Infection Toxoplasma Gondii Susceptibility During Neutrophil

CXCR2 Deficiency Confers Impaired Neutrophil Recruitment and Increased Susceptibility During Toxoplasma gondii Infection This information is current as of September 24, 2021. Laura Del Rio, Soumaya Bennouna, Jesus Salinas and Eric Y. Denkers J Immunol 2001; 167:6503-6509; ; doi: 10.4049/jimmunol.167.11.6503

http://www.jimmunol.org/content/167/11/6503 Downloaded from

References This article cites 56 articles, 36 of which you can access for free at: http://www.jimmunol.org/content/167/11/6503.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 24, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. CXCR2 Deﬁciency Confers Impaired Neutrophil Recruitment and Increased Susceptibility During Toxoplasma gondii Infection1

Laura Del Rio,† Soumaya Bennouna,* Jesus Salinas,† and Eric Y. Denkers*2

Neutrophil migration to the site of infection is a critical early step in host immunity to microbial pathogens, in which chemokines and their receptors play an important role. In this work, mice deﬁcient in expression of the chemokine receptor CXCR2 were infected with Toxoplasma gondii and the outcome was monitored. Gene-deleted animals displayed completely defective neutrophil recruitment, which was apparent at 4 h and sustained for at least 36 h. KitW/KitW-v animals also displayed defective polymorphonuclear leukocyte migration, suggesting mast cells as one source of chemokines driving the response. Tachyzoite infection and ؊/؊

replication were accelerated in CXCR2 animals, resulting in establishment of higher cyst numbers in the brain relative to Downloaded from wild-type controls. Furthermore, serum and spleen cell IFN-␥ levels in infected, gene-deleted mice were reduced 60Ð75% relative to infected normal animals, and spleen cell TNF-␣ was likewise reduced by ϳ50%. These results highlight an important role for CXCR2 in neutrophil migration, which may be important for early control of infection and induction of immunity during Toxoplasma infection. The Journal of Immunology, 2001, 167: 6503Ð6509.

he CXC chemokine IL-8 is an important chemoattractant tions worldwide. In situations of immunodeficiency and during http://www.jimmunol.org/ and activator of neutrophils (1–3). In humans, there are congenital infection, Toxoplasma emerges as a major opportunistic T two high-affinity receptors for IL-8, designated CXCR1 pathogen that can be lethal if not appropriately treated (13, 14). T. and CXCR2 (4, 5). Although mice do not possess a homologous gondii is well known as a potent type 1 cytokine inducer, and while IL-8 gene, they express a CXCR with similarity to human CXCR2 these cytokines are required to survive infection, their overproduc- which is expressed predominantly on neutrophils. The murine re- tion can lead to pathology and death (15–23). ceptor binds several IL-8-like CXC chemokines, most notably We and others recently reported a requirement for neutrophils in 3 macrophage inflammatory protein (MIP) -2 and KC (6). early resistance to T. gondii (24–27). Although these cells display Recently, mice with a targeted deletion of CXCR2, also known microbicidal activity through phagocytosis and release of super- as murine IL-8R homolog (IL-8RL), were constructed (7). The oxides and peroxides, it is also clear that PMN can serve as a by guest on September 24, 2021 animals display defective neutrophil migration in response to thio- source of several proinflammatory cytokines during infection. For glycolate, although the killing function of intracellular and extra- the case of Toxoplasma, PMN release IL-12 and TNF-␣, as well as cellular bacteria remains intact. In a model of urinary tract infec- chemokines such as MIP-1␣ and MIP-1␤, in response to parasite tion, transepithelial polymorphonuclear leukocyte (PMN) stimulation (25, 28, 29). In an in vitro model of infection, migration is defective, resulting in bacteremia and systemic dis- tachyzoites induced recruitment of large neutrophil numbers into ease (8–10). The murine IL-8R homolog has also been implicated the peritoneal cavity within4hofinjection (30). The PMN were in increased susceptibility during infections with pathogens such as Candida albicans and Legionella pneumophila (11, 12), but its found to be the major source of IL-12 in this model system, and role during protozoan infection has hitherto remained unexplored. Ab-mediated neutrophil depletion resulted in early death of the In our laboratory, we use the intracellular protozoan Toxo- animals, associated with defective type 1 cytokine responses (24). plasma gondii as a model to study initiation of immunity and early These results, and similar findings by others (31–36), led us to host resistance during microbial infection. Toxoplasmosis is a hypothesize that PMN, by virtue of their ability to rapidly migrate widespread parasitic infection among human and animal popula- to a site of infection and release proinflammatory cytokines, may be important immunoregulatory cells during the immune response to Toxoplasma. *Department of Microbiology and Immunology, College of Veterinary Medicine, In the present report, we examined the ability of CXCR2Ϫ/Ϫ Cornell University, Ithaca, NY 14853; and †Departamento de Patologia Animal (Mi- crobiologia e Immunologia), Facultad de Veterinaria, Universidad de Murcia, Murcia, mice to respond to T. gondii infection. Our results reveal a pro- Spain found defect in the ability of neutrophils to migrate into the peri- Received for publication June 8, 2001. Accepted for publication October 1, 2001. toneal cavity following tachyzoite inoculation. Production of The costs of publication of this article were defrayed in part by the payment of page proinflammatory cytokines, in particular TNF-␣ and IFN-␥, was charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. lower in CXCR2-deficient mice. The gene-deleted mice harbored more parasites in the peritoneal cavity during early infection and 1 This work was supported by National Institutes of Health Grant AI47888. L.D.R. was supported by Ministerio de Educacioń y Cultura of Spain. greater brain cyst numbers during chronic infection. Mast cell- W W-v 2 Address correspondence and reprint requests to Dr. Eric Y. Denkers, Department of deficient (Kit /Kit ) mice also displayed a defective ability to Microbiology and Immunology, College of Veterinary Medicine, Cornell University, recruit PMN during early infection, suggesting that these cells Ithaca, NY 14853-6401. E-mail address: [email protected] serve as a major chemokine source involved in neutrophil recruit- 3 Abbreviations used in this paper: MIP, macrophage inflammatory protein; PMN, polymorphonuclear leukocyte; KO, knockout; STAg, soluble tachyzoite lysate Ag; ment. Our results suggest that CXCR2 is required for early WT, wild type; PEC, peritoneal exudate cell; IL-8Rh, IL-8R homolog. neutrophil recruitment, and that this chemokine receptor and its

