Identification of Farnesoid X Receptor Β As a Novel Mammalian Nuclear Receptor Sensing Lanosterol

Identiﬁcation of Farnesoid X Receptor ␤ as a Novel Mammalian Downloaded from Nuclear Receptor Sensing Lanosterol Kerstin Otte,1* Harald Kranz,1 Ingo Kober,1 Paul Thompson,1 Michael Hoefer,1 Bernhard Haubold,1 Bettina Remmel,1 Hartmut Voss,1 Carmen Kaiser,1 Michael Albers,1 Zaccharias Cheruvallath,1 David Jackson,1 Georg Casari,1 Manfred Koegl,1† Svante Pa¨a¨bo,2 Jan Mous,1 1 1 Claus Kremoser, † and Ulrich Deuschle † http://mcb.asm.org/ LION Bioscience AG, 69120 Heidelberg,1 and Max Planck Institute for Evolutionary Anthropology, 04103 Leipzig,2 Germany

Received 19 September 2002/Returned for modiﬁcation 31 October 2002/Accepted 12 November 2002

Nuclear receptors are ligand-modulated transcription factors. On the basis of the completed human genome sequence, this family was thought to contain 48 functional members. However, by mining human and mouse genomic sequences, we identiﬁed FXR␤ as a novel family member. It is a functional receptor in mice, rats,

rabbits, and dogs but constitutes a pseudogene in humans and primates. Murine FXR␤ is widely coexpressed on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology with FXR in embryonic and adult tissues. It heterodimerizes with RXR␣ and stimulates transcription through specific DNA response elements upon addition of 9-cis-retinoic acid. Finally, we identified lanosterol as a candidate endogenous ligand that induces coactivator recruitment and transcriptional activation by mFXR␤. Lanosterol is an intermediate of cholesterol biosynthesis, which suggests a direct role in the control of cholesterol biosynthesis in nonprimates. The identification of FXR␤ as a novel functional receptor in nonprimate animals sheds new light on the species differences in cholesterol metabolism and has strong implications for the interpretation of genetic and pharmacological studies of FXR-directed physiologies and drug discovery programs.

Cholesterol metabolism is a tightly regulated enzymatic cholesterol metabolism and sensitivity to dietary cholesterol. pathway. Deregulation of this pathway leads to accumulation While rodents respond to cholesterol feeding with induction of of excess cholesterol and can result in diseases such as athero- CYP7A1, humans and rabbits appear to lack this response and sclerosis and gallstone formation (10). The homeostatic bal- are left more sensitive to the cholesterolemic effects of dietary ance between uptake and elimination of cholesterol is accom- cholesterol (13, 35, 36). This difference was directly attributed plished by regulation of three pathways: de novo cholesterol to the ability of LXR to regulate CYP7A in different species (4, synthesis from acetate, uptake of cholesterol from the intes- 24). tine, and elimination of cholesterol through the synthesis of Nuclear hormone receptors form a family of evolutionarily bile acids. conserved sequences, and a standardized nomenclature has Cholesterol catabolism into bile acids is controlled by tran- been proposed (26). Six subfamilies are currently recognized; scriptional feedback and feedforward mechanisms that are me- the nuclear receptors FXR and LXR␣ and -␤ form the sub- diated by members of the nuclear receptor family. Activation group NR1H together with the Drosophila ecdysone receptor of cholesterol breakdown into bile acids is mediated by liver X (EcR), which recognizes the metamorphosis steroid ecdysone ␣ receptor alpha (LXR ; NR1H3), a nuclear receptor that binds as its natural ligand (16). A set of 48 human nuclear hormone oxysterols formed during the synthesis and metabolism of cho- receptors was known well before the human genome was se- lesterol (14, 18, 28). Together with another nuclear receptor, ␣ quenced. In the Drosophila genome, only 21 nuclear hormone liver receptor homologue 1 (NR5A2), LXR stimulates tran- receptors were predicted (1), whereas for Caenorhabditis el- scription of cholesterol 7␣-hydroxylase (CYP7A1), an enzyme egans, more than 270 sequences homologous to the nuclear catalyzing the rate-limiting step of this pathway. Suppression of hormone receptor family were identified (32). Publication of cholesterol degradation into bile acids is triggered by the far- the sequence of the human genome allowed the identification nesoid X receptor (FXR; NR1H4), which binds to and is ac- of all genes homologous to the nuclear receptor family of tivated by bile acids (21, 27, 33). Ligand-bound FXR activates proteins. We and others identified three novel nuclear receptor transcription of the short heterodimer partner (NR0B2) and sequences apart from the 48 known nuclear receptors, all po- subsequently downregulates transcription of CYP7A1 (11, 19). tentially representing pseudogenes in humans (6, 20, 29). However, there are species differences in the regulation of Given the known species-specific difference in cholesterol metabolism, our attention was particularly drawn to a pseudo- * Corresponding author. Mailing address: LION Bioscience AG, Im gene showing strong homology to FXR (NR1H4) that we and Neuenheimer Feld 515, 69120 Heidelberg, Germany. Phone: 49-6221- others designated FXR␤ (NR1H5). Here we demonstrate that 4038228. Fax: 49-6221-4038301. E-mail: [email protected]. ␤ † Present address: Phenex Pharmaceuticals AG, 69120 Heidelberg, FXR is, in contrast to previous perception, a novel functional Germany. member of the NR1H subgroup of nuclear receptors. It con-

