PDX1 and ISL1 Differentially Coordinate with Epigenetic Modifications to Regulate Insulin Gene Expression in Varied Glucose Concentrations

Accepted Manuscript

PDX1 and ISL1 differentially coordinate with epigenetic modifications to regulate insulin gene expression in varied glucose concentrations

Weiping Wang, Qiong Shi, Ting Guo, Zhe Yang, Zhuqing Jia, Ping Chen, Chunyan Zhou

PII: S0303-7207(16)30067-3 DOI: 10.1016/j.mce.2016.03.019 Reference: MCE 9454

To appear in: Molecular and Cellular Endocrinology

Received Date: 1 November 2015 Revised Date: 26 February 2016 Accepted Date: 15 March 2016

Please cite this article as: Wang, W., Shi, Q., Guo, T., Yang, Z., Jia, Z., Chen, P., Zhou, C., PDX1 and ISL1 differentially coordinate with epigenetic modifications to regulate insulin gene expression in varied glucose concentrations, Molecular and Cellular Endocrinology (2016), doi: 10.1016/j.mce.2016.03.019.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

Regular paper

PDX1 and ISL1 differentially coordinate with epigenetic modifications to regulate insulin gene expression in varied glucose concentrations

Weiping Wang, Qiong Shi, Ting Guo, Zhe Yang, Zhuqing Jia, Ping Chen, Chunyan Zhou*

Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences; Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function; Key Laboratory of Molecular Cardiovascular Sciences, Ministry of Education of China; Peking University, 38 Xue Yuan Road, Beijing 100191, China

*Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, MANUSCRIPTPeking University, 38 Xue Yuan Road, Beijing 100191, China, Phone: 86-10-82802417. Fax: 86-10-62015582. E-mail: [email protected]

ACCEPTED

ACCEPTED MANUSCRIPT ABSTRACT The mechanism of insulin gene transcription control in response to glucose concentration is poorly defined. The islet-restricted transcription factors PDX1 and ISL1 interact with BETA2, activating insulin gene expression. However, their contribution and hierarchical organization in insulin expression control based on glucose concentration remain unknown. We investigated PDX1 and ISL1 regulation of insulin gene expression in pancreatic β cells cultured in normal (5 mM/L) and high (25 mM/L) glucose conditions. ISL1 interacted with BETA2 to maintain basic insulin gene transcriptional activity under normal glucose. The ISL1-recruited cofactors SET9 and JMJD3 facilitated insulin gene histone modifications under normal glucose. In high-glucose concentrations, PDX1 formed a complex with BETA2 to enhance insulin gene expression. PDX1 also recruited SET9 and JMJD3 to promote the activation of histone modulation on the insulin promoter. This is the first evidence transcription factors orchestrate epigenetic modifications to control insulin gene expression based on glucose concentration. MANUSCRIPT Keywords: Insulin, PDX1, ISL1, Glucose, SET9, JMJD3

ACCEPTED

ACCEPTED MANUSCRIPT

1. Introduction

Insulin is one of the critical hormones for regulating blood glucose levels and is produced exclusively by pancreatic β cells. The insulin ( INS ) gene was first cloned and sequenced in 1980, opening up a new field of research on the mechanisms controlling its expression (Bell, Pictet, Rutter et al., 1980). To date, more than 40 regulatory transcription factors of insulin gene expression have been identified (Melloul, Marshak and Cerasi, 2002,Hay and Docherty, 2006). However, the circumstances under which these factors play their roles in regulating insulin gene transcription remain unclear. The islet-restricted transcription factors PDX1 (pancreatic and duodenal homeobox 1), ISL1 (insulin gene enhancer binding protein, islet factor 1), and BETA2 (beta cell E-box transcription factor 2) bind to the A3/A4 and E2 boxes located between 0 and -410 bp upstream of the transcription start site in the rat insulin I promoter (RIP1) (Le Lay and Stein, 2006,Karlsson, Thor, Norberg et al., 1990,Ohlsson, Karlsson and Edlund, 1993). MANUSCRIPT This cis -acting regulatory sequence is essential for glucose regulation of insulin gene expression (Melloul, Ben-Neriah and Cerasi, 1993); glucose is the central regulator of β cell function and insulin gene expression (Nielsen, Welsh, Casadaban et al., 1985,Evans-Molina, Garmey, Ketchum et al., 2007). PDX1, a master regulator of insulin gene transcription, has been implicated in glucose regulation of insulin gene transcription. PDX1 interacts with histone acetyltransferase p300 to hyperacetylate histone H4 on the insulin gene promoter in response to high glucose concentrations (Mosley, Corbett and Ozcan, 2004). In addition to PDX1, ISL1, a LIM homeodomain protein, also binds to the A3/4 box ofACCEPTED the insulin promoter. As a key transcription factor, ISL1 is not only involved in insulin gene regulation (Peng, Wang, Meng et al., 2005,Zhang, Wang, Guo et al., 2009), but also in cell fate specification and embryonic development (Thor, Ericson, Brannstrom et al., 1991,Wilfinger, Arkhipova and Meyer, 2013). However, whether ISL1 is involved in glucose regulation of insulin gene expression remains unclear.

ACCEPTED MANUSCRIPT

Intriguingly, previous research has revealed that both PDX1 and ISL1 interact with BETA2, a bHLH transcription factor that binds to the E2 box of the insulin promoter, to activate insulin gene expression (Zhang et al., 2009,Ohneda, Mirmira, Wang et al., 2000). However, no light has been shed on the detailed mechanism underlying how PDX1 and ISL1 influence insulin gene expression under different physical conditions, such as blood glucose levels. Whether the activation of insulin gene expression involves the occurrence of a similar or differing activation effect, or even a competitive effect, remains to be elucidated. In the present study, we explored the molecular mechanism underlying the function of PDX1 and ISL1 in regulating insulin gene expression in response to environmental glucose stimuli. Recent studies have reported increasingly complicated modes of insulin gene regulation in pancreatic islet β cells, which not only involve traditional transcription regulation such as protein–protein and protein–DNA interactions, but also epigenetic modification (Moon, Han, Kim et al., 2014,Qiu, Guo, Huang et al., 2002,Ramalingam, Lu, Hudmon et al., 2014). Gain of histone H3 trimethylated at lysine 4 (H3K4me3) and loss of H3K27me3 on the gene promotersMANUSCRIPT are essential for inducing heterochromatin to euchromatin formation and gene transcription activity (Del Rizzo and Trievel, 2014,Estaras, Fueyo, Akizu et al., 2013). SET9 is an islet-enriched histone H3 K4–specific methyltransferase that enhances PDX1 transcription activity on insulin gene regulation (Francis, Chakrabarti, Garmey et al., 2005). Our recent research has also shown that SET9 functions not only as a histone methyltransferase that increases histone H3 K4 trimethylation on the cyclin D1 promoter region, but also as an adaptor to bridge ISL1 and PDX1 in pancreatic islet β cells (Yang, Zhang, Lu et al., 2015). As a key H3K27me3 demethylase, JMJD3 plays an important role in regulating geneACCEPTED expression in response to environmental signaling stimuli (He, Kim, Kim et al., 2015). We have identified a number of ISL1- or PDX1-interacting proteins by mass spectrometry in pancreatic islet β cells (Yang et al., 2015). Among these factors, we found that SET9 and JMJD3 could be potential candidate epigenetic modifiers. Hence, we investigated whether ISL1 or PDX1 could affect insulin gene transcription in different glucose concentrations not only through traditional

ACCEPTED MANUSCRIPT transcription regulation, but also in association with epigenetic modification. In the present study, we demonstrate that ISL1 interacts with BETA2 to maintain basic insulin gene transcriptional activity in normal glucose conditions. In high-glucose conditions, PDX1 forms a complex with BETA2 to enhance insulin gene expression. As cofactors of ISL1 or PDX1, SET9 and JMJD3 facilitate insulin gene histone modification under different glucose conditions. These observations delineate a novel and precise insulin gene regulation pattern in response to glucose signals. Our study provides the first evidence that transcription factors orchestrate epigenetic modifications for proper control of insulin gene expression in response to environmental signaling stimuli.