ligands play an important protective role in resistance to PECs Toxoplasma. Peritoneal exudate cells (PEC; 2 ϫ 105 per sample) collected by peritoneal lavage with 10 ml of PBS were cytospun (700 rpm for 5 min) onto glass microscope slides (VWR Scientific, Rochester, NY) using cytofunnels Materials and Methods (Thermo Shandon, Pittsburgh, PA). To determine the composition of PEC Mice and the number of parasites, differential counts were performed on Diff- Quick-stained (American Scientific Products, McGraw Park, IL) cytocen- Female BALB/c and 129/J mice (6–8 wk of age) were obtained from The trifuge slides. A minimum of 300 cells were counted per slide. Jackson Laboratory (Bar Harbor, ME). Heterozygous CXCR2 knockout (KO) mice (C.129S2(B6)-Cmkartm1/Mwm) were purchased from The Jack- Spleen cell culture son Laboratory and bred at the College of Veterinary Medicine animal Spleens were collected from mice 7 days after i.p. infection with 100 ME49 facility (Cornell University, Ithaca, NY). The KO animals were originally cysts. After gentle mashing, cells were suspended in complete DMEM engineered by homologous recombination of a defective CXCR2 gene into consisting of 10% FCS, 1 mM sodium pyruvate, 0.1 mM nonessential 129 embryonic stem cells, followed by transplantation into C57BL/6 blas- amino acids, 10 mM HEPES buffer, 100 U/ml penicillin, 0.1 mg/ml strep- tocysts. Resulting chimeric animals were backcrossed onto a BALB/c tomycin (all from Life Technologies), and 50 mM 2-ME (Sigma-Aldrich). background for 10 generations (7). After genotyping for the CXCR2 gene, The resulting single cell suspension was centrifuged for 7 min at 1,000 ϫ a colony of homozygous KO mice was established and used in the studies g, supernatant was decanted, and erythrocytes were lysed using erythrocyte described. Female KO animals were age-matched to wild-type (WT) con- W W-v ϩ/ϩ lysis buffer (Sigma-Aldrich). Cells were cultured (37°C; 5% CO2)indu- trols. Mast cell-deficient Kit /Kit and congenic normal WBB6F1 plicate wells of 96-well plates (Costar, Cambridge, MA) at a concentration littermates were obtained from The Jackson Laboratory. The mice were of 5 ϫ 106 cells/ml with medium or STAg (2 ␮g/ml). After 24 or 48 h, housed under specific pathogen-free conditions in the College of Veteri- supernatants were collected and stored at Ϫ20°C until assayed. nary Medicine animal facility, which is accredited by the American Asso- Downloaded from ciation for Accreditation of Laboratory Care. Cytokine measurement To measure IFN-␥, the ELISA was performed. Ninety-six-well plates Mouse genotyping (Costar) were coated overnight at 4°C with mAb HB170 in ELISA coating buffer (0.1 M Na2CO3, 0.1 M NaHCO3,1mMNaN3, pH 9.6). After re- To isolate DNA, tail snips were digested in lysis buffer (80 ␮lof10% moving supernatant, plates were blocked for1hat37°C with 3% nonfat sodium dodecyl sulfate, 400 ␮l of 1 M Tris (pH 7.4), 400 ␮l of 1 M NaCl, dry milk in PBS. After five washes with PBS containing 0.05% Tween

␮ ␥ http://www.jimmunol.org/ 80 l of 500 mM EDTA, 4 mg of proteinase K in 3040 ml of H2O per tail (PBST), samples and rIFN- standard (R&D Systems, Minneapolis, MN) ␮ snip). Following an 18-h incubation at 56°C, 800 lofH2O was added and were added in 3% nonfat dry milk, and the plates were incubated for 1 h digest-centrifuged, and resulting supernatant was added to premixed phe- at 37°C. Plates were washed five times in PBST, biotinylated anti-IFN-␥ nol/CHCl3/isoamylalcohol (25:24:1; Sigma-Aldrich, St. Louis, MO). After mAb XMG1.2 (BD PharMingen, San Diego, CA) was added, and the vortexing and centrifugation, the aqueous phase was collected and re-ex- plates were incubated at 37°C for 1 h. After washing five times, HRP- ␮ tracted with CHCl3. DNA precipitation was achieved by addition of 50 l labeled streptavidin (Kirkegaard & Perry Laboratories, Gaithersburg, MD) of 3 M sodium acetate and 1 ml of 100% ethanol followed by incubation was added and plates were incubated for 30 min at 37°C. Finally, plates at Ϫ70°C overnight. After centrifugation (10 min at 4°C), pellets were were washed 10 times and 100 ␮l of ABTS substrate (Kirkegaard & Perry washed in 70% ethanol and resuspended in Tris-EDTA buffer, pH 8. DNA Laboratories) was added to each well. Sample absorbances were measured was quantitated on a UV spectrophotometer (Bio-Rad, Hercules, CA). at 405 nm on a Microplate BioKinetics reader (Bio-Tek Instruments, PCR amplification was accomplished as described elsewhere (25) using Winoosky, VT). by guest on September 24, 2021 primers specific for the CXCR2 gene and the neomycin cassette, which IL-12(p40) was measured in a similar manner, using plate-bound anti- replaces the single exon encoding the IL-8Rh in KO mice (7). Primer IL-12 mAb C15.6 and biotinylated anti-IL-12 mAb C17.8 (kindly provided sequences used were GGTCGTACTGCGTATCCTGCCTCA (CXCR2, by G. Trinchieri, Wistar Institute, Philadelphia, PA). Plates were coated forward), TAGCCATGATCTTGAGAAGTCCAT (CXCR2, reverse), CT with C15.6 diluted in PBS, then blocked with 1% BSA (Sigma-Aldrich) in TGGGTGGAGAGGCTATTC (neomycin, forward), and AGGTGAGAT PBS. After washing, HRP-labeled streptavidin addition (Kirkegaard & GACAGGAGATC (neomycin, reverse). The amplification cycle consisted Perry Laboratories), washing, and ABTS addition (Kirkegaard & Perry of 2 min at 94°C followed by 30 cycles at 94°C for 30 s, 57°C for 30 s, and Laboratories), sample absorbances were measured at 405 nm. 72°C for 5 min. Chain elongation at 72°C was continued for 5 min after the TNF-␣ levels were measured by a mouse-specific TNF-␣ ELISA kit last cycle. Amplification of CXCR2 and neomycin gene fragments results according to the manufacturer’s instructions (R&D Systems). in 350- and 280-bp products, respectively. An ethidium bromide gel showing PCR amplification products from a representative typing experiment is Flow cytometric analysis shown in Fig. 1. PEC and RBC-lysed splenocytes were washed with FACS buffer (1% FCS, Genotyping of Nramp1 was performed essentially as described above. 0.01% NaN3 in PBS) and blocked with anti-mouse CD16/CD32 (BD The primers used were TGGACGCATCCCGCTGTGGGG (forward PharMingen) in PBS with 5% normal mouse serum for 30 min on ice. After primer specific for 129-derived Nramp1), TGGACGCATCCCGCTGT the cells were washed with FACS buffer, FITC-conjugated anti-B220 GGGA (forward primer specific for BALB/c-derived Nramp1), and (Caltag Laboratories, Burlingame, CA), anti-CD4, anti-Gr-1 (both from GCATGATGATGGCACCGACGAT (common reverse primer). The am- BD PharMingen), and PE-conjugated anti-F4.80 (Caltag Laboratories), anti- plification cycle consisted of 2 min at 94°C followed by 26 cycles at 94°C CD8 (BD PharMingen), and anti-CD11b (clone M1/70; BD PharMingen) for 30 s, 60°C for 30 s, and 72°C for 5 min. Chain elongation at 72°C was were added, and the cells were incubated on ice for 30 min. The cells were continued for 5 min after the last cycle. RT-PCR amplification of this analyzed on a FACSCalibur flow cytometer, and CellQuest software (BD portion of the Nramp1 gene results in a 790-bp amplicon, as predicted from Immunocytometry Systems, San Jose, CA) was used to analyze the data. sequence data (37) and as confirmed by agarose gel electrophoresis. Statistical analysis Parasites, Ag, and infection Significant differences were determined using Student’s t test. Values of p Ͻ 0.05 were considered significant. All experiments were performed on at Tachyzoites of the virulent RH strain were maintained in vitro by infection least two independent occasions, and responses of individual animals were of human foreskin fibroblasts and biweekly passage in complete medium analyzed throughout. consisting of DMEM (Life Technologies, Gaithersburg, MD) supple- mented with 1% FBS (HyClone Laboratories, Logan, UT), penicillin (100 Results ␮ U/ml), and streptomycin (100 g/ml) (both from Life Technologies). CXCR2Ϫ/Ϫ mice display increased susceptibility to infection Tachyzoites from freshly lysed fibroblast cultures were washed once with

