DOCSLIB.ORG

Investigations of CHD1 Function in Transcription and Development of Drosophila Melanogaster

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigations of CHD1 Function in Transcription and Development of Drosophila Melanogaster Copyright Ó 2008 by the Genetics Society of America DOI: 10.1534/genetics.107.079038 Note Investigations of CHD1 Function in Transcription and Development of Drosophila melanogaster Ivy E. McDaniel, Jennifer M. Lee, Matthew S. Berger, Cori K. Hanagami and Jennifer A. Armstrong1 Joint Science Department, W. M. Keck Science Center, Scripps, Claremont McKenna, and Pitzer Colleges, Claremont, California 91711 Manuscript received July 19, 2007 Accepted for publication November 19, 2007 ABSTRACT In this report we describe chd1 mutant alleles and show that the CHD1 chromatin-remodeling factor is important for wing development and fertility. While CHD1 colocalizes with elongating RNA polymerase II (Pol II) on polytene chromosomes, elongating Pol II can persist on chromatin in the absence of CHD1. These results clarify the roles of chromatin remodelers in transcription and provide novel insights into CHD1 function. N eukaryotic cells, RNA polymerase II (Pol II) encoun- derived from larvae lacking the Kismet (KIS) chroma- I ters nucleosomes at each step in transcription. To tin-remodeling protein retain Pol IIoser5, but lose Pol deal with these obstacles, Pol II requires the action of a IIoser2, suggesting that KIS is required for an early step in plethora of proteins including chromatin-remodeling the transition to transcription elongation (Srinivasan factors, which function as DNA-translocating machines et al. 2005). The CHD1 (chromodomain, helicase, DNA- that draw waves of DNA around the histone octamer to binding protein 1) chromatin-remodeling protein local- slide, perturb, or disassemble the nucleosomes (Cairns izes to active genes of polytenes in a pattern nearly 2005; Smith and Peterson 2005; Saha et al. 2006). identical to that of Pol IIoser2, suggesting a role for CHD1 While a number of chromatin-remodeling factors have in facilitating elongation (Stokes et al. 1996; Srinivasan been identified, the relative roles of these proteins in Pol et al. 2005). II transcription are unclear. Taken together, these results lead to a model in which The stages of transcription are largely defined by the three Drosophila chromatin-remodeling factors function phosphorylation status of the C-terminal domain sequentially to allow transcription: (1) BRM is required (CTD) of the largest subunit of Pol II. During initiation, for initiation, (2) KIS is required for the transition from the CTD is unphosphorylated (Pol IIa); as Pol II clears promoter clearance to the elongation phase, and (3) the promoter, it is phosphorylated at serine 5 within the CHD1 is required for continued elongation by Pol II. A heptad repeats of the CTD; and later in elongation, Pol place for CHD1 in elongation is also supported by data II is phosphorylated on serine 2 (Pol IIoser2)(Phatnani in yeast. Saccharomyces cerevisiae CHD1 is localized to a and Greenleaf 2006). Recent studies utilizing tran- transcriptionally active gene and physically interacts scriptionally active polytene chromosomes derived from with transcription elongation factors (Simic et al. 2003). Drosophila melanogaster larval salivary glands suggest that To determine whether Drosophila CHD1 is required for three distinct chromatin-remodeling factors may be elongation, we generated loss-of-function alleles of chd1 required for a successful round of transcription. Pol and examined the consequences of the loss of CHD1 on IIa levels are reduced on polytene chromosomes de- global chromosome structure and transcription. rived from larvae expressing a dominant-negative allele chd1 is not an essential gene: To investigate the func- of brahma (brm), suggesting that the SWI2-like BRM tion of CHD1, we generated two deletion alleles (chd14 chromatin remodeler is critical for transcription initia- and chd15) by imprecise