DOCSLIB.ORG

Enhancement in Motor Learning Through Genetic Manipulation of the Lynx1 Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Enhancement in Motor Learning Through Genetic Manipulation of the Lynx1 Gene Enhancement in Motor Learning through Genetic Manipulation of the Lynx1 Gene Julie M. Miwa1*, Andreas Walz2 1 California Institute of Technology, Pasadena, California, United States of America, 2 Ophidion, Inc., Pasadena, California, United States of America Abstract The cholinergic system is a neuromodulatory neurotransmitter system involved in a variety of brain processes, including learning and memory, attention, and motor processes, among others. The influence of nicotinic acetylcholine receptors of the cholinergic system are moderated by lynx proteins, which are GPI-anchored membrane proteins forming tight associations with nicotinic receptors. Previous studies indicate lynx1 inhibits nicotinic receptor function and limits neuronal plasticity. We sought to investigate the mechanism of action of lynx1 on nicotinic receptor function, through the generation of lynx mouse models, expressing a soluble version of lynx and comparing results to the full length overexpression. Using rotarod as a test for motor learning, we found that expressing a secreted variant of lynx leads to motor learning enhancements whereas overexpression of full-length lynx had no effect. Further, adult lynx1KO mice demonstrated comparable motor learning enhancements as the soluble transgenic lines, whereas previously, aged lynx1KO mice showed performance augmentation only with nicotine treatment. From this we conclude the motor learning is more sensitive to loss of lynx function, and that the GPI anchor plays a role in the normal function of the lynx protein. In addition, our data suggests that the lynx gene plays a modulatory role in the brain during aging, and that a soluble version of lynx has potential as a tool for adjusting cholinergic-dependent plasticity and learning mechanisms in the brain. Citation: Miwa JM, Walz A (2012) Enhancement in Motor Learning through Genetic Manipulation of the Lynx1 Gene. PLoS ONE 7(11): e43302. doi:10.1371/ journal.pone.0043302 Editor: Jeff A. Beeler, University of Chicago, United States of america Received April 5, 2012; Accepted July 18, 2012; Published November 5, 2012 Copyright: ß 2012 Miwa, Walz. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was supported by the Tobacco-Related Disease Research Program grant TRDRP 19KT-0032 (http://www.trdrp.org/), and Croll Research Foundation on Autism to JMM, and National Institutes of Health, The National Institute of Mental Health grant R43MH083416-02 to AW (http://www.nimh.nih. gov/index.shtml). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: JMM in owns stock Ophidion, Inc. and is an unpaid consultant to the company. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials. * E-mail: [email protected] Introduction receptor hypersensitivity can lead to enhancements in synaptic plasticity [17] and improved fear conditioning [16]. While aged The cholinergic system is a critical modulatory system lynx1KO mice were not affected in rotarod performance, there governing complex processes in the brain. Nicotinic receptors of was a significant increase in lynx1KO mice in motor learning the cholinergic system bind to the endogenous neurotransmitter when treated with nicotine. These data support the hypothesis that acetylcholine, as well as the exogenous drug, nicotine. Activation lynx1KO mice are more sensitive to the effects of nicotine than of such receptors can augment neurotransmitter release, synaptic wild-type mice and that this enhanced cholinergic tone resulted in transmission and enhance synaptic plasticity [1]. Nicotinic improved learning on the rotarod task. Although lynx1 is widely receptor activation can also influence some forms of learning expressed throughout the brain, it shows particularly high levels in and memory, including fear conditioning [2,3], avoidance learning select cells within the cerebellum. Therefore, we sought to [4], water maze [5,6], and motor learning [7,8]. Several investigate further the mechanism of action of lynx1 on nicotinic mechanisms exist to control the activity of the cholinergic system receptor function, extending some of the initial observations of [9,10,11,12,13]. Regulating the activity levels of the cholinergic enhanced motor learning into the cerebellum