endotoxin-free PBS (Sigma-Aldrich) and resuspended in endotoxin-free We initially conﬁrmed the genotype of the F1 generation resulting PBS for i.p. injection. ME49 bradyzoite cysts were maintained in Swiss- from a cross between heterozygous CXCR2 WT and KO mice on Webster mice and infections were conducted as described previously (25). a BALB/c genetic background (Fig. 1). The homozygous KO an- Soluble tachyzoite lysate Ag (STAg) was prepared by sonication of RH Ϫ/Ϫ strain tachyzoites in the presence of protease inhibitors as described else- imals were selected to establish a colony of CXCR2 animals. where (25). The STAg solution was stored at Ϫ70°C until use. Resulting homozygous KO and WT control mice were infected by The Journal of Immunology 6505

FIGURE 1. Genotypic analysis of mice from a heterozygous cross between WT and CXCR2 KO mice. DNA was isolated from tail snips of F1 progeny from ϩ/Ϫϫϩ/Ϫ crosses and subjected to RT-PCR-mediated ampliﬁcation of the endogenous CXCR2 gene and neomycin (Neo), which replaces CXCR2 in the KO chromosome. Ampliﬁed DNA was subjected to agarose gel electrophoresis and products were visualized by viewing ethidium bromide-stained gels under UV illumination.

FIGURE 3. Defective PMN inﬂux in CXCR2 KO mice early after T. i.p. injection of 100 ME49 cysts, and 30 days later brains were gondii infection. Animals were infected by i.p. injection of 2 ϫ 106 RH removed for cyst enumeration. As shown in Fig. 2, brains from strain tachyzoites. After 4 h, PECs were harvested, centrifuged onto glass CXCR2 KO animals harbored approximately ﬁve-fold greater cyst microscope slides, and stained with Diff-Quik. Percentages of eosinophils numbers than WT mice. (EO), neutrophils (NEU), lymphocytes (LY), monocytes (MO), and mast

cells (MC) were determined by differential counting. The results are ex- Downloaded from Neutrophils fail to migrate into the peritoneal cavity during pressed as mean Ϯ SD of individual mice. Results are representative of two early infection in CXCR2 KO mice different experiments. Because IL-8 is a major neutrophil chemotactic cytokine, we as- sessed the ability of PMN to migrate into the peritoneal cavity this time point, large numbers of PMN were present in cell pop- following parasite inoculation. WT and KO animals were i.p. in-

6 ulations from WT mice (Fig. 4, A and C). In contrast, few or no http://www.jimmunol.org/ jected with 2 ϫ 10 RH strain tachyzoites. We previously showed Ϫ Ϫ neutrophils were evident in populations from CXCR2 / animals that the latter results in a rapid PMN influx, detectable in C57BL/6 (B and D). mice within4hofinfection (30). A similar result was found in In Fig. 5, cells from the peritoneal cavity were isolated and BALB/c animals, with an increase in neutrophils from 11% in stained with the granulocyte-associated marker Gr-1 (Ly6G) (38) noninfected mice to 45% in animals infected 4 h previously (Fig. and the macrophage marker F4/80 (39) 36 h after PBS injection or 3). In a situation of CXCR2 deficiency, the percentage of PMN RH infection. In WT mice, five distinct populations could be was lower in noninfected animals (4%), and there was a complete distinguished: Gr-1lowF4/80low, Gr-1lowF4/80high, Gr-1intF4/80int, failure to recruit these cells following infection (Fig. 3). Gr-1highF4/80low, and Gr-1highF4/80int (Fig. 5A). In response to high low Parasite numbers are increased and PMN influx remains parasite infection, there was a large increase in GR-1 F4/80 by guest on September 24, 2021 high int defective 36 h postinfection and Gr-1 F4/80 populations in cells from WT animals. High- level Gr-1 expression is known to be granulocyte restricted, and Chemokines in general are regarded as highly redundant media- fluorescence microscopy confirmed that the GR-1highF4/80low and tors; therefore, it was of interest that recruitment of neutrophils in high int Ϫ/Ϫ Gr-1 F4/80 populations were composed of neutrophils (data CXCR2 mice was totally defective during early infection. Nev- Ϫ Ϫ not shown). In CXCR2 / mice, there was an almost complete ertheless, it was possible that PMN could be recruited by CXCR2- absence of Gr-1high cells, consistent with a failure in neutrophil independent cytokines later in infection. Accordingly, we examined peritoneal cell populations 36 h after tachyzoite infection. At