excision of an EP element tion (Armstrong et al. 2002). Polytene chromosomes inserted into position -2 of the chd1 promoter (GenExel stock G2213) (Figure 1A). We observed no differences 1 in the behavior of the two alleles. As described below, Corresponding author: Joint Science Department, W. M. Keck Science 4 5 4 5 Center, 925 N. Mills Ave., Scripps, Claremont McKenna, and Pitzer chd1 and chd1 homozygous and chd1 /chd1 hetero- Colleges, Claremont, CA 91711. E-mail: [email protected] allelic individuals display phenotypes that are less se- Genetics 178: 583–587 (January 2008) 584 I. E. McDaniel et al. Figure 1.—The generation of two chd1 alleles. (A) The chd14 allele carries a dele- tion from À1to11994 with the additional sequence CATGATGAAATAACATATAGT TAGATATGAAATAA. The chd15 allele car- ries a deletion from À1to11871 with the additional sequence CATGATGAAAT AACATCATCATAACATGAAATAAC. Much of the additional sequence in both alleles is derived from the P element. (B) Western blot analysis of embryo extracts derived from Oregon-R (WT), flies in which the P element was precisely excised (precise), and chd14/CyO and chd15/CyO heterozy- gotes. Full-length CHD1 is observed in each lane, and a truncated protein (pre- dicted to be 166 kDa) is not observed in the mutant heterozygous embryo extracts. The CHD1 rabbit polyclonal antibody was raised and affinity purified against CHD1 amino acids 1706–1721 (CRLNMDRHED RKKHHRG) (Covance). This peptide antibody recognizes CHD1 on polytenes in a pattern identical to that observed with the antibody raised by Robert Perry (Stokes et al. 1996) (data not shown). vere than those seen in hemizygous mutants ½using mRNA by in situ hybridization and found that chd1 is Df(2L)Exel7014. These genetic data would suggest that broadly expressed throughout embryogenesis and in chd14 and chd15 are hypomorphic alleles. We investi- imaginal discs (data not shown). This broad expression gated the possibility that the two chd1 alleles could pattern is similar to that of brm and kis (Elfring et al. 1998; generate proteins with N-terminal truncations. Given Daubresse et al. 1999) and suggests that, like BRM and the location of the earliest in-frame start codon, we KIS, CHD1 could function globally to regulate transcription. predict that both chd14 and chd15 alleles would gener- While chd1 is broadly expressed, we observed specific ate a 166-kDa protein. However, Western blot analysis phenotypes in mutant animals, suggesting that CHD1 of heterozygous embryo extracts failed to detect an may function as a tissue-specific chromatin-remodeling N-terminal truncated protein (Figure 1B). While it is factor. Wing margins in chd14 and chd15 homozygous, formally possible that chd14 and chd15 express an un- heteroallelic, and hemizygous mutant individuals dis- stable protein that is not detectable by Western blot, played notching (Figure 2B), with 3.8–36% of heteroallelic we propose that our alleles are protein nulls and con- individuals and 75–94% of hemizygous individuals clude that chd1 is not an essential gene. chd14 and chd15 showing notched wing margins (Table 1). Several con- homozygous, heteroallelic, and hemizygous mutant in- trol individuals are presented in Table 1 to ensure that dividuals are viable, although they display a 1- to 2-day the cut-in wing margins were not a consequence of the developmental delay, and some marker combinations chromosomal markers (which are a result of meiotic reduce viability of chd1 mutants. Given the genetic data mapping of the chd1 alleles), although the markers may described above, we propose that 1 of the other 18 genes affect how often the phenotype is seen (Table 1). The uncovered by Df(2L)Exel7014 may dominantly enhance variability of the wing-notching phenotype was not chd1 mutant phenotypes. For example, okra (the RAD54 correlated with developmental delay or viability. Indi- homolog, a SNF2-like helicase) is located 20 kb away viduals homozygous for the precise excision did not from chd1. okra mutant phenotypes include female show cut-in wing margins, indicating that the phenotype sterility (Kooistra et al. 1997), one of the chd1 pheno- is due to lack of CHD1. This specific wing phenotype is types that may be dominantly enhanced by the deficiency. not observed in animals lacking BRM or KIS and sug- chd1 mutants reveal unexpected defects in fertility and gests that genes critical for wing-margin formation are wing development: We examined the distribution of chd1 especially sensitive to loss of CHD1. Figure 2.