by manipulating the system, or achieving optimal cholinergic tone in the brain, can be levels of the lynx1 gene. an effective means of controlling the extent of plasticity The rotarod task measures motor coordination and can also mechanisms. measure motor learning [18]. The cerebellum is highly implicated One mechanism of cholinergic regulation previously reported is in the functioning of this task, and it is a well documented site of achieved through the modulator, lynx1 [14]. Our studies indicate action for other learning paradigms [19] such as conditioned eye- that lynx1 can form stable complexes with nicotinic receptors, blink [20,21,22]. The main function of the cerebellar circuit is to resulting in lower agonist affinity, faster desensitization and slower refine sensory and motor information – integrating these inputs to recovery from desensitization of a4b2 nicotinic receptors, acting as fine tune motor activity to aid in motor coordination [23]. The a molecular brake on nicotinic receptor function [15]. Removal of Purkinje cell is the main output neuron in the cerebellar cortex this brake, such as in lynx1 null mutant (lynx1KO) can exhibit and sends inhibitory signals to the deep nuclear neurons of the features of enhanced cholinergic tone – greater agonist sensitivity cerebellum. The cerebellar Purkinje cell is a highly integrative cell, and intracellular calcium levels and reduced desensitization in which segregates its many afferent inputs into discrete subdomains. response to nicotine in the brain [9,16]. The resulting nicotinic Its main excitatory inputs are received by parallel fibers synapsing PLOS ONE | www.plosone.org 1 November 2012 | Volume 7 | Issue 11 | e43302 Learning Enhancements and Lynx1 Figure 1. Summary of three transgenic lynx1 constructs: L7 lynx1, L7 secreted lynx1, and lynx1 BAC. (A) L7-lynx1 construct, upper, utilizing a pcp (L7) promoter sequence in front of a full length lynx1 cDNA contained the full length lynx1 coding sequence. Lower, L7-sec-lynx1, pcp (L7) promoter driving expression of a secreted variant of lynx1, lacking the final asparagine residue that makes up the mature form of lynx1, and lacking the GPI-anchor hydrophobic consensus sequence. An in-frame HA sequence replaces the GPI anchor sequence. (B) Representative structural model of lynx1 (right hand molecule) with associated GPI-linked tether (red circles) to the plasma membrane (grey). Model is based on the NMR structure of lynx1 [56]. Left hand molecule, the secreted variant of lynx1 can translocate freely across the plasma membrane and diffuse into the extracellular and/or synaptic space. (C) BAC modification strategy for the generation of a lynx1 modified BAC transgenic mouse line. doi:10.1371/journal.pone.0043302.g001 onto distal dendrites of Purkinje cells, and climbing fibers climbing fiber excitatory input, and stellate/basket neuron synapsing onto the somatodendritic region near to Purkinje cell inhibitory input. bodies. The majority of inhibitory inputs onto Purkinje cells arise Lynx genes and family members consist of both secreted from stellate and basket cells in the molecular layer [19], synapsing [37,38,39,40,41,42], and membrane-bound variants onto Purkinje proximal dendrites and cell bodies, respectively. [9,43,44,45,46,47,48,49,50]. The majority of the mammalian Synaptic alterations during the pairing of presynaptic stimuli can family members are membrane-bound peripheral membrane be induced by removing inhibition, indicating that alterations in proteins, anchored to the membrane through sugar-lipid interac- excitatory/inhibitory balance could influence synaptic plasticity in tions via a glycosylphospholipid (GPI)–linked anchor. Previously this circuit. Therefore, the cerebellar cortex is a useful region to we reported that purified lynx1 protein has modulatory capability probe the effect of cholinergic modulation of neuronal circuits. over nicotinic receptors in vitro [14], distinct from effects of co- The cholinergic system has been reported to mediate release of expression of the full-length membrane anchored form of the neurotransmitter in the cerebellum [24,25,26,27,28], and there- protein [15]. To further probe the biophysical mechanism of fore influence cerebellar activity [29,30] in normal [31] and action of the membrane anchor for lynx function, we employed abnormal [32] brain function. Both muscarinic and nicotinic genetic engineering strategies to express membrane bound and receptors have been localized in the cerebellar cortex [33]. In the secreted lynx isoforms in the brains of mice utilizing three rat cerebellum, a4 nicotinic receptor subunit immunoreactivity genetically modified mouse lines. has been identified in the cell bodies in the molecular, granule and Purkinje cell layers and in pre-synaptic terminals to Purkinje cells Results [34]. a7 nicotinic receptor subunit immunoreactivity can be found in rat Purkinje cell and granule cell dendrites, but not in granule A secreted version of the lynx1