FIGURE 4. Defective PMN response at 36 h is associated with high tachyzoite numbers in CXCR2 KO mice. Tachyzoites (RH strain, 2 ϫ 106) were i.p. inoculated into WT and KO animals, then 36 h later PECs were collected, centrifuged onto glass slides, and stained with Diff-Quik. A and FIGURE 2. Cyst numbers are elevated in brains of CXCR2 KO relative C, Cells from WT animals, showing large PMN numbers. B and D, Cells to WT mice. Animals were infected by i.p. inoculation of 100 ME49 cysts. from KO mice, demonstrating near complete absence of neutrophils but After 30 days, brains were removed and homogenized, and cyst numbers large tachyzoite numbers. Original magniﬁcation of A and B was ϫ40; C enumerated. Each circle represents an individual mouse. This experiment and D, ϫ100. The arrows in D point to individual tachyzoites. This ex- was repeated three times with equivalent results. periment was repeated three times with equivalent results. 6506 CXCR2 DEFICIENCY DURING T. gondii INFECTION

FIGURE 7. Quantitation of tachyzoites and infection in peritoneal cav- ities of WT and CXCR2 KO mice. Peritoneal cells and extracellular tachyzoites were obtained by lavage 36 h after infection with 2 ϫ 106 RH tachyzoites. Parasite and cell counts were determined by microscopic ex- amination of Diff-Quik-stained cells. A, Extracellular tachyzoites were counted in four fields (17,000 ␮m2 per field). B, The number of intracellular tachyzoites per infected cell was determined in four fields. C, The FIGURE 5. Flow cytometric analysis of peritoneal cells from WT and percentage of infected cells was estimated by counting four fields from 6 mutant mice. A, Cells were collected 36 h after i.p. inoculation of 2 ϫ 10 each sample. In these experiments, 91% of infected cells are monocytes RH strain tachyzoites or an equivalent volume of PBS, then stained with (two to eight tachyzoites per cell). Approximately 5% of the remaining Downloaded from mAb to Gr-1 (Ly6G) and F4/80. Percentages lying in each circled popu- infected cells are PMN with one to two intracellular tachyzoites. The data lation are indicated. Each fluorescence plot shows the results from an in- show mean Ϯ SD from individual mice (n ϭ 5 per group) and are repre- .p Ͻ 0.05 ,ء .dividual mouse (n ϭ five per group). B, CXCR2 KO (KO), BALB/c con- sentative of two experiments W W-v ϩ/ϩ ϩ ϩ trols (BA), Kit /Kit (W/W-v), and WBB6F1 controls ( / ) were infected as in A, then the number of Gr-1ϩ cells at 36 h postinfection was quantitated by flow cytometry. These experiments were repeated twice with identical results. tracellular parasite numbers, as well as percentage of infected http://www.jimmunol.org/ cells, there was a dramatic increase in parasite levels in CXCR2Ϫ/Ϫ mice. These data confirm that the defect in neutrophil recruitment during infection (Fig. 5, A and B). Interestingly, low high infiltration is sustained for at least 36 h, and that the absence of tachyzoite infection resulted in a complete loss of Gr-1 F4/80 CXCR2 increases susceptibility to infection. cells, with a concomitant increase in Gr-1intF4/80int cells from WT and KO populations (Fig. 5A). The latter displayed a macrophage CXCR2-dependent neutrophil influx is defective in mast cell- morphology, as determined by fluorescence microscopy (data not deficient KitW/KitW-v mice shown). Mast cells are capable of serving as a source of MIP-2 and TNF-␣,

We also performed double staining for F4/80 and CD11b in by guest on September 24, 2021 mediators which have been implicated in PMN recruitment in populations derived from infected and PBS-injected WT mice. As models of bacterial host defense and T cell-mediated delayed-type shown in Fig. 6, the F4/80high population present in PBS-injected hypersensitivity (40, 41). The MIP-2 chemokine binds with high animals also expressed high levels of CD11b. Likewise, after RH affinity to CXCR2 (6). Therefore, to determine whether mast cells infection, the F4/80int cells coexpressed intermediate levels of were involved in the PMN influx during Toxoplasma infection, we CD11b. The F4/80lowCD11bint population appearing after infec- examined the response of mast cell-deficient KitW/KitW-v mice. As tion most likely represents PMN, as these cells also expressed high ϩ shown in Fig. 5B, the influx of Gr-1 cells was reduced approx- levels of Gr-1 (data not shown). imately three-fold in mast cell-deficient mice relative to control Increased tachyzoite numbers appeared to be present in prepa- littermates. Nevertheless, this decreased PMN influx was not as rations from the KO mice (Fig. 4). We confirmed that this was the drastic as that seen in CXCR2 KO mice, in which there was an case by enumerating parasite numbers and percentage of infected ϳ90% reduction in neutrophil numbers (Fig. 5B). We conclude cells, as shown in Fig. 7. Thus, in terms of intracellular and ex- that mast cells are an important chemokine source driving PMN recruitment during T. gondii infection, but that other cells are also likely to play a role in providing these mediators in this infection model.

Parasite-induced type 1 cytokine responses are defective in CXCR2Ϫ/Ϫ animals We next evaluated spleen cell responses in animals undergoing acute Toxoplasma infection. The spleen cell phenotype was evaluated by ﬂow cytometry (Table I). Noninfected KO mice displayed increased levels of Gr-1ϩ cells in the spleen, as previously described (7), and this was also the case for 7-day infected animals. The remaining populations of T lymphocytes, B lymphocytes, macrophages, and NK cells appeared similar for both mouse strains, with increases in all populations following infection, al- FIGURE 6. Expression of F4/80 and CD11b on peritoneal cells from though there was a small but statistically signiﬁcant increase in infected animals. Peritoneal cells were collected 36 h after i.p. injection of ϩ PBS or 2 ϫ 106 RH strain tachyzoites. Cells were analyzed as described in F4/80 cells in CXCR2 KO animals. Fig. 5, using Abs to F4/80 and CD11b (clone M1/70). Percentages lying in Because we and others have found that PMN can serve as an each circled population are indicated. This experiment is representative of IL-12 source that may play a role in type 1 cytokine response two performed. induction (24, 30, 34), we examined spleen cell cytokine release The Journal of Immunology 6507

Table I. Phenotypic composition of splenocytes from T. gondii-infected and non-infected WT and CXCR2 KO micea