864 VOL. 23, 2003 NOVEL MAMMALIAN NUCLEAR RECEPTOR SENSING LANOSTEROL 865

stitutes a functional nuclear hormone receptor in all of the Invitrogen) containing 10% fetal calf serum. Cotransfection was performed in mammalian species investigated except primates and humans, Optimem (Invitrogen) with 50 ng of the appropriate expression vector, 50 ng of ␤ the reporter construct, and 10 ng of a thymidine kinase-Renilla luciferase control where it encodes a nonfunctional protein. In mice, FXR is vector with Lipofectamine (Invitrogen) for 4 h. Cells were then treated with Downloaded from able to activate transcription and its endogenous ligand was ligands and grown in DMEM for 18 h. Ligands and ketoconazole (Sigma) were identified as the cholesterol precursor lanosterol. Since lanos- dissolved in dimethyl sulfoxide (DMSO) and stored at Ϫ20°C. Lanosterol was terol is an intermediate in the cholesterol biosynthetic path- freshly dissolved in ethanol at 35°C. When treated with lanosterol, cells were way, this nuclear receptor may represent an additional level at grown in the presence of 1% DMSO for 2.5 h to permeabilize cell membranes and facilitate uptake (38) and then kept in DMEM for 16 h. After ligand which cholesterol levels are controlled in nonprimate mam- treatment, cells were harvested and luciferase assays were performed with the mals. dual-luciferase reporter assay as described by the manufacturer’s (Promega) manual. Transfection data were normalized to the Renilla control and expressed as mean numbers of relative light units from triplicate assays Ϯ the standard MATERIALS AND METHODS deviations (SDs). http://mcb.asm.org/ ␤ ␣ Bioinformatic analysis. A database of all nuclear receptor protein sequences Coactivator recruitment assay. The mFXR and hLXR LBDs were used in was constructed and used to search the daily human genome updates (GenBank) the Pharmingenes Baculovirus Expression vector system. The hFXR LBD and by employing the BLASTX tool with default parameters (2). Two FXR␤-con- hTif2 were expressed in Escherichia coli. The resulting proteins were GST or His taining bacterial artificial chromosomes (BACs) were identified: GenBanknew affinity purified as recommended by Pharmacia and QIAGEN. His-hTif2 was accession no. AC026039 and EMBLnew accession no. AL390235. biotinylated (Roche). A biotinylated mSCR1 peptide (amino acids 680 through Molecular cloning of FXR␤. The murine FXR␤ (mFXR␤) genome locus was 704) was purchased (SynPep Corp.). Proteins and compounds were mixed with 1 isolated by screening the BAC library Easy-to-Screen DNA Pools BAC Mouse nM europium cryptate–anti-GST antibody and 100 ng of streptavidin-allophy- ES (release II) from Incyte Genomics by using primers 5Ј TGGGGTCCTTTG cocyanin in black 384-well microtiter plates (Nunc Fluotrac200). The reaction ␮ TTTTCCA3Ј and 5ЈGTGAAATGGACATGTACATGCG. FXR␤-containing mixture volume was 25 l. Plates were shaken for 2 min at 800 rpm and incu-

