Research Note

Sex Identification in the Chinese Softshell Turtle Pelodiscus sinensis

(Trionychidae) Using the SBNO1 Gene

Lan Zhao#, Xin Wang#, Qiu-Hong Wan, Sheng-Guo Fang*

The Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of

Education and State Conservation Centre for Gene Resources of Endangered Wildlife,

College of Life Sciences, Zhejiang University, Hangzhou 310058, China

# These authors contributed equally to this work.

*Corresponding author: Prof. Sheng-Guo Fang

Email: [email protected]

Running title

Sex identification in the Chinese softshell turtle

Abstract

The Chinese softshell turtle exhibits ZZ/ZW sex determination. To identify the sex of embryos, juvenile and adult individuals, we designed two pairs PCR primers, SB1-196 which amplify a fragment of 196 bp in the female and the other, CK1-482, amplify 482 bp fragment in both the sexes. It is validated in 24 adult turtles of known sex, sampled from three different locations.

This one-step sexing technique is rapid and easy to perform, and reported for the first time.

Key words: PCR, sex identification, sex chromosome, molecular sexing, reptile, Chinese softshell turtle.

Introduction

Chinese softshell turtle, Pelodiscus sinensis (family Trionychidae, suborder Cryptodira), possesses heteromorphic sex chromosomes (ZZ male, ZW female) (Kawai et al. 2007) is widely distributed in

China and southeastern Asia (Zhao and Adler 1993) and have several populations named after the place of origin, e.g. Yellow River population, Taihu Lake population, and Japanese population, are well-studied in China (Liu et al. 2004; Xiao et al. 2005; Wang et al. 2010).

Owing to the high economic value because of its larger size in male turtles (Figure 1a) in China, identification of the sex of embryos and juvenile is an important area of research. Although the sex of

Chinese softshell turtles can be identified on the basis of 1) karyomorphology - by identifying female- specific W chromosome (male: ZZ; female: ZW), 2) by comparative genomic hybridization (CGH) pattern analysis (Kawai et al. 2007; Tang et al. 2015), which require expertise, time consuming and prone to error. Besides, Chinese soft-shell turtle is listed in the International Union for Conservation of

Nature (IUCN) Red List as vulnerable A1d + 2d, thus wild populations are threatened and shrinking.

Therefore, an easy and rapid method for identifying the sex of this species will contribute in breeding

and conservation programme.

In the present study, a pair of primer is designed according to molecular differences present between the Z and W chromosome in this species. Besides, another pair of primer is used as a positive control.

Using these two primer sets the sex phenotype is identified in adult from different tissues including blood.

Materials and methods

Sample collection and DNA extraction

Adult females and males (10 each) of the Japanese population from Tianfu turtle farm (Zhejiang, China); one male and one female of the Yellow River population from Dongying turtle farm (Shandong, China); and one male and one female of the Taihu Lake population from Meihua aquaculture farm (Zhejiang,

China) were collected. Genomic DNA was extracted from the livers of adult turtles by using Cell/Tissue

Genomic DNA Extraction Kit (No. GK0222, Shanghai Generay Biotech Co. Ltd., Shanghai, China), following the manufacturer’s protocol. The sex of the turtles was identified at the time of sampling based on direct observation of an ovary or testis (Figure 1a).

Primer design

To assess molecular differences between the Z and W chromosomes of the Chinese softshell turtle, we randomly designed several pairs of primers spanning the intron of the strawberry notch homolog 1 gene

(SBNO1, NCBI gene ID: 102459121), present on both Z and W chromosomes (Kawagoshi et al. 2009).

Among these primers, we found a pair of primers can amplify a 325-bp fragment in males and an additional 305-bp fragment in females a indicating that the 325-bp fragment may be Z-linked, whereas the 305-bp fragment may be W-linked. To distinguish these two sequences, we named the 325-bp fragment, amplified in both sexes as SB1-400_Z and the female-specific 305-bp fragment as SB1-

400_W. We then designed a pair of W-specific primers named SB1-196, which allowed amplification

only in females (see Figure 1b). We also designed another pair of primers, named CK1-482, from the gene splicing factor 3a subunit 1 (SF3A1) sequence (NCBI gene ID: 102458538) which amplify a 482 bp fragment in both the sexes serving as a positive control (all primers are listed in Table 1).