Mouse Gr-1ϩ B220ϩ CD4ϩ CD8ϩ F4/80ϩ Total

WT noninfected 0.1 Ϯ 0.0b 11.7 Ϯ 2.3 5.4 Ϯ 1.6 1.9 Ϯ 0.7 0.6 Ϯ 0.1 22.4 Ϯ 5.4 KO noninfected 5.0 Ϯ 0.7c 16.7 Ϯ 1.4 8.0 Ϯ 0.3 3.0 Ϯ 0.0 2.2 Ϯ 0.2c 46.4 Ϯ 6.8 WT infected 3.3 Ϯ 0.8 53.5 Ϯ 7.0 15.5 Ϯ 1.8 6.5 Ϯ 0.9 7.4 Ϯ 0.9 103.3 Ϯ 12 KO infected 13.6 Ϯ 3.9 45.9 Ϯ 6.2 26.8 Ϯ 5.1 9.5 Ϯ 1.3 12.5 Ϯ 2.5 142.5 Ϯ 20

a Seven days after i.p. infection with 100 T. gondii cysts, splenocytes were isolated and stained for flow cytometric analysis. b Data are expressed as means Ϯ SD (ϫ 10Ϫ6) of the total cell number expressing the indicated phenotypic marker. Each group was composed of five mice, and results are representative of two independent experiments. c p Ͻ 0.05 relative to cells from infected KO mice. after in vitro stimulation with STAg. Both IFN-␥ and TNF-␣ re- the neutrophil influx in parental 129 and BALB/c mice. As shown sponses were lower using cells from 7-day infected KO mice rel- in Fig. 9B, a strong PMN response was associated with both ative to WT controls (Fig. 8). Nevertheless, IL-12 levels produced strains, despite carrying different Nramp1 alleles. In addition, the by spleen cells from KO and WT animals were not significantly percentage of infected cells in the peritoneal cavity did not differ different. This is likely to be the result of the presence of splenic between the strains (Fig. 9B). These results strongly argue that the PMN and dendritic cells, which produce IL-12 in response to disrupted CXCR2 gene itself, rather than the 129-derived Nramp1 STAg (25, 42). When we examined serum cytokine levels we allele, accounts for the impaired neutrophil response in the Downloaded from found that CXCR2Ϫ/Ϫ mice displayed five-fold less serum IFN-␥ KO mice. than WT controls, although there was not a significant difference in TNF-␣ or IL-12 serum levels (Fig. 7). Similar results were found Discussion in mice undergoing infection with RH strain parasites. The results of our study argue that mouse CXCR2 is essential for early neutrophil recruitment during T. gondii infection. Animals Ϫ/Ϫ Nramp1 genotype of CXCR2 animals deficient in mast cells also displayed an impaired PMN influx, http://www.jimmunol.org/ Genetic studies have mapped the Nramp1 gene to within 50 kb of suggesting these cells as a source of mediators that bind to the murine IL-8Rh gene (43, 44). The Nramp1 gene is capable of CXCR2. The defective neutrophil influx was associated with influencing resistance to intracellular bacteria (44). Because the higher parasite numbers in the peritoneal cavity during early stages 129 mouse strain carries a WT Nramp1 allele and the BALB/c of infection, and this was reflected by increased cyst numbers later strain carries a mutant Nramp1 allele, it was possible that CXCR2 during chronic infection. Earlier studies suggested that tachyzoites KO animals carried a 129-derived Nramp1 gene. We used primers release factors chemotactic for neutrophils (45). Our studies argue specific for Nramp 783, the single nucleotide position differing that host CXCR2 expression is necessary for PMN recruitment. between the two parental mouse strains (44), to amplify an While it is possible that the parasite releases CXCR2-binding li- by guest on September 24, 2021 Nramp1 amplicon in an allele-specific manner. As shown in Fig. gands, we think it more likely that the chemotactic mediators are 9A, the KO strain retains a 129-derived Nramp1 gene, despite 10 host derived. Indeed, in our laboratory we have been unable to generations of backcrossing to the BALB/c strain. To confirm that detect tachyzoite-derived neutrophil chemotactic factors (S. K. presence of this allele was not affecting our results, we evaluated Bliss and E. Y. Denkers, unpublished observations). Although mice do not express an IL-8 homolog, several CXC chemokines bind to the IL-8Rh, including MIP-2 and KC (6, 46). Of these, KC is ϳ10-fold less potent than MIP-2, arguing that the latter may be more important as a CXCR2 ligand. Nevertheless, in pulmonary infections with Legionella pneumophila and Pseudo- monas aeruginosa, neutralization of either MIP-2 or KC resulted in only partial blockade of the PMN influx, whereas Ab blocking of CXCR2 completely inhibited neutrophil recruitment (12, 47). Thus, both MIP-2 and KC chemokines, by binding to CXCR2 on neutrophils, may be involved in neutrophil trafficking during T. gondii infection. Previous studies on IL-12Ϫ/Ϫ and IFN-␥Ϫ/Ϫ mice have shown that T. gondii infection induces abnormally high levels of PMN recruitment into the peritoneal cavity (18, 27). Given our results, it would be of interest to determine whether these cytokines play a down-regulatory role in expression of either CXCR2 or ligands of this chemokine receptor. We are currently examining MIP-2 and KC production, as well as neutrophil CXCR2 expression in IL-12 and IFN-␥ KO mice to determine levels of these mediators in the presence and absence of IL-12 and IFN-␥. FIGURE 8. Cytokine production by infected WT and KO animals. WT Our results showing that KitW/KitW-v mice display a defective and CXCR2 KO mice were infected (100 ME49 cysts), then 7 days later neutrophil influx during T. gondii infection implicate mast cells as spleens were isolated and serum was collected. Spleen cells were stimu- ␮ an important chemokine source driving CXCR2-dependent PMN lated with STAg (2 g/ml), supernatants were harvested 48 h later, and W W-v cytokines were quantitated by ELISA. The data are expressed as means Ϯ migration into the peritoneal cavity. Because the Kit /Kit mice Significant differences between and their WT counterparts are on a different genetic background ,ء .(SD of individual mice (n ϭ 5 per strain W W-v WT and KO (p Ͻ 0.05). The results are representative of three individual than that of CXCR2 KO animals and the Kit /Kit mice also experiments. display other mast cell-independent abnormalities, this result must 6508 CXCR2 DEFICIENCY DURING T. gondii INFECTION

FIGURE 9. Nramp1 genotype of KO mice. A,An Nramp1 gene fragment was subjected to RT-PCR-as- sisted amplification using a primer specific for BALB/ c-derived (A primer) and 129-derived (G primer) Nramp1. B, Mice were infected with 2 ϫ 106 RH strain tachyzoites, then 36 h later peritoneal cells were harvested, centrifuged onto glass slides, and stained with Diff-Quik. The percentage of PMN and infected cells was calculated by counting 300 cells in randomly selected fields.