Load more

Recommended publications
  • Genome-Wide Association of Genetic Variation in the PSCA Gene with Gastric Cancer Susceptibility in a Korean Population
    pISSN 1598-2998, eISSN 2005-9256 Cancer Res Treat. 2019;51(2):748-757 https://doi.org/10.4143/crt.2018.162 Original Article Open Access Genome-Wide Association of Genetic Variation in the PSCA Gene with Gastric Cancer Susceptibility in a Korean Population Boyoung Park, MD, PhD1,2 Purpose Sarah Yang, PhD3,4 Half of the world’s gastric cancer cases and the highest gastric cancer mortality rates are observed in Eastern Asia. Although several genome-wide association studies (GWASs) have Jeonghee Lee, MS3 revealed susceptibility genes associated with gastric cancer, no GWASs have been con- PhD3 Hae Dong Woo, ducted in the Korean population, which has the highest incidence of gastric cancer. Il Ju Choi, MD, PhD5 Young Woo Kim, MD, PhD5 Materials and Methods Keun Won Ryu, MD, PhD5 We performed genome scanning of 450 gastric cancer cases and 1,134 controls via Affymetrix Axiom Exome 319 arrays, followed by replication of 803 gastric cancer cases and Young-Il Kim, MD, PhD5 3,693 healthy controls. Jeongseon Kim, PhD2,3 Results We showed that the rs2976394 in the prostate stem cell antigen (PSCA) gene is a gastric- 1Department of Medicine, Hanyang cancer-susceptibility gene in a Korean population, with genome-wide significance and an University College of Medicine, Seoul, odds ratio (OR) of 0.70 (95% confidence interval [CI], 0.64 to 0.77). A strong linkage dise- 2 Graduate School of Cancer Science and quilibrium with rs2294008 was also found, indicating an association with susceptibility. Policy, National Cancer Center, Goyang, 3Molecular Epidemiology Branch, Division of Individuals with the CC genotype of the PSCA gene showed an approximately 2-fold lower Cancer Epidemiology and Prevention, risk of gastric cancer compared to those with the TT genotype (OR, 0.47; 95% CI, 0.39 to Research Institute, National Cancer Center, 0.57).
    [Show full text]
  • Prostate Stem Cell Antigen Is Expressed in Normal and Malignant Human Brain Tissues
    ONCOLOGY LETTERS 15: 3081-3084, 2018 Prostate stem cell antigen is expressed in normal and malignant human brain tissues HIROE ONO, HIROMI SAKAMOTO, TERUHIKO YOSHIDA and NORIHISA SAEKI Division of Genetics, National Cancer Center Research Institute, Tokyo 104-0045, Japan Received June 25, 2015; Accepted October 24, 2016 DOI: 10.3892/ol.2017.7632 Abstract. Prostate stem cell antigen (PSCA) is a glyco- functions in subcellular signal transduction (2). Originally, sylphosphatidylinositol (GPI)-anchored cell surface protein PSCA was identified as a gene upregulated in prostate cancer (3), and exhibits an organ-dependent expression pattern in cancer. and later its upregulation was demonstrated in other types of PSCA is upregulated in prostate cancer and downregulated in tumor, including urinary bladder cancer, renal cell carcinoma, gastric cancer. PSCA is expressed in a variety of human organs. hydatidiform mole and ovarian mucinous tumor, where PSCA is Although certain studies previously demonstrated its expres- thought to be involved in tumor progression (1). However, down- sion in the mammalian and avian brain, its expression in the regulation of the gene was reported in gastric and gallbladder human brain has not been thoroughly elucidated. Additionally, cancer, where it may act as a tumor suppressor (4,5). As another it was previously reported that PSCA is weakly expressed in the pattern of its expression in cancer, PSCA is not expressed in the astrocytes of the normal human brain but aberrantly expressed ductal cells of the normal pancreas or the epithelial cells in the in glioma, suggesting that PSCA is a promising target of normal lung, however, it is expressed in their malignant coun- glioma therapy and prostate cancer therapy.