—chd1 mutant individuals display wing defects that include notched wing margins. In contrast to a wild-type Oregon-R wing (A), wings from chd14 b pr c px sp/chd5 b individuals show notched wing margins (B). Wings from chd1 mu- tant animals are 80% the size of wild-type wings, consistent with their overall smaller size. Note 585 TABLE 1 Wing defects in chd1 mutant flies Total % of flies no. of displaying cut-in Genotype flies wing marginsa chd14 b pr c px sp/chd15 b 285 3.8 chd14 b pr c px sp/chd15 bcsp 115 36 chd14 b pr c px sp/b 269 0 chd14 b pr c px sp/al b c sp 294 0 b pr c px sp/chd15 bcsp 280 0 chd14 b pr c px sp/Df(2L)Exel7014 159 78 chd15 b/Df(2L)Exel7014 48 94 In(2LR) Gla, Bc/Df(2L)Exel7014 209 0 a At least one wing showed a cut-in wing margin. chd14 and chd15 homozygous, heteroallelic, and hemi- zygous males are sterile; CHD1 is therefore required for male fertility (Table 2). chd1 mutant males displayed normal mating behaviors, and there were no obvious defects in the general morphology of testes of chd14/ chd15 mutant males (data not shown). While our mutant males produced zero progeny, control males produced an average of 101 progeny per single male under the same conditions. CHD1 is also important for female fertility as chd1 mutant females produced few offspring (Table 2) (by comparison, a single wild-type female Figure 3.—chd1 mutant individuals display defects in oo- produced 108 progeny under the same conditions). We genesis. Ovarioles derived from wild-type (A) and chd14/ propose that the majority of the fertilized eggs cannot Df(2L)Exel7014 hemizygous mutant females (B) were stained develop due to an inability to repackage the sperm with DAPI and prepared as described (Verheyen and Cooley pronuclear DNA into H3.3-containing chromatin (Konev 1994).
Load more

Recommended publications
  • Recombinant CHD1 Protein
    Recombinant CHD1 protein Catalog No: 81307, 81607 Quantity: 20, 1000 µg Expressed In: Baculovirus Concentration: 0.4 µg/µl Source: Human Buffer Contents: Recombinant CHD1 protein is supplied in 25 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5 mM TCEP. Background: CHD1 (Chromodomain Helicase DNA Binding Protein 1) is one of the CHD family proteins. They are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD1 is a ATP-dependent chromatin-remodeling factor which functions as substrate recognition component of the transcription regulatory histone acetylation (HAT) complex SAGA. It can regulate polymerase II transcription, and is also required for efficient transcription by RNA polymerase I, and more specifically the polymerase I transcription termination step. CHD1 is not only involved in transcription-related chromatin-remodeling, but also required to maintain a specific chromatin configuration across the genome. It is required for the bridging of SNF2, the FACT complex, the PAF complex as well as the U2 snRNP complex to H3K4me3. Protein Details: Full length CHD1 protein (accession number AAI17135.1) was expressed in a baculovirus system with an N-terminal FLAG-Tag. The molecular weight of the protein is 197.9 kDa. Recombinant CHD1 protein gel Application Notes: This product was manufactured as described in Protein Details. 7.5% SDS-PAGE gel with Where possible, Active Motif has developed functional or activity assays for Coomassie blue staining recombinant proteins. Additional characterization such as enzyme kinetic activity assays, inhibitor screening or other biological activity assays may not have been MW: 197.9 kDa performed for every product.