be interpreted with some caution. Nevertheless, our findings are in mice. The fact that IFN-␥ responses were not totally absent likely accord with those of others suggesting that mast cells drive neutrophil accounts for the ability of CXCR2 KO mice to survive infection, recruitment through release of TNF-␣ and MIP-2 in models of bac- albeit with higher cyst numbers. Nevertheless, while these data are terial clearance and T cell-mediated delayed-type hypersensitivity consistent with a role for PMN in triggering type 1 cytokine re- (40, 41). In our experiments, the defective neutrophil migration in sponses, we cannot exclude the possibility that susceptibility of the mast cell-deficient mice was less profound than that occurring in CXCR2Ϫ/Ϫ mouse strain reflects decreased microbicidal activity Downloaded from CXCR2 KO animals. The latter finding may indicate that mast cells at the site of infection. are not the sole source of CXCR2-binding chemokines in the perito- The results of this study indicate that, in addition to an inactive neal cavity during infection. In this regard, macrophages are capable CXCR2 gene, the KO animals differ from BALB/c WT mice by of producing both MIP-2 and KC, and human neutrophils themselves retaining an Nramp1 allele associated with resistance to Mycobac- are a potent IL-8 source (48–50). Although mice do not express IL-8, terium bovis. It is also of note that the Nramp1 gene may influence it is nevertheless possible that murine PMN produce CXCR2-binding susceptibility to T. gondii (56). However, we think it unlikely that http://www.jimmunol.org/ chemokines in response to T. gondii, as has been shown for the CC differences in the Nramp1 allele account for the defective PMN chemokines MIP-1␣ and MIP-1␤ (29). responses between WT and KO strains for the following reasons. In a related study to that reported in this work, it was shown that First, our results show that the parental strains, which differ in CCR1 KO mice display increased susceptibility to T. gondii (51). Nramp1 alleles, display an identical neutrophil influx during in- Unlike CXCR2, the ligands for CCR1 are CC chemokines such as fection and an equivalent parasite level in the peritoneal cavity. MIP-1␣, MIP-1␤, and RANTES (52). Indeed, the phenotype for T. Second, while the Nramp1 gene may influence macrophage pro- gondii-infected CCR1 and CXCR2 KO mice appears distinct. duction of the CXCR2 ligand KC, the particular allele carried by Thus, CCR1Ϫ/Ϫ animals display PMN trafficking to sites of infec- the KO strain is associated with increased, rather than decreased, tion but an impaired ability to mobilize neutrophils and their pre- KC gene expression (57). Therefore, our data suggest that absence by guest on September 24, 2021 cursors from the bone marrow (51, 53). In contrast, our studies and of CXCR2 itself, rather than an allele-specific Nramp1 influence, those of others (8, 10) show a defective ability of CXCR2Ϫ/Ϫ accounts for the effects reported in this work. neutrophils to migrate to sites of infection. In addition, while we In sum, our results point to an important function for CXCR2 in and others (12) found evidence for defective proinflammatory cy- trafficking PMN to the site of protozoan infection. In this study, tokine responses in the absence of a functional CXCR2, this was such newly recruited cytokine-secreting neutrophils may play a not the case in CCR1Ϫ/Ϫ mice. Differences in the chemotactic role in macrophage and dendritic cell activation, as well as dis- effects of CCR1 and CXCR2 ligands on PMN may underlie these playing direct microbicidal activity. In this manner, PMN recruit- disparate effects. ment is likely to be an essential early step in controlling microbial In our experiments, we found a dramatic infection-induced loss infection and may underlie induction of acquired immunity to Tox- of F4/80 strongly positive cells in the peritoneal cavity of both WT oplasma and many other infections. and KO animals. This was accompanied by an increase in cells expressing intermediate amounts of F4/80 and Gr-1. Fluorescence Acknowledgments microscopy suggested that the latter population was composed We thank Dr. B. A. Butcher for critical review of the manuscript and mainly of macrophages/monocytes (data not shown), and, indeed, J. Olaya for technical assistance. macrophages/monocytes have been previously found to express low levels of Gr-1 during models of inflammation (54). The ap- References 1. Hechtman, D. H., M. I. Cybulsky, H. J. Fuchs, J. B. Baker, and M. A. Gimbrone, parent loss of F4/80 bright-staining cells may reflect infection- Jr. 1990. Intravascular IL-8: inhibitor of polymorphonuclear leukocyte accumu- induced maturation of monocytes, as down-regulation of this Ag is lation at sites of acute inflammation. J. Immunol. 147:883. associated with the latter process (39). 2. Colditz, I., R. Zwahlen, B. Dewald, and M. Baggiolini. 1989. In vivo inflammatory activity of neutrophil-activating factor, a novel chemotactic peptide derived The results of our study show that defective neutrophil recruit- from human monocytes. Am. J. Pathol. 134:755. ment is associated with increased host susceptibility and is detect- 3. Leonard, E. J., A. Skeel, T. Yoshimura, N. Noer, S. Kutvirt, and D. Van Epps. able within 36 h of infection as increased tachyzoite numbers in 1990. Leukocyte specificity and binding of human neutrophil attractant/activation protein-1. J. Immunol. 144:1333. the peritoneal cavity, and at 30 days postinfection as increased 4. Murphy, P., and H. Tiffany. 1991. Cloning of complementary DNA encoding a numbers of cysts establishing within the brain. The reason for this functional human interleukin-8 receptor. Science 253:1280. increased susceptibility is not known; however, we and others have 5. Holmes, W. E., J. Lee, W. J. Kuang, G. C. Rice, and W. I. Wood. 1991. Structure and functional expression of a human interleukin-8 receptor. Science 253:1278. presented evidence for an immunoregulatory role of PMN in ini- 6. Lee, J., G. Cacalano, T. Camerato, K. Toy, M. W. Moore, and W. I. Wood. 1995. tiating type 1 cytokine responses (12, 24, 31, 33, 55). The present Chemokine binding and activities mediated by the mouse IL-8 receptor. J. Im- data are consistent with this concept. Thus, CXCR2 KO mice dis- munol. 155:2158. ␥ ␣ 7. Cacalano, G., J. Lee, K. Kikly, A. M. Ryan, S. Pitts-Meek, B. Hultgren, played dysregulated IFN- and TNF- responses in the spleen, and W. I. Wood, and M. W. Moore. 1994. Neutrophil and B cell expansion in mice serum IFN-␥ levels were dramatically lower in the IL-8Rh KO that lack the murine IL-8 receptor homolog. Nature 265:682. The Journal of Immunology 6509