2. Materials and Methods 2.1 Diabetes animal model and rat pancreatic islet isolation The animal experiments were performed in accordance with the ethical principles and guidelines for scientific experiments on animals of the Swiss Academy of Medical Sciences (1995). The Animal Care andMANUSCRIPT Use Committee of Peking University approved all protocols (LA 2010-066). Db/db mice (14–16 weeks old), which are homozygous for the db gene and exhibit an obese and diabetic phenotype, were used for the type 2 diabetes animal model. Db/m mice, which are heterozygous for the db gene and exhibit a non-diabetic, normal phenotype, were used as controls to the db/db mice. The mice were anesthetized with 5 mg/100 g body weight sodium pentobarbital, and the pancreatic tissues were removed. RNA was prepared from these tissues and used for real-time reverse transcription (RT)-PCR assay. Rat pancreaticACCEPTED islets were isolated from 100–120 g male Sprague-Dawley rats as previously described (Guo, Wang, Zhang et al., 2011). Briefly, donor pancreases were perfused in situ with collagenase V (3 mg/mL; Sigma-Aldrich, St. Louis, MO, USA), harvested immediately thereafter, and incubated at 37°C with gentle vortexing (375 rpm) for 30 min. Islets were released from the pancreas and were isolated by hand. The isolated pancreatic islets were washed with Hank’s solution twice at 4°C, counted,

ACCEPTED MANUSCRIPT and cultured in RPMI 1640 complete medium with 25 or 5 mmol/L glucose for 24 h or for an indicated duration.

2.2 Cell culture

Monolayer cultures of the hamster pancreatic islet β cell line HIT-T15 (ATCC number CRL-1777, Manassas, Virginia, USA) and mouse insulinoma cell line NIT-1 (ATCC number CRL-2055) were maintained in RPMI 1640 (GIBCO BRL, New York, USA) complete medium, which contained 11.1 mmol/L glucose with 2 mM/L glutamine, 100 U/mL penicillin, 100 U/mL streptomycin, and 10% fetal bovine serum. The medium was changed every 1 – 2 days until the cells were transferred to medium containing 25 or 5 mmol/L glucose and cultured for a further 24 h or for an indicated duration, and were harvested for the remaining experiments.

2.3 Insulin secretion assay Rat pancreatic islets (200 islets/well in 6-well plates) or HIT-T15 cells (5 × 10 4/well in 6-well plates) were cultured in RPMIMANUSCRIPT 1640 medium with 11.1 mmol/L glucose for 24 h. Cells were washed in glucose-free Krebs-Ringer bicarbonate buffer three times and re-incubated in RPMI 1640 medium containing 5 or 25 mmol/L glucose at 37°C for 60 min. The medium was collected after gentle centrifugation and stored at −20°C for measurement of insulin secretion using a radioimmunoassay (RIA) kit (China Atomic Energy Diagnostics, Beijing, China). Data were normalized to total protein.

2.4 Quantitative real-time RT-PCR and RNA interference (RNAi) Total RNAACCEPTED was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Amplifications were performed in an ABI 7300 Real-Time PCR System (Applied Biosystems Co, Carlsbad, CA, USA) with different primers (Table 1). All annealing temperatures were 60°C. Transcript levels were normalized to 18S RNA. Each value represents the average of at least three independent experiments. RNAi duplexes for Pdx1 (si-PDX1), Isl1 (si-ISL1), or

ACCEPTED MANUSCRIPT control siRNA (non-silencing, Non) were obtained from GeneChem (Shanghai, China) (Table 2) and used to transfect HIT-T15 cells according to the manufacturer’s instructions.

2.5 Plasmid constructs and luciferase assays The plasmid constructs pRIP1-luc (luciferase reporter plasmid containing a 0 to -410-bp sequence upstream from the transcription start site in RIP1), pcDNA3-ISL1, pcDNA3-PDX1, and pCMV-BETA2 have been previously described (Zhang, Yang, Jia et al., 2014,Lu, Wang, Wang et al., 2005). Cells were seeded and cultured in a 24-well plate and transfected with the appropriate plasmid DNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions when they were 80% confluent. The total amount of DNA was kept constant using a pcDNA3 plasmid. Cells were cultured in RPMI 1640 medium with 11.1 mmol/L glucose. After 24-h transfection, cells were changed to medium containing 5 or 25 mmol/L glucose and the luciferase activity was assayed 12 h later. Luciferase activity was normalized to Renilla luciferase activity. All experiments wereMANUSCRIPT performed in triplicate, and three independent repeat experiments were performed.

2.6 Chromatin immunoprecipitation (ChIP) and ChIP re-IP assays ChIP and ChIP re-IP experiments were performed in HIT-T15 cells according to previously described methods (Yang et al., 2015). After elution, real-time PCR or conventional PCR were performed to amplify the DNA fragment containing the insulin promoter covering the ISL1/BETA2 or PDX1/BETA2 binding sites with the following primers, F: 5′-CCAATGAGTGCTTTCTGC-3′, R: 5′-AAGTACCTCCTCTCTGCC-3ACCEPTED′ (144-bp fragment).

2.7 Immunoprecipitation and western blot analysis Cell lysates were prepared using radioimmunoprecipitation assay lysis buffer (P0013E; Beyotime, Shanghai, China) containing protease inhibitor cocktail (469313200; Roche, Basel, Switzerland) according to the manufacturer’s instructions.

ACCEPTED MANUSCRIPT

Immunoprecipitation and western blotting were carried out as described previously using the antibodies listed below (Zhang et al., 2014). For semi-quantitative assay, the post-immunoprecipitation supernatant was subjected to western blotting using anti– lamin B antibody as an internal control. The antibodies used in these experiments were rabbit monoclonal anti-ISL1 (ab3727-1; Abcam, Cambridge, UK.), mouse monoclonal anti-BETA2 (sc-1084; Santa Cruz, Dallas, Texas, USA.), rabbit polyclonal anti-PDX1 (ab47267; Abcam), mouse monoclonal anti-SET7/9 (A301-747A; Bethyl, Montgomery, Texas, USA), mouse monoclonal anti-JMJD3 (sc-130157; Santa Cruz), anti-H3K4me1 (ab8895; Abcam), anti- H3K4me3 (17-678; Millipore), anti-H3K27me3 (ab6002; Abcam), mouse monoclonal anti–β-actin (sc-130300; Santa Cruz), and anti–lamin B (sc-374015, Santa Cruz).

2.8 Statistical analysis Data are expressed as the mean ± standard deviation (SD). Comparisons between groups were analyzed using Student’s t-test or analysis of variance (ANOVA), and the Student–Newman–Kleuss method was used MANUSCRIPT to estimate the level of significance. Differences were considered statistically significant at p < 0.05.