    [Show full text]
  • Organization, Evolution and Functions of the Human and Mouse Ly6/Upar Family Genes Chelsea L
    Loughner et al. Human Genomics (2016) 10:10 DOI 10.1186/s40246-016-0074-2 GENE FAMILY UPDATE Open Access Organization, evolution and functions of the human and mouse Ly6/uPAR family genes Chelsea L. Loughner1, Elspeth A. Bruford2, Monica S. McAndrews3, Emili E. Delp1, Sudha Swamynathan1 and Shivalingappa K. Swamynathan1,4,5,6,7* Abstract Members of the lymphocyte antigen-6 (Ly6)/urokinase-type plasminogen activator receptor (uPAR) superfamily of proteins are cysteine-rich proteins characterized by a distinct disulfide bridge pattern that creates the three-finger Ly6/uPAR (LU) domain. Although the Ly6/uPAR family proteins share a common structure, their expression patterns and functions vary. To date, 35 human and 61 mouse Ly6/uPAR family members have been identified. Based on their subcellular localization, these proteins are further classified as GPI-anchored on the cell membrane, or secreted. The genes encoding Ly6/uPAR family proteins are conserved across different species and are clustered in syntenic regions on human chromosomes 8, 19, 6 and 11, and mouse Chromosomes 15, 7, 17, and 9, respectively. Here, we review the human and mouse Ly6/uPAR family gene and protein structure and genomic organization, expression, functions, and evolution, and introduce new names for novel family members. Keywords: Ly6/uPAR family, LU domain, Three-finger domain, uPAR, Lymphocytes, Neutrophils Introduction an overview of the Ly6/uPAR gene family and their gen- The lymphocyte antigen-6 (Ly6)/urokinase-type plas- omic organization, evolution, as well as functions, and minogen activator receptor (uPAR) superfamily of struc- provide a nomenclature system for the newly identified turally related proteins is characterized by the LU members of this family.
    [Show full text]
  • Activation of Somatostatin Inhibitory Neurons by Lypd6-Nachrα2 System Restores Juvenile
    bioRxiv preprint doi: https://doi.org/10.1101/155465; this version posted August 28, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Activation of Somatostatin Inhibitory Neurons by Lypd6-nAChRα2 System Restores Juvenile- like Plasticity in Adult Visual Cortex Masato Sadahiro1-5†, Michael P. Demars1-5†, Poromendro Burman1-5, Priscilla Yevoo1-5, Milo R. Smith1-5, Andreas Zimmer6, Hirofumi Morishita1-5* 1 Department of Psychiatry, 2 Department of Neuroscience, 3 Department of Ophthalmology, 4 Mindich Child Health and Development Institute,5 Friedman Brain Institute, Icahn School of Medicine at Mount Sinai, 1 Gustave L. Levy Pl, New York, NY 10029, USA 6 Institute of Molecular Psychiatry, Medical Faculty, University of Bonn, Bonn 53127, Germany *Contact to: [email protected] † M.S. and M.P.D. share co-first authorship bioRxiv preprint doi: https://doi.org/10.1101/155465; this version posted August 28, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Heightened juvenile cortical plasticity declines into adulthood, posing a challenge for functional recovery following brain injury or disease. A network of inhibition is critical for regulating plasticity in adulthood, yet contributions of interneuron types other than parvalbumin (PV) interneurons have been underexplored. Here we show Lypd6, an endogenous positive modulator of nicotinic acetylcholine receptors (nAChRs), as a specific molecular target in somatostatin (SST) interneurons for reactivating cortical plasticity in adulthood. Selective overexpression of Lypd6 in adult SST interneurons reactivates plasticity through the α2 subtype of nAChR by rapidly activating SST interneurons and in turn inhibiting sub-population of PV interneurons, a key early trigger of the juvenile form of plasticity.