BACs were purchased, and the locus was sequenced by using PCR products bated for 60 min at room temperature. Measurement of fluorescence from both on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology generated with the above-described primers. Flanking regions were sequenced by fluorophores at 665 nm (acceptor signal) and 615 nm (donor signal) occurred in ␮ primer walking. FXR␤ cDNAs from mice and other mammalian species except a time window of 50 to 400 s after excitation on a Victor V HTRF reader. humans were isolated by using adult liver and testis RNAs from the respective Signals were plotted as ratios of light intensity at 665 nm versus light intensity at species and the above-described primers. For amplification of primate FXR␤ 615 nm. For analysis of dose-response curves, ratios were plotted against log sequences, genomic DNAs and RNAs from the respective species were derived concentrations and 50% effective concentrations (EC50s) were calculated by from the collections at the S. Pa¨äbo laboratory. Full-length cDNAs were isolated Prism (GraphPad Software Inc.) by rapid amplification of cDNA ends with a GeneRacer kit (Invitrogen). Human FXR␤ (hFXR␤) cDNAs were isolated by reverse transcription (RT)-PCR of adult human testis RNA (Clontech) with primers 5Ј CCAGACCAACCTATTC RESULTS TTCCTCGAGAAATAAGGGAC 3Ј and 5Ј TGGGGTCCTTTGTTTTCCAAG TGCTAAGTATTTCTG 3Ј in 35 PCR cycles followed by 30 cycles of nested Identification of primate FXR␤ as a pseudogene. In an ef- PCR. fort to identify novel nuclear hormone receptor proteins after Expression analysis. RT-PCR expression analysis of mFXR␤ was performed with primers 5Ј TCATCCAGCACCAGATCTGGGAAAG 3Ј and 5Ј GTCCTT the publication of the human genome sequence, we performed TGTTTTCCACATGCGAAGG 3Ј and that of mFXR was performed with prim- exhaustive database searches with the BLAST algorithm (2). ers 5Ј GGGATGTTGGCTGAATGTTTGTTAACTG3Ј and 5Ј TCACTGCAC As one result, we and others (6, 20, 29) detected a novel ATCCCAGATCTCACAG3Ј in 35 and 28 cycles PCR cycles, respectively, with a member of the NR1H subgroup, termed FXR␤ (NR1H5), on panel of adult (Clontech) and embryonic (Quantum Appligene) RNAs. the basis of its homology to FXR. The novel gene has con- Plasmids. The gateway cloning system (Life Technologies) was used to insert the ligand binding domains (LBDs) of hFXR (amino acids 187 to 472) and served intron positions compared to FXR, which, together with mFXR␤ (amino acids 186 to 505) into pCMV-BD (Stratagene) and that of the sequence conservation, argues in favor for a functional human retinoic X receptor alpha (hRXR␣; amino acids 197 to 461) into nuclear receptor. In addition to previously published results pCMV-AD (Stratagene) to generate mammalian two-hybrid vectors. pCMV- (20), we identified several splice variants of FXR␤ in RNA BD-hFXR and pCMV-BD-mFXR␤ express their respective FXR LBDs as fusion proteins with the Gal4 DNA binding domain (DBD). The hRXR␣ LBD is from human testis (data not shown). However, by sequencing expressed fused with the activation domain (AD) of NF-␬B. As a Gal4-respon- those cDNAs and three independent genome loci, we found sive luciferase reporter, pFR-LUC (Stratagene) was used. Full-length mFXR␤ that hFXR␤ contains two stop codons in exon 11 and three (GenBank accession no. AY094586) was inserted into expression vector frame shifts at exon-intron junctions (Fig. 1A, arrows). The ␬ pCMV-AD containing an NF- B AD (Stratagene) and expression vector extremely low transcript levels determined by nested RT-PCR pcDNA4/TO (Invitrogen). Luciferase reporter plasmids were constructed by inserting synthetic response elements (REs) into the XhoI site of vector pGL2- and the presence of two stop codons and three frame shifts in Promoter (Promega). Oligonucleotides were designed containing two REs sep- the cDNA strongly argue that FXR␤ is a pseudogene in the arated by 10 nucleotides. The REs consist of two consensus half sites with the human lineage. sequence AGGTCA as inverted repeats (IRs), everted repeats (ERs), or direct To assess whether FXR␤ constitutes a functional protein in repeats (DRs) with zero- to eight-nucleotide spacers between the half sites and flanking XhoI sites. other primate species, we performed PCR amplification of The I-BABP RE reporter construct contains two tandem copies of the oligo- genome loci and analysis of the chimpanzee, gorilla, orangu- nucleotide CCCCAGGGTGAATAACCTCGGGGCTCTGTCCCTCCAATCC tan, and rhesus monkey FXR␤ sequences. In all cases, stop CAGGGTGAATAACCTCGGGA from the human I-BABP promoter (12) li- codons and frame shifts were identified at positions similar to gated between the KpnI and BglII sites of pGL2-Promoter (Promega). For the those in the human mRNA and no transcripts could be de- homogeneous time-resolved fluorescence (HTRF) assay, the mFXR␤ LBD (amino acids 186 to 505) and the hLXR␣ LBD (amino acids 155 to 447) were tected by RT-PCR from liver and testis RNA sources (data not fused to glutathione S-transferase (GST), His tagged, and recombined into the shown). Thus, FXR␤ seems to be a nonfunctional gene in pACGHLT polylinker (Pharmingen) with a gateway cassette (Life Technolo- these primate species as well. gies). A GST fusion of the hFXR LBD (amino acids 187 to 476) and a His-tagged FXR␤ codes for a functional receptor in other mammals. NR interaction domain of human Tif2 (hTif2; amino acids 548 to 878) were recombined into pDest15 and pDest17 (Life Technologies). RT-PCR amplification of liver RNA and subsequent sequence Transient transfections. Human embryonic kidney (HEK) 293 cells were analysis of nonprimate mammals, including mice, rats, rabbits, ␤ maintained at 37°Cin5%CO2 in Dulbecco modified Eagle medium (DMEM; and dogs, revealed FXR mRNAs showing continuous open 866 OTTE ET AL. MOL.CELL.BIOL. Downloaded from

FIG. 1. FXR␤ genomic structures and molecular cloning. (A) Schematic representation of FXR␤ genomic structure. mFXR␤ and hFXR␤ loci show similar exon-intron structures. Here the murine locus is displayed, consisting of at least 11 exons spanning 26 kb of

genomic DNA. Striped boxes represent the DBD, gray boxes represent http://mcb.asm.org/ the LBD, the asterisk represents the stop codon, and the ﬂag represents the start codon. The 5Ј untranslated region is encoded by exon 1, while exon 11 encodes the 3Ј untranslated region (black boxes). Hu- man stop codons and frame shifts are indicated by vertical arrows. Untranslated regions are not completely sequenced for the human locus. (B) Sequence of mFXR␤. Shown are cDNA and protein sequences of mFXR␤ (GenBank accession no. AY094586). Start and stop codons are bold, and the poly(A) signal is underlined.