8. Frendeus, B., G. Godaly, L. Hang, D. Karpman, A.-C. Lundstedt, and mice through modulating the Th1/Th2 dichotomy in different directions. Eur. C. Svanborg. 2000. Interleukin-8 receptor deficiency confers susceptibility to J. Immunol. 31:265. acute experimental pyelonephritis and may have a human counterpart. J. Exp. 33. Pedrosa, J., B. M. Saunders, R. Appelberg, I. M. Orme, M. T. Silva, and Med. 192:881. A. M. Cooper. 2000. Neutrophils play a protective nonphagocytic role in sys- 9. Hang, L., B. Frendeus, G. Godaly, and C. Svanborg. 2000. Interleukin-8 receptor temic Mycobacterium tuberculosis infection of mice. Infect. Immun. 68:577. knockout mice have subepithelial neutrophil entrapment and renal scarring fol- 34. Romani, L., A. Mencacci, E. Cenci, G. Del Sero, F. Bistoni, and P. Puccetti. lowing acute pyelonephritis. J. Infect. Dis. 182:1738. 1997. An immunoregulatory role for neutrophils in CD4ϩ T helper subset selec- 10. Godaly, G., L. Hang, B. Frendeus, and C. Svanborg. 2000. Transepithelial neu- tion in mice with candidiasis. J. Immunol. 158:2356. trophil migration is CXCR1 dependent in vitro and is defective in IL-8 receptor 35. Romani, L., A. Mencacci, E. Cenci, R. Spaccapelo, G. Del Sero, I. Nicoletti, knockout mice. J. Immunol. 165:5287. G. Trinchieri, F. Bistoni, and P. Puccetti. 1997. Neutrophil production of IL-12 11. Balish, E., R. D. Wagner, A. Vazquez-Torres, J. Jones-Carson, C. Pierson, and and IL-10 in candidiasis and efficacy of IL-12 therapy in neutropenic mice. J. Im- Ϫ/Ϫ T. Warner. 1999. Mucosal and systemic candidiasis in IL-8Rh BALB/c mice. munol. 158:5349. J. Leukocyte Biol. 66:144. 36. Chen, L., Z. H. Zhang, and F. Sendo. 2000. Neutrophils play a critical role in the 12. Tateda, K., T. A. Moore, M. W. Newstead, W. C. Tsai, X. Zeng, J. C. Deng, pathogenesis of experimental cerebral malaria. Clin. Exp. Immunol. 120:125. G. Chen, R. Reddy, K. Yamaguchi, and T. J. Standiford. 2001. Chemokine- 37. Govini, G., S. Vidal, M. Cellier, P. Lepage, D. Malo, and P. Gros. 1995. Genomic dependent neutrophil recruitment in a murine model of Legionella pneumonia: structure, promoter sequence, and induction of expression of the mouse Nramp1 potential role of neutrophils as immunoregulatory cells. Infect. Immun. 69:2017. gene in macrophages. Genomics 27:9. 13. Navia, B. A., C. K. Petito, J. W. M. Gold, E. S. Cho, B. D. Jordon, and 38. Fleming, T. J., M. L. Fleming, and T. R. Malek. 1993. Selective expression of J. W. Price. 1986. Cerebral toxoplasmosis complicating the acquired immune Ly-6G on myeloid lineage cells in mouse bone marrow: RB6–8C5 mAb to gran- deficiency syndrome: clinical and neuropathological findings in 27 patients. Ann. ulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J. Im- Neurol. 19:224. munol. 151:2399. 14. Remington, J. S., and G. Desmonts. 1990. Toxoplasmosis. In Infectious Diseases 39. Plasman, N., and B. Vray. 1993. Mouse peritoneal macrophages: characterization of the Fetus and Newborn Infant. J. S. Remington and J. O. Klein, eds. Saunders, of functional subsets following Percoll density gradients. Res. Immunol. 144:151. Philadelphia, p. 89. 15. Denkers, E. Y., and R. T. Gazzinelli. 1998. Regulation and function of T cell- 40. Biedermann, T., M. Kneilling, R. Mailhammer, K. Maier, C. A. Sander, mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. G. Kollias, S. L. Kunkel, L. Hultner, and M. Rocken. 2000. Mast cells control Downloaded from 11:569. neutrophil recruitment during T cell-mediated delayed-type hypersensitivity re- 16. Alexander, J., and C. A. Hunter. 1998. Immunoregulation during toxoplasmosis. actions through tumor necrosis factor and macrophage inflammatory protein 2. Chem. Immunol. 70:81. J. Exp. Med. 192:1441. 17. Yap, G., M. Pesin, and A. Sher. 2000. IL-12 is required for the maintenance of 41. Malaviya, R., T. Ikeda, E. Ross, and S. N. Abraham. 1996. Mast cell modulation ␣ IFN-␥ production in T cells mediating chronic resistance to the intracellular of neutrophil influx and bacterial clearance at sites of infection through TNF- . pathogen, Toxoplasma gondii. J. Immunol. 165:628. Nature 381:77. 18. Scharton-Kersten, T. M., T. A. Wynn, E. Y. Denkers, S. Bala, L. Showe, 42. Reis e Sousa, C., S. Hieny, T. Scharton-Kersten, D. Jankovic, H. Charest,