    [Show full text]
  • Biochemical Pharmacology 97 (2015) 418–424
    Biochemical Pharmacology 97 (2015) 418–424 Contents lists available at ScienceDirect Biochemical Pharmacology journa l homepage: www.elsevier.com/locate/biochempharm Review Long-lasting changes in neural networks to compensate for altered nicotinic input a,b a,b, Danielle John , Darwin K. Berg * a Neurobiology Section, Division of Biological Sciences, University of California San Diego, La Jolla, CA 92093-0357, United States b Kavli Institute for Brain and Mind, University of California, San Diego, La Jolla, CA 92093-0357, United States A R T I C L E I N F O A B S T R A C T Article history: The nervous system must balance excitatory and inhibitory input to constrain network activity levels Received 30 May 2015 within a proper dynamic range. This is a demanding requirement during development, when networks Accepted 7 July 2015 form and throughout adulthood as networks respond to constantly changing environments. Defects in Available online 20 July 2015 the ability to sustain a proper balance of excitatory and inhibitory activity are characteristic of numerous neurological disorders such as schizophrenia, Alzheimer’s disease, and autism. A variety of homeostatic Keywords: mechanisms appear to be critical for balancing excitatory and inhibitory activity in a network. These are Nicotinic operative at the level of individual neurons, regulating their excitability by adjusting the numbers and Homeostasis types of ion channels, and at the level of synaptic connections, determining the relative numbers of Compensation excitatory versus inhibitory connections a neuron receives. Nicotinic cholinergic signaling is well Neural network E/I ratio positioned to contribute at both levels because it appears early in development, extends across much of Circuits the nervous system, and modulates transmission at many kinds of synapses.
    [Show full text]
  • Nicotinic Signaling: Alpha3 Beta4 Heteromers, Alpha5 Subunits, and the Rp Ototoxin Lypd6b Vanessa Ochoa University of Vermont
    University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2015 Nicotinic Signaling: Alpha3 Beta4 Heteromers, Alpha5 Subunits, And The rP ototoxin Lypd6b Vanessa Ochoa University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Neuroscience and Neurobiology Commons Recommended Citation Ochoa, Vanessa, "Nicotinic Signaling: Alpha3 Beta4 Heteromers, Alpha5 Subunits, And The rP ototoxin Lypd6b" (2015). Graduate College Dissertations and Theses. 472. https://scholarworks.uvm.edu/graddis/472 This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. NICOTINIC SIGNALING: ALPHA3 BETA4 HETEROMERS, ALPHA5 SUBUNITS, AND THE PROTOTOXIN LYPD6B A Dissertation Presented by Vanessa Ochoa to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Specializing in Neuroscience October, 2015 Defense Date: July 15, 2015 Dissertation Examination Committee: Rae Nishi, Ph.D., Advisor Nicholas H. Heintz, Ph.D., Chairperson Victor May, Ph.D. Rodney Parsons, Ph.D. Anthony Morielli, Ph.D. Cynthia J. Forehand, Ph.D., Dean of the Graduate College ABSTRACT Prototoxin proteins have been identified as members of the Ly6/uPAR super family whose three-finger motif resembles that of α-bungarotoxin. Though they are known to modify the function of nAChRs, their specificity is still unclear. Our lab identified three prototoxin proteins in the chicken ciliary ganglion: Ch3ly, Ch5ly, and Ch6ly.