3. Results

3.1 Insulin (Ins), Pdx1, Isl1, and Beta2 gene expression patterns in diabetic mice pancreatic islets and in pancreatic cells cultured in normal or high-glucose medium differed To establish the Ins , Pdx1 , Isl1 , and Beta2 gene expression patterns under different glucose conditions, pancreatic islets were isolated from hyperglycemic type 2 diabetes ACCEPTED db/db mice (14–16 weeks, blood glucose, 26.7 ± 3.5 mmol/L) and normoglycemic db/m mice (blood glucose, 5.6 ± 1.2 mmol/L). In addition, NIT-1 and HIT-T15 β cells were cultured in RPMI 1640 medium containing high glucose concentrations (25 mmol/L) or normal glucose concentrations (5 mmol/L) for 12 h. Pdx1 and Ins expression was increased significantly in high-glucose conditions as compared with normal glucose conditions; Isl1 and Beta2 expression was essentially

ACCEPTED MANUSCRIPT unchanged under both high- or normal glucose conditions (Fig. 1A-1D, 1E, p < 0.01). Consistently, insulin secretion from the cultured primary rat pancreatic islets and the NIT-1 and HIT-T15 cells responded positively to high-glucose conditions (Fig. 1F, p < 0.01). The results imply that PDX1, ISL1, and BETA2 may play different roles in insulin gene expression in response to glucose signaling.

MANUSCRIPT

Fig. 1. Ins , Pdx1 , Isl1 , and Beta2 gene expression patterns differed in pancreatic islets from diabetic mice and pancreatic cells cultured in normal or high-glucose medium. Relative levelACCEPTED of Ins , Pdx1 , Isl1 , and Beta2 mRNA was measured by real-time RT-PCR in isolated pancreatic islets from db/db mice (control, pancreatic islets of db/m mice) (A); primary rat pancreatic islets (B), mouse NIT-1 β cells (NIT, C), and hamster HIT-T15 β cells (HIT, D) cultured in RPMI 1640 with 5 or 25 mmol/L glucose for 12 h (gene expression levels were normalized to 18S RNA). E) Representative image of three independent experiments shows the expression of PDX1, ISL1, and BETA2 nuclear protein in rat pancreatic islets cultured in RPMI

ACCEPTED MANUSCRIPT

1640 with 5 or 25 mmol/L glucose for 12 h. Lamin B1 served as the loading control of nuclear protein. F) Insulin secretion was analyzed by RIA in primary rat pancreatic islets and NIT-1 and HIT-T15 cells cultured in RPMI 1640 with 5 or 25 mmol/L glucose for 12 h. The supernatant was collected and assayed (n = 5). Bars represent the mean ± SD from three samples. ** p < 0.01 as compared with db/m group (A) or with 5 mmol/L glucose group (B–E).

3.2 PDX1 and ISL1 synergistic effects with BETA2 on the insulin promoter differed with the glucose concentration in culture We demonstrated differing Pdx1 and Isl1 gene expression patterns in β cells cultured with high or normal glucose concentrations. To investigate whether they play different regulatory roles on insulin gene expression in response to glucose signaling, a luciferase reporter plasmid containing RIP1 (0 to -410 bp) was transfected into NIT-1 or HIT-T15 cells together with pcDNA3-PDX1 or pcDNA3-ISL1 alone or co-transfected with pCMV-BETA2, respectively. As shown in Fig. 2A and 2C, PDX1 alone or with BETA2 exhibited higher activity MANUSCRIPT on the insulin gene promoter in high-glucose cultures as compared to those containing 5 mmol/L glucose. In contrast, the activity of ISL1 alone and with BETA2 remained similar on the insulin gene promoter in high- or normal glucose cultures (Fig. 2B and 2D). A luciferase reporter plasmid with the firefly luciferase gene inserted downstream of the rat insulin I mini-enhancer (-247 ∼ -197 bp, containing E2 and A3/A4-boxes) also was used to test the transcription activities of PDX1, ISL1 and BETA2 (Zhang et al., 2009). Similar to RIP1 promoter, PDX1 and ISL1 synergistic effects with BETA2 differed with the glucose concentrations in culture were also observed on the mini-enhancer (data not shown). Intriguingly,ACCEPTED when the plasmid of PDX1 was co-transfected with ISL1, ISL1 showed a competitive effect with PDX1 and weaken PDX1 on transactivation of insulin promoter with high glucose culture (Fig. S1). We suppose that it is probably because ISL1 owns weaker transactivation ability of ISL1 on the insulin promoter is weaker than that of PDX1 with 25 mM glucose culture (Fig. S1), but both PDX1 and ISL1 recognize the same elements (A3/A4 box) and may

ACCEPTED MANUSCRIPT competitively bind on the insulin promoter (Zhang et al., 2009). It should be mentioned that the transactivation of insulin promoter by PDX1 is increased only in 25mM glucose medium not in 5mM glucose medium although the total protein levels were not significantly differed in the cells cultured with 25 mmol/L glucose condition or with 5 mmol/L glucose condition (Fig S2A). However, PDX1 protein was increased significantly in nuclear extracts from the cells cultured in high-glucose conditions as compared with normal glucose conditions (p<0.01, Fig. S2B). ISL1 and BETA2 expression was essentially unchanged under either high or normal glucose conditions. As a gene promoter could be activated effectively by activators in nuclei, only nuclear PDX1 protein could increase insulin gene transcription significantly. Furthermore, Isl1 knockdown (si-Isl1) in HIT-T15 cells cultured with normal glucose medium attenuated insulin secretion significantly, while Pdx1 knockdown (si-Pdx1) did not affect insulin secretion in cells cultured in normal glucose medium (Fig. 2E, p < 0.01). In contrast, the knockdown of Pdx1 , but not Isl1 , attenuated insulin secretion significantly in cells cultured with high-glucose medium (Fig. 2E, p < 0.01). Pdx1 and Isl1 did not exertMANUSCRIPT synergistic effects under normal or high glucose conditions. In addition, the inhibitory effect on insulin gene expression following Pdx1 knockdown remained until 48 h after cells had been transferred to high-glucose medium, while insulin gene expression still peaked at 24 h following Isl1 knockdown (Fig. 2F). These results indicate that PDX1 may serve as the main activator of insulin gene expression in β cells cultured in high-glucose medium, while ISL1 may mainly maintain basic insulin gene expression under normal glucose conditions. ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIPT

Fig. 2. PDX1 and ISL1 synergistic activation effects with BETA2 on the insulin promoter differed according to the glucose concentration in culture. A–D)

Transcriptional activation efficiency of PDX1 and BETA2 (A, C) or ISL1 and BETA2 (B, D) on RIP1ACCEPTED detected by luciferase reporter assay in plasmid-transfected NIT-1 (NIT) (A, B) or HIT-T15 (HIT) (C, D) cells cultured in RPMI 1640 medium with 5 or 25 mmol/L glucose. E) HIT-T15 cells were transfected with si-Pdx1, si-Isl1, or both (si-Pdx1 + si-Isl1) and then cultured in medium containing 5 or 25 mmol/L glucose. Insulin secretion levels were measured by RIA (n = 5). Non-silencing siRNA (Non) served as the control. F) Relative insulin gene expression level was measured in HIT-T15 cells transfected with si-Isl1 or si-Pdx1. Cells were cultured in RPMI 1640

ACCEPTED MANUSCRIPT containing 5 mmol/L glucose for 48 h, and then changed to 25 mmol/L glucose medium, and RNA was extracted at 0, 4, 8, 12, 24, and 48 h later. HIT-T15 cells without siRNA transfection served as the control. Data represent three independent experiments, each performed in triplicate. Bars represent the mean ± SD. * p < 0.05, ** p < 0.01 as compared with the control or as indicated.