indicating that these two genes are, in fact, FXR␤ orthologs. on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology We identified in silico two different ORFs from the draft sequence of the pufferfish (Fugu rubripes) genome that show similarity to the FXR genes. Fugu rupies FXR1 is included with good confidence in the FXR lineage. FXR2 is building a separate deep branch at the root of the tree and appears to be ancestral to the duplication that led to the clusters of FXR and FXR␤. Mutation rates are higher for FXR␤ than for FXR, as represented by respective branch lengths on the phylogenetic tree (Fig. 2). Ubiquitous tissue expression of mFXR␤. To investigate the potential function of the novel receptor, we analyzed mFXR␤ transcripts in embryonic and adult tissues. Five splice variants of mFXR␤ were isolated by RT-PCR from adult liver and testis RNA. Isoforms differentially splice out parts of exon 3, 8, or 10 and thereby differ in the regions encoding the DBD and the LBD (Fig. 3A). mFXR␤ is ubiquitously and strongly expressed during embryonic development, and its expression pat- tern largely overlaps that of FXR (Fig. 3B). This mRNA distribution suggests a function of mFXR␤ during embryonic development. In the adult, however, mFXR␤ expression is more tissue specific and restricted mainly to the liver, reproductive tissues, and heart. Coexpression with FXR is observed in the liver and intestine, main tissues of FXR expression and function, but not in the kidney (8). The IR1 and ER2 REs are recognized by mFXR␤. Nuclear receptors bind specifically to repeats of single DNA hexamers called REs (23). They bind either as monomers, homodimers, or heterodimers with RXR. As heterodimers, they bind to REs reading frames (ORFs). These mRNAs therefore potentially consisting of a repeated core motif that can be an IR, a DR, or encode functional nuclear receptor proteins. RT-PCR and an ER. To determine the DNA binding properties of mFXR␤, ␤ rapid amplification of cDNA ends of mFXR verified 10 cod- we fused mFXR␤ to a constitutively active NF-␬BADand ing exons translating into a protein of 505 amino acids (Fig. 1A screened against a panel of luciferase reporter constructs con- Ј and B). The 5 untranslated region is encoded by exon 1, while taining synthetic consensus IR, DR, and ER elements in tran- exon 11 encodes the 3Ј untranslated region and is flanked by a sient cotransfection assays. Transactivation of the luciferase poly(A) signal. reporter gene was observed with the synthetic IR1 and ER2 All isolated FXR␤ sequences form a robust phylogenetic elements, as well as the FXR RE from the I-BABP promoter, group well separated from the FXR cluster (Fig. 2). The FXR which is itself an IR1 element (12) (Fig. 4A). The specific orthologs recently isolated from Xenopus laevis, FOR1 and -2 interaction with typical FXR REs suggests that at least part of (31), are included with high confidence in the FXR␤ branch, the FXR target genes may also be regulated by FXR␤. VOL. 23, 2003 NOVEL MAMMALIAN NUCLEAR RECEPTOR SENSING LANOSTEROL 867

mFXR␤ heterodimerizes with RXR␣. Since nuclear receptors are known to interact with their REs as either homodimers ␤ or RXR heterodimers (23), we examined the ability of mFXR Downloaded from to interact with RXR in response to its ligand, 9-cis-retinoic acid (9-cis-RA). For a mammalian two-hybrid assay, the LBDs of mFXR␤ and hFXR were fused to the Gal4 DBD while hRXR␣ was fused to an NF-␬B AD and cotransfected in HEK 293 cells with a luciferase reporter construct. Compared to the control, we observed the expected constitutive interaction between the hFXR and hRXR␣ LBDs (Fig. 4B). Addition of

9-cis-RA further enhanced this interaction. Compared to http://mcb.asm.org/ hFXR, mFXR␤ exhibited a signiﬁcantly stronger constitutive FIG. 2. Phylogenetic tree containing FXR and FXR␤ genes from interaction with RXR␣ that was also potentiated by 9-cis-RA. different species. The phylogenetic tree was calculated on the basis of These data indicate a constitutive mFXR␤-RXR␣ interaction protein alignments by using PHYLIP (phylogeny interference package, and a responsiveness of the complex formed to the RXR ligand 1993; distributed by J. Felsenstein, University of Washington, Seattle, Wash.) on the basis of the following sequences (accession numbers): 9-cis-RA. chicken FXR (AF492497), hFXR (U68233), rat FXR (U18374), Lanosterol promotes coactivator recruitment by mFXR␤. mFXR (NM009108), Fugu FXR1 (S001361), mFXR␤ (AY094586), FXR, LXR␣, and LXR␤ are activated by bile acids (21, 27, 33) frog FOR2 (AF456452), frog FOR1 (AF4564519), Fugu FXR2

and oxysterols (14, 18), respectively, all of which are interme- on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology (S000248), and drosophila EcR (M74078). Numbers indicate the boot- strap support (out of 1,000) for the respective nodes. Asterisks indicate diates of the cholesterol metabolic pathway. Since these recep- putatively nonfunctional proteins in primates. tors are evolutionarily related to FXR␤, we tested compounds

FIG. 3. Transcription of mFXR␤. (A) Splice variants of mFXR␤. Five splice variants were isolated and sequenced (GenBank accession no. AY094586 through AY094590). Striped boxes indicate exons encoding the DBD, and gray boxes indicate exons encoding the LBD. Numbers indicate exons. Shown are only coding regions. (B) Tissue distribution of mFXRs. mFXR and mFXR␤ transcripts were determined by RT-PCR ampliﬁcation of nonhomologous sequences derived from the LBDs of the respective receptors. ␤-Actin served as an internal control. RNAs from indicated embryonic and adult tissues were used as templates. Lane M, DNA size marker. d, day. 868 OTTE ET AL. MOL.CELL.BIOL. Downloaded from http://mcb.asm.org/ on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology

FIG. 4. mFXR␤ binds selectively to nuclear REs and forms heterodimers with RXR␣. (A) DNA REs recognized by mFXR␤. HEK 293 cells were cotransfected with expression plasmids containing mFXR␤ fused to an NF-␬B AD (black bars) or an empty vector (white bars) and the indicated plasmid from a panel of luciferase reporter constructs containing synthetic IR, ER, or DR REs with different spacers between the half sites (zero to eight nucleotides). Luciferase activities are means of triplicate experiments, and the SDs are indicated. (B) Interaction of mFXR␤ with RXR␣ is enhanced by 9-cis-RA. HEK 293 cells were cotransfected with the reporter vector pFR-Luc and RXR␣ fused to an NF-␬BAD (pCMV-AD-hRXR␣) in combination with either pCMV-BD (white bars), FXR fused to the Gal4 DBD (pCMV-BD-hFXR; gray bars) or an mFXR␤ fusion with the Gal4 DBD (pCMV-BD-mFXR␤; black bars). Cells were treated with 1 ␮M9-cis-RA (ϩ) or an equivalent volume of DMSO (Ϫ). Cells from triplicate experiments were assayed for luciferase activity, and means Ϯ SDs are shown. RLU, relative light units. that are related to the respective ligands of these homologs for nist ligand that induces coactivator recruitment by mFXR␤. binding to mFXR␤. This set of around 100 compounds in- The FXR-specific compound GW4064 (22) has very poor af- cludes cholesterol metabolites, steroid hormones, and other finity for mFXR␤ (Fig. 5B), suggesting different ligand speci- bile acid metabolites. We employed an HTRF ligand-sensing ficities for both receptors. Furthermore, lanosterol displays a assay to measure the interaction between the mFXR␤ LBD remarkable specificity for mFXR␤ as it binds neither to the and a short peptide derived from the coactivator mSRC-1 closest relative of mFXR␤, FXR (Fig. 5B), nor to the more induced by a ligand. Interestingly, lanosterol, an intermediate distant relative LXR␣ (data not shown). In addition, mFXR␤ of the de novo cholesterol biosynthetic pathway, showed the shows somewhat promiscuous ligand binding as it binds a quite greatest affinity in the ligand-sensing assay. Lanosterol induces diverse spectrum of chemical structures with lower affinity interaction between mSRC-1 and the mFXR␤ LBD with an (Fig. 5C). Again, these compounds do not bind to FXR (data ϳ ␮ EC50 of 1 M (Fig. 5A). Similar affinities are reported for not shown). Finally it is important to note that various bile the physiological ligands of other lipid receptors (14, 18, 34). acids that, in part, can serve as endogenous ligands for FXR Thus, lanosterol is a likely candidate for an endogenous ago- have no significant affinity for mFXR␤ (Fig. 5D). This again VOL. 23, 2003 NOVEL MAMMALIAN NUCLEAR RECEPTOR SENSING LANOSTEROL 869 indicates that there is no overlap between FXR and FXR␤ in existence of an FXR␤-type gene already in the common an- terms of specificity for natural ligands cestors of amphibians and mammals. We identified in silico ␤

Lanosterol activates mFXR as an agonist ligand. Finally, two different ORFs from the pufferfish (F. rubripes) genome, Downloaded from we sought to investigate the transcriptional activities of one of which is included in the FXR lineage while the other is mFXR␤ on the I-BABP RE-containing reporter gene con- building a separate deep branch at the root of the tree. Since struct in a cellular context and the modulation of these activ- no sequence with similarity to FXR␤ could be detected in the ities by 9-cis-RA and lanosterol. Lanosterol is an intermediate pufferfish genome, the phylogenetic data indicate an origin of of the cholesterol biosynthetic pathway (Fig. 6A). It is a pre- the FXR␤ gene as part of the postulated second wave of gene cursor of the meiosis-activating sterols FF-MAS and T-MAS, duplications during tetrapod (land-living vertebrate) evolution which are synthesized from lanosterol by the cytochrome P-450 that probably led to the diversification of receptors (7). FXR␤ enzyme CYP51 (30). In transient transfection assays, we co- later lost its function as a secondary event. However, it is http://mcb.asm.org/ transfected a full-length mFXR␤ expression plasmid with the unknown when during the evolution of primates the gene lost I-BABP reporter construct. mFXR␤ expression results in con- its function, since our analysis focused on great apes (gorillas, stitutive activation of reporter gene activity compared to the chimpanzees, and orangutans) and just one Old World monkey vector control (Fig. 6B). Addition of 9-cis-RA results in a (rhesus monkey) was added. Further analyses of other dose-dependent increase in luciferase activity only in the pres- branches of the primate lineage are necessary to solve this ence of mFXR␤. This supports the notion that mFXR␤ can issue. To our knowledge, FXR␤ represents the first member of exert its transcriptional activity as a heterodimer with RXR␣. the nuclear hormone receptor family constituting a functional Furthermore, treatment of cells with 5 ␮M lanosterol signifi- receptor protein in several mammalian species but a pseudo- cantly stimulated reporter gene expression (Fig. 6C). This ac- gene in the primate lineage. It is therefore possible that other on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology tivation was potentiated by the simultaneous addition of 9-cis- identified human pseudogenes in this family have functional RA. These data strongly suggest that mFXR␤ is, indeed, a counterparts in primate or nonprimate species as well. functional hormone receptor, with lanosterol as its physiolog- FXR␤ was identified through its sequence similarity to FXR ical agonist ligand. and was shown in our phylogenetic analysis to code for an However, as lanosterol is a highly water-insoluble compound independent nuclear receptor protein. However, when exam- and may only be able to enter cells to a small extent during the ining transcript levels in mouse tissues, we observed significant transfection assay, we sought to independently confirm the coexpression of FXR and FXR␤. Both receptors are ubiqui- observed lanosterol effect. Inhibition of CYP51, the enzyme tously expressed in embryos, which argues for a role of both that demethylates lanosterol as the first step in the conversion receptors during embryonic development. In addition, they are to cholesterol, by ketoconazole (25, 37; Fig. 6A) should lead to coexpressed in a subset of tissues in adult organisms. FXR has accumulation of lanosterol within the cell. We therefore co- been shown to be involved in the regulation of cholesterol-bile transfected HEK 293 cells with the full-length mFXR␤ expres- acid metabolism and in the regulation of bile acid transporters sion vector and the I-BABP reporter construct and treated the in the intestine, which is accompanied by high expression levels cells with ketoconazole. We indeed observed transcriptional in tissues such as those of the liver, kidneys, and intestine (8). activation by mFXR␤ above the basal level (Fig. 6C). This Coexpression with mFXR␤ in the liver and intestine but not in effect could be potentiated by the addition of lanosterol and the kidneys may indicate at least partly overlapping functions. 9-cis-RA to the medium. Together, these results provide con- The expression of mFXR␤ in tissues such as the testis and vincing evidence that lanosterol acts as an agonist ligand for ovary suggests additional roles in reproductive functions. mFXR␤ both in vitro and in vivo. Like most nonsteroidal receptors, such as LXR and FXR, mFXR␤ binds specific DNA elements as a heterodimer with ␣ DISCUSSION RXR , the 9-cis-RA receptor. Furthermore, we show that mFXR␤ can function through consensus IR1 and ER2 REs Nuclear hormone receptors are ligand-modulated transcrip- and is active as well on an FXR RE originating from the tion factors that mediate the transcriptional effects of endog- I-BABP promoter (12). Most published FXR target genes con- enous ligands such as steroid, thyroid, and retinoid hormones tain one or more IR1-type elements in the proximal promoter (9). The importance of nuclear receptors as targets for the or distal enhancers that function as an FXR RE and are re- development of medicines raised strong interest in the identi- quired for transcriptional activation (3, 11, 12, 17, 19, 21). Our fication of novel functional nuclear receptors in the human finding that mFXR␤ recognizes consensus, as well as natural, genome. Bioinformatic approaches did not identify novel func- IR1 elements strongly suggests the existence of common target tional receptors in the human genome in addition to the 48 genes for both FXR and FXR␤. Moreover, FXR␤ activates previously known nuclear receptors. Only three additional transcription through ER2 but not ER8 elements, derivatives pseudogenes were identified, including an FXR homologue of which were recently described as targets for FXR (15). This designated FXR␤ (6, 20, 29). finding, on the other hand, indicates possible differences in We demonstrate in our report that in other mammalian target genes between the two receptors. species like mice, rats, rabbits, and dogs, the gene for FXR␤ Our results show that mFXR␤ is a nuclear hormone recep- has the capacity to code for a functional nuclear receptor tor that is activated by lanosterol, an intermediate in the cho- protein. In a phylogenetic analysis, all isolated FXR␤ se- lesterol biosynthetic pathway. Importantly, mFXR␤ is not ac- quences form a phylogenetic group well separated from the tivated by bile acids, the endogenous ligands for its closest FXR cluster. Since the FXR homologs from X. laevis, FOR1 homolog, FXR. The ligand-bound nuclear receptors FXR and and -2 (31), are, in fact, FXR␤ orthologs, our data indicate the LXR are known to modulate cholesterol breakdown through 870 OTTE ET AL. MOL.CELL.BIOL. Downloaded from http://mcb.asm.org/ on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology

FIG. 5. Identification of ligands for mFXR␤. (A) Lanosterol selectively induces SRC1 binding to mFXR␤ at physiological concentrations. GST-mFXR␤ LBD and biotinylated mSRC1 peptide were mixed, and the effect of lanosterol and the FXR agonist GW4064 on the interaction ␮ was determined by HTRF assay. Cofactor interaction is induced by lanosterol with an EC50 of 1 M, whereas GW4064 only acts as a weak agonist. Signals are plotted as means of triplicates, and error bars indicate SDs. (B) GST-hFXR LBD was mixed with biotinylated, His-tagged hTif2, and the effects of lanosterol and GW4064 on the respective interaction were assayed. The FXR agonist GW4064 induces cofactor interaction with an ␤ EC50 of 70 nM, whereas lanosterol does not show any effect. (C) A diverse set of compounds induces cofactor interaction with mFXR but not FXR. Shown are EC50s and the relative efficacy of SRC1 recruitment (the efficacy of lanosterol was set to 100%) calculated from dose-response experiments for a selected group of compounds found to be active for FXR␤. (D) Cholates and cholic acids do not induce significant SRC1 binding to mFXR␤, whereas lanosterol does induce SRC1 recruitment. GST-mFXR␤ LBD and biotinylated mSRC1 peptide were mixed. The effects of various compounds at a concentration of 40 ␮M on the interaction was determined by HTRF assay. Ratios of signals versus DMSO controls are plotted as means of triplicates, and SDs are indicated. CDCA, chenodeoxycholic acid; DCA, deoxycholic acid; UDCA, ursodeoxycholic acid; CA, cholic acid.

regulation of CYP7A1, the rate-limiting enzyme of this path- with little change in plasma cholesterol concentrations, hu- way. However, there are observed differences between species mans do experience alterations in plasma cholesterol levels in the regulation of cholesterol homeostasis. While rodents when sterol balances change (5). These observed differences seem to be able to adapt to large ﬂuctuations in sterol input have so far been explained by a rapid catabolism in rodents VOL. 23, 2003 NOVEL MAMMALIAN NUCLEAR RECEPTOR SENSING LANOSTEROL 871

biosynthesis in rodents that is absent in primates and in this way contribute to the observed species-speciﬁc differences.

Finally, our understanding of cholesterol metabolic path- Downloaded from ways in humans, which in part is deduced from pharmacological studies and compound testing in nonprimate mammals, may have to be revisited because of our ﬁnding of a novel and additional nuclear receptor, FXR␤, that is a pseudogene in primates.

ACKNOWLEDGMENTS

We thank R. Bu¨rgermeister, M. Post, K. Fedel, K. Matena, I. http://mcb.asm.org/ Balogh, V. Fichter, and S. Ellwanger for excellent technical assistance and S. Heck and R. Lo¨bbert for critical suggestions.