    [Show full text]
  • Molecular Evolution of the Avian CHD1 Genes on the Z and W Sex Chromosomes
    Copyright 2000 by the Genetics Society of America Molecular Evolution of the Avian CHD1 Genes on the Z and W Sex Chromosomes Anna-Karin Fridolfsson and Hans Ellegren Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University, SE-752-36 Uppsala, Sweden Manuscript received December 8, 1999 Accepted for publication April 14, 2000 ABSTRACT Genes shared between the nonrecombining parts of the two types of sex chromosomes offer a potential means to study the molecular evolution of the same gene exposed to different genomic environments. We have analyzed the molecular evolution of the coding sequence of the ®rst pair of genes found to be shared by the avian Z (present in both sexes) and W (female-speci®c) sex chromosomes, CHD1Z and CHD1W. We show here that these two genes evolve independently but are highly conserved at nucleotide as well as amino acid levels, thus not indicating a female-speci®c role of the CHD1W gene. From comparisons of sequence data from three avian lineages, the frequency of nonsynonymous substitutions (Ka) was found to be higher for CHD1W (1.55 per 100 sites) than for CHD1Z (0.81), while the opposite was found for synonymous substitutions (Ks, 13.5 vs. 22.7). We argue that the lower effective population size and the absence of recombination on the W chromosome will generally imply that nonsynonymous substitutions accumulate faster on this chromosome than on the Z chromosome. The same should be true for the Y chromosome relative to the X chromosome in XY systems. Our data are compatible with a male-biased mutation rate, manifested by the faster rate of neutral evolution (synonymous substitutions) on the Z chromosome than on the female-speci®c W chromosome.
    [Show full text]
  • CHD1 Loss Negatively Influences Metastasis-Free Survival in R0
    Cancer Gene Therapy https://doi.org/10.1038/s41417-020-00288-z ARTICLE CHD1 loss negatively influences metastasis-free survival in R0- resected prostate cancer patients and promotes spontaneous metastasis in vivo 1,2 2 1,2 3 4 2 Su Jung Oh-Hohenhorst ● Derya Tilki ● Ann-Kristin Ahlers ● Anna Suling ● Oliver Hahn ● Pierre Tennstedt ● 1 1 1 1 1 5,8 Christiane Matuszcak ● Hanna Maar ● Vera Labitzky ● Sandra Hanika ● Sarah Starzonek ● Simon Baumgart ● 6 7 7 7 7 2 Steven A. Johnsen ● Martina Kluth ● Hüseyin Sirma ● Ronald Simon ● Guido Sauter ● Hartwig Huland ● 1 1 Udo Schumacher ● Tobias Lange Received: 21 September 2020 / Revised: 9 December 2020 / Accepted: 10 December 2020 © The Author(s) 2021. This article is published with open access Abstract The outcome of prostate cancer (PCa) patients is highly variable and depends on whether or not distant metastases occur. Multiple chromosomal deletions have been linked to early tumor marker PSA recurrence (biochemical relapse, BCR) after radical prostatectomy (RP), but their potential role for distant metastasis formation is largely unknown. Here, we 1234567890();,: 1234567890();,: specifically analyzed whether deletion of the tumor suppressor CHD1 (5q21) influences the post-surgical risk of distant metastasis and whether CHD1 loss directly contributes to metastasis formation in vivo. By considering >6800 patients we found that the CHD1 deletion negatively influences metastasis-free survival in R0 patients (HR: 2.32; 95% CI: 1.61, 3.33; p < 0.001) independent of preoperative PSA, pT stage, pN status, Gleason Score, and BCR. Moreover, CHD1 deletion predicts shortened BCR-free survival in pT2 patients and cancer-specific survival in all patients.