3.3 PDX1 and ISL1 interacted differently with BETA2 according to the glucose concentration in culture We and others have previously reported that both PDX1 and ISL1 activate insulin promoter synergistically with BETA2 in β cells (Zhang et al., 2009,Ohneda et al., 2000). However, the relationship between PDX1–BETA2 and ISL1–BETA2 remains unclear. To investigate why PDX1 and ISL1 regulate insulin gene expression differently in high- or normal glucose conditions, Co-IP was performed to analyze whether PDX1–BETA2 or ISL1–BETA2 could form different complexes in response to different glucose signals. PDX1 interacted with BETA2 in HIT-T15 cells cultured in high-glucose medium but no PDX1–BETA2 MANUSCRIPT complex was formed when the cells were cultured in normal glucose medium. Conversely, the ISL1–BETA2 complex was observed only in cells cultured in normal glucose medium (Fig. 3A, 3B). Taken together, our data show that PDX1, rather than ISL1, associates with BETA2 to form a PDX1–BETA2 complex in response to high glucose signals. In normal glucose conditions, the ISL1–BETA2 complex is formed to maintain the basic level of insulin gene expression.

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED Fig. 3. PDX1 and ISL1 interaction with BETA2 differed according to the glucose concentration in culture. Semi-quantitative Co-IP assays were performed to measure PDX1–BETA2 or ISL1–BETA2 interaction. Nuclear protein was extracted from HIT-T15 cells after 12-h culture in 5 or 25 mmol/L glucose medium. BETA2 served as the positive control; lamin B1 served as the loading control. A) Representative figure. B) Statistical analysis data. Data represent three independent experiments, each

ACCEPTED MANUSCRIPT performed in triplicate. Bars represent the mean ± SD. ** p < 0.01 as compared with the 5 mmol/L glucose group.

3.4 PDX1 and ISL1 DNA binding ability to the RIP1 differed according to the glucose concentration in culture To confirm whether the PDX1–BETA2 or ISL1–BETA2 complex binds to the insulin promoter region under high- or normal glucose conditions, ChIP assay was performed in HIT-T15 cells cultured in 5 or 25 mmol/L glucose medium. PDX1– BETA2 formed a transcriptional activation complex with the insulin promoter following 25 mmol/L glucose culture but not 5 mmol/L glucose culture (Fig. 4A, 4B, 4D). The ISL1–BETA2 complex was only identified in cells cultured in normal glucose conditions (Fig. 4A, 4B, 4C). Hence, we suspect that ISL1 interacts with BETA2 to maintain basic insulin gene expression under normal glucose conditions. When the cells are challenged with high glucose, PDX1 forms a complex with BETA2 to promote insulin gene expression. MANUSCRIPT

ACCEPTED

Fig. 4. PDX1 and ISL1 DNA binding activity on RIP1 differed according to the glucose concentration in culture. A, B) ChIP assay analysis of PDX1 or ISL1 recruitment on RIP1 using anti-PDX1 or anti-ISL1 antibodies, with normal

ACCEPTED MANUSCRIPT immunoglobulin G (IgG) as the control. DNA extracted from NIT-1 (NIT) cells (A) or HIT-T15 (HIT) cells (B) cultured with 5 or 25 mmol/L glucose for 12 h was amplified using real-time PCR. C, D) ChIP re-IP assay performed first with anti-ISL1 antibodies (1 st ChIP, C) or anti-PDX1 antibodies (1 st ChIP, D), and then with anti-BETA2 antibodies (2 nd ChIP) using chromatin harvested from HIT-T15 cells cultured with 5 or 25 mmol/L glucose for 12 h. The data represent three independent experiments, each performed in triplicate. Each bar represents the mean ± SD. ** p < 0.01 as compared with anti-ISL1 immunoprecipitation group.

3.5 PDX1 and ISL1 histone modification regulatory effects on the insulin promoter differed according to the glucose concentration in culture Previous studies have demonstrated that histone modifications are involved in regulating the expression of some genes in pancreatic islet β cells (Fujimaki, Ogihara, Morris et al., 2015,Ogihara, Vanderford, Maier et al., 2009). To investigate whether the epigenetic mechanism is also involved in insulin gene regulation in response to glucose signaling, ChIP assays were performed MANUSCRIPT to detect several histone modifications. Any modification, whether classic “active”, e.g., H3K4me1 and H3K4me3, or “repressive”, e.g., H3K27me3, at the PDX1/ISL1-binding region on the insulin promoter effected no change in HIT-T15 cells cultured in normal or high-glucose medium (Fig. 5A). Meanwhile, there was a strikingly high level of H3K4me1 and H3K4me3 modification as compared with the very low level of H3K27me3 on the insulin promoter (Fig. 5A). The results are consistent with the insulin gene being in active transcription state in pancreatic islet β cells. However, following Isl1 knockdown, these “active” histone modifications were markedly decreased in HIT-T15 cellsACCEPTED cultured in normal glucose medium but not in cells cultured in high-glucose medium, while H3K27me3 modification at the PDX/ISL1-binding region of the insulin promoter was increased (Fig. 5B-5D). Pdx1 knockdown had the opposite effect on H3K4me1, H3K4me3, and H3K27me3 modifications to that of Isl1 knockdown (Fig. 5E-5G). The above changes in histone modification are consistent with the change in insulin secretion levels in the cells with Isl1 or Pdx1 knockdown in

ACCEPTED MANUSCRIPT response to different glucose concentrations (Fig. 2E). Therefore, we surmise that PDX1 or ISL1 can alter the status of histone H3K4 and H3K27 methylation on the insulin promoter in β cells according to the glucose concentration in culture.

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

Fig. 5. PDX1 and ISL1 histone modification regulatory effects on the insulin promoter differed according to the glucose concentration in culture. A) ChIP assay carried out with antibodies against H3K4me1, H3K4me3, and H3K27me3 in HIT-T15 cells cultured with 5 or 25 mmol/L glucose for 12 h. B–G) ChIP assay carried out to detect H3K4me1, H3K4me3, and H3K27me3 in response to Isl1 knockdown (si-Isl1) (B–D) or Pdx1 knockdown (si-Pdx1) (E–G). H) Representative image showed the expression of PDX1 and ISL1 protein when siRNA (si-Pdx1or si-Isl1) transfected in HIT-T15 cells. β-actin served as the loading control. Data represent three independent experiments, each performed in triplicate. Bars represent the mean ± SD. * p < 0.05, ** p < 0.01 as compared with non-silencing siRNA (Non).