    [Show full text]
  • Lynx1 Regulates Nachrs to Preserve the Structure and Function of Neuromuscular Synapses During Aging
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.29.123851; this version posted October 8, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title Lynx1 regulates nAChRs to preserve the structure and function of neuromuscular synapses during aging Short Title Lynx1 role in NMJ maintenance One Sentence Summary Lynx1 promotes homeostatic plasticity at NMJs by regulating the function and stability of muscle-specific nAChRs. details for Authors DOI Sydney V. Doss1,2, Sébastien Barbat-Artigas4, Tracey Myers3, Bhola Shankar Pradhan5, manuscript TomaszWITHDRAWN J. Prószyńskisee5,6, Richard Robitaille4, Gregorio Valdez1* Affiliations 1 Department of Molecular Biology, Cellular Biology, and Biochemistry, Brown University, Providence, Rhode Island, USA. 2 Graduate Program in Translational Biology, Medicine, and Health, Virginia Tech, Blacksburg, Virginia, USA. 3 Fralin Biomedical Research Institute, Roanoke, Virginia, USA. 4 Département de neurosciences, Université de Montréal, Montréal, QC, Canada. 5 Laboratory of Synaptogenesis, Nencki Institute of Experimental Biology, Polish Academy of Sciences, Warsaw, Poland. 6 Laboratory of Synaptogenesis, Łukasiewicz Research Network − PORT Polish Center for Technology Development, Wrocław, Poland bioRxiv preprint doi: https://doi.org/10.1101/2020.05.29.123851; this version posted October 8, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Augmenting the Antinociceptive Effects of Nicotinic Acetylcholine Receptor Activity Through Lynx1 Modulation
    Aalborg Universitet Augmenting the antinociceptive effects of nicotinic acetylcholine receptor activity through lynx1 modulation Nissen, Neel I.; Anderson, Kristin R; Wang, Huaixing; Lee, Hui Sun; Garrison, Carly; Eichelberger, Samantha A; Ackerman, Kasarah; Im, Wonpil; Miwa, Julie M Published in: PLOS ONE DOI (link to publication from Publisher): 10.1371/journal.pone.0199643 Creative Commons License CC BY 4.0 Publication date: 2018 Document Version Publisher's PDF, also known as Version of record Link to publication from Aalborg University Citation for published version (APA): Nissen, N. I., Anderson, K. R., Wang, H., Lee, H. S., Garrison, C., Eichelberger, S. A., Ackerman, K., Im, W., & Miwa, J. M. (2018). Augmenting the antinociceptive effects of nicotinic acetylcholine receptor activity through lynx1 modulation. PLOS ONE, 13(7), [e0199643]. https://doi.org/10.1371/journal.pone.0199643 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. ? Users may download and print one copy of any publication from the public portal for the purpose of private study or research. ? You may not further distribute the material or use it for any profit-making activity or commercial gain ? You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us at [email protected] providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • Common Genetic Variants in the PSCA Gene in Fluence Gene Expression
    Common genetic variants in the PSCA gene influence gene expression and bladder cancer risk Yi-Ping Fua, Indu Kohaara, Nathaniel Rothmanb, Julie Earlc, Jonine D. Figueroab, Yuanqing Yed, Núria Malatse, Wei Tanga, Luyang Liua, Montserrat Garcia-Closasb,f, Brian Muchmorea, Nilanjan Chatterjeeb, McAnthony Tarwaya, Manolis Kogevinasg,h,i,j, Patricia Porter-Gilla, Dalsu Barisb, Adam Mumya, Demetrius Albanesb, Mark P. Purdueb, Amy Hutchinsonk, Alfredo Carratol, Adonina Tardónh,m, Consol Serran, Reina García-Closaso, Josep Lloretap, Alison Johnsonq, Molly Schwennr, Margaret R. Karagass, Alan Schneds, W. Ryan Divert, Susan M. Gapsturt, Michael J. Thunt, Jarmo Virtamou, Stephen J. Chanocka, Joseph F. Fraumeni, Jr.b,1, Debra T. Silvermanb, Xifeng Wud, Francisco X. Realc,n, and Ludmila Prokunina-Olssona,1 aLaboratory of Translational Genomics, Division of Cancer Epidemiology and Genetics, and bDivision of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; cEpithelial Carcinogenesis Group, Molecular Pathology Programme, Centro Nacional de Investigaciones Oncológicas, Madrid 28029, Spain; dDepartment of Epidemiology, University of Texas MD Anderson Cancer Center, Houston, TX 77030; eGenetic and Molecular Epidemiology Group, Spanish National Cancer Research Center, Madrid 28029, Spain; fDivision of Genetics and Epidemiology, Institute of Cancer Research, London SW7 3RP, United Kingdom; gCentre for Research in Environmental Epidemiology, Barcelona 08003, Spain; hMunicipal Institute of Medical