    [Show full text]
  • Chromatin Regulator CHD1 Remodels the Immunosuppressive Tumor Microenvironment in PTEN-Defi Cient Prostate Cancer
    Published OnlineFirst May 8, 2020; DOI: 10.1158/2159-8290.CD-19-1352 RESEARCH ARTICLE Chromatin Regulator CHD1 Remodels the Immunosuppressive Tumor Microenvironment in PTEN-Defi cient Prostate Cancer Di Zhao 1 , 2 , Li Cai 1 , Xin Lu 1 , 3 , Xin Liang 1 , 4 , Jiexi Li 1 , Peiwen Chen 1 , Michael Ittmann 5 , Xiaoying Shang 1 , Shan Jiang6 , Haoyan Li 2 , Chenling Meng 2 , Ivonne Flores 6 , Jian H. Song 4 , James W. Horner 6 , Zhengdao Lan 1 , Chang-Jiun Wu6 , Jun Li 6 , Qing Chang 7 , Ko-Chien Chen 1 , Guocan Wang 1 , 4 , Pingna Deng 1 , Denise J. Spring 1 , Y. Alan Wang1 , and Ronald A. DePinho 1 Downloaded from cancerdiscovery.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst May 8, 2020; DOI: 10.1158/2159-8290.CD-19-1352 ABSTRACT Genetic inactivation of PTEN is common in prostate cancer and correlates with poorer prognosis. We previously identifi edCHD1 as an essential gene in PTEN- defi cient cancer cells. Here, we sought defi nitivein vivo genetic evidence for, and mechanistic under- standing of, the essential role of CHD1 in PTEN-defi cient prostate cancer. In Pten and Pten /Smad4 genetically engineered mouse models, prostate-specifi c deletion ofChd1 resulted in markedly delayed tumor progression and prolonged survival. Chd1 deletion was associated with profound tumor microenvironment (TME) remodeling characterized by reduced myeloid-derived suppressor cells (MDSC) and increased CD8+ T cells. Further analysis identifi ed IL6 as a key transcriptional target of CHD1, which plays a major role in recruitment of immunosuppressive MDSCs.
    [Show full text]
  • Dynamic Landscape of Chromatin Accessibility and Transcriptomic
    www.nature.com/scientificreports OPEN Dynamic landscape of chromatin accessibility and transcriptomic changes during diferentiation of human embryonic stem cells into dopaminergic neurons César Meléndez‑Ramírez1,2,6, Raquel Cuevas‑Diaz Duran3,6*, Tonatiuh Barrios‑García3, Mayela Giacoman‑Lozano3, Adolfo López‑Ornelas1,2,4, Jessica Herrera‑Gamboa3, Enrique Estudillo2, Ernesto Soto‑Reyes5, Iván Velasco1,2* & Víctor Treviño3* Chromatin architecture infuences transcription by modulating the physical access of regulatory factors to DNA, playing fundamental roles in cell identity. Studies on dopaminergic diferentiation have identifed coding genes, but the relationship with non‑coding genes or chromatin accessibility remains elusive. Using RNA‑Seq and ATAC‑Seq we profled diferentially expressed transcripts and open chromatin regions during early dopaminergic neuron diferentiation. Hierarchical clustering of diferentially expressed genes, resulted in 6 groups with unique characteristics. Surprisingly, the abundance of long non‑coding RNAs (lncRNAs) was high in the most downregulated transcripts, and depicted positive correlations with target mRNAs. We observed that open chromatin regions decrease upon diferentiation. Enrichment analyses of accessibility depict an association between open chromatin regions and specifc functional pathways and gene‑sets. A bioinformatic search for motifs allowed us to identify transcription factors and structural nuclear proteins that potentially regulate dopaminergic diferentiation. Interestingly, we also found changes in protein and mRNA abundance of the CCCTC‑binding factor, CTCF, which participates in genome organization and gene expression. Furthermore, assays demonstrated co‑localization of CTCF with Polycomb‑repressed chromatin marked by H3K27me3 in pluripotent cells, progressively decreasing in neural precursor cells and diferentiated neurons. Our work provides a unique resource of transcription factors and regulatory elements, potentially involved in the acquisition of human dopaminergic neuron cell identity.