REFERENCES 1. Adams, M. D., et al. 2000. The genome sequence of Drosophila melano- gaster. Science 287:2185–2195. 2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 2:3389–3402. 3. Ananthanarayanan, M., N. Balasubramanian, M. Makishima, D. J. Man- gelsdorf, and F. J. Suchy. 2001. Human bile salt export pump promoter is on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology transactivated by the farnesoid X receptor/bile acid receptor. J. Biol. Chem. 276:28857–28865. 4. Chiang, J. Y., R. Kimmel, and D. Stroup. 2001. Regulation of cholesterol 7␣-hydroxylase gene (CYP7A1) transcription by the liver orphan receptor (LXR␣). Gene 262:257–265. 5. Dietschy, J. M., S. D. Turley, and D. K. Spady. 1993. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J. Lipid Res. 34:637–659. Review. 6. Enmark, E., and J. A. Gustafsson. 2001. Comparing nuclear receptors in worms, flies and humans. Trends Pharmacol. Sci 22:611–615. 7. Escriva, H., R. Safi, C. Hanni, M. C. Langlois, P. Saumitou-Laprade, D. Stehelin, A. Capron, R. Pierce, and V. Laudet. 1997. Ligand binding was acquired during evolution of nuclear receptors. Proc. Natl. Acad. Sci. USA 94:6803–6808. 8. Forman, B. M., E. Goode, J. Chen, A. E. Oro, D. J. Bradley, T. Perlmann, D. J. Noonan, L. T. Burka, T. McMorris, W. W. Lamph, et al. 1995. Iden- tification of a nuclear receptor that is activated by farnesol metabolites. Cell 81:687–693. 9. Giguere, V. 1999. Orphan nuclear receptors: from gene to function. Endocr. Rev. 20:689–725. 10. Goldstein, J. L., and M. S. Brown. 1990. Regulation of the mevalonate pathway. Nature 343:425–430. 11. Goodwin, B., S. A. Jones, R. R. Price, M. A. Watson, D. D. McKee, L. B. Moore, C. Galardi, J. G. Wilson, M. C. Lewis, M. E. Roth, P. R. Maloney, FIG. 6. Lanosterol activates mFXR␤. (A) Lanosterol is an inter- T. M. Willson, and S. A. Kliewer. 2000. A regulatory cascade of the nuclear mediate of the cholesterol metabolism pathway. Cholesterol is synthe- receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol. sized from acetyl coenzyme A (acetyl-CoA) via lanosterol and catab- Cell 6:517–526. olized into bile acids and steroids. Ketoconazole inhibits CYP51, the 12. Grober, J., I. Zaghini, H. Fujii, S. A. Jones, S. A. Kliewer, T. M. Willson, T. enzyme catalyzing the demethylation of lanosterol. (B) mFXR␤ is Ono, and P. Besnard. 1999. Identification of a bile acid-responsive element in the human ileal bile acid-binding protein gene. Involvement of the farne- activated by 9-cis-RA. HEK 293 cells were cotransfected with an ␤ soid X receptor/9-cis-retinoic acid receptor heterodimer. J. Biol. Chem. mFXR full-length expression vector (black bars) or an empty vector 274:29749–29754. (white bars) and the I-BABP RE luc reporter. Cells were treated with 13. Horton, J. D., J. A. Cuthbert, and D. K. Spady. 1995. Regulation of hepatic the indicated micromolar concentrations of 9-cis-RA. Mean luciferase 7␣-hydroxylase expression and response to dietary cholesterol in the rat and activities and SDs determined from triplicate experiments are shown. hamster. J. Biol. Chem. 270:5381–5387. (C) mFXR␤ is activated by lanosterol. HEK 293 cells were cotrans- 14. Janowski, B. A., P. J. Willy, T. R. Devi, J. R. Falck, and D. J. Mangelsdorf. ␤ 1996. An oxysterol signalling pathway mediated by the nuclear receptor fected with an mFXR full-length expression vector (black bars) or an ␣ empty vector (white bars) and the I-BABP RE luc reporter and treated LXR . Nature 383:728–731. 15. Kast, H. R., B. Goodwin, P. T. Tarr, S. A. Jones, A. M. Anisfeld, C. M. Stoltz, with the indicated micromolar concentrations of lanosterol, 9-cis-RA, P. Tontonoz, S. Kliewer, T. M. Willson, and P. A. Edwards. 2002. Regulation and ketoconazole. Mean luciferase activities and SDs determined from of multidrug resistance-associated protein 2 (ABCC2) by the nuclear recep- triplicate experiments are shown. RLU, relative light units. tors pregnane X receptor, farnesoid X-activated receptor, and constitutive androstane receptor. J. Biol. Chem. 277:2908–2915. 16. Koelle, M. R., W. S. Talbot, W. A. Segraves, M. T. Bender, P. Cherbas, and D. S. Hogness. 1991. The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily. Cell 67:59–77. caused by high CYP7A1 activity, which is balanced by a high 17. Laffitte, B. A., H. R. Kast, C. M. Nguyen, A. M. Zavacki, D. D. Moore, and rate of endogenous cholesterol synthesis. In humans, lower P. A. Edwards. 2000. Identification of the DNA binding specificity and potential target genes for the farnesoid X-activated receptor. J. Biol. Chem. enzyme levels, together with a lack of inducibility of CYP7A1 275:10638–10647. by dietary input of cholesterol, seem to lead to a greater sus- 18. Lehmann, J. M., S. A. Kliewer, L. B. Moore, T. A. Smith-Oliver, B. B. Oliver, ceptibility to high levels of cholesterol intake. As FXR␤ is J. L. Su, S. S. Sundseth, D. A. Winegar, D. E. Blanchard, T. A. Spencer, and T. M. Willson. 1997. Activation of the nuclear receptor LXR by oxysterols absent in humans but serves as a nuclear receptor in rodents, defines a new hormone response pathway. J. Biol. Chem. 272:3137–3140. it may add an additional layer of regulation to cholesterol 19. Lu, T. T., M. Makishima, J. J. Repa, K. Schoonjans, T. A. Kerr, J. Auwerx, 872 OTTE ET AL. MOL.CELL.BIOL.

and D. J. Mangelsdorf. 2000. Molecular basis for feedback regulation of bile Hammer, and D. J. Mangelsdorf. 1998. Cholesterol and bile acid metabolism acid synthesis by nuclear receptors. Mol. Cell 6:507–515. are impaired in mice lacking the nuclear oxysterol receptor LXR␣. Cell 20. Maglich, J. M., A. Sluder, X. Guan, Y. Shi, D. D. McKee, K. Carrick, K. 93:693–704.