3.6 PDX1 and ISL1 recruitment of SET9 and JMJD3 on the insulin promoter differed according to the glucose concentration in culture We explored how PDX1 or ISL1 alter the status of histone H3K4 and H3K27 methylation on the insulin promoter according to the glucose concentration in culture. Previously, we had screened ISL1- or MANUSCRIPT PDX1-interacting proteins by mass spectrometry in pancreatic islet β cells and identified SET9 and JMJD3 as potential candidates (Yang et al., 2015). SET9 is a histone H3K4–specific methyltransferase and a novel enzymatic cofactor necessary for maintaining pancreatic islet gene transcription (Ogihara et al., 2009). JMJD3, a H3K27 demethylase that acts as a critical epigenetic regulator, is involved in the development, differentiation, and maintenance of cell fate; tumorigenesis; and neurogenesis (He et al., 2015,Ene, Edwards, Riddick et al., 2012,Iida, Iwagawa, Kuribayashi et al., 2014,Park, Hong, Salinas et al., 2014,Yan, Sun, Zhu et al., 2014). As we had previously identified the ISL1- or PDX1-interactingACCEPTED proteins by mass spectrometry in pancreatic islet β cells (Yang et al., 2015), we suspected that ISL1 or PDX1 may affect insulin gene transcription through epigenetic modification, which may be associated with the two enzymatic cofactors above. Consequently, to test this hypothesis, Co-IP and ChIP re-IP were performed to determine whether ISL1 or PDX1 could form a complex with SET9 or JMJD3 to bind directly to the insulin promoter according to the glucose

ACCEPTED MANUSCRIPT concentration in culture. In cells cultured in normal glucose medium, ISL1 interacted with SET9 or JMJD3, but did so sparsely in cells cultured in high-glucose medium (Fig. 6A, 6C). Conversely, PDX1–SET9 or PDX1–JMJD3 interaction was observed in cells cultured in high-glucose medium rather than normal glucose medium (Fig. 6B, 6D). Hence, these results show that both ISL1 and PDX1 can recruit SET9 or JMJD3, but under different glucose conditions. Furthermore, ChIP and ChIP re-IP confirmed that ISL1–SET9 or ISL1–JMJD3 occupied and colocalized on the insulin promoter only in cells cultured in normal glucose medium (Fig. 6E and 6G). In contrast, PDX1–SET9 or PDX1–JMJD3 was enriched on the insulin promoter only in HIT-T15 cells cultured in high-glucose medium (Fig. 6F and 6H).

MANUSCRIPT

ACCEPTED

Fig. 6. PDX1 and ISL1 recruitment of SET9 and JMJD3 on the insulin promoter differed according to the glucose concentration in culture. A–D) Co-IP assay

ACCEPTED MANUSCRIPT performed to measure SET9 and JMJD3 recruitment by ISL1 or PDX1 in 5 mmol/L (A, B) or 25 mmol/L (C, D) glucose culture. Nuclear proteins were extracted from HIT-T15 cells after 12-h culture and were used for Co-IP assay. Nuclear protein extracts (5%) served as the loading control (Input). Normal IgG served as the negative control. E–H) ChIP re-IP assay performed first with anti-ISL1 or anti-PDX1 antibodies (1 st ChIP) then with anti-SET9 (2 nd ChIP) (E–F) or anti-JMJD3 antibodies (2 nd ChIP) (G–H) using chromatin harvested from HIT-T15 cells cultured with 5 or 25 mmol/L glucose for 12 h.

Taken together, the results indicate that ISL1 or PDX1 can regulate insulin gene expression both at traditional transcription level and at epigenetic level. ISL1 and PDX1 play different roles based on differing glucose conditions. 4. Discussion Glucose is the major physiological regulator of insulin gene expression (Poitout, Hagman, Stein et al., 2006). Some glucose-responsive transcription control elements on the insulin gene have been identified, and MANUSCRIPT several transcription factors have been implicated as being responsible for them (Pino, Ye, Linning et al., 2005). However, how glucose coordinately controls the recruitment of transcription factors, e.g., PDX1 and ISL1, to bind the insulin promoter and govern insulin gene expression remains puzzling. Previously, we discovered that ISL1 regulates insulin gene expression by interacting with BETA2 (Zhang et al., 2009). However, accumulating evidence has enhanced the conclusion that PDX1, rather than ISL1, exerts greater insulin gene regulation (Le Lay and Stein, 2006,Qiu et al., 2002,Iguchi, Ikeda, Okamura et al., 2005). Intriguingly,ACCEPTED both PDX1 and ISL1 can bind to the A3/A4 box in the insulin promoter, which is one of the major glucose-responsive transcription control elements for insulin gene expression. Hence, why both activators are required to bind the same site to regulate insulin gene expression is thought provoking. Is the relationship between them competitive or compatible? To clarify this, we first determined the Pdx1 and Isl1 gene expression patterns in islet

ACCEPTED MANUSCRIPT

β cells cultured in different glucose concentrations. High-glucose culture promoted Pdx1 gene expression, which is similar to the reports of others (Iguchi et al., 2005). In contrast with Pdx1 , Isl1 and Beta2 expression was barely affected by glucose, which implies the presence of differing regulatory effects on insulin gene expression in normal or high-glucose conditions. Further research has provided evidence supporting our speculation. PDX1 alone or with BETA2 had higher activation efficiency on the insulin gene promoter following stimulation with high glucose levels. Compared with PDX1, ISL1 contributed more greatly to insulin promoter activation in normal glucose conditions. Although these results indicate that PDX1 plays a major role in glucose regulation of insulin gene transcription, ISL1 is not dispensable. Only combined expression of PDX1 and ISL1, rather than PDX1 alone, induces insulin production in immature enterocytes (Kojima, Nakamura, Fujita et al., 2002). In the present study, we also found that if only the Isl1 gene was knocked down, not only was insulin secretion decreased in the cells cultured in normal glucose, the initiation of insulin gene expression was also delayed (Fig. 2E andMANUSCRIPT 2F). Collectively, the results suggest that PDX1 might potentiate insulin gene expression in response to high-glucose stimulation, while the role of ISL1 to maintain the basic level of insulin gene transcription. Our hypothesis on the diverse roles in PDX1- or ISL1-mediated insulin gene expression regulation is supported by the reports of others. The absence of Pdx1 in pancreatic islets can cause defects in glucose-stimulated insulin gene transcription in Psammomys obesus , a rodent model of type 2 diabetes, whereas a number of other insulin gene regulators, including MafA (v-maf musculoaponeurotic fibrosarcoma oncogene homologue A), do not affect glucose-stimulated insulin gene transcription (Leibowitz, ACCEPTED Yuli, Donath et al., 2001). The NES2Y cell line, isolated from patient pancreatic islets, lacks PDX1 . Although the cells can express the insulin gene, they cannot upregulate insulin gene transcription in response to high glucose levels (MacFarlane, Chapman, Shepherd et al., 1999). These reports provide evidence that PDX1 can act as a potent glucose-responsive transcriptional activator in insulin gene expression. Regarding ISL1, low insulin levels have been detected in a number of