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]
  • Lynx1 and the Β2v287l Mutation Affect the Stoichiometry of the Α4β2 Nicotinic Acetylcholine Receptor
    Lynx1 and the β2V287L Mutation Affect the Stoichiometry of the α4β2 Nicotinic Acetylcholine Receptor Thesis by Weston A. Nichols In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy California Institute of Technology Pasadena, California 2014 (Defended May 1, 2014) ii © 2014 Weston A. Nichols All Rights Reserved iii To my mother, father, and Peden. iv Acknowledgements First and foremost, thank you to Henry Lester, my Ph.D. advisor. Henry accepted me into his lab before it was clear that I would be useful as a graduate student, and provided me with a wonderfully appropriate mix of guidance and freedom. Early on, I wanted to start as many projects as possible, and pitched many that made no sense from a practical perspective, and probably several other perspectives. Henry told me not to do them in a way that forced me to learn the process of scientific diligence, and to take ownership of the projects I did pursue. Henry taught me this process by spending a lot of time with me through many meetings, including Fluorescence Club, α Club, and going for coffee at the Red Door. One of the most salient items that Henry taught me is how to plod through data slowly to come to a deeper understanding of the data and how (or if) it fits into a larger picture. I think this is something that is very hard to teach. Henry did it by spending a lot of time with me. Thank you to my thesis committee, Ray Deshaies, Dennis Dougherty, and David Prober.
    [Show full text]
  • Supplemental Data the Prototoxin Lynx1 Acts on Nicotinic
    Neuron, Volume 51 Supplemental Data The Prototoxin lynx1 Acts on Nicotinic Acetylcholine Receptors to Balance Neuronal Activity and Survival In Vivo Julie M. Miwa, Tanya R. Stevens, Sarah L. King, Barbara J. Caldarone, Ines Ibanez-Tallon, Cheng Xiao, Reiko Maki Fitzsimonds, Constantine Pavlides, Henry A. Lester, Marina R. Picciotto, and Nathaniel Heintz Supplemental Materials and Methods: Targeted mutagenesis: A 9kb HindIII/lynx1fragment was shotgun subcloned from lynx1 BAC26-1 (Miwa et al., 1999) into pBluescriptKS+ vector. Gene specific primers, GCTGCTGACC TCCTATTCAC TCTGGCACTG CCCTCACGTC ACGCGTTCTG CAAACCCTAT GCTACTCCGTCG and GCTGGGACCA GGGCCAAGGT CACCGGGGTA GCAAAGCCAG CAATATTCAT ATGTCCCGGC GGATTTGTCC TACTCAGGAG AGCG were used to PCR amplify from frt-neo-recA plasmid and the resulting PCR product was electroporated into 322EC cells, containing the 9kb lynx1 HindIII pKS+ construct. Modification was carried out using a bacterial recombination method (Yu et al., 2000). The targeting construct was electroporated into 129svj embryonic stem (ES) cells, which were injected into blastocysts and implanted into pseudopregnant females. Chimeras were crossed to C57Bl6/J mice to produce F1(129svj/C57Bl6/J) lynx1 +/- mice. Introduction of the neo gene created an additional Ssp1(S) restriction site which was exploited for use in screening for recombinants. 3' external probe was generated by PCR amplification from genomic DNA using primers CAATATGGATGCCTTCCCTACT and CAAGGAGGTAAGGAGCGTGTC primers. Western analysis utilized purified anti-lynx pAb (1:1000) (Ibanez-Tallon et al., 2002, 2004) to probe 10 µg of total homogenate from lynx1-/- and lynx1+/+ adult forebrain extracts, and detected with goat anti-rabbit HRP conjugated secondary antibodies (Jackson labs).In situ hybridization with coding probe showed no lynx1 message in lynx1- /- brains sections (data not shown).
    [Show full text]