Kamdar, T. M. Willson, and J. T. Moore. 2001. Comparison of complete 29. Robinson-Rechavi, M., A. S. Carpentier, M. Duffraisse, and V. Laudet. 2001. Downloaded from nuclear receptor sets from the human, Caenorhabditis elegans and Drosoph- How many nuclear hormone receptors are there in the human genome? ila genomes. Genome Biol. 2:RESEARCH0029. [Online.] http://www Trends Genet. 17:554–556. .genomebiology.com/ 30. Rozman, D., M. Cotman, and R. Frangez. 2002. Lanosterol 14␣-demethylase 21. Makishima, M., A. Y. Okamoto, J. J. Repa, H. Tu, R. M. Learned, A. Luk, and MAS sterols in mammalian gametogenesis. Mol. Cell. Endocrinol. 187: M. V. Hull, K. D. Lustig, D. J. Mangelsdorf, and B. Shan. 1999. Identifica- 179–187. tion of a nuclear receptor for bile acids. Science 284:1362–1365. 31. Seo, Y. W., S. Sanyal, H. J. Kim, D. H. Won, J. Y. An, T. Amano, A. M. 22. Maloney, P. R., D. J. Parks, C. D. Haffner, A. M. Fivush, G. Chandra, K. D. Zavacki, H. B. Kwon, Y. B. Shi, W. S. Kim, H. Kang, D. D. Moore, and H. S. Plunket, K. L. Creech, L. B. Moore, J. G. Wilson, M. C. Lewis, S. A. Jones, Choi. 2002. FOR, a novel orphan nuclear receptor related to FXR. J. Biol. and T. M. Willson. 2000. Identification of a chemical tool for the orphan Chem. 277:17836–17844. nuclear receptor FXR. J. Med. Chem. 43:2971–2974. 32. Sluder, A. E., and C. V. Maina. 2001. Nuclear receptors in nematodes: Mangelsdorf, D. J., C. Thummel, M. Beato, P. Herrlich, G. Schutz, K. 17: 23. themes and variations. Trends Genet. 206–213. http://mcb.asm.org/ Umesono, B. Blumberg, P. Kastner, M. Mark, P. Chambon, et al. 1995. The 33. Wang, H., J. Chen, K. Hollister, L. C. Sowers, and B. M. Forman. 1999. nuclear receptor superfamily: the second decade. Cell 83:835–839. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol. 24. Menke, J. G., K. L. Macnaul, N. S. Hayes, J. Baffic, Y. S. Chao, A. Elbrecht, Cell 3:543–553. L. J. Kelly, M. H. Lam, A. Schmidt, S. Sahoo, J. Wang, S. D. Wright, P. Xin, 34. Willson, T. M., P. J. Brown, D. D. Sternbach, and B. R. Henke. 2000. The G. Zhou, D. E. Moller, and C. P. Sparrow. 2002. A novel liver X receptor PPARs: from orphan receptors to drug discovery. J. Med. Chem. 43:527– agonist establishes species differences in the regulation of cholesterol 7␣- 550. hydroxylase (CYP7a). Endocrinology 143:2548–2558. 35. Quintao, E., S. M. Grundy, and E. H. Ahrens, Jr. 1971. Effects of dietary 25. Nitahara, Y., K. Kishimoto, Y. Yabusaki, O. Gotoh, Y. Yoshida, T. Horiuchi, cholesterol on the regulation of total body cholesterol in man. J. Lipid Res. and Y. Aoyama. 2001. The amino acid residues affecting the activity and 12:233–247. azole susceptibility of rat CYP51 (sterol 14-demethylase P450). J. Biochem. 36. Xu, G., G. Salen, S. Shefer, G. S. Tint, L. B. Nguyen, T. T. Parker, T. S. Chen, 129:761–768. J. Roberts, X. Kong, and D. Greenblatt. 1998. Regulation of classic and

26. Nuclear Receptors Nomenclature Committee. 1999. A uniﬁed nomenclature alternative bile acid synthesis in hypercholesterolemic rabbits: effects of on March 22, 2016 by MAY PLANCK INSTITUTE FOR Evolutionary Anthropology system for the nuclear receptor superfamily. Cell 97:161–163. cholesterol feeding and bile acid depletion. J. Lipid Res. 39:1608–1615. 27. Parks, D. J., S. G. Blanchard, R. K. Bledsoe, G. Chandra, T. G. Consler, S. A. 37. Yoshida, Y., and Y. Aoyama. 1987. Interaction of azole antifungal agents with Kliewer, J. B. Stimmel, T. M. Willson, A. M. Zavacki, D. D. Moore, and J. M. cytochrome P-450 14DM puriﬁed from Saccharomyces cerevisiae micro- Lehmann. 1999. Bile acids: natural ligands for an orphan nuclear receptor. somes. Biochem. Pharmacol. 36:229–235. Science 284:1365–1368. 38. Yu, Z. W., and P. J. Quinn. 1998. The modulation of membrane structure 28. Peet, D. J., S. D. Turley, W. Ma, B. A. Janowski, J. M. Lobaccaro, R. E. and stability by dimethyl sulphoxide. Mol. Membr. Biol. 15:159–168.