ACCEPTED MANUSCRIPT extrapancreatic tissues, including the brain, thymus, lachrymal glands, and salivary glands, while ISL1 instead of PDX1 is involved in regulating insulin expression in these organs (Kojima, Fujimiya, Matsumura et al., 2004). Brain tumor cells producing low levels of insulin can express ISL1 without expressing PDX1 (Nakamura, Kishi, Nishio et al., 2001) . Consistently, the insulin gene expression detected in these tissues or tumors is not responsive to glucose stimulation. These studies imply that ISL1 can activate insulin gene expression at a basic level, but is not a glucose-responsive transcriptional activator. Moreover, we explored the mechanism responsible for PDX1 and ISL1 differential regulation of insulin gene expression in normal or high-glucose conditions. Although BETA2 interacts with PDX1 and ISL1, there may be a competitive relationship between the two resultant complexes, i.e., PDX1–BETA2 and ISL1– BETA2. PDX1 can recruit BETA2 to form a complex, binding the insulin promoter in high-glucose conditions, while the ISL1–BETA2 complex on the insulin promoter is present only in normal glucose medium culture. Why does PDX1 interact with BETA2 only in higher than normal glucose MANUSCRIPT exposure? We found that 25 mmol/L glucose cultures could enrich PDX1 in nuclei more significantly than that with 5 mmol/L glucose culture. Enriched PDX1 exhibited a stronger recruitment with BETA2. Why is PDX1 enriched in β cells nuclear in higher than normal glucose exposure? The post-translational regulation of PDX1 might be one reason for this. In β cells incubated in low-glucose conditions, PDX1 is localized to the cytoplasm; in high-glucose conditions, PDX1 is localized to the nucleus (Welker, Gotz, Servas et al., 2013). Glucose signals promote phosphorylation and translocation of PDX1 to nuclei (Meng, Al-Quobaili, Muller et al., 2010). However, different from the high glucose-inducedACCEPTED nuclear translocation of PDX1, ISL1 exhibited constant nuclear localization in cells cultured in either normal or high glucose. Additionally, mass spectrometry did not detect phosphorylated modification of ISL1 in pancreatic islet β cells cultured in different glucose concentrations (data not shown). Hence, we speculated that high glucose can promote the modification and nuclear translocation of PDX1 and that enriched PDX1 is a stronger BETA2 recruiter

ACCEPTED MANUSCRIPT than ISL1 on the insulin promoter to potentiate insulin gene transcription. When β cells are cultured in normal glucose, PDX1 is dephosphorylated by phosphatase and translocates to the cytoplasm, losing the ability to interact with BETA2. ISL1 is localized to the nucleus, and accordingly has the chance to recruit BETA2 to the insulin promoter. The regulation of insulin gene expression is a complicated network involving more than 40 nuclear factors. Besides PDX1, ISL1 and BETA2, there are other β cell-restricted factors in response to glucose on insulin gene transcription. MafA, binding to the C1 box in the insulin promoter, also plays a critical role in β cell-specific insulin gene transcription as well as in glucose-regulated expression and secretion (Aguayo-Mazzucato, Koh, El Khattabi et al., 2011,Nishimura, Takahashi and Yasuda, 2015,Zhang, Moriguchi, Kajihara et al., 2005). The relationships among these activators involved in glucose-responsive insulin expression remain to be elucidated. Both SET9 and JMJD3 are involved in gene activation by inhibiting heterochromatin formation (Estaras et al., 2013,FujMANUSCRIPTimaki et al., 2015). The insulin gene is expressed almost exclusively in β cells of the pancreatic islets of Langerhans. One major feature of the insulin gene is in the β cell euchromatin structure. How can the insulin gene maintain an active chromatin state? It has been reported that the proximal insulin promoter is hyperacetylated at histone H3 and hypermethylated at H3K4 only in β cells. This hyperacetylation is caused by histone acetyltransferase p300 that is recruited by PDX1 to the proximal promoter, and the hypermethylation at the H3K4 modification correlates with the SET9 that is also recruited by PDX1 to the promoter (Mosley et al., 2004,Francis et al., 2005). However, to our knowledge, whether H3K27me3ACCEPTED and its modulation enzyme, i.e., JMJD3, are involved in the euchromatic structure around the insulin gene has not been reported. In our study, we demonstrated that PDX1 recruits not only SET9 but also JMJD3 on the insulin gene promoter to maintain the H3K4me1, H3K4me3, and de-H3K27me3 state of the insulin gene in β cells challenged with high glucose levels. These studies suggest that PDX1 plays a crucial role in maintaining the euchromatic structure of the insulin gene.

ACCEPTED MANUSCRIPT

However, in normal glucose conditions, PDX1 is located in the cytoplasm, and cannot recruit the chromatin modulation enzymes in the nucleus. How the active structure of the insulin gene is maintained remains poorly defined. Here, we observed that ISL1 instead of PDX1 interacted with SET9 and JMJD3 to bind the insulin promoter to maintain the H3K4me1, H3K4me3, and de-H3K27me3 state. Therefore, we propose a model in which a unique combination of transcription factors facilitates insulin gene transcription in β cells, namely, by PDX1 in high-glucose conditions and by ISL1 in normal glucose conditions, which acts in the setting of an open, euchromatic structure of the insulin gene. Taken together, our findings reveal a novel and precise mechanism of PDX1 and ISL1 systematic regulation of insulin gene expression at both traditional transcription level and at epigenetic level. ISL1 and PDX1 play different roles in response to varying glucose concentrations.

Conflicts of interest The authors declare no conflicts of interest. MANUSCRIPT Acknowledgments

We thank Prof. JC. Yang for generously providing db/db and db/m mice. This work was supported by the National Natural Science Foundation of China (Nos. 81170713, 81472022, 81370236, 81371889, 81071675, 81301874), the Natural Science Foundation of Beijing (No.5122021, 7132051), Specialized Research Fund for the New Teacher in Doctoral Program of Higher Education (2012001120135), the Leading Academic Discipline Project of Beijing Education Bureau, and the 111 Project of China (B07001). ACCEPTED