    [Show full text]
  • Structural Reorganization of the Chromatin Remodeling Enzyme
    RESEARCH ARTICLE Structural reorganization of the chromatin remodeling enzyme Chd1 upon engagement with nucleosomes Ramasubramanian Sundaramoorthy1, Amanda L Hughes1, Vijender Singh1, Nicola Wiechens1, Daniel P Ryan1†, Hassane El-Mkami2, Maxim Petoukhov3, Dmitri I Svergun3, Barbara Treutlein4‡, Salina Quack4, Monika Fischer4, Jens Michaelis4, Bettina Bo¨ ttcher5, David G Norman6, Tom Owen-Hughes1* 1Centre for Gene Regulation and Expression, School of Life Sciences, University of Dundee, Dundee, United Kingdom; 2School of Physics and Astronomy, University of St Andrews, St Andrews, United Kingdom; 3Hamburg Outstation, European Molecular Biology Laboratory, Hamburg, Germany; 4Institute for Biophysics, Faculty of Natural Sciences, Ulm University, Ulm, Germany; 5Lehrstuhl fu¨ r Biochemie, Rudolf-Virchow Zentrum, Universitat Wu¨ rzburg, Wu¨ rzburg, Germany; 6Nucleic Acids Structure Research Group, University of Dundee, Dundee, United Kingdom Abstract The yeast Chd1 protein acts to position nucleosomes across genomes. Here, we model *For correspondence: t.a. the structure of the Chd1 protein in solution and when bound to nucleosomes. In the apo state, the [email protected] DNA-binding domain contacts the edge of the nucleosome while in the presence of the non- Present address: †Department hydrolyzable ATP analog, ADP-beryllium fluoride, we observe additional interactions between the of Genome Sciences, The John ATPase domain and the adjacent DNA gyre 1.5 helical turns from the dyad axis of symmetry. Curtin School of Medical Binding in this conformation involves unravelling the outer turn of nucleosomal DNA and requires Research, The Australian substantial reorientation of the DNA-binding domain with respect to the ATPase domains. The National University, Canberra, orientation of the DNA-binding domain is mediated by sequences in the N-terminus and mutations Australia; ‡Max Planck Institute to this part of the protein have positive and negative effects on Chd1 activity.
    [Show full text]
  • CHD1 Motor Protein Is Required for Deposition of Histone Variant H3.3
    REPORTS sions, Df(2L)Chd1[1] and Df(2L)Chd1[2], deleted CHD1 Motor Protein Is Required for fragments of the Chd1 gene and fragments of unrelated adjacent genes. Heterozygous combi- nations, however, of Chd1[1] or Chd1[2] with Deposition of Histone Variant Df(2L)Exel7014 affect both copies of the Chd1 gene only (Fig. 1B). We also identified a single H3.3 into Chromatin in Vivo point mutation that results in premature translation termination of Chd1 (Q1394*) in a previously 1 2 3 2 4 Alexander Y. Konev, Martin Tribus, Sung Yeon Park, Valerie Podhraski, Chin Yan Lim, * described lethal allele, l(2)23Cd[A7-4] (11). 1 1 3 4 Alexander V. Emelyanov, Elena Vershilova, Vincenzo Pirrotta, James T. Kadonaga, Hence, l(2)23Cd[A7-4] was renamed Chd1[3]. 2 1 Alexandra Lusser, † Dmitry V. Fyodorov † Analysis of Western blots of embryos from heterozygous Chd1[3] fruit flies revealed the The organization of chromatin affects all aspects of nuclear DNA metabolism in eukaryotes. H3.3 is an presence of a truncated polypeptide besides full- evolutionarily conserved histone variant and a key substrate for replication-independent chromatin length CHD1 (Fig. 1C). No truncated polypep- assembly. Elimination of chromatin remodeling factor CHD1 in Drosophila embryos abolishes tides were detected in heterozygous Chd1[1] or incorporation of H3.3 into the male pronucleus, renders the paternal genome unable to participate in Chd1[2] embryos. Therefore, the corresponding zygotic mitoses, and leads to the development of haploid embryos. Furthermore, CHD1, but not ISWI, deficiencies result in null mutations of Chd1.