PCR

The 25-µL reaction system comprises 1 μL of DNA sample, 12.5 μL of 2× Taq Master Mix (No. GK8006,

Shanghai Generay Biotech Co. Ltd., Shanghai, China), 9.5 μL of ddH2O, 0.25 μL of 10 pmol/μL of each of the CK1-482 primers, and 0.75 μL of 10 pmol/μL of each of the SB1-196 primers. The reaction conditions were 94°C for 3 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 61°C for 30 s, extension at 72°C for 30 s, and a final extension at 72°C for 5 min. Amplification was performed in a

S1000 Thermal Cycler (Bio-Rad, CA, USA). PCR products were analysed by agarose gel electrophoresis in 1× TAE and visualised under UV light.

Molecular cloning, sequencing, and mapping

SB1-400_Z and SB1-400_W fragments cloned separately into the pUC18 using pMD™18-T Vector Cloning

Kit (Takara, Japan), were sequenced and mapped to the draft genome of the Chinese softshell turtle

(NCBI: AGCU00000000, Wang et al. 2013) by using Basic Local Alignment Search Tool (BLAST). Two scaffolds were mapped with identities of 100% (NCBI, NW_005852499) and 99% (NCBI,

NW_005854872), respectively thus two sex chromosome linked fragments were located on these two scaffolds.

Thereafter, we mapped the partial cDNA fragment of the SBNO1 gene (NCBI, AB478253), verified previously in the draft genome of the Chinese Soft-shell turtle, (Kawagoshi et al. 2009) identifying two scaffolds NW_005852499 (100% identity) and NW_005854872 (98% identity).

Results and discussion

Sex identification using PCR was developed nearly 28 years ago, offering a cheap, accurate, and reliable tool for for which the primers were mostly designed from gene presents in the sex-determining region of chromosome Y (SRY) in mammals or the chromodomain-helicase-DNA-binding gene (CHD) in birds

((Han et al. 1993; Griffiths et al. 1996; Kahn et al. 1998). For visualizing their sex-specific patterns occasionally restriction endonuclease recognition sites are included in the primer and the amplified fragment can then give a specific pattern after RE digestion (Amstrup et al. 1993; Sacchi et al. 2004).

To verify whether these two pairs of primers are suitable for identifying the sex of turtles, 24 adult turtles of known sex, sampled from three different locations, were tested. Both sexes showed consistently presence of 482-bp band, and the 196-bp band was specific only to the females (Figure 1c) whereas no

DNA control did not show any amplification.

The scaffolds NW_005852499 and NW_005854872 shared high identity with the partial cDNA fragment of the SBNO1 gene, while SB1-400_Z and SB1-400_W are also components of these two scaffolds, respectively. It is, therefore, reasonable to assume that the scaffold NW_005852499, which contained the gene SBNO1-Z, was located on the Z chromosome, and that the scaffold NW_005854872, which contained the gene SBNO1-W, was located on the W chromosome. However, this hypothesis needs to be validated.

In conclusion, PCR amplification using the SB1-196 and CK1-482 primers, followed by agarose gel electrophoresis, enabled sex identification in Chinese soft-shelled turtles where females show two bands 482 bp and 196 bp whereas the male has only 482bp band without any polymorphism in different population studied.

Acknowledgements

This work was supported by the National Key Program (2016YFC0503200) from the Ministry of Science and Technology of China, a special grant from the State Forestry Administration, and the Fundamental

Research Funds for the Central Universities of China.

We are grateful to Xiaoshan Tianfu Bio-Technology Co., Ltd., Hangzhou, Zhejiang Province, China, for providing samples of the Chinese Softshell of Japanese population.

References

Amstrup S. C., Garner G. W., Cronin M. A. et al. 1993 Sex identification of polar bears from blood and tissue samples[J]. Canadian Journal of Zoology. 71, 2174-2177.

Griffiths R., Daan S. and Dijkstra C. 1996 Sex Identification in Birds Using Two CHD Genes[J]. Proc

Biol Sci. 263, 1251-1256.

Han Y. M., Yoo. O. J. and Lee K. K. 1993 Sex determination in single mouse blastomeres by polymerase chain reaction[J]. Journal of Assisted Reproduction & Genetics. 10, 151-156.

Kahn W. N., John J. S. and Quinn T. W. 1998 Chromosome-Specific Intron Size Differences in the Avian

CHD Gene Provide an Efficient Method for Sex Identification in Birds[J]. The Auk. 115, 1074-1078.