ACCEPTED MANUSCRIPT

References [1] Bell, G.I., Pictet, R.L., Rutter, W.J., Cordell, B., Tischer, E. and Goodman, H.M., 1980. Sequence of the human insulin gene, Nature. 284, 26-32. [2] Melloul, D., Marshak, S. and Cerasi, E., 2002. Regulation of insulin gene transcription, Diabetologia. 45, 309-26. [3] Hay, C.W. and Docherty, K., 2006. Comparative analysis of insulin gene promoters: implications for diabetes research, Diabetes. 55, 3201-13. [4] Le Lay, J. and Stein, R., 2006. Involvement of PDX-1 in activation of human insulin gene transcription, J Endocrinol. 188, 287-94. [5] Karlsson, O., Thor, S., Norberg, T., Ohlsson, H. and Edlund, T., 1990. Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeo- and a Cys-His domain, Nature. 344, 879-82. [6] Ohlsson, H., Karlsson, K. and Edlund, T., 1993. IPF1, a homeodomain-containing transactivator of the insulin gene, EMBO J. 12, 4251-9. [7] Melloul, D., Ben-Neriah, Y. and Cerasi, E., 1993. Glucose modulates the binding of an islet-specific factor to a conserved sequence within the rat I and the human insulin promoters, Proc Natl Acad Sci U S A. 90, 3865-9. [8] Nielsen, D.A., Welsh, M., Casadaban, M.J. and Steiner, D.F., 1985. Control of insulin gene expression in pancreatic beta-cells and in an insulin-producing cell line, RIN-5F cells. I. Effects of glucose and cyclic AMP on the transcription of insulin mRNA, J Biol Chem. 260, 13585-9. [9] Evans-Molina, C., Garmey, J.C., Ketchum, R., Brayman, K.L., Deng, S. and Mirmira, R.G., 2007. Glucose regulation of insulin gene transcriptMANUSCRIPTion and pre-mRNA processing in human islets, Diabetes. 56, 827-35. [10] Mosley, A.L., Corbett, J.A. and Ozcan, S., 2004. Glucose regulation of insulin gene expression requires the recruitment of p300 by the beta-cell-specific transcription factor Pdx-1, Mol Endocrinol. 18, 2279-90. [11] Peng, S.Y., Wang, W.P., Meng, J., Li, T., Zhang, H., Li, Y.M., Chen, P., Ma, K.T. and Zhou, C.Y., 2005. ISL1 physically interacts with BETA2 to promote insulin gene transcriptional synergy in non-beta cells, Biochim Biophys Acta. 1731, 154-9. [12] Zhang, H., Wang, W.P., Guo, T., Yang, J.C., Chen, P., Ma, K.T., Guan, Y.F. and Zhou, C.Y., 2009. The LIM-homeodomain protein ISL1 activates insulin gene promoter directly through synergy with BETA2, J Mol Biol. 392, 566-77. [13] Thor, S., Ericson, J., Brannstrom, T. and Edlund, T., 1991. The homeodomain LIM protein Isl-1 is expressed in subsets of neurons and endocrine cells in the adult rat, Neuron. 7, 881-9. [14] Wilfinger, A., Arkhipova, V. and Meyer, D., 2013. Cell type and tissue specific function of islet genesACCEPTED in zebrafish pancreas development, Dev Biol. 378, 25-37. [15] Ohneda, K., Mirmira, R.G., Wang, J., Johnson, J.D. and German, M.S., 2000. The homeodomain of PDX-1 mediates multiple protein-protein interactions in the formation of a transcriptional activation complex on the insulin promoter, Mol Cell Biol. 20, 900-11. [16] Moon, S., Han, D., Kim, Y., Jin, J., Ho, W.K. and Kim, Y., 2014. Interactome analysis of AMP-activated protein kinase (AMPK)-alpha1 and -beta1 in INS-1 pancreatic beta-cells by affinity purification-mass spectrometry, Sci Rep. 4, 4376. [17] Qiu, Y., Guo, M., Huang, S. and Stein, R., 2002. Insulin gene transcription is mediated by interactions between the p300 coactivator and PDX-1, BETA2, and E47, Mol Cell Biol. 22,

ACCEPTED MANUSCRIPT

412-20. [18] Ramalingam, L., Lu, J., Hudmon, A. and Thurmond, D.C., 2014. Doc2b serves as a scaffolding platform for concurrent binding of multiple Munc18 isoforms in pancreatic islet beta-cells, Biochem J. 464, 251-8. [19] Del Rizzo, P.A. and Trievel, R.C., 2014. Molecular basis for substrate recognition by lysine methyltransferases and demethylases, Biochim Biophys Acta. 1839, 1404-15. [20] Estaras, C., Fueyo, R., Akizu, N., Beltran, S. and Martinez-Balbas, M.A., 2013. RNA polymerase II progression through H3K27me3-enriched gene bodies requires JMJD3 histone demethylase, Mol Biol Cell. 24, 351-60. [21] Francis, J., Chakrabarti, S.K., Garmey, J.C. and Mirmira, R.G., 2005. Pdx-1 links histone H3-Lys-4 methylation to RNA polymerase II elongation during activation of insulin transcription, J Biol Chem. 280, 36244-53. [22] Yang, Z., Zhang, Q., Lu, Q., Jia, Z., Chen, P., Ma, K., Wang, W. and Zhou, C., 2015. ISL-1 promotes pancreatic islet cell proliferation by forming an ISL-1/Set7/9/PDX-1 complex, Cell Cycle. 0. [23] He, X.B., Kim, M., Kim, S.Y., Yi, S.H., Rhee, Y.H., Kim, T., Lee, E.H., Park, C.H., Dixit, S., Harrison, F.E. and Lee, S.H., 2015. Vitamin C facilitates dopamine neuron differentiation in fetal midbrain through TET1- and JMJD3-dependent epigenetic control manner, Stem Cells. 33, 1320-32. [24] Guo, T., Wang, W., Zhang, H., Liu, Y., Chen, P., Ma, K. and Zhou, C., 2011. ISL1 promotes pancreatic islet cell proliferation, PLoS One. 6, e22387. [25] Zhang, Q., Yang, Z., Jia, Z., Liu, C., Guo, C., Lu, H., Chen, P., Ma, K., Wang, W. and Zhou, C., 2014. ISL-1 is overexpressed in non-Hodgkin lymphoma and promotes lymphoma cell proliferation by forming a p-STAT3/p-c-Jun/ISL-1MANUSCRIPT complex, Mol Cancer. 13, 181. [26] Lu, S., Wang, W.P., Wang, X.F., Zheng, Z.M., Chen, P., Ma, K.T. and Zhou, C.Y., 2005. Heterogeneity in predisposition of hepatic cells to be induced into pancreatic endocrine cells by PDX-1, World J Gastroenterol. 11, 2277-82. [27] Fujimaki, K., Ogihara, T., Morris, D.L., Oda, H., Iida, H., Fujitani, Y., Mirmira, R.G., Evans-Molina, C. and Watada, H., 2015. SET7/9 Enzyme Regulates Cytokine-induced Expression of Inducible Nitric-oxide Synthase through Methylation of Lysine 4 at Histone 3 in the Islet beta Cell, J Biol Chem. 290, 16607-18. [28] Ogihara, T., Vanderford, N.L., Maier, B., Stein, R.W. and Mirmira, R.G., 2009. Expression and function of Set7/9 in pancreatic islets, Islets. 1, 269-72. [29] Ene, C.I., Edwards, L., Riddick, G., Baysan, M., Woolard, K., Kotliarova, S., Lai, C., Belova, G., Cam, M., Walling, J., Zhou, M., Stevenson, H., Kim, H.S., Killian, K., Veenstra, T., Bailey, R., Song, H., Zhang, W. and Fine, H.A., 2012. Histone demethylase Jumonji D3 (JMJD3) as a tumorACCEPTED suppressor by regulating p53 protein nuclear stabilization, PLoS One. 7, e51407. [30] Iida, A., Iwagawa, T., Kuribayashi, H., Satoh, S., Mochizuki, Y., Baba, Y., Nakauchi, H., Furukawa, T., Koseki, H., Murakami, A. and Watanabe, S., 2014. Histone demethylase Jmjd3 is required for the development of subsets of retinal bipolar cells, Proc Natl Acad Sci U S A. 111, 3751-6. [31] Park, D.H., Hong, S.J., Salinas, R.D., Liu, S.J., Sun, S.W., Sgualdino, J., Testa, G., Matzuk, M.M., Iwamori, N. and Lim, D.A., 2014. Activation of neuronal gene expression by the JMJD3 demethylase is required for postnatal and adult brain neurogenesis, Cell Rep. 8, 1290-9.