    [Show full text]
  • Synthetic Essentiality of Chromatin Remodelling Factor CHD1 in PTEN
    LETTER doi:10.1038/nature21357 Synthetic essentiality of chromatin remodelling factor CHD1 in PTEN-deficient cancer Di Zhao1, Xin Lu1*, Guocan Wang1*, Zhengdao Lan1, Wenting Liao1, Jun Li2, Xin Liang1, Jasper Robin Chen1, Sagar Shah1, Xiaoying Shang1, Ming Tang2, Pingna Deng1, Prasenjit Dey1, Deepavali Chakravarti1, Peiwen Chen1, Denise J. Spring1, Nora M. Navone4, Patricia Troncoso5, Jianhua Zhang2, Y. Alan Wang1 & Ronald A. DePinho1 Synthetic lethality and collateral lethality are two well-validated identifying functional interactions of components in specific pathways conceptual strategies for identifying therapeutic targets in cancers that show mutually exclusive patterns of genomic alterations. Such with tumour-suppressor gene deletions1–3. Here, we explore an epistatic patterns include components of the retinoblastoma (Rb) or approach to identify potential synthetic-lethal interactions by p53 pathways, in which alterations in one gene in the pathway typ- screening mutually exclusive deletion patterns in cancer genomes. ically alleviates genetic pressure to alter another driver in the same We sought to identify ‘synthetic-essential’ genes: those that are pathway, consistent with minimal additional selective advantage to occasionally deleted in some cancers but are almost always retained the cancer cell9,10. in the context of a specific tumour-suppressor deficiency. We also Using The Cancer Genome Atlas (TCGA) database, we sought to posited that such synthetic-essential genes would be therapeutic establish and validate an approach
    [Show full text]
  • Structure of the Chromatin Remodelling Enzyme Chd1 Bound to A
    RESEARCH ARTICLE Structure of the chromatin remodelling enzyme Chd1 bound to a ubiquitinylated nucleosome Ramasubramanian Sundaramoorthy1, Amanda L Hughes1, Hassane El-Mkami2, David G Norman3, Helder Ferreira4, Tom Owen-Hughes1* 1Centre for Gene Regulation and Expression, School of Life Sciences, University of Dundee, Dundee, United Kingdom; 2School of Physics and Astronomy, University of St Andrews, St Andrews, United Kingdom; 3Nucleic Acids Structure Research Group, University of Dundee, Dundee, United Kingdom; 4School of Biology, University of St Andrews, St Andrews, United Kingdom Abstract ATP-dependent chromatin remodelling proteins represent a diverse family of proteins that share ATPase domains that are adapted to regulate protein–DNA interactions. Here, we present structures of the Saccharomyces cerevisiae Chd1 protein engaged with nucleosomes in the presence of the transition state mimic ADP-beryllium fluoride. The path of DNA strands through the ATPase domains indicates the presence of contacts conserved with single strand translocases and additional contacts with both strands that are unique to Snf2 related proteins. The structure provides connectivity between rearrangement of ATPase lobes to a closed, nucleotide bound state and the sensing of linker DNA. Two turns of linker DNA are prised off the surface of the histone octamer as a result of Chd1 binding, and both the histone H3 tail and ubiquitin conjugated to lysine 120 are re-orientated towards the unravelled DNA. This indicates how changes to nucleosome structure can alter the way in which histone epitopes are presented. DOI: https://doi.org/10.7554/eLife.35720.001 *For correspondence: [email protected] Introduction Competing interests: The The extended family of ATPases related to the yeast Snf2 protein acts to alter DNA-protein interac- authors declare that no tions (Flaus et al., 2006; Narlikar et al., 2013).
    [Show full text]
  • Comparative Genomics Reveals Chd1 As a Determinant of Nucleosome Spacing in Vivo
    INVESTIGATION Comparative Genomics Reveals Chd1 as a Determinant of Nucleosome Spacing in Vivo Amanda L. Hughes and Oliver J. Rando1 Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, Massachusetts 01605 ABSTRACT Packaging of genomic DNA into nucleosomes is nearly universally conserved in eukaryotes, KEYWORDS and many features of the nucleosome landscape are quite conserved. Nonetheless, quantitative aspects of chromatin nucleosome packaging differ between species because, for example, the average length of linker DNA between epigenomics nucleosomes can differ significantly even between closely related species. We recently showed that the difference gene regulation in nucleosome spacing between two Hemiascomycete species—Saccharomyces cerevisiae and Kluyveromyces lactis—is established by trans-acting factors rather than being encoded in cis in the DNA sequence. Here, we generated several S. cerevisiae strains in which endogenous copies of candidate nucleosome spacing factors are deleted and replaced with the orthologous factors from K. lactis.Wefind no change in nucleosome spacing in such strains in which H1 or Isw1 complexes are swapped. In contrast, the K. lactis gene encoding the ATP- dependent remodeler Chd1 was found to direct longer internucleosomal spacing in S. cerevisiae, establishing that this remodeler is partially responsible for the relatively long internucleosomal spacing observed in K. lactis.By analyzing several chimeric proteins, we find that sequence differences that contribute to the spacing activity of this remodeler are dispersed throughout the coding sequence, but that the strongest spacing effect is linked to the understudied N-terminal end of Chd1. Taken together, our data find a role for sequence evolution of a chromatin remodeler in establishing quantitative aspects of the chromatin landscape in a species-specific manner.