Kawai A., Nishidaumehara C., Ishijima J., Tsuda Y., Ota H. and Matsuda Y. 2007 Different origins of bird and reptile sex chromosomes inferred from comparative mapping of chicken z-linked genes.

Cytogenetic & Genome Research. 117, 92-102.

Kawagoshi T., Uno Y., Matsubara K. et al. 2009 The ZW micro-sex chromosomes of the Chinese soft- shelled turtle (Pelodiscus sinensis, Trionychidae, Testudines) have the same origin as chicken chromosome 15[J]. Cytogenetic & Genome Research. 125, 125-131.

Kunieda T., Xian M., Kobayashi E., et al. 1992 Sexing of mouse preimplantation embryos by detection of Y chromosome-specific sequences using polymerase chain reaction[J]. Biology of Reproduction. 46,

692.

Liu Z. Z., Cai W. Q. and Li S. F. 2004 Analysis of genetic variations of five populations in Trionyx sinensis by RAPD[J]. Journal of Fisheries of China. 28, 119-126.

Prichard P. C. H. 1979 Encyclopedia of Turtles. T. F. H. Publication, New Jersey.

Sacchi P., Soglia D., Maione S. et al. 2004 A non-invasive test for sex identification in short-toed Eagle

(Circaetus gallicus).[J]. Molecular & Cellular Probes. 18, 93-196.

Tang W., Hong W., Wang C. et al. 2015 Karyotype and chromosome G-band analysis of Chinese soft- shelled turtle, Pelodiscus sinensis[J]. Journal of Shanghai Ocean University. 24, 174-181.

Tokita M. and Kuratani S. 2001 Normal Embryonic Stages of the Chinese Softshelled Turtle Pelodiscus sinensis (Trionychidae)[J]. Zoological Science. 18, 705-715.

Wang Z. H., Yin S. J., Gao J. et al. 2010 Optimization of RAPD technique of fingerprinting analysis of

Pelodiscus sinensis populations[J]. Journal of Fishery Sciences of China. 30, 93-96.

Wang Z., Pascualanaya J. and Zadissa A. et al. 2013 The draft genomes of soft–shell turtle and green sea turtle yield insights into the development and evolution of the turtle–specific body plan[J]. Nature

Genetics. 46, 701-706.

Xiao Y. M., Chen L. L., Chen H. G. et al. 2005 RAPD Analysis of Genomic DNA in the Pelodiscus

Sinensis[J]. Journal of Natural Science of Hunan Normal University. 28, 72-75

Zhang D., Xiong M., Bu H. et al. 2016 Sex identification of the masked palm civet (Paguma larvata), using noninvasive hair samples[J]. Conservation Genetics Resources. 8, 207-209.

Zhao E. and Adler K. 1993 Herpetology of China.[J]. University of Science and Technology of Chengdu

Press. Chengdu.

Received 20 June 2018; revised 17 September 2018; accepted 19 September 2018

Table

Table 1. Nucleotide sequence of primers used for sexing Pelodiscus sinensis.

Primer Name Forward primer (5ʹ-3ʹ) Reverse primer (5ʹ-3ʹ)

SB1-400 CCAAATGGAGACAGAGCT TTGCTCCAATGTCCCTCAAGT

GGA

GTAGGAAAAGGAAGGACC GGATACAAAACAAAAGAAACA SB1-196 ATAGCTGG TACAAAATTGG

CK1-482 GTGTATGCAACTCTTCCCT AGCTTCCATTCGGTCTTGTCCTG

CTCCTATTC

Figure

Fig. 1 (a) An adult male turtle on the left, and an adult female turtle on the right. Both of these two turtles are from Yellow River estuary. (b) The nucleotide sequence of SB1-400_W and SB1-400_Z, and those of the primers designed (SB1-400F, SB1-196F, SB1-196R, and SB1-400R) are shown with arrows. (c, d) Sex identification from DNA samples of disparate populations of Chinese softshell turtles using SB1-

196 and CK1-482 primers (L, 250 bp-IV DNA ladder). (c) JP, Japanese population: lanes 1–10 on the left represent 10 male individuals; lanes 1–10 on the right represent 10 female individuals. (d) TL, Taihu

Lake population; YR, Yellow River population; NC, negative controls. For both (c) and (d), the female- specific band is 196 bp and the larger, positive control band is 482 bp.