E. Grunvald, S. Hieny, R. T. Gazzinelli, and A. Sher. 1996. In the absence of R. N. Germain, and A. Sher. 1997. In vivo microbial stimulation induces rapid http://www.jimmunol.org/ endogenous IFN-␥ mice develop unimpaired IL-12 responses to Toxoplasma CD40L-independent production of IL-12 by dendritic cells and their redistribu- gondii while failing to control acute infection. J. Immunol. 157:4045. tion to T cell areas. J. Exp. Med. 186:1819. 19. Suzuki, Y., M. A. Orellana, R. D. Schreiber, and J. S. Remington. 1988. Inter- 43. Cerretti, D. P., N. Nelson, C. J. Kozlosky, P. J. Morrissey, N. G. Copeland, feron-␥: the major mediator of resistance against Toxoplasma gondii. Science D. J. Gilbert, N. A. Jenkins, J. K. Dosik, and B. A. Mock. 1993. The murine 240:516. homologue of the human interleukin-8 receptor type B maps near the Ity-Lsh-Bcg 20. Gazzinelli, R. T., M. Wysocka, S. Hayashi, E. Y. Denkers, S. Hieny, P. Caspar, disease resistance locus. Genomics 18:410. G. Trinchieri, and A. Sher. 1994. Parasite-induced IL-12 stimulates early IFN-␥ 44. Vidal, S. M., D. Malo, K. Vogan, E. Skamene, and P. Gros. 1993. Natural re- synthesis and resistance during acute infection with Toxoplasma gondii. J. Im- sistance to infection with intracellular parasites: isolation of a candidate for Bcg. munol. 153:2533. Cell 73:469. 21. Gazzinelli, R. T., M. Wysocka, S. Hieny, T. Scharton-Kersten, A. Cheever, 45. Nakao, M., and E. Konishi. 1991. Neutrophil chemotactic factors secreted from R. Kuhn, W. Muller, G. Trinchieri, and A. Sher. 1996. In the absence of endog- Toxoplasma gondii. Parasitology 103:29. enous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal 46. Bozic, C. R., N. P. Gerard, C. von Uexkull-Gulenband, L. F. Kolakowski, by guest on September 24, 2021 ϩ immune response dependent upon CD4 T cells and accompanied by overpro- M. J. Conklyn, R. Breslow, H. J. Showell, and C. Gerard. 1994. The murine duction of IL-12, IFN-␥, and TNF-␣. J. Immunol. 157:798. interleukin 8 type B receptor homologue and its ligands: expression and biolog- 22. Neyer, L. E., G. Grunig, M. Fort, J. S. Remington, D. Rennick, and C. A. Hunter. ical characterization. J. Biol. Chem. 269:29355. 1997. Role of interleukin-10 in regulation of T-cell-dependent and T-cell-inde- 47. Tsai, W. C., R. M. Strieter, B. Mehrad, M. W. Newstead, X. Zeng, and pendent mechanisms of resistance to Toxoplasma gondii. Infect. Immun. 65:1675. T. J. Standiford. 2000. CXC chemokine receptor CXCR2 is essential for protec- 23. Suzuki, Y., A. Sher, G. Yap, D. Park, L. Ellis Neyer, O. Liesenfeld, M. Fort, tive innate host response in murine Pseudomonas aeruginosa pneumonia. Infect. H. Kang, and E. Gufwoli. 2000. IL-10 is required for prevention of necrosis in the Immun. 68:4289. small intestine and mortality in both genetically resistant BALB/c and susceptible 48. Wolpe, S. D., B. Sherry, D. Juers, G. Davatelis, R. W. Yurt, and A. Cerami. 1989. C57BL/6 mice following peroral infection with Toxoplasma gondii. J. Immunol. Identification and characterization of macrophage inflammatory protein 2. Proc. 164:5375. Natl. Acad. Sci. USA 86:612. 24. Bliss, S. K., L. C. Gavrilescu, A. Alcaraz, and E. Y. Denkers. 2001. Neutrophil 49. Adams, L. B., J. B. Hibbs, Jr., R. R. Taintor, and J. L. Krahenbuhl. 1990. Mi- depletion during Toxoplasma gondii infection leads to impaired immunity and crobiostatic effect of murine-activated macrophages for Toxoplasma gondii: role lethal systemic pathology. Infect. Immun. 69:4898. for synthesis of inorganic nitrogen oxides from L-arginine. J. Immunol. 144:2725. 25. Bliss, S. K., Y. Zhang, and E. Y. Denkers. 1999. Murine neutrophil stimulation 2ϩ ␥ 50. Kuhns, D. B., H. A. Young, E. K. Gallin, and J. A. Gallin. 1998. Ca -dependent by Toxoplasma gondii antigen drives high level production of IFN- -independent production and release of IL-8 in human neutrophils. J. Immunol. 161:4332. IL-12. J. Immunol. 163:2081. 51. Khan, I. A., P. M. Murphy, L. Casciotti, J. D. Schwartzman, J. Collins, J.-L. Gao, 26. Sayles, P. C., and L. J. Johnson. 1997. Exacerbation of toxoplasmosis in neutro- and G. R. Yeaman. 2001. Mice lacking the chemokine receptor CCR1 show phil depleted mice. Nat. Immun. 15:249. increased susceptibility to Toxoplasma gondii infection. J. Immunol. 166:1930. 27. Scharton-Kersten, T., G. Yap, J. Magram, and A. Sher. 1997. Inducible nitric oxide is essential for host control of persistent but not acute infection with the 52. Rossi, D., and A. Zlotnik. 2000. The biology of chemokines and their receptors. intracellular pathogen Toxoplasma gondii. J. Exp. Med. 185:1. Annu. Rev. Immunol. 18:217. 28. Bacon, C. M., E. F. Petricoin, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, 53. Gao, J.-L., T. A. Wynn, Y. Chang, E. J. Lee, H. E. Broxmeyer, S. Cooper, and J. J. O’Shea. 1995. IL-12 induces tyrosine phosphorylation and activation of H. L. Tiffany, H. Westphal, J. Kwong-Chung, and P. M. Murphy. 1997. Impaired STAT 4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307. host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cy- 29. Bliss, S. K., A. J. Marshall, Y. Zhang, and E. Y. Denkers. 1999. Human poly- tokine balance in mice lacking CC chemokine receptor 1. J. Exp. Med. 185:1959. morphonuclear leukocytes produce IL-12, TNF-␣, and the chemokines macro- 54. Lagasse, E., and I. L. Weissman. 1996. Flow cytometric identification of murine phage-inflammatory protein-1␣ and -1␤ in response to Toxoplasma gondii anti- neutrophils and monocytes. J. Immunol. Methods 197:139. gens. J. Immunol. 162:7369. 55. Romani, L., F. Bistoni, and P. Puccetti. 1997. Initiation of T-helper cell immunity 30. Bliss, S. K., B. A. Butcher, and E. Y. Denkers. 2000. Rapid recruitment of neutrophils to Candida albicans by IL-12: the role of neutrophils. Chem. Immunol. 68:110. with prestored IL-12 during microbial infection. J. Immunol. 165:4515. 56. Blackwell, J. M., C. W. Roberts, T. I. A. Roach, and J. Alexander. 1994. Influ- 31. Tateda, K., T. A. Moore, J. C. Deng, M. W. Newstead, X. Zeng, A. Matsukawa, ence of macrophage resistance gene Lsh/Ity/Bcg (candidate Nramp)onToxo- M. S. Swanson, K. Yamaguchi, and T. J. Standiford. 2001. Early recruitment of plasma gondii infection in mice. Clin. Exp. Immunol. 97:107. neutrophils determines subsequent T1/T2 host responses in a murine model of 57. Roach, T. I., D. Chatterjee, and J. M. Blackwell. 1994. Induction of early-re- Legionella pneumophila pneumonia. J. Immunol. 166:3355. sponse genes KC and JE by mycobacterial lipoarabinomannans: regulation of KC 32. Chen, L., T. Watanabe, H. Watanabe, and F. Sendo. 2001. Neutrophil depletion expression in murine macrophages by Lsh/Ity/Bcg (candidate Nramp). Infect. exacerbates experimental Chagas’ disease in BALB/c, but protects C57BL/6 Immun. 62:1176.