    [Show full text]
  • Loss of MAP3K7 Sensitizes Prostate Cancer Cells to CDK1/2 Inhibition and DNA Damage by Disrupting Homologous Recombination Satoshi Washino1, Leah C
    Published OnlineFirst July 12, 2019; DOI: 10.1158/1541-7786.MCR-18-1335 Cancer Genes and Networks Molecular Cancer Research Loss of MAP3K7 Sensitizes Prostate Cancer Cells to CDK1/2 Inhibition and DNA Damage by Disrupting Homologous Recombination Satoshi Washino1, Leah C. Rider1, Lina Romero1, Lauren K. Jillson1, Trisiani Affandi2, Angela M. Ohm2, Elaine T. Lam3, Mary E. Reyland2, James C. Costello1, and Scott D. Cramer1 Abstract The combined loss of CHD1 and MAP3K7 promotes aggres- without loss of Map3k7. Dinaciclib treatment reduced expres- sive prostate cancer by unknown mechanisms. Because both of sion of homologous recombination (HR) repair genes such as these genes are lost genetically in prostate cancer, they cannot ATM, ATR, BRCA2, and RAD51, blocked BRCA1 phosphory- be directly targeted. We applied an established computational lation, reduced RAD51 foci formation, and increased gH2AX systems pharmacology approach (TRAP) to identify altered foci selectively in prostate cells with suppression of Map3k7, signaling pathways and associated druggable targets. We com- thus inhibiting HR repair of chromosomal double-strand pared gene expression profiles of prostate cancer with coloss of breaks. Dinaciclib-induced HR disruption was also observed CHD1 and MAP3K7 with prostate cancer diploid for these in human prostate cells with knockdown of MAP3K7. Cotreat- genes using The Cancer Genome Atlas patient samples. This ment of dinaciclib with DNA-damaging agents or PARP inhib- analysis prioritized druggable target genes that included CDK1 itor resulted in a stronger cytotoxic effect on prostate cells with and CDK2. We validated that inhibitors of these druggable suppression of MAP3K7 compared with those without loss of target genes, including the CDK1/ CDK2 inhibitor dinaciclib, MAP3K7, or to each single agent.
    [Show full text]
  • Structure of the Chromatin Remodelling Enzyme Chd1 Bound to a Ubiquitinylated Nucleosome
    bioRxiv preprint doi: https://doi.org/10.1101/290874; this version posted March 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Structure of the chromatin remodelling enzyme Chd1 bound to a ubiquitinylated nucleosome. Ramasubramanian Sundaramoorthy1, Amanda L. Hughes1, Hassane El- Mkami2, David Norman3 and Tom Owen-Hughes1. 1 Centre for Gene Regulation and Expression, School of Life Sciences, University of Dundee, Dundee, DD1 5EH, UK. 2 School of Physics and Astronomy, University of St Andrews, St Andrews KY16 9SS, UK 3Nucleic Acids Structure Research Group, University of Dundee, Dundee DD1 5EH, UK. 1 bioRxiv preprint doi: https://doi.org/10.1101/290874; this version posted March 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Abstract ATP-dependent chromatin remodelling proteins represent a diverse family of proteins that share ATPase domains that are adapted to regulate protein-DNA interactions. Here we present structures of the yeast Chd1 protein engaged with nucleosomes in the presence of the transition state mimic ADP-beryllium fluoride. The path of DNA strands through the ATPase domains indicates the presence of contacts conserved with single strand translocases and additional contacts with both strands that are unique to Snf2 related proteins.
    [Show full text]