ACCEPTED MANUSCRIPT

[32] Yan, Q., Sun, L., Zhu, Z., Wang, L., Li, S. and Ye, R.D., 2014. Jmjd3-mediated epigenetic regulation of inflammatory cytokine gene expression in serum amyloid A-stimulated macrophages, Cell Signal. 26, 1783-91. [33] Poitout, V., Hagman, D., Stein, R., Artner, I., Robertson, R.P. and Harmon, J.S., 2006. Regulation of the insulin gene by glucose and fatty acids, J Nutr. 136, 873-6. [34] Pino, M.F., Ye, D.Z., Linning, K.D., Green, C.D., Wicksteed, B., Poitout, V. and Olson, L.K., 2005. Elevated glucose attenuates human insulin gene promoter activity in INS-1 pancreatic beta-cells via reduced nuclear factor binding to the A5/core and Z element, Mol Endocrinol. 19, 1343-60. [35] Iguchi, H., Ikeda, Y., Okamura, M., Tanaka, T., Urashima, Y., Ohguchi, H., Takayasu, S., Kojima, N., Iwasaki, S., Ohashi, R., Jiang, S., Hasegawa, G., Ioka, R.X., Magoori, K., Sumi, K., Maejima, T., Uchida, A., Naito, M., Osborne, T.F., Yanagisawa, M., Yamamoto, T.T., Kodama, T. and Sakai, J., 2005. SOX6 attenuates glucose-stimulated insulin secretion by repressing PDX1 transcriptional activity and is down-regulated in hyperinsulinemic obese mice, J Biol Chem. 280, 37669-80. [36] Kojima, H., Nakamura, T., Fujita, Y., Kishi, A., Fujimiya, M., Yamada, S., Kudo, M., Nishio, Y., Maegawa, H., Haneda, M., Yasuda, H., Kojima, I., Seno, M., Wong, N.C., Kikkawa, R. and Kashiwagi, A., 2002. Combined expression of pancreatic duodenal homeobox 1 and islet factor 1 induces immature enterocytes to produce insulin, Diabetes. 51, 1398-408. [37] Leibowitz, G., Yuli, M., Donath, M.Y., Nesher, R., Melloul, D., Cerasi, E., Gross, D.J. and Kaiser, N., 2001. beta-cell glucotoxicity in the Psammomys obesus model of type 2 diabetes, Diabetes. 50 Suppl 1, S113-7. [38] MacFarlane, W.M., Chapman, J.C., Shepherd, R.M., Hashmi, M.N., Kamimura, N., Cosgrove, K.E., O'Brien, R.E., Barnes, P.D., Hart, A.W.,MANUSCRIPT Docherty, H.M., Lindley, K.J., Aynsley-Green, A., James, R.F., Docherty, K. and Dunne, M.J., 1999. Engineering a glucose-responsive human insulin-secreting cell line from islets of Langerhans isolated from a patient with persistent hyperinsulinemic hypoglycemia of infancy, J Biol Chem. 274, 34059-66. [39] Kojima, H., Fujimiya, M., Matsumura, K., Nakahara, T., Hara, M. and Chan, L., 2004. Extrapancreatic insulin-producing cells in multiple organs in diabetes, Proc Natl Acad Sci U S A. 101, 2458-63. [40] Nakamura, T., Kishi, A., Nishio, Y., Maegawa, H., Egawa, K., Wong, N.C., Kojima, H., Fujimiya, M., Arai, R., Kashiwagi, A. and Kikkawa, R., 2001. Insulin production in a neuroectodermal tumor that expresses islet factor-1, but not pancreatic-duodenal homeobox 1, J Clin Endocrinol Metab. 86, 1795-800. [41] Welker, S., Gotz, C., Servas, C., Laschke, M.W., Menger, M.D. and Montenarh, M., 2013. Glucose regulates protein kinase CK2 in pancreatic beta-cells and its interaction with PDX-1, Int J BiochemACCEPTED Cell Biol. 45, 2786-95. [42] Meng, R., Al-Quobaili, F., Muller, I., Gotz, C., Thiel, G. and Montenarh, M., 2010. CK2 phosphorylation of Pdx-1 regulates its transcription factor activity, Cell Mol Life Sci. 67, 2481-9. [43] Aguayo-Mazzucato, C., Koh, A., El Khattabi, I., Li, W.C., Toschi, E., Jermendy, A., Juhl, K., Mao, K., Weir, G.C., Sharma, A. and Bonner-Weir, S., 2011. Mafa expression enhances glucose-responsive insulin secretion in neonatal rat beta cells, Diabetologia. 54, 583-93. [44] Nishimura, W., Takahashi, S. and Yasuda, K., 2015. MafA is critical for maintenance of the mature beta cell phenotype in mice, Diabetologia. 58, 566-74.

ACCEPTED MANUSCRIPT

[45] Zhang, C., Moriguchi, T., Kajihara, M., Esaki, R., Harada, A., Shimohata, H., Oishi, H., Hamada, M., Morito, N., Hasegawa, K., Kudo, T., Engel, J.D., Yamamoto, M. and Takahashi, S., 2005. MafA is a key regulator of glucose-stimulated insulin secretion, Mol Cell Biol. 25, 4969-76.

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

Supplements data

Fig. S1. PDX1 and ISL1 activation effects on the insulin promoter differed according to the glucose concentrations in culture. Transcriptional activation efficiency of PDX1 and ISL1 on RIP1 detected by luciferase reporter assay in plasmid-transfected HIT-T15 (HIT) cells cultured in RPMI 1640 MANUSCRIPTmedium with 5 or 25 mmol/L glucose. Data represent three independent experiments, each performed in triplicate. Bars represent the mean ± SD. * p < 0.05, ** p < 0.01.

ACCEPTED

ACCEPTED MANUSCRIPT

Fig. S2. The expression of PDX1, ISL1, and BETA2 at the total protein levels (A) and nuclear protein levels (B). The protein levels were analyzed by Western blot. The total protein and nuclear extracts were preparedMANUSCRIPT from the cells transfected with pcDNA3-PDX1, pcDNA3-ISL1 and pCMV-BETA2 for 48 h in 5 mmol/L or 25 mmol/L glucose medium. Left, Representative figures of 3 independent experiments. Right, Statistical analysis of the data from 3 experiments. β-actin and Lamin B1 served as the loading control of total protein or nuclear proteins, respectively.

ACCEPTED

ACCEPTED MANUSCRIPT

Tables Table 1. Real-time RT-PCR primer sequences. Genes Primer Sequences (5’- 3’) Insulin F, AGGACCCACAAGTGGAACAACT R, CAACGCCAAGGTCTGAAGGT Pdx1 F, CGCGTCCAGCTCCCTTT R, TGCCCACTGGCCTTTCC Isl1 F, CTGCTTTTCAGCAACTGGTCA R, TAGGACTGGCTACCATGCTGT Beta2 F, ATGACCAAATCATACAGCGAGAG R, CATCGTGAAAGATGGCATTGAG 18S rRNA F, GTAACCCGTTGAACCCCATT R, CCATCCAATCGGTAGTAGCG

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

Table 2. RNAi duplex sequences. Genes RNAi duplex Sequences (5’- 3’) Pdx1 sense, GAAAGAGGAAGAUAAGAAAtt antisense, UUUCUUAUCUUCCUCUUUCtt Isl1 sense, GAGACAUGGUGGUUUAtt antisense, UUUCUCCUUGCACCUCtt Non-silencer siRNA sense, UUCUCCGAACGUGUCACGUtt antisense, ACGUGACACGUUCGGAGAAtt

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

Highlights • We propose a novel insulin gene regulation pattern responding to glucose signaling. • ISL1–BETA2 complex maintains basic insulin gene expression under normal glucose. • PDX1–BETA2 complex enhances insulin gene expression in high-glucose conditions. • SET9 and JMJD3 aid INS gene histone modification in different glucose conditions.

MANUSCRIPT

ACCEPTED