics Proteomics, 2 (2) (2007), pp. 150-164

[19] M.B. Renfree Uterine proteins in the marsupial, Didelphis marsupialis virginiana, during gestation J. Reprod. Fertil., 42 (1) (1975), pp. 163-166

[20] S.J. Richardson, K.M. Dziegielewska, N.A. Andersen, S. Frost, G. Schreiber The acute phase response of plasma proteins in the polyprotodont marsupial Monodelphis domestica Comp. Biochem. Physiol. B Biochem. Mol. Biol., 119 (1) (1998), pp. 183-188

[21] S. Black, I. Kushner, D. Samols C-reactive protein J. Biol. Chem., 279 (47) (2004), pp. 48487-48490

[22] C. Mold, T.W. Du Clos C-reactive protein increases cytokine responses to Streptococcus pneumoniae through interactions with Fcγ receptors J. Immunol., 176 (12) (2006), pp. 7598-7604

240

[23] O.T. Ong, L.J. Young, J.M. Old Preliminary genomic survey and sequence analysis of the complement system in non-eutherian mammals Aust. Mammal., 38 (1) (2016), pp. 80-90

[24] C. Uhlar, I. Black, D. Shields, C. Brack, G. Schreiber, A. Whitehead Wallaby serum amyloid A protein: cDNA cloning, sequence and evolutionary analysis Scand. J. Immunol., 43 (3) (1996), pp. 271-276

[25] F. Martinon, K. Burns, J. Tschopp The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-β Mol. Cell, 10 (2) (2002), pp. 417-426

[26] J.S. Hoffman, E.P. Benditt Changes in high density lipoprotein content following endotoxin administration in the mouse. Formation of serum amyloid protein-rich subfractions J. Biol. Chem., 257 (17) (1982), pp. 10510-10517

[27] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. LipmanBasic local alignment search tool J. Mol. Biol., 215 (3) (1990), pp. 403-410

[28]R.N. Johnson, M. Hobbs, M.D. Eldridge, A.G. King, D.J. Colgan, M.R. Wilkins, Z. Chen, P.J.Prentis, A. Pavasovic, A. Polkinghorne The koala genome consortium Tech. Rep. Aust. Mus., 24 (2014), pp. 91-92

[29] J.D. Thompson, D.G. Higgins, T.J. Gibson CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucl. Acids Res., 22 (22) (1994), pp. 4673-4680

[30] A. Bradley, W. Foster, D. Taggart Red-tailed phascogale S. Van Dyck, R. Strahan (Eds.), The Mammals of Australia, Reed New Holland, Chatswood, New South Wales, Australia (2008), pp. 101-102

[31] H.J. Stannard, C.R. Borthwick, O. Ong, J.M. Old Longevity and breeding in captive red-tailed phascogales (Phascogale calura) Aust. Mamm., 35 (2) (2013), pp. 217-219

[32] D.A. Benson, M. Cavanaugh, K. Clark, I. Karsch-Mizrachi, D.J. Lipman, J. Ostell, E.W. Sayers GenBank Nucl. Acids Res., 41 (D1) (2013), pp. D36-D42

[33] F.H. González, F. Tecles, S. Martínez-Subiela, A. Tvarijonaviciute, L. Soler, J.J. Cerón Acute phase protein response in goats J. Vet. Diagn. Invest., 20 (5) (2008), pp. 580-584

[34] A. German, M. Hervera, L. Hunter, S. Holden, P. Morris, V. Biourge, P. Trayhurn Improvement in insulin resistance and reduction in plasma inflammatory

241

adipokines after weight loss in obese dogs Domest. Anim. Endocrinol., 37 (4) (2009), pp. 214-226

[35] C. Cray, J. Zaias, N.H. Altman Acute phase response in animals: a review Comp. Med., 59 (6) (2009), pp. 517-526

[36] A.J. Szalai The antimicrobial activity of C-reactive protein Microb. Infect., 4 (2) (2002), pp. 201-205

[37] M. Pepys, M.L. Baltz Acute phase proteins with special reference to C- reactive protein and related proteins (pentaxins) and serum amyloid A protein Adv. Immunol., 34 (1983), pp. 141-212

[38] M.B. Pepys, G.M. Hirschfield C-reactive protein: a critical update J. Clin. Invest., 111 (12) (2003), pp. 1805-1812

[39] S. Jacobsen, M. Kjelgaard-Hansen, H.H. Petersen, A.L. JensenEvaluation of a commercially available human serum amyloid A (SAA) turbidometric immunoassay for determination of equine SAA concentrations Vet. J., 172 (2) (2006), pp. 315-319

[40] G. Wirtz, S.A. Westfall Immune complement of the opossum Immunochemistry, 4 (1) (1967), pp. 61-63

[41] G. Bugla-Płoskońska, A. Kiersnowski, B. Futoma-Kołoch, W. Doroszkiewicz Killing of gram-negative bacteria with normal human serum and normal bovine serum: use of lysozyme and complement proteins in the death of salmonella strains O48 Microb. Ecol., 58 (2009), pp. 276-289

[42] K.A. Joiner, C. Hammer, E. Brown, R. Cole, M. Frank Studies on the mechanism of bacterial resistance to complement-mediated killing. I. Terminal complement components are deposited and released from Salmonella minnesotaS218 without causing bacterial death J. Exp. Med., 155 (3) (1982), pp. 797-808

[43] R. Osawa, W.H. Blanshard, P.G. O’Callaghan Microflora of the pouch of the koala (Phascolarctos cinereus) J. Wildl. Dis., 28 (2) (1992), pp. 276-280

[44] M. Merchant, D. Henry, R. Falconi, B. Muscher, J. Bryja Antibacterial activities of serum from the Komodo Dragon (Varanus komodoensis) Microbiol. Res., 4 (e4) (2013), pp. 16-20

[45] S. Kumar Textbook of Microbiology JP Medical Ltd, United Kingdom (2012)

[46] G. Bobek, E.M. Deane Possible antimicrobial compounds from the pouch of the koala, Phascolarctos cinereus Lett. Pept. Sci., 8 (3–5) (2001), pp. 133-137

242

[47] J. Wang, E.S. Wong, J.C. Whitley, J. Li, J.M. Stringer, K.R. Short, M.B. Renfree, K. Belov, B.G.Cocks Ancient antimicrobial peptides kill antibiotic- resistant pathogens: Australian mammals provide new options PLoS One, 6 (8) (2011), p. e24030

[48] J. Deakin, D.W. Cooper Characterisation of and immunity to the aerobic bacteria found in the pouch of the brushtail possum Trichosurus vulpecula Comp. Immunol. Microbiol. Infect. Dis., 27 (1) (2004), pp. 33-46